Indian Army - Madhya Pradesh

40753546 bids are invited for haemocult test occult blood test kit of 50 tests , keto diastixbott of 100 strips , urine multi stix 10 sg siemens 100 strips , protein and sugar diastixbott of 100 strips , biochemical test kit hi media , macconkey broth hi media 500 gm , tmppd for oxidase test , abst octa disc ready made gnb and gpc , zn stain kit readymade , bactec alert aerobic biomerieux , bactec alert aerobic paediatric , water culture agar double strength , blood agar base , cled agar , l j media slant , oxidase test disk , nichrome wire loop , tsi media , sabourad dextrose agar sda , gram stain kit readymade , acetone commercial , slide microscope thickness 1 point 15 to 1 point 35 mm size 75mm x 25mm , sterile containers 50ml wide mouth sealed , tissue embedding rings pack of 500 , tissue cassettes plastic , alcohol amyl , alcohol dehydrated ethanol , d p x mounting med , diamond glass writing 240 oblique 240 , formalin 05 ltr can , hydrogen peroxide solution 500 ml , kit for pas ready to use , knife bard parker blade size 2 fitting commercial no 22 packet of 6 , pap stain rapid , paper filter round greens no 795 9 cm pkt of 100 , paraffin liquid 500ml , paraffin wax tissue embedding , parrafin tissue block moulds metal steel , perls iron stain kit , cover slip microscopic rectangular 22 x 50 mm , cover slip microscopic rectangular 22 x 30 mm , myeloperoxidase stain ready to use , xylene xylol pure , cell clean for sysmex xp 100 50 ml , printer roll for sysmex hemat analyzer xp 100 , pt prothrombin time reagent vial of 25 tests , reticulocyte stain kit readymade j k diagnostics , bovine albumin 22 percent , anti h lactin , hbsag elisa kit 96 test , hiv i and ii rapid test kit tridot , micropipettes tips for 200 dash 1000 ul , hbsag rapid kit , rapid card screening for hcv , serum anti d for saline tube test , serum anti human globulin , serum haemaglutinating gp a anti b monoclonal , serum haemaglutinating gp ab anti ab monoclonal , serum haemaglutinating gp b anti a monoclonal , thyroid profile t3 1 kit equal 96 test , thyroid profile t4 1 kit equal 96 test , thyroid profile tsh 1kit 96 test , elisa reader print roll , micropipettes variable volume 0 dash 50 ul , micropipettes variable volume 100 dash 1000 ul , vdrl rapid test , dengue ns1 igg igm test combo , erba norm and erba path internal qc combipack , glucose powder 500gm , kit for estimation of ck mb 2 x 8 ml 2 x 2 ml , kit for estimation of lipase 1 x 20 ml , kits for estimation of total protein 5 x 50 ml , protein csf kit 1 x 50 ml micro protein , tube test 75 mm x 12 mm rimless , d dimmer estimation test kit pack size 1x7 ml 1x4 ml , widal test kit 4 x 5 ml 50 tests per kit , micropipettes tips for 1 dash 200 ul , ehrlich haematoxylin stain merck , tissue paper roll , vaccutainer sterile with gel 5ml gold bd , vaccutainer edta 3ml lavender bd , vaccutainer sodium fluoride 3ml gray bd , vaccutainer heparin tubes 4ml green bd , vaccutainers sodium citrate 2 point 7 ml plastic citrate tube m oblique 3 point 2 percent 13 x 75mm 2 point 7 ml light blue bd , chloroform , ra factor 35 test , micropipettes fixed volume 500 ul , micropipettes fixed volume 1000 ul , micropipettes volume 1 dash 5 ul , micropipettes variable volume 5 dash 50 ul , micropipettes variable volume 10 dash 100 ul , microtome blade high profile packet of 50 blade , milk testing kit , kits for estimation of electrolytes semi automated , kits for estimation of cholestrol kit 05 x 20 ml , kits for estimation of glucose 2 x 200 ml , kit for estimation of bilirubin t oblique d 2x60ml 2x60ml , kits for estimation of creatinine 4x60 ml , true nat mtb 50 test , true nat mtb plus 50 test , true nat mtb rif d x 50 test , true nat hbv clip 50 test , true prep auto mtb sample pre treatment pack 50 test , true prep auto universal sample treatment pack 50 test , true nat hpv hr clip 20 test , true prep auto transport medium for swab specimen pack 20 test , nylon flocculated cervical swabs 20 test , true nat positive control kit panel first 08 test , true nat positive control kit panel second 08 test , true nat positive control kit panel third 08 test total quantity : 23351...

Northern Coalfields Limited - Madhya Pradesh

40682627 bids are invited for semi automatic rotatory microtome (q3) , fully automatic esr analyzer (q3) , trinocular microscope (q3) , coagulation analyzer (q3) total quantity : 6...

Department of Higher Education - Madhya Pradesh

40110994 bids are invited for ph meter with electrode , autoclave 50 ltr , compound microscope , dissectingmicrosope , oven , water and soil testing kit , spectrophotometer 340 900nm , water bath 6 holes , tlc kit , he ne laser complete , fiber optics trainer , study of hall effect complete setup , stop watch digitsl , ionisation potential lithium , active and passive filter , pulse demodulation trainer , frequency demodulation trainer , function genrator , zener regulator , impedance of lcr circuit , series and paralel circuit , cliping and clamping circuit using , study of crystall oscilator , schimtts trigger trainer , power amplifier , diac and triac trainer , transistorized differential app , newtons rings apparatus , vernier caliper , travelling microscope , interia table , photo diode , di electric constant apparatus , thomson method , lees apparatus , hartley colphits , plankss constant app , fet trainer app , thermistor apparatus , transistor comp app , solar cell apparatus , rc coupled amplifier , potentiometer , lcr circuit for curve , amplitude demodulation trainer , chemical balance , ph meter digital electrode , heating mentle 7 ltr , melting point apparatus , do meter , deonizer , gel elctrophoresis , oven universal , vaccum pump , soxhlet extraction , micro centrifuge 10000 rpm , digital balance , magnetic strrirer hot plate , polarimter half shade , kjeldal digestion 6 unit , flamephotometer , rotary microtome , thermotate , bod incubator , cod digestion , distillation app single 3 ltr , distillation app sinlge 5 ltr , water bath 12 holes , colarimeter , heating mentle 500 ml , incubator ss , heating mentle 1 ltr , autoclave portable , vortex shaker , centrifuge 3500 rpm , hot air oven , colonyy counter , binocular microscope , image projection systum , laminar air flow , uv single beam spectrophotometer , refrigerator for zoology , microwave oven for zoology , energy gap , mosfet total quantity : 143...

Department of Higher Education - Madhya Pradesh

40077074 bids are invited for lab development ph meter with electrode , autoclave 50 ltr , compound microscope , image projection system , oven , water and soil testing kit , spectrophotometer 340 900nm , water bath 6 holes , tlc kit , fiber optics trainer , study of hall effect complete setup , stop watch digitsl , ionisation potential lithium , active and passive filter , pulse demodulation trainer , frequency demodulation trainer , function genrator , zener regulator , impedance of lcr circuit , series and paralel circuit , cliping and clamping circuit using , study of crystall oscilator , schimtts trigger trainer , power amplifier , diac and triac trainer , transistorized differential app , newtons rings apparatus , stop clock , travelling microscope , photo diode , di electric constant apparatus , thomson method , hartley colphits , plankss constant app , fet trainer app , thermistor apparatus , transistororised diffrential amplifier , appratus to study specific registnce in energy gap of semiconductor , solar cell apparatus , thermositor characetristics appratues , transistor characteristics built in power supply and metres , rc coupled amplifier , lcr circuit for curve , amplitude demodulation trainer , ph meter digital electrode , heating mentle 7 ltr , melting point apparatus , do meter , deonizer , gel elctrophoresis , oven universal , vaccum pump , soxhlet extraction , potentiometer , micro centrifuge 10000 rpm , digital balance , spectrometer 340 900 , rotary microtome , thermotate , bod incubator , cod digestion , distillation app single 3 ltr , distillation app sinlge 5 ltr , water bath 12 holes , colarimeter , heating mentle 500 ml , incubator ss , heating mentle 1 ltr , autoclave portable , vortex shaker , centrifuge 3500 rpm , ph meter , hot air oven stainless steel , autoclve vertical 50 ltr , colonyy counter , binocular microscope , image projection systum , laminar air flow , uv single beam spectrophotometer , refrigerator for zoology , microwave oven for zoology total quantity : 102...

Medical Education Department - Madhya Pradesh

39904419 bids are invited for robertson cooked meat medium , coverslip , sodium hydroxide pellets , sodium nitrate , sodium hypo chlorate , sodium hypobromite , sodium bromide , sodium nitoprusside , sodium tungstate , sodium chloride , sodium potassium tartrate , sodium carbonate , sodium sulphate , sodium nitrite , potassium oxalate , potassium iodide , potassium chloride , potassium sulphate , potassium hydroxide pellets , potassium bi sulphate , ethyl alcohol , methyl alcohol , glutraldehyde , formaldehyde , phosphomolybdic acid , concentrated sulphuric acid , concentrated hydrochloric acid , concentrated nitric acid , phenyl hydrazine , dextrin , d glucose , d fructose , alpha nepthol , starch , lodine solution , copper sulphate , egg albumin , bovine serum albumin , caesin , gelatin , ninhydrin , pepsin , peptone , chloroform , cholesterol , bromine water , lead acetate , acetic acid , picric acid , ammonium molybdate , ammonium sulphate , mercuric sulphate , bromo cresol green , creatinine , lactose , sucrose , maltose , urease enzyme , phenopthalin , uric acid , phospho tungestic acid , silver nitrate , ferric chloride , toppers indicator , sulphur powder , barium chloride , bilirubim , benzideine solution , ammonium hydroxide , diazotised sulphanilic acid , hydrogen per oxide , o toluidine , diacetyl monoxine , thiosemicarbazide , acetone , ordinary filter paper , red litmas paper , blue litmas paper , benedicts soluton , barfoeds reagent , selvinoffs reagent , blood culture bottle 25 ml , mannitol salt agar , paraffin wax grannular , sodium hypochlorite solution p , calcium , sodium and patassium erma , sgpt pathozym , hba1c , total bilirubin erba , troponin l , hdl erba , small micro tips , large tips 1ml , urea erba , t3 , t4 , tsh , total protein , test tube brush small , urea , total bilirubin , alp , sgot ast , sgpt alt , total cholesterol , triglyceride , hdl cholesterol , albumin , amylase , lipase , ldh , troponin l , serum calcium , uric acid , fsh , prolactin , lh , ck mb l , glucose , glass tube , hiv tridot kit , hcv tridot kit , vdrl tridot kit , hiv elisa kit , hcv elisa kit , vdrl elisa kit , torch kit , eosin , microtome blade , scalpell blade , dispo plastic dropper total quantity : 15836...

Department of Higher Education - Madhya Pradesh

39843432 bids are invited for lab dev bh curve feromagnetic materail , power amplfier , potntiometer , viscocity of fluid using poisons met , capicator and impedance apparatus , charging and discharging capicator , analog to digital convertor , mercury lamp , he ne laser , carey foster app , mosfet characterstics , lee s app , ldr charactorstics , ketterate pendulum kit , jaegors app , ionisation potentioal of complete setup , interia table , impedance of power factor , horizontal torsion app , hartley and colphitsapp , half and full wave , galvanometer , physical balance , photo transistor , function generator , anemometer , bod incubator , flamephotometer , normal chromotography chamber , micropipete 1 5 ml , magnetic strrirer , diigtal balance , slide reader , rotary microtome , soxhlet extraction systum , digital colony counter , gel electrophoresis , autoclave 50 ltr , tissue culture rack , image projection systum , digital thermometer , digital tds meter , water bath 12 holes , incubator stainless steel , heating mentle 1 ltr , uv transluinator , autoclave portable , tlc kit , autoclave vertical 50 ltr , dissecting microscope , oven , digital ph meter , spectrophtometer 340 900 n m , electrophoresis , compound microscope total quantity : 116...

Directorate Of Medical Education - Madhya Pradesh

39769516 supply of e injection, iv fluid, tablet, capsul, srup, solution, eye drop, ointment, cream, powder, gel, spray, inhaler , injection, iv fluid, capsul, syrup, solution, eye drop, ointment, cream, powder, gel, spray, inhaler , aceborophylline 100 mg , amoxicillin 250 mg cap , amoxycilline – 500 mg , amoxycilline + clavulanic acid 375 mg cap. , amoxycilline + clavulanic acid 625 mg cap. , ampicillin 250mg+ cloxacillin250mg , ampicilline – 500 mg , aprepitant 125 mg+aprepitant 80 mg capsule kit , calcitriol 0.25mcg soft geletine capsule , chloramphenicol 250 mg capsule , chloramphenicol 500 mg capsule , cholecalciferol ( vitamin d3 ) capsules 60000 iu , clindamycin 300mg capsule / tab ( 10x10 ) , tablet capsule , clindamycin 600mg capsule / tab ( 10x10 ) , tablet capsule , crizotinib capsules 250mg , cyclosporine 100 mg , cyclosporine 50 mg , deferiprone 500 mg cap. , doxycycline 100 mg , fluoxetine 40 mg , fluoxetine bp 20 mg , hydroxy urea 500 mg cap. , imatinib mesylate 100 mg , itraconazole 100 mg , ivabradin 5mg , lenalidomide ( 10mg ) , capsule , lenalidomide ( 25mg ) , capsule , methylcobalamin 1500 mcg+alpha lipoic acid 100 mg+folic acid 1.5 mcg thiamine mononitrate 10 mg ( pyridoxine hcl 3 mg ) cap. , omeprazole 20 mg , orlistat capsule usp 120 mg , orlistat capsule usp 60 mg , oseltamivir ( 45mg ) , capsule , oseltamivir ( 75mg ) , capsule , palbociclib 100 mg cap , palbociclib 125 mg cap , palbociclib 75 mg cap , pancreatic enzymes 20000 iu capsule , pancreatic enzymes 25000 iu capsule , pancreatic enzymes 8000 iu capsule , pregabalin 75 mg + methylcobalamin 750 mcg , rabeprazole 20mg , tablet or capsule , racecadotril capsules ip 100mg , rifaximine 400 mg , sildenafil 20mg , sunitinib malate capsules 50 mg , temozolamide 100 mg , temozolamide 250 mg , tetracycline 250 mg capsule , tetracycline 500 mg capsule , topotecan hydrochloride capsules 1 mg , vitamin e usp ( 400 mg ) , capsule , acyclovir 3%w / w 5 ml vial , atropine sulphate 1% 5 ml vial , beclomethasone ( 0.025% ) + clotrimazole 1% + neomycin sulphate 0.5%5 ml ear drop , benzocaine 2.7% w / v + chlorbutol 5% w / v +paradichlorobenzene 2% w / v + turpentine oil 15% w / v ear drop , carboxymethylcellulose solu. eye drop 0.5% , carboxymethylcellulose solu. eye drop 1% , ciprofloxacin eye drop 0.3% 10 ml , fluromethanol eye drop , gatifloxacin ophthalmic solution 0.3% w / v 5ml vial , gentamycin eye drop , homatropine hydrobromide 2 %w / v 10ml eye drops , homatropine hydrobromide 2 %w / v 5ml eye drops , lignocaine hcl 4% eye drop , loteprednol eye drop , methyl cellulose / visco elastic , moxifloxacin +prednisolone eye drope , moxifloxacin 0.5% eye drop , natamycin eye drop , nepafenac ophthalmic solution , ofloxacin 0.3% 5 ml vial , olopatidine hydrochloride ophthalmic solution 0.1% , pilocarpine eye drops 2% , polyethelene glycol 400 & propylene glycol ophthalmic solution 10ml , polyvinyl alcohol 1.4% 5 ml , povidone iodine 5% solution eye drop 5ml , prednisoloneeye / drop. , proparacaine , sodium chloride opthalmic solution 5% eye drop , timolol maleate 0.5% 5 ml vial , tobramycin 0.3% 5ml eye drop , topicamide +phenylephrine eye drop , tropicamide 1% 5 ml vial , acyclovir 3% eye oint.5 gm tube , atropine eye oint. 3gm tube , chloramphenicol eye ointment 5 gm tube , ciprofloxacin eye ointment 5 gm tube , hydroxypropylmethylcellulose 2% w / v ophthalmic solution ocular lubricant 5gm ointment , tobramycin eye oint.3gm tube , medical nitrous oxide gas , benzocaine gel usp 20% w / w 15gm tube , chlorhexidine gluconate 1.0% w / w 15gm tube , choline salicylate and lignocaine hydrochloride 10 gm tube , diclofenac gel 1% 30 gm , dinoprostone 0.5 mg 3 gm pre filled syringe gel , ecg gel 250ml bottle , lignocaine hydrochloride 2% w / v gel , oxetacaine 10mg + aluminium hydroxide 291mg + milk of magnesia 98 mg per 5ml 200 ml bottle , triamcinolone acetonide dental paste usp, 0.1% 5gm tube , ultra sonograph gel 250ml bottle , white petroleum jelly kg , amino acid infusion 5 %100 ml , amino acids 10% w / vin glass bottle 500ml, , aminoacid ( essential ) 10% 100 ml ffs bottle , balanced crystalloid solution 500 ml bottle , ciprofloxacin200 mg / 100 ml ffs bottle , dextrose 40% 100 ml bottle , dextrose 5 % with normal saline 0.45% 500 ml glass bottel with rubber cork , dextrose saline ( dns ) 5% + 0.9% 500 ml ffs bottle , dextrose with saline ( 5% + 0.45% ( 500ml ffs bottle ) ) , injection , dextrose, 25% 100 ml ffs bottle , dextrose, d 10 10% 500 ml ffs bottle , dextrose, d 5, 5% 500 ml ffs bottle , dextrose, d 50 50% 100 ml ffs bottle , electrolyte m ( multi electrolyte with 5% dextrose iv injection type iii ip ) , type iii ip 500 ml ffs bottle , electrolyte p ( multiple electrolytes & dextrose injection type i ip ) type i ip 500 ml ffs bottle , fluconazole 100ml bottle. 2mg / ml. , glutamine dipeptide 100ml bottle , glycine irrigation solution ip 3000 ml bottle , hydroxyethylstarch 6% solution with sodium chloride 0.9% iv infusion 500 ml ffs bottle , levofloxacin 500 mg / 100 mlffs bottle , linezolid 200 mg / 100ml 300 ml bottle , mannitol20%100 ml ffs bottle , mannitol 20% 350ml , metronidazole 500 mg / 100 mlffs bottle , normal saline 0.9% 100 ml ffs bottle , normal saline 0.9% 3 ltrs bottle , normal saline 0.9% 500 ml ffs bottle , normal saline 1.6% 500 ml bottle , normal saline 3% 100 ml ffs bottle , normal saline glass bottle 100ml , normal saline glass bottle 500ml , ofloxacin 200mg / 100 ml bottle , ornidazole iv 500mg / 100ml ( 100ml bottle ) , infusion , paracetamol1000 mg 100 ml ffs bottle , ringer lactatei / v 0.24 % v / v of lactic acid ( eq. to0.32% w / v of sodium lactate ) , 0.6 % w / v sodium chloride, 0.04 %w / v potassium chloride and 0.027 % w / v calcium chloride 500 ml ffs bottle , ringer lactatei / v 0.24 % v / v of lactic acid ( eq. to0.32% w / v of sodium lactate ) , 0.6 % w / v sodium chloride, 0.04 %w / v potassium chloride and 0.027 % w / v calcium chloride 500 ml glass bottle , sodium chloride hyper tonicn / 2 ( 0.45% ) 500 ml ffs bottle , sodium chloride ( 1 / 2 n ) + dextrose 0.45% + 5% 500 ml ffs bottle , total parenteral nutrition 1000 ml with 763 kcal dextrose 15% w / v, amino acids 10% w / v with electrolytes & intravenous fat emultion triglycerides 20% w / v ) ( all in one inthree chamber bag ) , 1000ml , total parenteral nutrition ( including carbohydrate + proteins + fats solution 2000 ml ) , infusion , budesonide nebulising suspension containing budesonide ( 0.5 mg / 2 ml, 2ml amp ) , suspension , sevoflurane usp inhalation anesthetic 250 ml ( 250 ml ) , bottle , desflurane 240ml bottle , formoterol + budesonide ( 6 mcg + 100 mcg / puff ( 120 mdi ) ) , inhaler , ipratropium bromide ( 250 mcg / ml respules / ampoule ) , inhalation , isoflurane inhalation 250 ml bottle , levosalbutamol ( 1.25mg ) , ipratropium ( 500mcg ) respule ( 3ml ) , ampule , salbutamol nebuliser solution bp sabutamol sulphate eq. to salbutamol 1mg per ml ( 2.5 ml amp ) , ampule , sterile acetylcysteine solution usp 20% w / v 2ml respules , salmeterol 25 mcg + fluticasone 125 mcg ( 120mdi ) , inhaler , 5 fluro uracil 250mg 10 ml amp , 5 fluro uracil 500mg 10 ml amp , actrapid penfill 100iu / 3 ml injection , acyclovir inj ( 250 mg / vial ) , injection , acyclovir inj ( 750 mg / vial ) , injection , acyclovir intervenous infusion i.p ( 500mg / vial ) , injection , adalimumab ( 20 mg / 0.4 ml vial ( pfs / vial / ampule ) ) , ampule , adalimumab ( 40 mg / 0.8 ml vial ( pfs / vial / ampule ) ) , ampule , adenosine ( 6 mg / 2ml ) , injection , ado trastuzumab emtansine 100 mg inj , adrenaline ( 1 mg / ml ( 1 ml amp ) ) , injection , aflibercept injection for intravitreal 2mg / 0.05ml vial , alamine 8.2gm+l glutamic acid 13.46gm 100 ml bottle i / v , alteplase for injection 50mg vial , amidotrizoate meglumine; sodium amidotrizoate ( 76% ) dye 50 ml bottle , amikacin250mg / 2 ml 2 ml vial , amikacin ( 500mg / 2ml ( 2ml vial ) ) , injection , aminophylline ( 25 mg / ml 10 ml vial ) , injection , amiodarone 50mg / ml ( 3ml vial / amp ) , injection , amoxycillin +clavulanic acid ( ( amoxycillin 500 + clavulanic acid 100 mg ) / vial ) , injection , amoxycillin and potassium clavulanate i.p. ( 1 gm + 0.2 gm / 10 ml vial ) , injection , amphotericin b inj ip 50 mg ( liposomal amphotericin b also acceptable ) , injection , ampicillin ( 500 mg / vial ) , injection , ampicilline 1000mg + sulbactam 500mg, injection , anti d immunoglobulin for iv / im use ( monoclonal ) ( 150mcg ( 1ml vial ) ) , injection , anti rabies vaccine i.p. inj. human ( tissue culture ) for i / d and i / m route 2.5 iu with ( 1ml diluents ) , vial , anti scorpion venominj <120mg total protein and >150 ld50 [ mouse ] neutralizing units / vial , anti snake venom polyvalent inj 10ml ( lyophilized ) ( 10 ml vial ) , injection , anti thymocyte globulin ( 250mg / 5ml ) , injection , anti thymocyte immunoglobulin ( rabbit ) ( 5mg / ml ( 25mg vial ) ) , injection , artesunate ( 60 mg / vial ) , injection , ascorbic acid 100mg / ml 5ml amp ( vitamin c ) inj , atracurium ( 10mg / ml ) , injection , atropine sulphate 0.6 mg / ml sc / im / iv ( 2ml amp ) , injection , azithromycin 100mg / 5ml inj , azithromycin 500mg / 5ml inj , bendamustine ( 100mg vial ) , injection , benfotiamine7.5mg +folic acid ip 0.75mg +methylcobalamin jp 750mcg +pregabalin ip 75mg +vitamin b6 ( pyridoxine hcl ip 1.5mg ) injection , benzathine penicilline 12 lac iu / vial ( vial ) , injection , betamethasone sodium phosphate ( ml contain betamethasone sodium phosphate equal to 4mg of betamethasone ( 1ml amp ) ) , injection , bevacizumab 100 mg ( 4 ml vial ) , injection , bleomycin ( 15 units / vial ) , injection , bortezomib ( 2.5mg ) , injection , bortezomib ( 2mg ) , injection , bortezomib ( 3.5mg ) , injection , botulinum toxin type a injection 100units / vial , botulinum toxin type a injection 200units / vial , brilliant blue g solution 0.05% w / v , brolucizumab solution for injection 120mg / ml , bupivacaine hcl for spinal anaesthesia 0.5% ( heavy ) amp 4 ml amp , bupivacaine hydrochloride ( 0.5% ( 20 ml vial ) ) , injection , buprenorphine hydrochloride0.3mg base / ml 1ml amp inj , busulfan ( 6mg / ml ( 10ml vial ) ) , injection , butorphanol 1mg / ml 1ml amp , c3r dye riboflavin hypotonic , c3r dye riboflavin isotonic , caffeine citrate inj. ( 20mg / ml 1 ml vial ) , injection , caffeine citrate inj. ( 20mg / ml 3 ml vial ) , injection , calcium carbonate 10% 10ml amp , calcium chloride 10% 100mg / ml 10ml vial , calcium gluconate 10% ( 10ml vial / amp ) , injection , calcium leucovorin ( 50 mg / vial inj ) , injection , carboplatin ( 150mg 15 ml vial ) , injection , carboplatin ( 450mg 45ml multidose vial ) , injection , carboprost ( 250 mcg ( 1 ml amp / vial ) ) , injection , carmustine injection ip 100 mg vial , cefazolin inj ( 500mg vial ) , injection , cefepime 500mg and tazobactam 125 mg inj ( vial ) , injection solution for , cefepime ( 500mg injection ) , injection , cefoperazone + sulbactam 1000 mg +500 mg vial , cefoperazone 1000mg + sulbactam 500mg inj ( vial ) , injection , cefoperazone 1gmvial , cefotaxime + sulbactam 1000 mg + 500 mg vial ( 1000 mg + 500 mg ) , injection , cefotaxime sodium 1 gm / vial , cefotaxime sodium 500mg vial , ceftazidime 1gm vial , ceftazidime inj ( 500mg / vial ) , injection , ceftazidime ( 250mg / vial ) , injection , ceftriaxone 1 gm / vial , ceftriaxone 1000 mg+disodium edetate 37 mg+sulbactam 500 mg powder for solution for infusion , ceftriaxone 1000mg + sulbactam 500mg ( vial ) , injection , ceftriaxone ( 500mg vial ) , injection , ceftriaxone+tazobactum ( 1gm+125mg, vial ) , injection , cefuroxime ( 1.5 gm ) , injection , cefuroxime ( 1000 mg ) , injection , cefuroxime ( 500 mg ) , injection , cetuximab 2mg / ml 100mg / 50ml vial , cetuximab 2mg / ml 200ml / 100 ml vial , cetuximab ( 500 mg ) , injection , chloramphenicol sodium succinate 500 mg, injection , chloroquine phosphate ( 40mg / ml ( 5 ml amp ) ) , injection , chlorpheniramine maleate ( 10mg / ml inj 10 ml ) , vial , chlorpromazine injection ip 25mg / ml 1 ml vial , cholecalciferol 600000 iu / 2ml ( 2ml amp ) , injection , cholecalciferol 600000 iu / ml ( 2ml amp ) , injection , cis atracurium 2mg / ml ( 5ml vial ) solution for injection , cisplatin ( 10 mg ) , injection , cisplatin ( 50 mg ) , injection , cladribine injection 1mg / ml 10ml vial , clindamycin 600mg ( 150mg / ml ) , injection , clindamycin ( 150mg / ml ( 2 ml vial / amp ) ) , injection , clonidine100 mcg / ml 10 ml vial , colistimethate sodium for injection ip ( 2 m iu vial ) , injection , colistinethate sodium inj bp ( 1 million iu ) , injection , cyanoacrylate glues 120mg / ml , cyclophosphamide inj ( 1000 mg / vial ) , injection , cyclophosphamide inj ( 200 mg / vial ) , injection , cyclophosphamide inj ( 500 mg / vial ) , injection , cynocobalamin 500mcg +folic acid 15mg+niacinamide 200 mg + ascorbic acid 100mg inj , cynocobalamin 500mcg +folic acid 15mg+niacinamide 200 mg inj , cytarabine 1000 mg / ml 1ml vial , cytarabine ( 100mg ) , vial , dacarbazine 200 mg inj , dacarbazine 500 mg inj , dactinomycin 0.5 mg inj , daunorubicin hydrochloride 20 mg / vial , daunorubicin hydrochloride 50 mg / vial , decitabine for injection 50mg / vial , desferioxamine , desferioxamine , dexamethasone intravitreal implant 0.7mg , dexamethasone sodium phosphate ( 4mg / 2ml ( 2ml vial ) ) , injection , dexamethasone sodium phosphate ( 8mg / 2ml ( 2ml vial ) ) , injection , dexmedetomidine 100 mg / ml ( 1 ml amp ) , dextran injection ip 10%w / v 500ml bottle , diatrizoate meglumine 809.13 mg+diatrizoate sodium 635.90 mg 76% 20ml, injection , diatrizoic acid 60% 20ml amp , diatrizoic acid 65% 20ml amp , diazepam ( 5 mg / ml ( 2 ml amp ) ) , injection , diclofenac sodium 25 mg / ml ( 3ml amp ) , injection , diclofenac sodium 75mg intended to use iv aqueous formulation ( 1ml amp ) , injection , dicyclomine ( 10mg / ml ( 2 ml amp ) ) , injection , digoxin i.p. 0.5mg / 2ml amp inj , diltiazem 25mg ( 5ml vial ) , injection , diphtheria antitoxin 10000 iu ( 10ml vial ) , injection , dobutamine hcl 50 mg / ml ( 5ml amp ) , injection , docetaxel ( 120mg vial ) , injection , dopamine hydrochloride 40 mg / ml 5 ml amp , doxorubicin ( lyophilised ) ( 50mg vial ) , injection , doxorubicin ( lyophilized ) ( 10 mg / vial ) , injection , drotaverine ( 40mg / 2ml ( 2ml amp ) ) , injection , edaravone injection jp 1.5mg / ml ( 20ml amp ) inj , enalapril maleate inj 1.25 mg per ml 2ml vial , enoxaparin ( 40mg equivalent to 4000 iu vial / pfs ) , injection , enoxaparin ( 60mg equivalant to 6000 iu vial / pfs ) , injection , ephedrine 30 mg / ml ( 1 ml amp ) , injection , epirubicin ( 100mg / vial ) , injection , epirubicin ( 50mg / vial ) , injection , erythropoietin ( 10000iu inj ) , injection , erythropoietin ( 4000 iu inj vial / pfs ) , injection , esmolol 100 mg / vial ( 10mg / ml ) , injection , etanercept 25mg / vial ( pack of 2 vials ) , injection , etanercept 50mg / vial ( pack of 2 vials ) , injection , ethamsylate inj ( 125mg ( 2ml amp ) ) , injection , etiophylline and theophylline ( 220 mg / 2ml ) , injection , etomidate vial ( 2mg / ml ) ( 10ml vial ) , injection , etoposide injection ip 100 mg / 5 ml , fat emulsion 20% 250 ml bottle , fentanyl citrate inj 100 mcg / ml ( 2ml ampoule ) , ampule , fentanyl citrate inj 50 mcg / ml ( 2ml ampoule ) , ampule , filgrastim 300 mcg ( prefilled syrings ) , vial , filgrastim injection pfs 300 mcg recombinant human granulocyte colony stimulating factor ( rhu g csf ) , fludarabine phosphate 50mg ( each ) , injection , fluorescein 20% 5 ml amp , flupentixol 25 mg inj , flupentixol injection ip 20 mg / ml , fluphenazine 25 mg / ml 1 ml amp , frusemide ( 10 mg / ml ( 2 ml amp ) ) , injection , ganciclovir 500 mg vial , gas gangrene antitoxin 10, 000iu / ml ( 4ml amp ) , gemcitabine ( 1.4 gm vial ) , injection , gemcitabine ( 1000mg vial ) , injection , gentamicin inj ( 40 mg / ml 2 ml amp ) , injection , glargine 100 iu / ml, 3ml cartridge inj. ( firm has to supply one compatible pen with every 20 cartridges as and when required without any extra cost ) ( 100 iu / ml ) , cartridges , glutathione 600mg vial, injection , glycopyrrolate 0.5mg + neostigmine 2.5mg 5ml amp , glycopyrrolate inj. 0.2 mg / ml ( 1 ml amp ) , injection , granulocyte colony stimulating factor ( g csf ) 300mcg vial , haemocoagulase 1 iu ( 1ml amp ) inj , haemophilus influenzae type b vaccine 0.5ml , haloperidol inj ( 50mg / ml ) , injection , haloperidol inj ( 5mg / ml ( 1 ml amp ) ) , injection , heparin inj ( 5000iu / ml 5ml vial ) , injection , heparin ( 1000iu / ml 5ml vial ) , injection , hepatitis b immunoglobulin ( 100 iu / vial ) , vial , hepatitis b vaccine / 1ml ( 1ml ) , ampule , human albumin solution i.p. 20%w / v ( 100 ml ffs bottle / glass bottle ) , bottle , human anti d. immunoglobulin ( monoclonal ) ( 300mcg / vial ) , injection , human insulin regular / soluble ( 40iu / ml ( 10ml vial ) ) , injection , hyaluronidase 1500 iu / 2 ml ( 2 ml amp / vial ) , injection , hydrocortisone sodium succinate ( 100 mg / vial ) , injection , hydroxy propyl methyl cellulose injection 2% ( 3ml prefilled syringe ) , syrings , hydroxyprogesterone caproate inj i.p. 250mg / ml , hyoscine butylbromide 20mg / ml ( 1ml vial / amp ) , injection , i / v polysacchride or conjugate pneumococcal ( 0.5 ml ) , vaccine , ifosfamide for injection1 gm vial , ifosfamide for injection1 gm with mesna injection vial , ifosfamide for injection2 gm vial , imipenem 1000 mg vial / amp, injection , imipenem 500 mg with cilastatin 500mg ( vial / amp ) , injection , infliximab powder for concentrate for solution for infusion ( r dna origine ) 100mginj , insulin lispro ( insulin lispro 25% and insulin lispro protamine 75% ) ( rdna origin ) 100iu / ml , iohexol ( non ionic contrast medium in sterile aqueous solution ) 300 mg iodine / ml ( 100 ml ) , bottle , iohexol injection 350 mg iodine / ml ( 20 ml vial ) , consumable , irinotecan hydrochloride ( 100 mg ) , injection , irinotecan ( 40mg / vial ) , injection , iron sucrose usp ( 100 mg / 5 ml ( 5 ml amp ) ) , injection , isobaric levobupivacaine ( 0.5% ) , injection , isoprenaline 2 mg / ml ( 1 ml ) , injection , isoxsuprine hcl5mg / ml 2ml amp , iv human immunoglobulin 5% iv ig ( 5gm / 100ml bottle, injection , ketamine hydrochloride ( 50mg / ml ( 10 ml vial ) ) , injection , ketorolac trometamol 30 mg / ml 1ml solution for injection , l ornithine and l aspartate ( 5mg / 10 ml ) , injection , labetalol ( 20 mg / 4 ml ( 4ml amp ) ) , injection , l asparaginase 10000iu / vial, injection , l asparaginase 5000 iu lyophilized ( vial ) , injection , leuprolide acetate for injection 3.75mg depot , leuprolide acetate for injection 6.25mg depot , levetiracetam ( 100mg / ml ) , injection , levobupivacaine hyperbaric ( 0.5% ) , injection , levosulpiride injection ( 12.5 mg / ml ) amp , lidocaine hydrochloride topical solution usp 4% ( 40mg / ml ) , injection , lignocaine ( preservative free ) ( 2 % 50 ml vial ) ) , injection , lignocaine 10% ( 10mg / ml ( 30 ml vial ) ) , injection , lignocaine 2 % ( 21.3 mg / ml ( 30 ml vial ) ) , injection , lignocaine 2% + adrenaline 5 mcg / ml ( 30 ml ) , injection , lignocaine for spinal anaesthesia lignocaine 5% +destrose 7.5% 2 ml amp heavy , lignocaine hydrochloride inj ip 1% 2ml vial , liposomal amphotericin b suspension in saline 10mg , liposomal amphotericin b suspension in saline 50mg , liposomal amphotericin b ( 50 mg ) , injection , liposomal doxorubicin 20 mg or pegylated liposomal doxorubicin ( 2 mg / ml 10ml vial ) , injection , lorazepam ( 2 mg / ml 1 ml vial ) , injection , lorazepam ( 2 mg / ml 2 ml vial ) , injection , low molecular weight dextran 40000iu vial , magnesium sulphate injection ( i.p.50 % w / v 10 ml amp ) , injection , meningococcal polysaccharide vaccine groupe a, c, y and w 135 combined vial , meningococcal vaccine ( group a, c, y, w ) 0.5 ml vaccine , mephentermine inj 30mg / ml ( 10 ml vial ) , injection , meropenem ( 1000 mg ( vial ) ) , injection , meropenem ( 500 mg / vial ) , injection , mesna 200mg / 2ml ( 2ml amp ) , injection , methacarbamol 100 mg. / 10ml vial , methotrexate 15 mg / ml ( preservative free ) inj , methotrexate 50 mg / 2 ml, 2 ml vial , methotrexate 500mg / 5ml ( 5ml in 1 vial ) , injection , methyl ergometrine inj meleate ( 0.2 mg / ml ( 1ml amp ) ) , injection , methyl prednisolone sodium succinate inj ( usp 125mg ) , vial , methyl prednisolone sodium succinate inj. 40mg vial , methyl prednisolone sodium succinate inj.1000mg vial , methyl prednisolone ( 500mg ) , injection , methylcobalamin 1500 mcg +folic acid 0.7mg+ niacinamide 12 mg inj , methylcobalamine ( vitamin b12 ) 500 mcg / ml, 3 ml amp , methylene blue injection usp 1% ( 10mg / ml ) 10 ml amp , metoclopramide 5mg / ml ( 2 ml amp ) , injection , metoprolol inj 5 mg / ml ( 5ml vial ) , injection , micafungin sodium 100 mg / vial, injection , micronised progesterone 50mg / ml 2ml amp , micronized progesterone 100mg / ml2ml amp , midazolam 1mg / ml, 1 ml amp , midazolam 1mg / ml, 5 ml amp , milrinone 1mg / ml solution for injection / infusion , mitomycin c for injection 40mg inj , mitoxantrone 2 mg / ml inj , mixed.30 / 70 insullin biphasic isophane40 iu / ml 10 ml vial , morphine sulphate 10mg / ml 1ml amp , moxifloxacin opthalmic solution 0.5ml pfs , multivitamin 10ml ( amp inj ) , injection , n acetyl cysteine inj 200mg / ml 10 ml amp , naloxone inj. 0.4 mg / ml ( 1ml ampoule ) , injection solution for , neostigmine ( 0.5mg / ml ( 1ml amp ) ) , injection , nikethamide injection 1mg / ml ip 10 ml amp , nitrofurantoin 300mcg injection , nitroglycerine inj. 25 mg / 5ml ( 5ml ) , ampule , noradrenaline bitartrate 2 mg base / 2 ml amp injection ( 2 ml amp ) , injection , novomix 30 penfill 100 iu inj 3 ml cartridge , octreotide 100microgram / ml solution for injection 1 ml amp , octreotide 50 microgram / ml solution for injection 1 ml amp , olanzapine10 mg / vial inj , olanzapine depot inj , ondansetron ( 2 mg / ml ( 2 ml amp ) ) , injection , ondansetron ( 2 mg / ml ( 4 ml amp ) ) , injection , oxaliplatin ( 100mg ) , injection , oxaliplatin ( 50mg inj 25 ml vial ) , injection , oxytocin inj ( 5 iu / ml ( 1ml amp ) ) , injection , paclitaxel 260mg ( 43.34ml vial ) , injection , paclitaxel inj ( 100mg ) , injection , paclitaxel nanoparticle / protein bound particles inj. ( 100mg vial ) , vial , panitumumab 100mg / 5ml inj , paracetamol amp for i / v use ( 2ml ) , ampule , paracetamol inj ( 150mg / ml 2ml amp ( 2ml amp ) ) , injection , parenteral nutrition two chamber bags without lipid 2000ml , peg gcsf 6 mcg , pembrolizumab 100mg / 4ml ( 25mg / ml ) , pemetrexed ( 100mg ) , injection , pemetrexed ( 500mg ) , injection , penicillin v 125 mg inj , pentaprazole inj vial ( 40 mg ) , injection , pentazocin lactate 30mg / ml 1ml amp. , pentoxifylline 20 mg / ml , perfluoro n octane liquid , pertuzumab 30 mg / ml ( 420mg / 14ml ) , injection , pheniramine maleate ( 22.75 mg / ml ( 2 ml amp ) ) , injection , phenobarbitone100mg / ml 1ml amp. , phenobarbitone200mg / ml 1ml amp. , phenytoin sodium ( 50 mg / ml ( 2ml amp ) ) , injection , pilocarpine nitrate inj. ip 0.5 % w / v ( 1 ml ) , injection , piperacillin + tazobactam 1000 mg + 125 mg vial 10 ml vial ( ) , injection , piperacillin + tazobactam ( 2000 mg + 250 mg 20ml vial ) , injection , piperacillin + tazobactum ( 4.5 g ) , injection , potassium chloride inj. 150mg / 10ml amp ( 150mg / 10ml amp ) , ampule , pralidoxime chloride injection i.p. 1gm ( 20 ml ) , injection , preservative free lidocaine tropicamide phenylephrine hydrochloride inj , progesterone b.p.100mg / 2ml ( 2 ml vial ) , injection , promethazine 25 mg / ml ( 2 ml amp ) , injection , propofol sodium 1%w / v ( 10mg / ml ( 20ml vial ) ) , injection , protamine sulphate 1%w / v ( 10mg / 5ml ( 5ml amp ) ) , injection , quinine dihydrochloride ( 300mg / ml ( 2ml amp ) ) , injection , rabeprazole 20 mg injection , rabies immunoglobulin inj 300 iu ( ( 2ml vial pfs ) ) , injection , ranitidine ( 50mg / 2ml , 2ml amp ) , injection , recombinant anti hemophilic factor viii ( 250 iu inj / vial ) , injection , recombinant anti hemophilic factor viii ( 500 iu inj / vial ) , injection , remdesivir inj 100mg / vial , rh erythropoetin ( 2000 i.u ) , injection , rituximab ( 100mg ) , injection , rituximab ( 500mg ) , injection , ropivacaine 0.5% 20 ml vial , ropivacaine 0.75% 4ml amp , ropivacaine 10mg / ml 2.5ml vial , ropivacaine hydrochloride0.2% 40mg / 20ml vial ( 2mg / ml ) , ropivacaine hydrochloride0.75% 150 mg / 20 ml vial ( 7.5mg / ml ) , sargramostim 500 mcg / ml inj , sildenafil 10mg i.v. 12.5ml , sildenafil citrate 10mg / ml 10ml vial , silicone oil 1500 cst , silicone oil 5000 cst , sodium bicarbonate inj. 7.5% w / v ( 10ml ) , ampoule , sodium thiopentone 0.5 gm powder / vial ( 20ml vial ) , injection , sodium thiopentone 1 gm powder / vial ( 20ml vial ) , injection , sodium valproate 100 mg / ml, 5 ml amp , somatropin 1.33mg 4iu injection , streptokinase inj 15 lac iu ( vial / amp ) , injection , streptomycin inj ( 0.75g ) , injection , succinyl choline ( 50mg / ml ( 10 ml vial ) ) , injection , surfactant ( porcine lung surfectant extract 80mg / ml ) , surfactant bovine ( 135 mg phopholipid per 5 ml, 5ml vial ) , suspension for intratracheal instillation ( 80mg / ml ( pack size as licensed ) ) , suspension , teicoplanin ( 200 mg / vial ) , injection , terbutaline suplhate 0.5 mg / ml ( injection 1 ml amp ) , injection , teriparatide injection ip 600mcg / 2.4 ml amp , terlipressine inj. 1mg / 10ml vial ( 1 each ) , injection , tetanus immunoglobulin usp / ip ( 500 iu / vial ) , vial , tetanus toxide 0.5ml ampoule ( 0.5ml amp ) , ampule , thiamin ( 200mg 2ml ) , 4 ml amp, injection , thiamine ( vitamin b1 ) hcl 100mg / 2ml 4ml amp, injection , tigecycline 50mg ( each ) , injection , tobramycin sulphate injection ip 80 mg / 2ml ( 2 ml vial ) , tocilizumab ( 400mg ) , injection , torsemide injection ( 10 mg / ml, 2 ml amp ) , tramadol ( 100mg / ml ( 2 ml amp ) ) , injection , tramadol ( 50mg / ml ( 2ml amp ) ) , injection , tranexamic acid injection bp / ip ( 100mg / ml ( 10ml vial ) ) , injection , tranexamic acid injection bp / ip ( 100mg / ml ( 5ml amp ) ) , injection , trastuzumab 440 mg injection ( vial ) , injection , triamcinolone ( ( 40 mg / ml ) 1ml vial ) , injection , trypan blue opthalmic solution ( 0.06% 1 ml ) pre filled syringe , ulinastatin ( 1 lac iu ) , vial , urokinase ( 5 lac iu ) , vial , vancomycin hydrochloride ( 1000mg vial ) , injection , vancomycin hydrochloride ( 500mg ) , injection , vasopressin ( 20 iu / ml ) , injection , vasopressin ( 40 iu / ml ) , injection , vecuronium bromide ( 2mg / ml ( 2ml amp ) ) , injection , verapamil hydrochloride 2.5 mg / ml amp , vinblastine ( 10 mg / 10 ml ( 10ml amp ) ) , injection , vincristine sulphate ( 1mg / ml ( 1 ml vial ) ) , injection , vinorelbine ( 10 mg ) , injection , vinorelbine ( 50 mg ) , injection , vitamin b complex injection ( nfi formula 30ml / vial ) , injection , vitamin k1 ( 10mg / 1ml ( 1 ml amp ) ) , injection , vitamin k1 ( 1mg / 0.5ml ( 0.5 ml amp ) ) , injection , voriconazole ( 200 mg / vials ) , injection , water for injection 10 ml amp , zoledronic acid ( 4mg vial ) , injection , zuclopenthixol acuphase 50 mg inj , zuclopenthixol decanoate 200 mg inj , abo / rh ( d ) ahg neonate group card , acetic acid solution 3% v / v100ml , acetone detection kit , acetone solution 05 litre pack , ada kit , ahg coombs test gel card , aluminium ammonium sulphate powder 500gm , amacr , ana test kit , anhydrous cuso4 powder , anti a lactin 05ml , anti ab sera 10ml , anti d igg+ igm 10ml , anti d igm 10ml , anti hlactin 05ml , anti her / erbb2 monoclonal , anti human globulin ( ahg ) 05ml , anti a sera 10 ml , anti b sera 10 ml , banded use in blood bank , barium chloride 10 %500 ml , bcl 2 , benedict reagent5 lit cane , bismark brown stain 100 gm , blood culture media aerobic for adult ( bac t / alert pf plus ) , blood culture media anaerobic for pediatric ( bac t / alert pf plus ) , blotting paper 50 / pkt , blotting paper sheet , blue tip 2ml , bovine albumin 22%05ml , buffer solution for hiv 50ml , ca 125 , calcium chloride 05ml / vail , capillary tube , cd 41 pc7 , cd34 , cd42b pe , cd61 pc5.5 , cd62p fitc , combined spinal epidural ( cse ) kit , coombs sera ( igg + c3d ) , coombs sera c3d , coombs sera igg , couplin jar , cover slips size 18x18mm , cover slips size 22x22mm , cox 2 , csf protein kit , cyclin d 1 , cyto fix spray , cytoflex daily qc , cytokeratin ae1 / ae3 , dengue card test , desmin , disposable microtome blade ( 50 blades in one ) , disposable test tube with screw cap , dpx mount 250ml , ehlrich aldehyde reagent 125 , ema , estrogen receptor epi monoclonal , field stain a 500 ml , field stain b 500 ml , filter paper 12.5 cm 0.1 micron ( 50 per pkt ) , flow count bead , fluorospheres 2ml , forward & reverse grouping auto control gel card , fouchet reagent 250ml , glacial acetic acid 100 ml , glass pasture pippett with rubber , glial fibrillary acidic protein ( gfap ) , glucose kit god / pod , h2so4 25 % 500 ml bottle , haematoxylene 5gm , hbsag elisa test kit 4th generation 96 test , hbsag rapid test kit50 test , hbv elisa test kit 4th generation96 test , hbv rapid test kit , hcv elisa test kit 4th generation 96 test , hcv rapid test kit , hemoglobin test strips , hiv elisa test kit 4th generation 96 test , hiv rapid test kit , hpr polymerr kit with dab chromogen , hydro chloride acid about 36.46% , i.d. microtyping abd card , i.d. microtyping gel card ahg , immersion oil , immunotrol , immunotrol low , iso propyl alcohol , ki67 / mib 1 06 ml antibody kit , leishman stain 500 ml , leucoreductionfilter ( bed side ) , leucoreductionfilter ( lab side ) , light green stain 100 gm , liquid ammonia 500 ml , liss diluent for gel card , malaria parasite antigen test kit rapid , malaria parasite elisa test kit , massons trichrome stain , mercuri oxide 25gm , methanol 2.5lit , mgg 480ml , multi parameter urine strips ( 100 in 1 box ) , myogenin , n / 10 hcl 500ml , neutral gel card , nfp , nitric acid 500 ml , nkx 3 1 , p 53 , pandys reagent 125ml , pap pen , papanicalou ea 125ml pea 030 , papanicalou og 6 125ml pea 010 , paraffin wax 58 60c , pas stain , pasture pipette , poly l lysine solution p8920 0.1%w / v 100 ml bottle , polythene gloves , pricking lancet , progestron receptor monoclonal , retic stain 125ml , rh phelotype card with anti k , rpr test kit , s 100 , sharp collection containers disposable5 ltrs , sharp collection containers disposable 1.5 ltrs , sheath fluid , single donor platelet kit make haemonotics / terumo penpol ( close system ) , slide tray , sma , sodium chloride for analysis , steel cassets for tissue processing , stem trol , sugar albumin urine sticks ( bi parameter ) 100 strips / bottle , sulpgar powder 500 gm , sulpho salicylic acid 500ml , synaptophysin , test tube , tetrachrome , tips for auto pippets ( 2 to 100 micron yellow 1000 / pkt ) , tips for auto pippets ( 200 to 1000 micron blue 500 / pkt ) , tissue paper roll , titriplex iii pure ( edta ) , total protein kits 100 ml , tris buffer gr 500gm , tween 20 for synthesis 500ml , vdrl elisa test kit , vdrl rapid test kit , versa lyse solution , vimentin , wafers cutting blade for tube welders , xylene lr 2.5l, packaging size: 2.5 lits. , yellow gel tube vaccum blood collection tube , yellow tip plastic , calamine lotion ( ( contains per 1000 ml: calamine 150 gm, zinc oxide 50 gm, bentonite 30 gm, sodium citrate 5gm, liquified phenol 5ml, glycerin 50 ml ) 50 ml bottle ) , lotion , permethrin lotion 5% w / v ( 60 ml bottle ) , lotion , hydrogen peroxide 3% w / v mouth gargle 100 ml bottle , povidine iodine ( gargle 2% w / v 100 ml bottel ) , bottle , clotrimazole 1% w / v ( 15ml ) , mouth paint , clotrimazole, baclomethasone, benzocaine mouth paint 15ml , triamcinolone acetonide paste bp 0.1 %w / w, 5gm , triamcinolone oromucosal paste bp 0.1 %w / w, 5gm , chlorhexidine gluconate mouthwash 0.2% w / v solution ( 50ml bottle ) , solution , potassium permanganate ( kmno4 ) 25 mg ( 100ml bottle ) mouth wash , xylometazoline nasal ( 0.1%w / v ( 10 ml vial ) ) , drop , saline ( sodium chloride 6.5 mg ) nasal gel 15 gm tube , saline ( sodium bicarbonate 700mg + sodium chloride 2.3gm ) nasal wash 3 gm kit , sterile haemocoagulase solution 0.2cu 10ml drop , turpentine oil 100 ml bottle , mct oil and permitted anti oxidant ( tocopheryl acetate ) 100 ml bottle , acyclovir 5%w / w ( 5gm ) , ointment or cream , amorphous hydrogel wound dressing with colloidal silver 15gm , beclomethasone dipropionate, clotrimazole, neomycine sulphate, chlorocresol ( 0.025% + 1% + 0.5% + 0.1% w / w ( 5gm tube ) ) , ointment or cream , betamethasone 0.5mg +gentamicin 1mg 20gm cream , betamethasone valerate cream 0.05% ( 15gm tube ) , ointment , betamethasone valerate oint 0.1% ( 15 gm tube ) , ointment , centella asiatica extract based skin moisturization and antiscar gel 50gm , clindamycin phosphate gel usp 1% 30gm tube , clobetasol propionate 0.05% ( 15 gm tube ) , cream , clotrimazole i.p. 2%w / w ( 15gm tube ) , cream , fluconazole ointment 0.5% w / w 15 gm tube , framycetin sulphate 1% w / w 30 gm tube , fusidic acid cream / sodium fusidic ointment 2% ( 15gm tube ) , tube , heparin and benzyl nicotinate 20gm ointment , ketoconazole cream 2% 30gm cream , lidocaine hydrochloride ip 3%w / w + hydrocortisone ip 0.25% w / w + allantoin ip 0.5% w / w + zinc oxide 5% w / w, 15gm tube , luliconazole ( 1% w / w ) , cream 20gm , magnesium sulphate, sulphacetamide, urea, proflavin ( in glycerine base ) ointment 75 gm , mupirocin ( 2% w / w ( 5 gm tube ) ) , ointment , neomycin sulphate+bacitracin zinc ( 5mg+500 iu / gm ointment ( 15gm tube ) ) , tube , papain urea and silk protein based debriding ointment and cream 100 gm , papain urea and silk protein based debriding ointment and cream 25 gm , papain urea and silk protein based debriding ointment and cream 50gm , papain urea debriding ointment 15 gm tube , permethrin cream 5% w / v ( 60 gm ) , tube , placenta extract gel 20 gm tube , povidone iodine 5 % w / w + metronidazole 1 % w / w, 15 gm tube , povidone iodine and silk protein based topical antiseptic and wound healing ointment 100 gm , povidone iodine and silk protein based topical antiseptic and wound healing ointment 250gm , povidone iodine and silk protein based topical antiseptic and wound healing ointment 25gm , povidone iodine and silk protein based topical antiseptic and wound healing ointment 50 gm , povidone iodine ointment 5% 250gm jar , povidone iodine ointment 7.5% 500gm jar , salicylic acid 6 %, 30 gm ointment , silk protein based antimicrobial wound healing ointment loaded with asiaticoside and silver 100 gm , silk protein based antimicrobial wound healing ointment loaded withasiaticoside and silver 25 gm , silk protein based antimicrobial wound healing ointment loaded withasiaticoside and silver 250 gm , silk protein based antimicrobial wound healing ointment loaded withasiaticoside and silver 50 gm , silver nitrate hydrogel wound dressing 0.2% w / w 25 gm tube , silver sulphadiazine cream usp 1% ( 500 gm jar ) , cream , bacitracin zinc 400 u+neomycin sulphate 3400 u+polymyxin b sulphate 5000 u ( 10 gm powder ) , clotrimazole ( 1% 100 gm ) , powder , formula milk for infants 500gm , polyethylene glycol with electrolytes for oral solution 137gm , potassium permegnet powder 400 gm pkt , povidone iodine powder 5% w / w 10 gm powder , protien powder ( 200 gm 1x1 ) , powder , silk protein andnano silver based microbicidal sterile wound dressing dusting powder 100 gm , silk protein andnano silver based microbicidal sterile wound dressing dusting powder 50 gm , silk protein and antimicrobial nano silver based surgical particle wound dressing 10ml vial , silk protein and antimicrobial nano silver based surgical particle wound dressing 5ml vial , formoterol 12 mcg+tiotropium bromide 18 mcg / cap powder for inhalation , collagen granules 10 ml , fosfomycin trometamol powder ( sachet of 3 gm granules ) , human milk fortifiers ( hmf sachets ) ( 1x1gm ) , sachet , l arginine 3gm + proanthocyanidin 75mg ( 10gm sachet ) , sachet , lactic acid bacillus ( 150 million spores ) , sachet , orodispersible probiotic sachets ( 2 gm sachet ) , ors who powder glucose anhydrous 13.5g / l, sodium chloride 2.6g / l, potassium chloride 1.5g / l, trisodium citrate 2.9g / l ( as per attached pack specification ) , powder , acyclovir 5% ( 5gm ) , ointment or cream , alcoholic handrub with triple action:50%2 propano+25%1.propanol+2.5% chx+0.5 triclosan.500 ml , antiseptic hospital concentrate contdaining 20% chlorohexidine soln ip 7.5% v / v cetrimide ip 15%w / v iso peopyl alchohol 6 8% 1000ml. , beclomethasone dipropionate lotion 0.05% w / v 100ml bottle , caffeine citrate 20mg / ml 1.5 ml oral solution , caffeine citrate 20mg / ml 3 ml oral solution , citric acid 500 ml bottle , compound benzointincture, benzoin, aloe, storax, tolu balsam and enough alcohol to make a tincture ( 74 80% alcohol ) , 100 ml , feracrylum 1% 100 ml solution , formaldehyde solution37% acq. 450 ml bottle , gentian violet solution 30ml bottle , gluteraldehyde solution 2% ( 5 litre can ) , solution , glycerine + sodium chloride enema ( 15% + 15% 20 30 ml / pack ) , enema , glycerine ip 500ml bottle , hand wash solution ( sol.isoprapanol, propanol , mecetronium, skin care additives ) 500 ml bottle , hydrogen peroxide 6% solution ( who gmp certification exempted for this item ) ( 400 ml ) , bottle , liquid paraffin ( 500 ml, bottle ) , solution , povidone iodine 10% , povidone iodine solution 5% ( 500 ml ) , bottle , povidone iodine surgical scrub solution. 7.5% ( 500 ml bottle ) , solution , sodium hypochlorite solution 5% ( 500 ml bottle ) , consumable , solution heparin topical 1000iu / ml ( each ) , 5 ml vial , surface & environmental disinfectant each 100 gm contains: ( 1.6 dihydroxy, 2 5 dioxahexane 11.2 g. glutaraldehyde 5.0 g. benzalkonium chloride ip 5.0 g ) , solution , benzocaine ( 0.36% w / w ) , cetrimide ( 0.50% w / w ) 1 packet ( s ) ( 100 gm spray each ) , saline ( benzalkonium chloride 0.01%w / v + sodium chloride 0.65%w / v ) nasal spray 20 ml , methylcobalamin nasal spray 250 mcg / spray ( 5 ml bottle of nasal spray ) , budesonide nasal spray 32 mcg per spray 120 sprays 8.43 ml nasal spray , fluticasone 50mcg / spray ( 70 120 meter dose nasal ) , spray , lignocaine spray 10% ( 100ml ) , spray , absorbable 2 0 endo suture cartridge 48 length , advance rf energy hand instrument of 5 mm shaft diameter for open procedures with shaft length 14 cm and should be both hand and foot activated. compatible with ultrasonic vessel sealing dissector system installed in myh , advance rf energy hand instrument of 5 mm shaft diameter for laproscopicprocedures with shaft length 35 cm and should be both hand and foot activated. compatible with ultrasonic vessel sealing dissector system installed in myh , disposable circular stapler 25 / 26mm diameter , disposable circular stapler 28 / 29mm diameter , disposable trocar 05mm , disposable trocar 10mm , disposable trocar 12mm , disposable trocar 15mm , disposable circular stapler 31mm diameter , disposable circular stapler – 32mm diameter , disposable circular stapler33mm diameter , disposable circular stapleriii rows , disposable clipapplier medium 10mm with 20 clips , disposable clip applier medium 5mm with 16 clips , disposable curved cutter stapler 1.44 mm , disposable curved cutter stapler 2.0 mm , disposable hemorrhoidal stapler 32 mm , disposable hemorrhoidal stapler iii rows , disposable hemorrhoidal stapler stapler 33 mm diameter with detachable anvil ( staple height 3.5 mm ) , disposable linear stapler with fixed staple height 75mm 90mm size , disposable linear stapler with fixed staple height 55mm 60mm size , disposble skin stapler ( 35 pins high quality medical grade plastic, cartridge with ss rectangular design pins with wire diameter 0.60 mm and size after closure ( 7.2 x 4.3 mm ) , consumable , distal tip closure titanium ligation clip large size , distal tip closure titanium ligation clip medium size , distal tip closure titanium ligation clip small size , endoscopic cutter & stapler60mmregular length , endoscopic cutter & stapler60mmlonglength , endosuturing device 10mm with toggle lever , handpiece ( blue ) compatible with ultrasonic vessel sealing dissector system installed in myh , handpiece ( transducer ) compatible with ultrasonic vessel sealing dissectorinstalled in myh , hemorrhoid stapler 33.5 mm diameter with detachable anvil, bridged anoscope, housing of 20 cc , locking clip cartridge medium / large , mesh fixation device with 15 poly ( lactide co glycolide ) absorbable tacks , mesh fixation device with 30 poly ( lactide co glycolide ) absorbable tacks , mesh fixation device with non absorbable titanium tacks 15mm , mesh fixation device with non absorbable titanium tacks 20mm , mesh fixation device with non absorbable titanium tacks 30mm , multifire clip applier long size 15 clip , multifire clip applier small size 20 clip , non absorbable 2 0 endo suture cartridge 48 length , open clip applicator 100 20cm length , open clip applicator 200 20cm length , open clip applicator 300 20cm length , open clip applicator 400 20cm length , partially absorbable mesh with absorable & semi absorbable sides 15cm x 15cm , partially absorbable mesh with absorable & semi absorbable sides 10cm x 15cm , plastic locking clip applicator medium / large , polycearbonte bladeless trocarwith reducer seal 10mm , polycearbonte bladeless trocarwith reducer seal 12mm , polycearbonte bladeless trocar with reducer seal 5mm , polyproplene with polyglecaprone 25 partially absorbable mesh 10cmx 15cm , polyproplene with polyglecaprone 25 partially absorbable mesh 7.6cmx 15cm , reload 55 60mm for medium thick tissue blue compatible with linear cutter. , reload 55 60mm for thin / vascular tissue white compatible with linear cutter. , reload 75 80mm for medium thick tissue blue compatible with linear cutter. , reload 75 80mm for thick tissue green compatible with linear cutter. , reload compatible with curved cutter 40mmx3.5mm , reload endoscopic cutter & stapler45mm purple , reload endoscopic cutter & stapler60mm purple , reload endoscopic cutter & staplter45mm blue , reload endoscopic cutter & staplter45mm green , reload endoscopic cutter & staplter60mm / black , reload endoscopic cutter & staplter60mm blue , reload endoscopic cutter & staplter60mm gold , reload endoscopic cutter & staplter60mm green , reload endoscopic cutter & staplter60mm white , reload forlinear cutter 55mm 60mm size green , reload forlinear cutter 75mm 80mm size blue , reload forlinear cutter 75mm 80mm size green , reload forlinear cutter 90mm 100 mm size green , reload for linear cutter 55mm 60mm size blue , reload for linear cutter 90mm 100 mm size blue , reload for linear stapler with fixed staple height 35mm 45mm size blue , reload for linear stapler with fixed staple height 35mm 45mm size green , reload for linear stapler with fixed staple height 55mm 60mm size blue , reload for linear stapler with fixed staple height 55mm 60mm size green , reusable laparoscopic clip applicator for large titanium clips with 15cm 20cm length , reusable laparoscopic clip applicator for large titanium clips with non detachable jaw assembly , reusable laparoscopic clip applicator for large titanium clips. , reusable laparoscopic clip applicator for medium large titanium clips with28cm 30 cm length , reusable laparoscopic clip applicator for medium large titanium clips with non detachable jaw assembly , reusable linear cutter 55 60mm with 200 firing , reusable linear cutter 75 80mm with 200 firing , skin staple remover with plastic handle , suture locking autolock , titanium clip 100mm , titanium clip 200mm , titanium clip 300mm , titanium clip 400mm , universal reload cartridge for 55 mm / 75mm new linear cutter for tissue thickness ranging from 1 mm to 2 mm with 6 rows of staples 3 on either side of cut line, 440 grade stainless steel knife integrated in the cartridge , 88 titanium staples / 118 titanium staples. , universal stapler 55mm / 75mm new linear cutter along with staple height selector and 3d staple technology with ambidextrous firing with 6 rows of stapler height range of 1.5 mm to 2.00 m. , hemorrhoid stapler 29 34 mm diameter with detachable anvil, bridged anoscope, housing of 20 cc , 11 cell panels for antibody screening & identification , 1pc pedia stoma kit: colostomy / lleostomy 1pcsystem flat transparent open paediatric stoma bag with spiral adhesive, and clip locking drainage. cutablesize 10 to 35mm 5 pc, c shaped hydrocolide elastic tape with bevelled edges 10 pc, water base gaur gum and alcohol free adhesive paste 60gm 1 pc, contain magnesium citrate, glycerine, petrolatum, citric acid skin barrier cream to maintain 5.5 skin ph 1pc, cmc guar gum and xanthan gum base stoma powder 25gm 1pc, hexamethyldisiloxane cyclonentasiloxane and silicone base adhesive remover spray 1pc, silicon based non alcoholic skin barrier spray contain hexamethyldisiloxane cyclonentasiloxane to avoid residues building up by creating theam breathable film on the skin 50ml, cleanser to clean skin exposed to intestinal secretions consist of isopropyl alcohol, allantoin, natural coconut oil 5 pc , 2.2 mm disposable keratome blade , 3 cell panels for antibody screening & identification , 3d hydrocellular microbicidal, composite dressing anti microbial chronic wound dressing, 3d hydrocellular dressing for exudate and moisture management, non adherent for easy removal size: 10cmx10cm , 3d hydrocellular microbicidal, composite dressing anti microbial chronic wound dressing, 3d hydrocellular dressing for exudate and moisture management, non adherent for easy removal size: 15cmx15cm , 3d hydrocellular microbicidal, composite dressing anti microbial chronic wound dressing, 3d hydrocellular dressing for exudate and moisture management, non adherent for easy removal size: 7.5cmx7.5cm , 3d microbicidal composite dressing broad spectrum anti microbial, transparent water proof dressing, non adherent for easy removal size: 10 x 15 cm , 3d microbicidal composite dressing broad spectrum anti microbial, transparent water proof dressing, non adherent for easy removal size: 10 x 20 cm , 3d microbicidal composite dressing broad spectrum anti microbial, transparent water proof dressing, non adherent for easy removal size: 10 x 25 cm , 3d microbicidal composite dressing broad spectrum anti microbial, transparent water proof dressing, non adherent for easy removal size: 10 x 30 cm , 3d microbicidal composite dressing broad spectrum anti microbial, transparent water proof dressing, non adherent for easy removal size: 10 x 35 cm , 3d microbicidal composite dressing broad spectrum anti microbial, transparent water proof dressing, non adherent for easy removal size: 6 x 7 cm , abdominal belt ( 34 inch each ) , consumable , abdominal drain kit sizes :14fg, 16fg, 20fg, 22fg, 24fg , abdominal drain set 28 no. , abdominal drain set 32 no , absorbable gelatine sponge ( ip 80mm x 50mm x 10mm ) , consumable , absorbent cotton wool ip 500 grms ( each ) roll ( iso:13485:2016 ) , consumable , accessory spikes ( 1x1 pis ) , consumable , adhesive plasters usp 7.5 cm x 10 mts / roll , adult diaper size l ( each ) , consumable , ag ion impregnated central venous double lumen polyurethane catheter, 7.5 fr, g 16x18 length 16cm , ag ion impregnated central venous triple lumen polyurethane catheter, 7.5 fr, g 14x18x18 length 16cm , ag ion impregnated triple lumen catheter for haemodialysis, fr 12, l 15cm, with polyurethan extention tube, flow rate per lumen –320 ml / min , ahmed valve drainage device for glaucoma surgery , air bed mattress ( with complete set ) , consumable , air blanket compatible with bair hugger , alcohal based hand sanitizer ( 500ml bottle with dispenser ) , consumable , ambu bag ( silicon type ) paediatrics each 300 500 ml with oxygen connecting tube, should be supplied with a carry pouch, ambu bag should be complete with required autoclavable valves and other accessories ( should have silicon rubber bellow to withstand autoclave at 134 degree c, should be autoclavable upto 40 times ) , consumable , ambu bag / adult each 1000 1700ml, with oxygen connecting tube , should be supplied with a carry pouch , ambu bag should be complete with required autoclavable valves and other accessories, ( ( should have silicon rubber bellow to withstand autoclave at 134 degree c ) should be multiple times autoclavable ) , consumable , anesthesia kit spinal & epidural with balloon indicator lor syringe type 16g / 25g ( 80mm*113mm / 90mm*123mm ) , 18g / 27g ( 80mm*113mm / 90mm*123mm ) , anterior vitrectomy pack for centurion gold phaco machine , anti bacterial coated double lumen central line paediatric , anti bacterial coated foleys catheter 12f , 14f , anti bacterial coated triple lumen central line adult , antibacterial impregnated evd cathetor evd cathetor set and csf collection bag , antimicrobial , liquid parafin based silver sulphate antiseptic tulle 10cmx12cm , antimicrobial double lumen polyurethane cvc catheter kit with rollerson syringe, fr 3 5, g 18x18, l 15 / 16cm. peadiatric , antimicrobial double lumen polyurethane cvc catheter kit with rollerson syringe, fr 5 7, g 18x18, l 15 / 16cm. , anti microbial gloves sterile disposable latex surgical gloves pre powdered conformity surgical rubber gloves meets all the requirements of international and national std.astm d 3577, en 455, iso 10282 & 13422 standard size available 6 , anti microbial gloves sterile disposable latex surgical gloves pre powdered conformity surgical rubber gloves meets all the requirements of international and national std.astm d 3577, en 455, iso 10282 & 13422 standard size available 6.5 , anti microbial gloves sterile disposable latex surgical gloves pre powdered conformity surgical rubber gloves meets all the requirements of international and national std.astm d 3577, en 455, iso 10282 & 13422 standard size available 7 , anti microbial gloves sterile disposable latex surgical gloves pre powdered conformity surgical rubber gloves meets all the requirements of international and national std.astm d 3577, en 455, iso 10282 & 13422 standard size available 7.5 , anti microbial gloves sterile disposable latex surgical gloves pre powdered conformity surgical rubber gloves meets all the requirements of international and national std.astm d 3577, en 455, iso 10282 & 13422 standard size available 8 , antimicrobial incise drape 3 meter , antimicrobial triple lumen polyurethane cvc catheter kit with rollerson syringe, fr 3 5, g 16*18x18, l 15 / 16cm. peadiatric , antimicrobial triple lumen polyurethane cvc catheter kit with rollerson syringe, fr 5 7, g 16*18x18, l 15 / 16cm. , antimicrobial, liquid paraffin based chlorhexidien antiseptic tulle 10cmx12cm , aquacel dressing size 4x4 / 10cmx10xm , armored cuffed tube made of 100% silicon, radio opaque, should have prefilled stylet mounted connector, piot balloon with universal port. size. fr 2, 2.5, 3, 3.5, 4, 4.5, 5, 5.5, 6, 6.5, 7, 7.5, 8, 8.5, 9 should be fda / ce approved , av blood lines with av pressure transducer ( acceptable for fitting to all standard dialyzer ) with side tubing ( for heparinization and av pressure monitorig ) blood tubing set dialysis , baby diapers small ( 10 diaper per pkt ) , consumable , baby drape sheets , backflush blunt tip needle 23 g , backflush soft tip needle 23 g , backflush soft tip needle 25 g , bandage contact lens , barium sulphate powder susp 95% w / v powder ( hd ) 95% 400gm , bhex ring with forcep ( flexible hexagonal plastic ( polyimide ) ring with 75 micron profile having notches at corner and flanges at sides, size 6.5 mm, providing pupillary expansion 5.5 mm ) , bicanalicular ( jacks on ) lacrimal intubation set , bio flat reel 25cmx200 mtr , bionet machine connector , biopsy forceps type with / without spike / hot biopsy, length : 110cm / 160 cm / 210 cm, sterile for single use only, diameter – 1.8 mm / 2.5 mm as ordered , biopsy gun ( 16 20 gauge ) , consumable , bipap mask size large , bipap mask size medium , bipap mask size small , bipolar cable , bipolar cable 12 ft silicone constellation vitrectomy , bipolar cable 12 ft silicone for centurion gold phaco , bipolar cable 12 ft. silicone , bipolar cord with bipolar electyrocautery pencil , bipolar forceps cable , bipolar forceps su coap.steril , bis monitor electrode , black thread ( stitching ) big , bleaching powder gr ii 25 kg bag , blood administration ( transfussion ) set , blood bag double 350 ml cpd solu , blood bag double 350 ml with sagam , blood bag double 350ml ( as per attached specification ) , each , blood bag quadruple 350 ml top bottom with cpd sagam solu , blood bag quadruple 450 ml top bottom with cpd sagam solu , blood bag single 350 ml , blood bag top to bottom quadruple 450 ml , blood bag transfer 350 ml , blood bag triple 350ml as per attached specification ( each ) , bag , blood bag triple sagam 350ml ( each ) , bag , blood collection tube clot activator with rubber cap 13x75 , blood culture bottle ( glass autoclavable 100ml ) , consumable , blood pressure cuff adult 25cm 40cm , blood pressure cuff pediatric 19cm 27.5cm , blood transfusion set double moldedchamber without airway , blood transfusion set single molded chamber without airway , bone marrow aspiration needles ( 13g ) , bone marrow aspiration needles ( 14g ) , bone marrow aspiration needles ( 15g ) , bone marrow aspiration needles ( 16g ) , bone marrow biopsy needle 13g , bone marrow biopsy needle size 11gx10cm , bone wax sterilised ( 2.5 gm / packet ) , consumable , calcium hypochlorite containing not less than 0.25% w / v of available chlorine buffered with boric acid ( 1:1 ) to a ph of 7.5 8.5 solution , cannula fixer set , carbolic acid 500 ml , cardiovascular angiographic catheter 100cm, 4fr ( 1.35mm ) , c arm cover disposable , catheter double lumen7.7 no , catheter mount ( adult size ) , consumable , catheter mount ( pediatric size ) , consumable , catheter single lumen4.7 no , catheter single lumen6.6 no , catheter single lumen7.7 no , cautery pencil disposable ( each ) , consumable , cautery plate disposable ( each ) , consumable , central line double lumen 16 fr , central line single lumen , central venous catheter 4fr , cerebral catheter reservoir 12mm dia chamber , cerebral catheter reservoir 18mm dia chamber , cerebral catheter reservoir large 18mm diameter chamber , cerebral catheter reservoir small 12mm diameter chamber , cervical collar soft , chemical enzyme based cleaner non ionic, amphoteric surfactants, solvents, complexing agents, amino acid derivative, corrosion inhibitors, anti foaming agent , chest drainage catheter size: fg20 to fg40 , chest drainage catheter size: fg20 to fg40 with trocar , chlorhexidine antiseptic sterile gauze dressing 10 cm x 10 cm ( 10 pouches ) gauze , chlorhexidine gluconate dressing material , circular stapler for end to end anastomosis with 31 mm diameter having varied staple height of 3.5 4 4.5mm , circular stapler for end to end anastomosis with 31 mm diameter having varied staple height of 4 4.5 5mm , circular stapler for end to end anastomosis with 33 mm diameter having varied staple height of 3.5 4 4.5mm , circular stapler for end to end anastomosis with 33 mm diameter having varied staple height of 4 4.5 5mm , cling drape drape size: 15 x 500 cm. , closed suction tracheostomy suction tube with pros , collagen patch , collagen sheet , colostomy kit , combined pack of iol , keratome2.2 / 2.8 mm , sideport blade 1.2 mm, balanced salt solution, viscoat, disposable cassette with 45 degrees flared phacotip with sleeve , iol cartridge , condom catheter , contured titanium mesh for cranioplasty 15x12cm , cord clamp , corrugated drainage sheet , cotton crape bandage 05cm x 4m ( box of 10 bandages ) ( no. ) , consumable , cotton crape bandage 10cm x 4m ( box of 10 bandages ) ( no. ) , consumable , cotton crape bandage 15cm x 4m ( box of 10 bandages ) ( no. ) , consumable , cr system digital film ( size 10x12 ) carestream, consumable , cr system digital film ( size 14x17 ) carestream, consumable , cr system digital film ( size 8x10 ) carestream, consumable , craniotomy cutter blade , craniotomy drape ( 1.6 x 3.2 mtrs ) , craniotomy drape sheet size 2.6x3.6 m, 50gsm , cresol with soap solution ip ( 5 liter jar ) , consumable , cvc line double lumen polyurethane catheter ( flexon material ) with bls introducer and nitinol j guide wire, 7fr, g 16x16 length 15cm , cvc line triple lumen polyurethane catheter ( flexon material ) with bls introducer and nitinol j guide wire, 7.5 fr, g 14x18x18, length 15cm, 20cm ( anti microbial coated ) , cvl dressing07 cm x 8.5 cm for central line , cvl dressing10 cm x 12 cm pad for central line , cvp ( central venous pressure ) manometer , cylinder connection nut , cylinder key , cylinder spanner , d.j. stent ( 3 fr ) , ( 4 fr ) , ( 5 fr ) , ( 6 fr ) , consumable , dermatome blades 50 mm , dialyzers 1.5 / 1.6 multiple use made of polysulphone or polyethersulfone low / middle flux, hi performance dialyser performance enhanced technology with hi biocompatibility housed in medical grade polycarbonate openable ends for easy cleaning caps ( for dialysate inlet utlet for safer storage openable caps ( red and blue ) hi quality sterilisation procedure using gamma radiation and should meetings standards of european ce / iso13485:2003sterlised ) , consumable , diathermy probe 25 g constellation vitrectomy , differential pressure flow sensor for savina 300 drager ventilator , dispoable raney clip strelized pack of 10 nos , disposable c arm cover , disposable camera cover , disposable curved scissor 23 g , disposable endgrasping forcep 23 g , disposable eye drape 120x120 nonwooven precut with drainage pouch , disposable eye drape 70x70 nonwooven precut with drainage pouch , disposable eye shield u / v light protector for infants & neonates. sterile single pack. , disposable haemorrhoidal circular stapler with dual safety with transparent housing size 34 , disposable hiv kit sterile:full gown 1 ( wrap around gown made water ressistant ) ( disposable bag 1, 120x210 cm plain sheet large 1, water proof lagging 1 pair, cap 1, mask 1, sterile rubber gloves 1 pair, goggle 1pc. ) , consumable , disposable ilm forcep 23 g , disposable ilm forcep 25 g , disposable iris retractor , disposable membrane scraper 23 g , disposable membrane scraper 25 g , disposable microscope cover , disposable n 95 mask , disposable needle 18g ( single use ) , disposable needle 18g x 1 1 / 2 ( single use ) , disposable needle 20g ( single use ) , disposable needle 22g ( single use ) , disposable needle 23g ( single use ) , disposable needle 24g ( single use ) , disposable needle no 26g x 1 1 / 2 , disposable needle no 26g x 1 / 2 , disposable paper gloves size 7, 7.5, 8 , disposable perforator with hudson end 12 mm , disposable phaco set for cnturion gold phaco machine , disposable phaco set with phaco tip and sleevefor cnturion gold phaco machine , disposable plastic appron ( full size ) , consumable , disposable plastic apron material 25 microne polyethylene , disposable shoe cover , disposable shunt drepe size 120x210 cm, incise area 70x15 cm , disposable soft tip needle 23 g , disposable spinal needle 18 , disposable spinal needle 22 , disposable spinal needle 23 , disposable spinal needle 24 , disposable spinal needle 25 , disposable sterile gloves bis specification gloves, surgical rubber, made of hypoallergic latex 100%, electronically tested sterilized by gamma irradiatio eto is no:13422:1992 as amended upto , 7 inch / pair ( pair ) , consumable , disposable sterile gloves bis specification gloves, surgical rubber, made of hypoallergic latex 100%, electronically tested sterilized by gamma irradiatio eto is no:13422:1992 as amended upto , 7.5 inch / pair ( pair ) , consumable , disposable sterile gloves bis specification gloves, surgical rubber, made of hypoallergic latex 100%, electronically tested sterilized by gamma irradiatio eto is no:13422:1992 as amended upto , 8 inch / pair ( pair ) , consumable , disposable sterile gloves bis specification gloves, surgical rubber, made of hypoallergic latex 100%, electronically tested sterilized by gamma irradiatio eto is no:13422:1992 as amended upto , 6.5 inch / pair ( pair ) , consumable , disposable sterile gloves isi marked surgical rubber made of hypoallergic latex 100% , electronically tested sterilized by gamma irradiation / eto is no:13422:1992 as amended upto, powder free 7 inch / pair ( pair ) , consumable , disposable sterile gloves isi marked surgical rubber made of hypoallergic latex 100% , electronically tested sterilized by gamma irradiation / eto is no:13422:1992 as amended upto, powder free 8 inch / pair ( pair ) , consumable , disposable sterile gloves isi marked surgical rubber made of hypoallergic latex 100% , electronically tested sterilized by gamma irradiation / eto is no:13422:1992 as amended upto, powder free6.5 inch / pair ( pair ) , consumable , disposable sterile gloves isi marked surgical rubber made of hypoallergic latex 100% , electronically tested sterilized by gamma irradiation / eto is no:13422:1992 as amended upto, powder free7.5 inch / pair ( pair ) , consumable , disposable sterile gown , disposable suction catheter all size , disposable surgeon cap ( box of 100 caps ) , consumable , disposable three layer surgical mask , disposable trolly drape 18x120 cm , disposable trphine 10 , disposable trphine 10.5 , disposable trphine 11 , disposable trphine 11.5 , disposable trphine 12 , disposable trphine 13 , disposable trphine 3 , disposable trphine 6 , disposable trphine 6.5 , disposable trphine 7 , disposable trphine 7.5 , disposable trphine 8 , disposable trphine 8.5 , disposable trphine 9 , disposable trphine 9.5 , disposable wrap around ot gown with 2 nos hand towel , distilled water 5 litre ( each ) , consumable , dj stent / double j stents size 3fr 7fr, 10 26cm , dome valve hydrocephalous shunt system bacterial resistant high pressure , dome valve hydrocephalous shunt system bacterial resistant low pressure , dome valve hydrocephalous shunt system bacterial resistant medium pressure , dome valve hydrocephalous shunt system high pressure , dome valve hydrocephalous shunt system low pressure , dome valve hydrocephalous shunt system medium pressure , double lumen peripherally inserted central venous silicon catheter ( 7fr, 9fr, 11fr, 14fr ) length 90cm, with subcutaneous cuff for long term venous access , double lumen peripherally inserted central venous silicon catheter ( 3fr, 4fr, 4.5fr, 5fr ) length 60cm , drap sheeth 120cm x 210cm sterile , draw sheet ( each ) , consumable , dry collagen patch , non adhesive absorbalbe porus lyophilized fish origin collogen 10x10cm. , dry collagen patch , non adhesive absorbalbe porus lyophilized fish origin collogen 30x30cm. , dura repair patch made of poly propylene non woven extra large 15x20cm , dura repair patch made of poly propylene non woven large 10x12cm , dura repair patch made of poly propylene non woven small 8x10cm , ear buds ( plastic one ) , ear cotton swab ( each ) , consumable , ecg electrodes ( each ) , consumable , ecg paper computerized triple channel 20m , ecg paper roll 210 mm x 20 mtr ( each ) , consumable , ecg paper roll 80 mm x 20 mtr ( each ) , consumable , elastic adhesive bandage 10cm x 4 , elastic adhesive bandage 10cm x 6 , elastomeric pump for post operative analgesia , electrocautery plate , emg ( electromyography ) needle , endo stich lap suturing device 10 mm , endo stitching / suturing instrument, endo suturing instruments for endoscopic suturing and knot tying, with one handed operation along with easy needle transfer between jaws. maximum jaw opening of 19 mm with an option to hold different sutures. should fit through a 10 mm trocar , endocapsular ring ( capsular tensionring ) 11mm , endocapsular ring ( capsular tensionring ) 12mm , endocapsular ring ( capsular tensionring ) 13mm , endoscopic suture product endo stitch 10 mm cartidges, disposable suture loading units for endostitch instrument with sizes of 2 0 endostitch and 2 0 , endotracheal tube cuffed size 3 , endotracheal tube cuffed size 3.5 , endotracheal tube cuffed size 4 , endotracheal tube cuffed size 5 , endotracheal tube cuffed size 6 , endotracheal tube cuffed size 6.5 , endotracheal tube cuffed size 7 , endotracheal tube cuffed size 7.5 , endotracheal tube cuffed size 8 , endotracheal tube cuffed size 8.5 , endotracheal tube cuffed size 9 , endotracheal tube cuffed size 9.5 , endotracheal tube introducer ( bougie ) adult 5 , endotracheal tube with secondary lumen for surfactant therapy, size 2, 2.5, 3, 3.5, 4, 4.5 , endotracheal tubes plain without cuff size 2, 2.5, 3, 3.5, 4, 4.5 , epidural kit ( needle & catheter 16g, ) , epidural kit ( needle & catheter 18g ) , epidural kit ( needle & catheter 19g, ) , epidural needle 16g, 18g ( each ) , consumable , eto chemical indicator , eto gas cartridges , eto tape indicator , examination gloves size large ( 100 pcs / pkt ) , examination gloves size medium ( 100 pcs / pkt ) , examination gloves size small ( 100 pcs / pkt ) , exchange transfusion catheter with four way adaptor size 4 cm, l 40 cm , extarnal lumber cfs drainage system , extarnal ventricular cfs drainage system , extention line ( 10 cm ) , consumable , extention line ( 100 cm ) , consumable , extention line ( 150 cm ) , consumable , extention line ( 200 cm ) , consumable , extention line ( 50 cm ) , consumable , extra ventricular drain ( evd ) , eye shield transperant , feeding tube size 3, 4, 5, 6, 7, 8 , feeding tube size 9, 10, 12, 14 , fibrin glue , films of size 10x12 inches compatible films to dr system ( 10x12 inches ) , prognosys medical systems film , films of size 11x14 inches compatible films to dr system ( 11x14 inches ) , prognosys medical systems film , films of size 14x17 inches compatible films to dr system ( 14x17 inches ) , prognosys medical systems film , films of size 8x10 inches compatible films to dr system ( 8x10 inches ) , prognosys medical systems film , flexo metallic tube no. 6, 6.5, 7, 7.5, 8, 8.5 , flourescein strips , flow sensor for bellavista ventilator , fluorescein strips pkt , foam sclerotherapy fibre , fogarty embolectomy catheter, size: 4fr , fogharty catheter ( size 20 two way ) , consumable , foleys catheter 3 way 22 size , foleys catheter latex based baloon capacity ( 30 50ml ) three way ( a ) fg 16, 18, 20, 22 , foleys catheter size 12 2 way ( 10 each ) , consumable , foleys catheter size 14 2 way , foleys catheter size 16 2 way ( 11 each ) , consumable , foleys catheter size 18 2 way , foleys catheter size 20 2 way ( 12 each ) , consumable , foleys urinary catheter pediatrics ( size 8 10 ) , each , forcep for raney clip , fuji digital film ( size 10x12 ) , consumable , fuji digital film ( size 11x14 ) , consumable , fuji digital film ( size 14x17 ) , consumable , fuji digital film ( size 8x10 ) , consumable , gasket forvaccume jar 1000 ml , gasket forvaccume jar 600 ml , gasket for humidifier bottel , gigli saw wire , glass slide iso mark no 12mm , glass tube 125x150 , glucometer strips pkt ( 50 strip / pkt ) , guedel airway all size soft and smooth , guide wire 0.35 no , guide wire 0.38 no , guide wire 150cm staight tip , guide wire 80cm. , guidewire lengths: 50 cm 0.035? ( 0.89 mm + 0.01 mm ) * / 0.038? ( 0.97 mm + 0.02 mm ) * , h2o2 catridge , halogen bulb holder ( heavy duty ) , hemodialysis fluid for bicarb made ( part a 10 ltr + part b 500gm ) , hernia flat mesh size: 10x15 , hernia flat mesh size: 15x15 , hernia flat mesh size: 15x20 , hernia flat mesh size: 3x5 , hernia flat mesh size: 6x6 , hip u drape * hygiene sheet * adhesive, size 180 x160 , hme filter , humbysknife disposable blade , hydrocephalous shunt system bacterial resistant high pressure , hydrocephalous shunt system bacterial resistant low pressure , hydrocephalous shunt system bacterial resistant medium pressure , hydrocephalous shunt system high pressure , hydrocephalous shunt system low pressure , hydrocephalous shunt system medium pressure , hydrocephalus shunt medium pressur ( vp shunt ) , hyperextension bracemedium size , icd bag 1000 ml with trocar adult size , icd bag 1000 ml with trocar pediatric size , implantable pain port with epidural catheter for long term pain management , impregnated antimicrobial latex two way foleys catheter with silicon coated.it should be impregnated with silver nano particles to prevent catheter associated uti and catheter blockage should have strong drainage funnel, double fixed non return valve for free inflation and deflation. size 14 balloon capacity between 1ml to 30ml, 50ml , impregnated antimicrobial latex two way foleys catheter with silicon coated.it should be impregnated with silver nano particles to prevent catheter associated uti and catheter blockage should have strong drainage funnel, double fixed non return valve for free inflation and deflation. size 16 balloon capacity between 1ml to 30ml, 50ml , impregnated antimicrobial latex two way foleys catheter with silicon coated.it should be impregnated with silver nano particles to prevent catheter associated uti and catheter blockage should have strong drainage funnel, double fixed non return valve for free inflation and deflation. size 18 balloon capacity between 1ml to 30ml, 50ml , impregnated antimicrobial latex two way foleys catheter with silicon coated.it should be impregnated with silver nano particles to prevent catheter associated uti and catheter blockage should have strong drainage funnel, double fixed non return valve for free inflation and deflation. size 20 balloon capacity between 1ml to 30ml, 50ml , impregnated antimicrobial latex two way foleys catheter with silicon coated.it should be impregnated with silver nano particles to prevent catheter associated uti and catheter blockage should have strong drainage funnel, double fixed non return valve for free inflation and deflation. size 22 balloon capacity between 1ml to 30ml, 50ml , impregnated antimicrobial latex two way foleys catheter with silicon coated.it should be impregnated with silver nano particles to prevent catheter associated uti and catheter blockage should have strong drainage funnel, double fixed non return valve for free inflation and deflation. size 24 balloon capacity between 1ml to 30ml, 50ml , impregnated antimicrobial latex two way foleys catheter with silicon coated.it should be impregnated with silver nano particles to prevent catheter associated uti and catheter blockage should have strong drainage funnel, double fixed non return valve for free inflation and deflation. size 26 balloon capacity between 1ml to 30ml, 50ml , infant mucus extractor sterile pvc ( each ) , surgical material , insulin syringe sterile disposable each ( graduation upto 100 units ) 30g needle ( 40 units / ml ( 30 g needle, 40units / ml ) ) , syrings , intraocular lens 14 30d dioptre , intravenous set with airway and needle ( ( adult ) ) , surgical material , intravenous set with airway and needle ( ( pediatric ) ) , surgical material , intrepid i / a tip bent , intrepid i / a tip straight , introducer sheath 0.97mm, 7 fr, ( 2.3mm ) , 11cm , introducer sheath 6fr , iodine drape with frame size 30x25 cm , iodine drape with frame size 35x35 cm , iodine drape with frame size 60x45 cm , iris claw iol ( pmma lens optic size 5 5.5mm overall size 8 9mm without any dialing hole, biconvex ) , iv cannula size with injection valve ( port ) ( 16g ) , consumable , iv cannula size with injection valve ( port ) ( 18g ) , consumable , iv cannula size with injection valve ( port ) ( 20g ) , consumable , iv cannula size with injection valve ( port ) ( 22g ) , consumable , iv cannula size with injection valve ( port ) ( 24g ) , consumable , iv cannula size with injection valve ( port ) ( 26g ) , consumable , iv regulator set ( control drop set each ) , consumable , j r c bag 1 ltr , j r c bag 1.5 ltr , j r c bag 500 ml , j tip 0.035 mm guidewire , jugular catheter ( 12fr ( adult ) ) , consumable , jugular catheter ( 8fr ( pediatric ) ) , consumable , k3 blood vaccutainer ( edta 100 tubes / pkt ) , consumable , k 90 catheter ( each ) , consumable , kellys pad disposable , lamino spinal drape sheet size 1.5x3 m, 50 gsm , laryngeal mask airway ( lma ) ( no. 4 ) , consumable , laryngeal mask airway ( lma ) ( no. 5 ) , consumable , laryngeal mask airway classic size 1, 1.5, 2, 2.5, 3, 4, 5 , laser radial fibre 600 micron and 400 micron , liga clip 200mm, 300mm, 400mm , lissamine green strip , litmus paper strip , liver biopsy gun size 19g , lma reusable pro seal second generation with gastric drain tube and reinforcement airway tube. size 1, 1.5, 2, 2.5, 3, 4, 5. , long length quincke spinal needle for pain management, size – g 22, length – 120mm & 150mm , loop nylon suture black monofilament 1 ( 4.0 metric ) 96 ( 244 cm ) tp 1 65mm 1 / 2c taper , low adherent absorbent wound dressing with a polyester perforated wound contact layer size 50cm 7mtr roll , lung exersizer ( each ) , consumable , mackintosh double colour water proof roll ( 20 meter per roll ) , malecot rubber catheter no 12 , malecot rubber catheter no 16 , malecot rubber catheter no 20 , malecot rubber catheter no 22 , malecot rubber catheter no 24 , medical dry imaging film size 10x12 , medical dry imaging film size 14x17 , medical dry imaging film size 8x10 , megil forcep with stylet adult size 5 set , mesure volume set soft chamber, with bulb latex 110ml , methacrylate based oxygen permeable non adherent 3 dimensional transforming powder dressing size 4 x 4 , micro drip set with bulb latex , micro vitreo retinal blade 20 g , microlaryngeal surgery tube no 5 , microsensor basic kit for icp monitor , mio 1 pc flat base colostomy ki: colostomy / lleostomy 1pc system flat transparent stoma bag with body fit additional elastic adhesive technology ( elastic modulus 0.34 n / mm ) , bag consists one barier foil a oekotex certified and a woven water repellent textile grey colour material. triple layer filter with full circle pre filter and three times fold velcro locking drainage. one side transparent for inspection cutable size 10 to 55mm 5 pc, c shaped hydrocolide elastic tape with bevelled edges 10pc, water base gaur gum and alcohol free adhesive paste 60gm 1 pc, contain magnesium citrate, glycerine, petrolatum, citric acid skin barrier cream to maintain 5.5 skin ph 1pc, cmc guar gum and xanthan gum base stoma powder 25gm 1pc, hexamethyldisiloxane cyclonentasiloxane and silicone base adhesive remover spray 1pc, silicon based non alcoholic skin barrier spray contain hexamethyldisiloxane cyclonentasiloxane to avoid residues building up by creating theam breathable film on the skin 50ml, cleanser to clean skin exposed to intestinal secretions consist of isopropyl alcohol, allantoin, natural coconut oil 5 pc , mio 2pc system convex base colostomy kit: colostomy / lleostomy 60 mm aperture light convex with integrated flex line base plate with body fit technology additional elastic adhesive ( triple layer ) and with 4 ears belt lock 5 pc, woven water repellent textile material neutral grey colour for optimal discretion 60 mm stoma transparent bag consists one barrier foil and a oekotex certified with full circle filter and wave shaped locking with highlighted colour lock button 5 pc, neutral grey colour standard size ostomy belt compatible for bags having 4 ear hooks 1 pc, c shaped hydrocolide elastic tape with bevelled edges 10 pc, waterbase gaur gum and alcohol free adhesive paste 60gm 1 pc. contain magnesium citrate, glycerine, petrolatum, citric acid skin barrier cream to maintain 5.5 skin ph 1pc, cmc guar gum and xanthan gum base stoma powder 25gm 1pc, hexamethyldisiloxane cyclonentasiloxane and silicone base adhesive remover spray 1pc, silicon based non alcoholic skin barrier spray contain hexamethyldisiloxane cyclonentasiloxane to avoid residues bulding up by creating theam breathable film on the skin 50ml, cleanser to clean skin exposed to intestinal secretions consist of lsopropyl alcohol, allantoin, natural coconut oil 5 pc , mio 2pc system convex base colostomy kit: colostomy / lleostomy 70 mm aperture light convex with integrated flex line base plate with body fit technology additional elastic adhesive ( triple layer ) and with 4 ears belt lock 5 pc, woven water repellent textile material neutral grey colour for optimal discretion 60 mm stoma transparent bag consists one barrier foil and a oekotex certified with full circle filter and wave shaped locking with highlighted colour lock button 5 pc, neutral grey colour standard size ostomy belt compatible for bags having 4 ear hooks 1 pc, c shaped hydrocolide elastic tape with bevelled edges 10 pc, waterbase gaur gum and alcohol free adhesive paste 60gm 1 pc. contain magnesium citrate, glycerine, petrolatum, citric acid skin barrier cream to maintain 5.5 skin ph 1pc, cmc guar gum and xanthan gum base stoma powder 25gm 1pc, hexamethyldisiloxane cyclonentasiloxane and silicone base adhesive remover spray 1pc, silicon based non alcoholic skin barrier spray contain hexamethyldisiloxane cyclonentasiloxane to avoid residues bulding up by creating theam breathable film on the skin 50ml, cleanser to clean skin exposed to intestinal secretions consist of lsopropyl alcohol, allantoin, natural coconut oil 5 pc , mio 2pc system convex base urostomy kit: urostomy 50mm 2pc system 6 mm aperture light convex plate with integrated flex line base plate with body fit technology additional elastic adhesive ( triple layer ) and with 4 ears belt lock 5 pc, 50 mm transparent bag, consists one barrier foil and a non woven water repellent textile grey colour material. soft locking drainage. audible click sound locking system with highlighted colour lock button. coupling with wave shaped locking bag. one side transparent for inspection. size 50mm 5 pc, neutral grey colour standard size ostomy belt compatible for bags having4 ear hooks 1pc, c shaped hydrocolide elastic tape with bevelled edges 10 pc, water base gaur gum and alcohol free adhesive paste 60gm 1 pc, contain magnesium citrate, glycerine, petrolatum, citric acid skin barrier cream to maintain 5.5 skin ph 1pc, cmcguar gum andxanthan gum base stoma powder 25gm 1pc, hexamethyldisiloxane cyclonentasiloxane and silicone base adhesive remover spray 1pc, silicon based non alcoholic skin barrier spray contain hexamethyldisiloxane cyclonentasiloxane to avoid residues building up by creating theam breathable film on the skin 50ml, cleanser to clean skin exposed to intestinal secretions consist of isopropyl alcohol, allantoin, natural coconut oil 5 pc , monopolar cautry wire disposable , monopolar electrocautery pencil with cord , mucus extractor with connector for bronchoscope capacity 70 ml , multienzymatic instrument cleaner concentrate with protease, lipase, amylase, cellulase disinfection solution ( 1 litre solution ) , multifocal / trifocal foldable iol , multifunctional mask with the attachment of nebulizer mask, venture mask, oxygen mask, aerosol mask, with 7 oxygen tube.adult and paediatric. , naso pharyngeal airway adult all size , naso pharyngeal airway paediatric all size , natural hydrowxyapatite wirh natural collagen block size 30x15x6mm , natural hydrowxyapatite wirh natural collagen block size 30x15x7mm , natural hydrowxyapatite wirh natural collagen block size 30x15x8mm , nebulization mask kit ( pediatrics ) , consumable , nebulization mask kit ( adult ) , consumable , needle 30g 1 / 2 inch bd , neonatal urine collection and measurement bag 100 ml , nitrile gloves size small / medium / large ( each ) , consumable , non absorbalble surgical suture , sterilised surgical needled suture ( coated braded polyster green ) 45cm oph 5 0 8mm 1 / 4 circle spatulated micropoint double , non oxidized, non regenarated cellulose hemostat 10x10cm , non oxidized, non regenarated cellulose hemostat 5x10cm , non oxidized, non regenarated cellulose hemostat 5x7.5cm , non oxidized, non regenarated cellulose hemostat 8x100cm , non oxidized, non regenarated cellulose hemostat 8x20cm , non rebreathing mask ( oxygen mask with reservoir bag ) , consumable , non sterile surgical rubber gloves 6.5 no. ( pair ) ( made of natural latex micro rough finish for better grip ) , consumable , non sterile surgical rubber gloves 7 no. ( pair ) ( made of natural latex micro rough finish for better grip ) , consumable , non sterile surgical rubber gloves 7.5 no. ( pair ) ( made of natural latex micro rough finish for better grip ) , consumable , ommaya resrvoir small , ommaya reswervoir large , one piece flat colostomy trp bag: one piece flat colostomy bag body fit additional elastic adhesive technology ( elastic modulus 0.34 n / mm ) , bag consists one barrier foil and a oekotex certified water repellent textile neutral grey colour material. triple layer filter with full circle pre filter and three times fold velcro locking drainage. one side transparent. experience of managing stoma care clinic. , open disposable clip applier for medium clip size 9.75 having 20 clips , open linear cutter reload with 3 rows of staple line having varied satple height of 3.5 4 4.5 mm in reload having 60mm length , open linear cutter reload with 3 rows of staple line having varied satple height of 4 4.5 5 mm in reload having 60mm length , open linear cutter stapler compatible with 3 rows of staple line having varied satple height of 3.5 4 4.5 mm in reload having 60mm length , open linear cutter stapler compatible with 3 rows of staple line having varied satple height of 4 4.5 5 mm in reload having 60mm length , ophthalmic mvr blade 20 g , ophthalmic mvr blade 23 g , oxygen adaptor 5 type , oxygen catheter , oxygen connection with flow meter for central line , oxygen connection with flow meter for cylinder , oxygen high pressure hose pipe , oxygen mask adult ( standard size ) , mask , oxygen mask pediatrics ( standard size ) , mask , oxygen penal regulator for oxygen liquied tank ( 1 25 kg ) , oxygen regulator for control penal board ( oxygen pipe line ) , oxygen regulator for jambo cylender , oxygen tailpipe ( flexible metalic ) , p t tubes 3.8% sodium citrate ( prothrombin tube ) , pacing leads 6 fr , paediatric double lumen polyurethan cvc line, 3 fr, l 10cm, 15cm, , paediatric double lumen polyurethane cvp catheter, 4.5 fr, g – 20x20 length – 6cm, 12.5cm , paediatric epidural set ( with 19g needle with matel stylet 22g catheter 0.22 micron epidural catheter andsyringes , paediatric triple lumen polyurethan cvc line with nitinol j guide wire, 4.5 fr, g 20*23*23, l 6cm, 8cm, 10cm, 12.5cm , paper adhesive plaster microporous surgical tape 2inch x 10mt roll , paper adhesive plaster microporous surgical tape 3inch x 10mt roll , paper adhesive plaster microporous surgical tape 4inch x 10mt roll , paper adhesive plaster microporous surgical tape 6inch x 10mt roll , paraffin gauze dressing 10cms x10cms , pec haemostatic patch for post renal dialysis size 5cm x 7cm , pediatric ventilator circuit complete set , peripheral inserted central catheter 4 fr , peripheral inserted central catheter 5 fr , peritonial dialysis catheter 200mm pediatric , peritonial dialysis catheter 280mm adult , peritonial dialysis fluid 1ltr. , pigtail catheter 6 fr ( 150 cm ) , pigtail catheter no 10 , pigtail catheter no 14 , plain sheet material 25 micron thick pe hygiene film size 210x120 cm , plain vial with screw cap size 12x75 , plaster of paris bandage 10 cm x 2.7 mtr / roll ( roll ) , bandage , plaster of paris bandage 15cm x 2.7mtr / roll ( roll ) , bandage , plaster of paris powder ( 1 kg ) , consumable , plastic nozel cap , plastic test tube 3 , post exposure prophylaxis kits ( pep kits ) , presbyopic correcting iol , pressure regulated v p shunt , probe for oxygen , programable valve with variable pressure settings ranges from 30 m h20 to 200 cm h20 and having interval of10 cm h20. should supply ventricular cathetor 14 cm long and distal cathetor 120 cm long , proseal lma ( plma ) size 1, 1.5, 2, 2.5, 3, 4, 5 , pulmonary artery catheter , punctual plug large , punctual plug medium , punctual plug small , pva sheets , radial a catheter , rectified sprit 4.5 ltr. , reinforced epidural wired polyurethane catheter kit with stainless steel needle. size catheter 19g, needle 17g. , reservoir large size , retina laser pack 23 g straight constellation vitrectomy , rose bengal dye strip 500 , ryles tube size 10, 12, 14, 16, 18 , scar free silicon nasal pad , scleral buckle no 276 , scleral buckle no 277 , scleral buckle no. 240 , scleral fixated iol , scrotal support size: ?xl ( 46 52 ) inches adult , self adhering silicon external catheter should be built in band, clear odorless single sterilized pack, 100% latex free. size 25 / 29 / 32 / 36 / 41mm. , semi automatic core biopsy instrument set with 2 throw length of 10 mm and 20 mm in a single device along with a throw length indicator window and a fire ready indicator mark compatible adjustable coaxial and a blunt tip stylet. should be usfda approved 18g*10cm, 18g*16cm & 18g*20cm, 20g*10cm, 20g*16cm , shirmers strip , short catheter with straight / j tip guide wire ( l 20, fr 2, g 22 ) , short pencil point spinal needle g 25 / 22, l 38mm. , should have dual hook for zero migration post deployment should have the option of repositioning after deployment should have dustable twisted wire construction for durability. 20g*107mm , sics kit ( small incision cataract surgery ) , silicon / double nasal prong with universal connector. all sizes , silicon cautery plate , silicon drain tube / chest tube securement device all size , silicon mask size 0, 1, 2, 3, 4 & 5 , silicone foley catheter 2 way 12 fr , silicone foley catheter 2 way 14 fr , silk protein and antimicrobial nano silver based sterile surgicalwound dressing sheet 10 cmx 25 cm , silk protein and antimicrobial nano silver based sterile surgicalwound dressing sheet 20 cmx 25 cm , silk protein and antimicrobial nano silver based sterile surgicalwound dressing sheet 20 cmx 40 cm , silk protein and antimicrobial nano silver based sterile surgical mesh wound dressing 10 cmx 25 cm , silk protein and antimicrobial nano silver based sterile surgical mesh wound dressing 20 cmx 25 cm , silk protein and antimicrobial nano silver based sterile surgical mesh wound dressing 20 cmx 40 cm , silk protein and antimicrobial nano silver based sterile surgical pu foam dressing 10 cmx 10 cm , silk protein and antimicrobial nano silver based sterile surgical pu foam dressing 20 cmx 20cm , silk protein based sterile surgicalwound dressing sheet20 cmx 40 cm , silk protein based sterile surgical pu foam dressing 20cmx20cm , silkolatex nasopharyngeal airway, with adjustable flange and widen end. sterilizedsizes 20, 22, 24, 26, 28, 30, 32, 34, 36 fr , single piece aspheric foldable iol hydrophobic acrylic hydrophobic acrylic, aspheric, single piece foldable, uv absorbing with blue light filter, 13mm length, 6.0mm optic diameter anterior asymmetric biconvex optic, l shape stable force planar haptic 0.04% covalently bonded yellowchromophore refractive index 1.46 1.55 compatible injector system a constant 118 118.8 , single piece hydrophobic acrylic foldable iol uv absorbing posterior chamber iol with haptic 13.0mm, biconvex6.00mm optic, refractive index 1.46 1.55, a constant 118 118.8 , single piece preloaded foldable iol preloaded with 2 2.2mm delivery port and depth guard controlled by tension glide plunger with hydrophobic acrylic foldable, aspheric , single piece , uv absorbing with blue light filter , 13mm length , 6.0mm optic diameter anterior asymmetric biconvex optic, l shape stable force planar haptic, 0.04% covalently bonded yellowchromophore, refractive index 1.46 1.55, us fda approved. a constant 118 118.8 , single use clip applier with 16 clips, 5mm diameter having display counter instrument u shaped clip , skin protective sheet 20mx20m: skin barrier for healthy peristomal skin or risk of skin damage due to badly secretions or skin damage already developed consist of polyethylene, plasticizer, polyamide, artificial resin, cmg, sis ( 20cm20cm ) , soda lime for anesthesia workstation 5kg , soft roll 15cm x 3 meter , spatula for papsmear , spring loaded automatic biopsy gun one handed cocking machanism with non roll handle design. angle sample notch for enhance needle action choice of two firing buttons.should be usfda approved 16g* 10cm, 16g* 16 cm, 18g* 10cm, 18g* 16cm, 18g* 20cm, 18g* 25cm , stellate for e.t. tube , sterilant cold disinfectant for dialysis containing peraetic acid hydrogen peroxide acetic acid 5 ltr. , sterile adhesive iodine drape size: 35x44 cm , sterile adhesive iodine drape size: 45x66 cm , sterile alcohol swabs , sterile disposable syringe 1ml , sterile disposable syringe with needle 2ml , sterile disposable syringe with needle 3 ml , sterile disposable syringe with needle 5ml , sterile gauze swab / pad , sterile hypodermic syringe with needle 10ml , sterile hypodermic syringe with needle 20ml , sterile hypodermic syringe with needle 50ml , sterile leur lock syringe 20ml , sterile leur lock syringe 50ml , sterile luer lock syringe 10 ml , sterile luer lock syringe 5 ml , sterile wet eye wipes , sterlization roll for plasma sterlizer 100 mm , sterlization roll for plasma sterlizer 150 mm , sterlization roll for plasma sterlizer 250 mm , subcutaneous catheter passer adult , subcutaneous catheter passer pediatric , suction pro kit for closed suction of tracheostomy with 12f catheter , supreme lma ( slma ) , surgical blade isi marked, size 11 ( 100 per packet ) , surgical material , surgical blade isi marked, size 15 ( 100 per packet ) , surgical material , surgical blade isi marked, size 22 ( 100 per packet ) , surgical material , surgical blade isi marked, size 24 ( 100 per packet ) , surgical material , surgical eye sponge spear , surgical kitdrape gown , surgical spirit ip ( 500 ml ) , bottle , sutureless dural substitute 4*6 cm , sutureless dural substitute 8*8 cm , t.piece circuit with oxygen tubing set ( complete set ) , tear test strip ( 100 strips in box ) , terumo guide wire m 0.035” 260cm j angled tip , thermometer digital , thomas splint , three piece iol with acrylic optic and pmma heptic acrylic multipiece sterile pcl ( iol / pc ) , 13.0mm length, 6.0mm optic diameter anterior asymmetric biconvex optic, 10 degree haptic, refractive index 1.46 1.55, a constant 118 118.8 , three way foley catheter, 10 fr , three way stop cock , tissue adhesives , titanium curved cranial mesh 100x100mm , titanium curved cranial mesh 120x120mm , titanium curved cranial mesh 120x150mm , titanium curved cranial mesh 120x180mm , titanium curved cranial mesh 60x60mm , titanium curved cranial mesh 60x80mm , titanium mesh for cranioplasty mesh 40x40mm curved , titanium self tapping screw 4 / 5mm , tmt graph paper , tounge depresser wooden , tracheostomy filter ( each ) , consumable , tracheostomy tube cuffed plastic size 5, 5.5, 6, 6.5, 7, 7.5, 8, 8.5 , tracheostomy tube with suction aid size: 8 and 8.5 , transbronchial needle aspiration , transducer set for invasive b.p. , translucent soft polyfilm surgery drape size 120x120 cm, incise area 25x20cm , triway with extention size 10, 50, 100, 150 , t tube size: 10, 12, 14, 16 &18 , turp set , twin nasal cannula adult , twin nasal cannula padiatric , ureteral catheter set , urine collecting bag 2 ltr. , urine collecting bag with urometer 1 ltr. , urine sugar diagnostic stip , vaccum adaptor 5 type , vaccum jar 1000 ml with regulator , vaccum jar 2000 ml with regulator , vaccum pump belt , vaccum pump oil , vaccum regulator , vaporizer , vascular haemostatic pad to stop external bleeding and catheterization site bleeding, chitosin material size 5x5 single pack. sterilized , vdrl rpr test kit , ventilator catheter mount , ventilator circuit , ventilator circuit ( heated wire ) , ventilator circuit ( neonatal ) , ventilator circuit full kit ( tubing+hmf+filter+catheter mount+bacteria filter ) , ventilator mask , ventilator nebulization kit with t piece , ventilator single tubing circuit ( adult ) , vfc ( viscous fluid control ) pack constellation vitrectomy , video camera cable cover length 2.5m width 15cm , vitrectomy set 23 g 10 k valve std total plus constellation vitrectomy , vitrectomy set 25 g 7.5 valve std total plus constellation vitrectomy , water bed , wipes , wound manager: large, diameter 208x297mm self adhesive, with flexible lid, which contain a drain port to remove the effluent from the bag, antireflux valve & inflatable ring which can be filled with air so that the lid should not touch the wound, unique daisy flower shaped base plate for better fit to body contours. one transparent window for easy inspection which can be remove time and again for inspection. the system should contain one transparent marking sheet so as to mark the required shap and size for cutting area 1pc, water base gaur gum and alcohol free adhesive paste 60gm 1 pc, contain magnesium citrate, glycerine, petrolatum, citric acid skin barrier cream to maintain 5.5 skin ph 1pc, cmc guar gum and xanthan gum base stoma powder 25gm 1pc, hexamethyldisiloxane cyclonentasiloxane and silicone base adhesive remover spray 1pc, silicon based non alcoholic skin barrier spray contain hexamethyldisiloxane cyclonentasiloxane to avoid residues building up by creating theam breathable film on the skin 50ml, cleanser to clean skin exposed to intestinal secretions consist of isopropyl alcohol, allantoin, natural coconut oil 5 pc , wound manager: medium, diameter 156x228mm self adhesive, with flexible lid, which contain a drain port to remove the effluent from the bag, antireflux valve & inflatable ring which can be filed with air so that the lid should not touch the wound, unique daisy flower shapedbase plate for better fit to body contours. one transparent windowfor easy inspection which can be remove time and again for inspection. the item should contain one transparent markingsheet so as to mark the required shap and size for cuting area 1pc, water base gaur gum and alcohol free adhesive paste 60gm 1pc, contain magnesium citrate, glycerine, petrolatum, citric acid skin barrier cream to mairntain 5.5 skin ph 1pc. cmc guar gum and xanthan gum base stoma powder 25gm 1pc, hexamethyldisiloxane cyclonentasiloxane and silicone base adhesive remover spray 1pc, silicon based non alcoholic skin barrier spray contain hexamethyldisiloxane cyclonentasiloxane to avoid residues building up by creating theam breathable film on the skin 50ml, cleanser to clean skin exposed to intestinal secretions consist of isopropyl alcohol, allantoin, natural coconut oil 5 pc , wound manager: small, diameter 104x159mm self adhesive, with lexible lid, whichcontain adrain port to remove the effluent from the bag, antirefluxvalve &inflatable ring which can be filled with alr so that the lidshould not touch the wound, unique daisy flower shaped base platefor better fit to body contours, one transparent window for easyinspection which can be remove time and again for inspection. thesystem should contain one transparent marking sheet so as tomark the required shap and size for cutting area 1pc, water basegaur gum and alcohol free adhesive paste 60gm 1 pc, containmagnesium citrate, glycerine, petrolatum, citric acid skin barriercream to maintain 5.5 skin ph 1pc. cmc guar gum and xanthangum base stoma powder 25gm 1pc, hexamethyldisiloxanecyclonentasiloxane and silicone base adhesive remover spray 1pc, silicon based non alcoholic skin barier spray contain hexamethyldisiloxane cyclonentasiloxane to avoid residuesbuilding up by creating theam breathable film on the skin 50ml, cleanser to clean skin exposed to intestinal secretions consist of isopropyl alcohol, allantoin, natural coconut oil 5 pc , wound protector extra small incision size 2 4 cm , wound protector large incision size 9 14 cm , wound protector large incision size 9 14 cm with retraction ring , wound protector medium incision size 5 9 cm , wound protector small incision size 2.5 6 cm , wound suctionset no 11 / 12 / 14 / 16 / 18 , x ray cassets ( 10x12 ) , consumable , x ray cassets ( 12x15 ) , consumable , x ray cassets ( 8x10 ) , consumable , x ray developer ( 22.5 ltr ) , consumable , x ray film fixer ( powder to make 22.5 liters pkt ) , consumable , x ray film ( blue sensitivity ) 50 sheet packet ( size 10x12 ) , consumable , x ray film ( blue sensitivity ) 50 sheet packet ( size 12x15 ) , consumable , x ray film ( blue sensitivity ) 50 sheet packet ( size 8x10 ) , consumable , x ray hangers ( clip type ) size 10x12 , x ray hangers ( clip type ) size 12x15 , x ray hangers ( clip type ) size 8x10 , x ray screen high speed size 12x15 , x ray screen high speed size 8x10 , x rayscreen high speed size 10x12 , y connector with extra long ventricular catheter , yankauer suction catheter ( complet set ) , 180 absorbablepolyglyconate knotless wound closure device with unidirectional 1 0 30cm, green 37mm 1 / 2 circle taper point , 180 absorbablepolyglyconate knotless wound closure device with unidirectional 2 0 30cm, green 37mm 1 / 2 circle taper point , 20g round body cutting needle 1 / 2 circle , 3 dimentional polyester mesh with micro porosity, x stich macro porosicty and multidirectional elasticity with optimesed atello collagen 1 absorbable anti adhesive barrier 12cm , 3 dimentional polyester mesh with micro porosity, x stich macro porosicty and multidirectional elasticity with optimesed atello collagen 1 absorbable anti adhesive barrier 15cm , 3 dimentional polyester mesh with micro porosity, x stich macro porosicty and multidirectional elasticity with optimesed atello collagen 1 absorbable anti adhesive barrier 20cm , 5 mm helical shaped non absorbable titanium tacker for laproscopic mesh fixation device with 30 tacks , 5 mm screw shaped polyglycolic lactic acid absorbable tacker for laproscopic mesh fixation fevice with min 30 tacks , absorbable adhesion barrier in the form of off white knitted fabric prepared by oxidized regenerated cellulose indicated for both open and laparoscopic procedures , absorbable gelatin based topical absorbable flowable hemostat with 6cc syringe pre filled with hemostatic matrix. with 14.3 cm white applicator tip & 14.6 cm blue flexible applicator tip , absorbable intraperitoneal umbilical patch of polyester mesh with collagen barrier and having absorbable pgla expanders with size 6 cm circle fda approved , absorbable intraperitoneal umbilical patch of polyester mesh with collagen barrier and having absorbable pgla expanders with size 8 cm circle fda approved , absorbable polycryl suture 7 0 3 / 8 circle spatulated micropoint needle polyglactin 910 usp , absorbable surgical suture ( synthetic ) sterilised surgicalneedled suture ( monofilament polydioxanone violet ) 70cm , absorbable unidirectional barbed devicepolydioxanone size 1, 40 mm 1 / 2 circle taper point needle 45 cm , absorbable unidirectional barbed device symmetric anchoring pattern, triclosan coated polydioxanone size 1, 40 mm 1 / 2 circle taper point needle 45 cm , absorbable unidirectional barbed device, symmetric anchoring pattern, triclosan coated polydioxanone, size 1, 36mm 1 / 2 circle taper point needle, 45 cm , black braided silk eyeless needled suture usp, size 8 0 suture length 76cm, needlelength & description 3 / 8 circle round bodied 30mm , black braided silk eyeless needled suture usp, code 5036 size 2 0 suture length in cm 76cm, needle length & description 3 / 8 circle reverse cutting 45mm , black braided silk eyeless needled suture usp, code 5082 size 4 0 suture length76cm, needle length & description 3 / 8 circle round bodied 16mm , black braided silk eyeless needled suture usp, code 5333 size 2 0 suture length 76cm, needle length & description 1 / 2 circle round bodied 30mm , blackbraided silk eyeless needled suture usp, size 5 0 suturelength 76cm, needlelength & description 1 / 2 circle round bodied 30mm , blackbraided silk eyeless needled suture usp, size 6 0 suturelength 76cm, needlelength & description 1 / 2 circle round bodied 30mm , blackbraided silk eyeless needled suture usp, code 5049 size 4 0 suturelength 76cm, needlelength & description 1 / 2 circle round bodied 16mm , blackbraided silk eyeless needled suture usp, code 5070 size 3 0 suturelength 76cm, needlelength & description 1 / 2 circle round bodied 25mm , blackbraided silk eyeless needled suture usp, code 5087 size 3 0 suture length76cm, needle length & description 1 / 2 circle round bodied 20mm , blackbraided silk eyeless needled suture usp, code 5334 size 1 0 suturelength 76cm, needlelength & description 1 / 2 circle round bodied 30mm , bovine collagen and glycosaminoglycan ( chondroitin 6 sulfate ) and silicone layer ( bilayer ) dermal regeneration template 2 in x 2 in , bovine collagen and glycosaminoglycan ( chondroitin 6 sulfate ) and silicone layer ( bilayer ) dermal regeneration template 4 in x 10 in , bovine collagen and glycosaminoglycan ( chondroitin 6 sulfate ) and silicone layer ( bilayer ) dermal regeneration template 4 in x 5 in , bovine collagen and glycosaminoglycan ( chondroitin 6 sulfate ) and silicone layer ( bilayer mashed ) mashed dermal regeneration template 2 in x 2 in , bovine collagen and glycosaminoglycan ( chondroitin 6 sulfate ) and silicone layer ( bilayer mashed ) mashed dermal regeneration template 4 in x 10 in , bovine collagen and glycosaminoglycan ( chondroitin 6 sulfate ) and silicone layer ( bilayer mashed ) mashed dermal regeneration template 4 in x 5 in , braided synthetic absorbable eyeless needled suture usp code 2423, size 1 0 suture ( os ) , braided synthetic absorbable eyeless needled suture uspbraided ab. suture 6 0 rc 1 / 4 circle 45cm needle 8 mm , braided synthetic absorbable polyglactin 910 eyeless needled suture size 6 0 round body needle , braided synthetic absorbable polyglactin 910 eyeless needled suture usp code 2341, size 2 0 suture length in 70cm 1 / 2 circle round bodied 30mm , braided synthetic absorbable polyglactin 910 eyeless needled suture usp code 2346, size 1 0 suture length in 90cm 1 / 2 circle40mm heave , braided synthetic absorbable polyglactin 910 eyeless needled suture usp code 2347, size 1 suture length in 90cm 1 / 2 circle40mm heave , braided synthetic absorbable polyglactin 910 eyeless needled suture usp code 2421, size 1 suture length in 90cm 1 / 2 circle rc 40mm os needle , braided synthetic absorbable polyglactin 910 eyeless needled suture usp code 2534, size 1 0 suture 90cms, 1 / 2 circle rc 36mm, os6 needle , coated braided polyglctin 910 with triclosan coating sut. ) with 1 / 2 cir rb needle 20mm length 75cm size 3 / 0. , coated braided polyglctin 910 with triclosan coating sut. ) with 1 / 2 cir rb needle 30mm length 100cm size 2 / 0. , coated braided polyglctin 910 with triclosan coating sut. ) with 1 / 2 cir rb needle 36mm length 90cm size 3 / 0 , coated braided polyglctin 910 with triclosan coating sut. ) with 1 / 2 cir rb needle 40mm length 100cm size 1 , coated braided polyglctin 910 with triclosan coating sut. ) with 1 / 2 cir rb needle 40mm length 100cm size 1 / 0 , complete absorbable mesh fixation device with minimum strap length 7.0 mm2 point fixation to hold the mesh and device with 25 tacks only. , copolymer of glycolied and e caprolactone, 1 0 ct 1 needle and 45cm suture length unidirectional spiral. , copolymer of glycolied and e caprolactone, 2 0 ct 1 needle and 45cm suture length unidirectional spiral. , copolymer of glycolied and e caprolactone, 3 0 rb 1 needle and 20cm suture length unidirectional spiral. , copolymer of glycolied and e caprolactone, 3 0 rb 1 needle and 45cm suture length unidirectional spiral. , disposable sterile perforator 14mm , knotless wound closure device with unidirectional 2 0 45cm, undyed24mm3 / 8 circlereverse cutting , knotless wound closure device with unidirectional 3 0 58cm, undyed24mm3 / 8 circlereverse cutting , macro porus partially absorbable mesh made up of approximately equal parts of polypropylene monofilament fiber ( 6 0 ) and poliglecaprone 25 monofilament fiber ( 5 0 ) with pore size 2.7 mm having a weight of 39 g / m2 and containing blue orientation stripes of polypropylene. 15cmx15cm , monofilament glycomer0, 90cm, violet40mm1 / 2 circletaper point , monofilament glycomer1, 90cm, violet 40mm 1 / 2 circle taper point , monofilament glycomer2 0 , 75cm, violet27mm1 / 2 circletaper point , monofilament glycomer3 0 75cm, undyed24mm3 / 8 circle reverse cutting , monofilament glycomer3 0 75cm, violet22mm1 / 2 circletaper point , non absorbable 4 0 polyester green braided 76cm , non absorbable pre shaped polypropylene mesh large size , non absorbable pre shaped polypropylene mesh medium size , non absorbable pre shaped polypropylene mesh small size , non absorbable prolene suture 6 0 polypropylene blue monofilament 3 / 8 round body needle 60cm , non absorbable surgical suture polypropylene 5 0 suture with reverse cutting needle 3 / 8 circle, 13.1mm, blue monofilament for scleral buckle , non absorbable surgical suture usp sterilised surgical suture ( braided silk black ) 38 cm 6 0 ( 0.7 metric ) 8mm 1 / 4 circle reverse cutting micropoint , non absorbable surgical suture usp sterilised surgical suture ( braided silk black ) 90 cm 5 0 ( 1 metric ) 12mm 3 / 8 circle reverse cutting , non absorbable suture polyester green 4 0 suture with 8mm 1 / 4 circle round body micropoint needle , non absorbable suture polyester green 4 0 suture with 8mm 1 / 4 circle spatulated micropoint needle , non absorbalble surgical suture usp sterilised surgical needled suture ( braided silk black ) 2 0 ( 3 metric ) 30mm 1 / 2 circle reverse body 90cm , non absorbalble surgical suture usp sterilised surgical needled suture ( braided silk black ) 2 0 ( 3 metric ) 30mm 1 / 2 circle round bodied 90cm , non absorbalble surgical suture usp sterilised surgical needled suture ( braided silk black ) 5 0 ( 3 metric ) 30mm 1 / 2 circle reverse body 90cm , oxidized regenerated cellulose ( absorbable hemostat fibrillar ) 1 in x 2 in ( 2.5cm x 5.1cm ) , oxidized regenerated cellulose based topical absorbable hemostar thicker weave 4x8 , oxidized regenerated cellulose based topical absorbable hemostat, fibrillar / layer form, with bactericidal property. fibril material ( 7layers ) for broad surface area coverage. size 2x4 inch , oxidized regenerated cellulose based topical absorbable hemostat, structured non wovenmaterial, with bactericidal property. ease of use in both open and minimally invasive procedures. size 2x4 inch , oxidized regenerated cellulose based topical absorbable hemostat, structured non wovenmaterial, with bactericidal property. ease of use in both open and minimally invasive procedures. size 4x4 inch , oxldlzed regenerated cellulose; rayon fiberas per us phrmcopela standards enforceable by us fda with bactericidal property 2x3 , oxldlzed regenerated cellulose; rayon fiber as per us phrmcopela standards enforceable by us fda with bactericidal property 3x4 , patient return electrode with current limiting nature & hence eliminate patient pad site burns based on capacitive coupling principle & made of akton polymer can be used for all patient’s weight >350 grams, radiolucent & latex free, no adhesive related irritation to patient skin.can be used any side up for easy handling in or andus fda approved compatible to any electrosurgical generator, size: 36” l x 20”w x 1 / 8”thickness. , pigtail catheter with needle length: 30cms size: 10fr, 12fr., 14fr, 16fr, 18fr , pistol grip curved coagulating shears with ergonomic handle in the following shaft length 36cm. can seal blood vessel up to and including 5mm in diameter compatible with ultrasonic vessel sealing dissector system , poliglecaprone 25 undyed 3 0, 3 / 8 circle reverse cutting26mm 70cm. , polyamide black size 10 / 0 3 / 8 circle spachula needle 6mm , polyamide black size 8 / 0 3 / 8 circle revers cutting needl 6mm , polydioxanone122cm, no 1 size loop sgle with 65 mm needle and 1 / 2 circle tp needle. , polydioxanone150cm usp1 0 rb ctx, 1 / 2 circle, 48mm , polydioxanone suture violet monofilament 1 ( 4.0 metric ) 96 ( 244 cm ) tp 1 65mm 1 / 2c taper , polydioxanone suture violet monofilament 2 0 ( 3.0 metric ) 27 ( 70 cm ) double armed trocar point stp 10 ( 10 ) needle straight 254mm , polydioxanone suture violet monofilament 3 0 ( 2.0 metric ) 36 90cm sh 26mm 1 / 2c taper , polydioxanone suture violet monofilament 4 ( 1.5 metric ) 36 90cm v 5 17mm 1 / 2c taper , polydioxanone suture violet monofilament 4 0 ( 1.5 metric ) 36 90cm v 5 17mm 1 / 2c taper , polyester suture no. 2 x 100 45mm hc tc , polyester suture no. 5 x 75 55mm hc tc , polyglactin 910 1 x 100 45mm hc rb , polyglactin 910 fast und 0 x 110 40mm hc rb , polyglactin 910 fast und 2 0 x 100 36mm hc rb , polyglactin 910 suture violet braided 4 0 ( 1.5 metric ) 18 ( 45cm ) tf 13mm 1 / 2c taper , polyglactin 910 with triclosan no. 0 x 90 36mm hc rb , polyglactin 910 with triclosan no. 0 x 90 40mm hc rb , polyglactin 910 with triclosan no. 1 x 100 55mm hc rb , polyglactin 910 with triclosan no. 1 x 90 36mm hc tc , polyglactin 910 with triclosan no. 1 x 90 40mm hc rb , polyglactin 910 with triclosan no. 1 x 90 40mm hc rc , polyglactin 910 with triclosan no. 2 x 90 40mm hc rb , polyglactin 910 with triclosan no. 2 x 90 40mm hc rc , polyglactin 910 with triclosan no. 2 0 x 90 30mm hc rb , polyglactin 910 with triclosan no. 2 0 x 90 40mm hc rb , polyglactin 910 with triclosan no. 3 0 x 90 20mm hc rb , polyglactin 910 with triclosan no. 3 0 x 90 36mm hc tc , polyglactin 910 with triclosan no. 4 0 x 70 20mm hc rb , polyglactin 910 with triclosan no. 5 0 x 45 16mm hc rb , polyglactin 910 with triclosan no.1 0x 90 36mm hc rc , polyglactin 910 with triclosan no.1 0x 90 40mm hc rb , polyglactin 910 with triclosan no.1 0x 90 40mm hc tc , polyglycolic acid no. 1 x 180 50 / 40mm cu rb hc tc dn , polypropylene 6 0x60 10mm hcrb dntp3 , polypropylene 7 0x60 09mm hcrb dntp3 , polypropylene 9 0 suture double arm reverse cutting straight needle color blue 8in , polypropylene blue monofilament p 3 13mm 3 / 8c reverse cutting 6 0 ( 0.7 metric ) 18 ( 45cm ) , polypropylene clear monofilament non absorbable cp 2 reverse cutting 1 / 2 circle 26mm 1 0 ( 4.0 metric ) 14cmx14cm bi directional, suture , polyster braided1 / 2 circle tapercut double needle with 17 mm needle and suture lenght 90cm , progrip self fixating mesh 12*08cm , progrip self fixating mesh 14*9cm , progrip self fixating mesh 15*15cm , progrip self fixating mesh 20*15cm , progrip self fixating mesh 30*15cm , protective disk with chg hydrophilic polyurethane absorptive foam with 92 g chlorhexidine gluconate ( chg ) 1 disk ( 2.5 cm ) 7mm center hole with radial slit usfda approved , protective disk with chg hydrophilic polyurethane absorptive foam with 92 g chlorhexidine gluconate ( chg ) 1 disk ( 2.5 cm ) 4.0 mm center hole with radial slit usfda approved , scissor grip curved coagulating shears with curved tapered tip for precise dissection and with 240 degree activation triggers that support multiple hand position in the following shaft length 17cm. can seal blood vessels up to & including 5mm in diameter with ultrasonic vessel sealing dissector . , self grippingpolyester / polypropylene monofilament mesh pre cut with pla grips with size 14 x 09 cm for left side , fda approved , self grippingpolyester / polypropylene monofilament mesh pre cut with pla grips with size 14 x 09 cm for right side, fda approved , self grippingpolyester / polypropylene monofilament mesh pre cut with pla grips with size 12 x 08 cm for left side, fda approved , self gripping polyester / polypropylene monofilament mesh pre cut with pla grips with size 12 x 08 cm for right side, fda approved , sterlizedabsorbable eyeless needled suture usp, code 2341, size 2 0 suture length in cm 70cm needle length & description 1 / 2 circle round bodied 30mm , sterlizedabsorbable eyeless needled suture usp, code 2345, size 2 0 suture length in cm 70cm needle length & description 1 / 2 circle round bodied 40mm , sterlizedabsorbableeyeless needled suture usp, code 2304, size 4 0 suture length in cm 70cm needle length & description 1 / 2 circle round bodied 20mm , sterlizedabsorbableeyeless needled suture usp, code 2317, size 2 0 suture length in cm 90cm needle length & description 1 / 2 circle round 30mm , sterlizedabsorbableeyeless needled suture usp, code 2437, size 3 0 suture length in cm 70cm needle length & description 1 / 2 circle round bodied 20mm , sterlizedabsorbable polyglycolic acid eyeless needled suture usp, code 2303, size 5 0 suture length in cm 45cm needle length & description 1 / 2 circle round bodied 16mm , sterlizedabsorbable polyglycolic acid eyeless needled suture usp, code 2442, size 5 0 suture length in cm 45cm needle length & description 3 / 8 circle cutting 16mm , sterlized monofilament polyamide eyeless needled suture usp, code 3318, size 4 0 suture length in cm 70cm needle length & description 3 / 8 circlecutting cutting 16mm , sterlized monofilament polyamide eyeless needled suture usp, code 3328, size 3 0 suture length in cm 70cm needle length & description 3 / 8 circlereverse cutting cutting 26mm , sterlized monofilament polyamide eyeless needled suture usp, code 3336, size 2 0 suture length in cm 70cm needle length & description 3 / 8 circlereverse cutting cutting 45mm , sterlized monofilament polyamide eyeless needled suture usp, code 3347, size 1 suture length in cm 100cm needle length & description 1 / 2 circleround bodied 40mm heavy , sterlized monofilament polyamide eyeless needled suture usp, code 7003, size 10 0 suture length in cm 30cm needle length & description 3 / 8 circledouble arm 6mm heavy , sterlized monofilament polyamide eyeless needled suture usp, code 3317, size 5 0 suture length in cm 70cm needle length & description 3 / 8 circle reverse cutting cutting 12mm , sterlized monofilament polyamide eyeless needled suture uspsize 6 0 suture length in cm 70cm needle length & description 3 / 8 circle reverse cutting cutting 12mm , sterlized monofilament polypropyleneeyeless needled suture usp, code 829, size 6 0 suture length in cm 70cm needle length & description 3 / 8 circle round bodied 13mm double armed. , sterlized monofilament polypropyleneeyeless needled suture usp, code 841, size 2 0 suture length in cm 70cm needle length & description 1 / 2 circle round bodied 30mm , sterlized monofilament polypropyleneeyeless needled suture usp, code 842, size 1 0 suture length in cm 70cm needle length & description 1 / 2 circle round bodied 30mm , sterlized monofilament polypropylene eyeless needled suture usp, code 823, size 6 0 suture length in cm 70cm needle length & description 3 / 8 circle slim blade cutting 15mm. , sterlized monofilament polypropylene eyeless needled suture usp, code 843, size 1 suture length in cm 70cm needle length & description 1 / 2 circle round bodied 40mm heavy , sterlized monofilament polypropylene eyeless needled suture usp, code 849, size 4 0 suture length in cm 70cm needle length & description 1 / 2 circle round bodied 16mm , sterlized monofilament polypropylene eyeless needled suture usp, code 870, size 4 0 suture length in cm 70cm needle length & description 3 / 8 circle cutting 16mm , sterlized monofilament polypropylene eyeless needled suture usp, code 881, size 5 0 suture length in cm 70cm needle length & description 3 / 8 circle round bodied 16mm. , sterlized monofilament polypropylene eyeless needled suture usp, code 882, size 5 0 suture length in cm 70cm needle length & description 3 / 8 circle round bodied 16mm.double 16mm armed , sterlized surgical chromic gutsutue eyeless needied usp, code 4201, size3 / 0, suture length in cm 76cm, needle length & description 3 / 8 circle cutting 22mm. , sterlized surgical chromic gutsutue eyeless needied usp, code 4216, size2 / 0, suture length in cm 76cm, needle length & description 3 / 8 circle round bodied 30mm. , sterlized surgical chromic gutsutue eyeless needied usp, code 4217, size1 / 0, suture length in cm 76cm, needle length & description 3 / 8 circle round bodied 30mm. , sterlized surgical chromic gutsutue eyeless needied usp, code 4221, size1 / 0, suture length in cm 76cm, needle length & description 3 / 8 circle round bodied 40mm. , sterlized surgical chromic gutsutue eyeless needied usp, code 4227, size 1, suture length in cm 100cm needle length & descriptio 1 / 2 circle round bodied 45mm heavy. , sterlized surgical chromic gutsutue eyeless needied usp, code 4237, size3 / 0, suture length in cm 76cm, needle length & description 1 / 2 circle round bodied 20mm. , sterlized surgical chromic gutsutue eyeless needied usp, code 4259, size1, suture length in cm 76cm, needle length & description 1 / 2 circle round bodied 40mm heavy. , sterlized surgical chromic gutsutue eyeless needied usp, code 4268, size5 / 0, suture length in cm 76cm, needle length & description 3 / 8 circle reverse cutting 12mm. , surgical silk bradedsterile foilover wrappack code 213 size 2 0 suture length in 2 x 75cm , surgical silk bradedsterile foilover wrappack code 214 size 1 0 suture length in 2 x 75cm , surgical silk bradedsterile foilover wrappack code 215 size 1 suture length in 2 x 75cm , suture dyed polyester poly ( p dioxxanone ) 1 0, 24x4cm, 1 / 2 circle 36mm rb 20 anchors / inch bidirctional. , synthetic absorbable surgical suturetriclosancoated violet monofilament polydioxanone suture with 70 cm size 2 0 with 1 / 2 circle taper point sh, 25mm to 26 mm needle usfda approved , synthetic absorbable surgical suture , polyglactin 910 with triclosan coated, undyed 3 0, 3 / 8 circle cutting ps1 prime, multi pass ethalloy, 24mm, 70 cm undyed , synthetic absorbable surgical suture , polyglactin 910 with triclosan coated undyed 2 0, 1 / 2 circle round body taper point ct 1 36 mm , 90 cm undyed , synthetic absorbable surgical suture triclosan coated monofilament poliglecaprone 25 suture, length 70 cm, size 2 0 with 3 / 8 circle oval round body visi black jb needle 26 mm , synthetic absorbable surgical suture triclosan coated violet monofilament polydioxanone suture with 90 cm size 1 with 1 / 2 circle taper point ct 1 40 mm needle usfda approved , synthetic absorbable surgical suture, polyglactin 910 with triclosan coated undyed1, 1 / 2 circle round body taper point ct 1 36mm, 90cm undyed. , transducer with unlimited counts compatible with ultrasonic vessel sealing dissector system , triclosan antibacterial coated polyglactin with 23 mm needle suture length 70cm, reverse cutting portt heavy needle size 1 no. , v shape clip applicators large , v shape clip applicators medium , v shape clip applicators medium large , v shape clip applicators small , v shape ligation clip large , v shape ligation clip medium , v shape ligation clip medium large , v shape ligation clip small , aciclovir 200mg / 5ml oral suspension 100ml bottle , albendazole suspension 200mg / 5ml ( 10 ml bottle ) , syrup , ambroxol hcl 15mg+terbutaline sulphate 1.25mg+guaiphenesin 50mg 5ml ( ( additional composition of menthol also acceptable ) 100ml bottle ) , syrup , ammonium chloride+ diphenhydramine+sodium citrate+menthol ( 138mg+14.08mg+57.03mg+2.5mg each 5ml cough syrup ) 100 ml, syrup , amoxicillin and clavulanic acid i.p. ( 200+28.5mg ( 30 ml bottle ) ) , syrup , amoxicillin ( 125 mg / 5ml ( 30 ml bottle ) ) , suspension , azithromycin ( 200mg / 5ml ( 15 ml bottle ) ) , syrup , baclofen 5 mg / 5ml ( 100 ml bottle ) , bromhexine hcl 4 mg+ guaiphensin 50 mg + terbutaline sulphate 1.25 mg / 5ml syp ( 100 ml bottle ) , syrup , calcium carbonate 625 mg, vitamin d3 125 iu / 5 ml ( 100 ml syrup ) , syrup , calcium phosphate ( 2 : 1 ratio ( 100 ml bottle ) ) , syrup ( each 5 ml contains : calcium 82 mg + vitamin d3 ( cholecalciferol ) 200 iu + vitamin b12 ( cynocobalamin ) 2.5 mcg ) , syrup , carbamazepine 100 mg / 5 ml oral suspension 100ml bottle , cefixime oral suspension ( 100 mg / 5 ml ( 30 ml bottle ) ) , suspension , cetirizine ( 5mg / 5ml ( 60 ml bottle ) ) , syrup , chloramphenicol 125 mg / 5ml 60ml syrup , chloroquine phosphate suspension equivalent to chloroquine ( 50mg / 5ml ( 60 ml bottle ) ) , suspension , ciprofloxacin 125mg / 5ml syp 60 ml bottle , co trimoxazole oral suspension i.p. 50 ml bottle , cyanocobalamin 7.5 mcg+ferrous ammonium citrate 160 mg+folic acid 0.5 mg / 10ml 200ml bottle , cyclosporine oran solution usp 100mg / ml 50 ml bottle, syrup , cyproheptadine hcl + tricholine citrate ( 2mg + 275 mg / 5 ml ( 200ml bottle ) ) , syrup , cyproheptadine hcl l lysine multivitamin syrup 200 ml syrup , dextromethorphan 10mg / 5ml ( 100ml bottle ) , syrup , disodium hydrogen citrate 1.25gm / 5ml 100 ml ( 100 ml ) , syrup , domperidone suspension 1mg / ml ( 30ml bottle ) , suspension , etiophylline +theophylline ( ( 46.5+14 ) mg / 5ml ( 100 ml bottle ) ) , syrup , glycerin ( glycerol ) oral liquid ip ( 100 ml bottle ) , ibuprofen 100mg + paracetamol 125mg per 5 ml syrup ( 60 ml bottle ) , syrup , ibuprofen syrup 100mg / 5ml ( 60 ml bottle ) , syrup , iron 40 mg, ammonium citrate 200 mg, cyanocobalamin 7.5 mg, folic acid 0.5 mg, zinc sulphate 7 mg ( per 5ml ) ( iron syrup 200 ml ) , bottle , lactulose ( 10gm / 15ml ( 100 ml bottle ) ) , solution , levetiracetam 100mg / ml syrup / solution ( 100ml bottle ) , syrup , magnesium hydroxide + aluminium hydroxide simethecon 250 mg + 250 mg + 50 mg / 5 ml 170 ml bottle ( syrup ) , syrup , metronidazole oral suspension ( 200 mg / 5ml ( 60 ml bottle ) ) , suspension , milk of magnesia+liquid paraffin 11.25ml+3.75ml ) 15ml ) , syrup ( 200ml bottle ) , syrup , multivitamin multimineral with antioxidant ( ascorbic acid 40 mg+cyanocobalamin 1 mcg+d panthenol 5 mg+folic acid 0.1 mg+l isoleucine 6.195 mg+l leucine 19.21 mg+l lysine 26.25 mg+l phenylalanine 5.25 mg+l threonine 4.41 mg+l valine 7.035 mg+methionine 9.66 mg+niacinamide 12 mg+pyridoxine 1.5 mg+riboflavine 1.1 mg+thiamine mononitrate 1 mg+tryptophan 5.25 mg / 15ml ) 200 ml syrup , nitazoxanide ( 100mg / 5ml ) 30 ml bottle , norfloxacin suspension ( 100 mg / 5 ml 30ml syrup ) , syrup , ofloxacin suspension 50mg / 5 ml ( 60 ml bottle ) , suspension , omega 3 fatty acid with vitamin d3 emulsion 150 ml bottle , ondansetron ( 2mg / 5ml 30ml bottle ) , syrup , paracetamol 150 mg / ml ( 15 ml bottle with dropper ) , drop , paracetamol syrup / suspension 125 mg / 5ml ( 60ml bottle ) ( syrup ) , syrup , phenobarbitone ( 20 mg / 5ml 100 ml bottle ) , syrup , phenytoin sodium oral suspension 30mg / 5ml 100 ml bottle , potassium chloride oral solution 100mg / ml ( 200ml bottle ) , bottle , prednisolone 5 mg / 5ml 60 ml syrup , salbutamol sulphate ( 2mg / 5ml 60ml ) ( 60ml bottle ) , syrup , sodium valproate oral solution ( 200 mg / 5 ml ) 200 ml bottle, solution , sodium valproate oral solution ( 200 mg / 5 ml ) , solution 100ml syrup , sorbitol 7.15 gm+tricholine citrate 0.55 gm 200ml bottle , sucralfate ( 1gm / 5ml ) 100 ml bottle, syrup or suspension , sulfamethoxazole +trimethoprim suspension ( 200 mg + 40 mg ) / 5 ml suspension ( 50 ml bottle ) , suspension , vitamin a syrup ( 100000 iu / ml with 1ml and 2 ml ( 100 ml bottle ) ) , syrup or solution , vitamin b complex nfi formula ( 100ml bottle ) , syrup , zinc sulphate syrup 20mg / 5ml ( 50 ml bottle ) , syrup , 6 mercaptopurine tablets ip 50mg , acamprosate ( 333 mg ) , tablet , acarbose 25 mg tablet , aceclofenac +thiocolchicoside ( 100mg+8mg ) , tablet , aceclofenac 100 mg +paracetamol 325 mg +chlorzoxazone 250 mg ( 100mg+325mg+250mg ) , tablet , aceclofenac 100mg+paracetamol 325mg + serratiopeptidase 15mg ( 10x10 ) , tablet , aceclofenac 100mg+paracetamol 325mg tab ( ) , tablet , aceclofenac 100mg+paracetamol 500mg , tablet , aceclofenac 100mg+serratiopeptidase 10mg ( 10x10 ) , tablet , aceclofenac ( 100mg ) , tablet , acenocoumarol 1mg , acenocoumarol ( 2 mg ) , tablet , acetazolamide tab ( 250mg ) , tablet , aciclovir tab 400 mg, tablet , acyclovir tab. ip 200mg ( dt tablets also acceptable ) , tablet , acyclovir ( 800mg ) , tablet , ademetionine ( 400mg ) , tablet , afatinib 40 mg tablet , agomelatine 25 mg tab , albendazole + ivermectin ( 400mg + 6mg ) , tablet , albendazole ip ( 400mg ) , tablet , alendronate ( 70 mg ) , tablet , alfuzocin hcl 10mg tablet , alfuzosin 10mg+dutasteride 0.5 mg , allopurinol 100 mg , alpha lipoic acid 100 mg+folic acid 1.5 mg+mecobalamin 1.5 mg+vitamin b6 3 mg , alprazolam 0.25 mg , amantadine hydrochloride 100 mg tablet , ambroxyl 30mg tab , amiodarone 200 mg , amisulpride 100 mg , amisulpride 200 mg , amisulpride 50 mg , amitriptyline tab. ip ( 25 mg ) , tablet , amitriptyline ( 10 mg ) , tablet , amitryptiline tab ( 50 mg ) , tablet , amitryptiline ( 75 mg ) , tablet , amlodipin tab ( 10mg ) , tablet , amlodipin tab ( 2.5mg ) , tablet , amlodipin tab ( 5mg ) , tablet , amlodipine ( 5 mg ) + metoprolol ( 50 mg ) , amlodipine ( 5 mg ) + telmisartan ( 40 mg ) , amolodipine 5mg +atenolol 50mg , anastrozole1mg , aripiprazole 10 mg , aripiprazole 15 mg , aripiprazole 30 mg , armodafinil 50 mg tablet , artemether 80mg lumefantrine 480mg tablets. packing 10x1x6 , artesunate 50 mg ( 3 tab ) + sulphadoxine 500 mg + pyrimethamine 25 mg ( 1 tab ) ( age group between 1 4 year ) , combi blister pack , ascorbic acid ( vitamin c ) tab i.p. ( 500mg ) , tablet , aspirin 75 mg+clopidogrel 75 mg+rosuvastatin 10 mg , aspirin 75 mg+prasugrel 10 mg , aspirin low dose ( 150mg tab ) , tablet , aspirin low dose ( 75mg tab ) , tablet , atenolol ( 25 mg ) , tablet , atenolol ( 50 mg ) , tablet , atomoxetine 10 mg tab , atomoxetine 25 mg tab , atorvastatin 10 mg , atorvastatin 10 mg+aspirin 75 mg. , atorvastatin 20 mg , atorvastatin 40 mg , axitinib 5mg , azathioprine 50 mg tab , azithromycin500 mg , azithromycin 250 mg tab , azithromycin+fluconazole+secnidazole ( 1gm+150mg+1gm ) tablet combikit , baclofen ( 10 mg tab ) , tablet , baclofen ( 20 mg tab ) , tablet , baclofen ( 30 mg tab ) , tablet , baclofen ( 40 mg tab ) , tablet , baclofen ( 5 mg tab ) , tablet , benfothiamin 150mg , betahistine ( 16 mg ) , tablet , betahistine ( 4 mg ) , tablet , betahistine ( 8 mg ) , tablet , betamethasone ( 0.5 mg ) , tablet , bicalutamide 50 mg, tablet , bisacodyl ( 5mg tab ) , tablet , bisoprolol 2.5 mg+hydrochlorothiazide 6.25 mg , bisoprolol 5 mg+amlodipine 5 mg , blonanserin 2 mg , blonanserin 4 mg , bosentan 62.5 mg tab , briveracetum 50mg tab , bromocriptine 2.5mg tab , buprinorphine 4mg , buprinorphine 8 mg , bupropion150 mg , bupropion300 mg , buspirone 10 mg , buspirone 5 mg , cabergoline tablets ip 0.25 mg , cabergoline tablets ip 0.5 mg , calcitriol 0.25mcg + calcium carbonate 500mg + zinc sulfate 7.5 mg , tablet , calcium acetate 667 mg tab , calcium carbonate ( 500 mg ) , tablet , calcium with vitamin d3 tablets usp calcium carbonate 1.25g eq. to elemental ( calcium 500mg and cholecalciferol ip 250 iu ) , tablet , capecitabine ( 500mg ) , tablet , carbamazepine sr100 mg, tablet , carbamazepine sr200 mg, tablet , carbamazepine sr400 mg, tablet , carbamazepine ( 200 mg ) , tablet , carbimazole 20 mg tablet , carbimazole ( 5 mg ) , tablet , carvedilol ( 3.125 mg ) , tablet , carvedilol ( 6.250 mg ) , tablet , cefadroxil 500 mg , cefixime 200 mg + clavulanic acid 125 mg ( tab ) , tablet , cefixime tab ip ( 100mg ) , tablet , cefixime tab ip ( 200mg ) , tablet , cefodoxime 200mg tab , cefpodoxime50 mg , cefuroxime 250 mg 10 x 10 ( 250 mg ) , tablet , cefuroxime 500 mg 10 x 10 ( 500 mg ) , tablet , cetirizine10 mg , chlordiazepoxide ( 10 mg ) , tablet , chlordiazepoxide ( 25 mg ) , tablet , chloroquine phosphate tab. ( 250mg ) , tablet , chlorpheniramine maleate 2 mg+phenylephrine 10 mg+nimesulide 100mg +caffeine 30 mg , chlorpheniramine maleate ( 4mg ) , tablet , chlorpromazine50mg , chlorpromazine 100 mg , chlorthalidone ( 50mg ) , tablet , chymotrypsin + trypsin ( 20000 iu + 100000 iu ) , tablet , cilostazole 100 mg tablets , cilostazole 200 mg tablets , cinnarizine 20 mg and dimenhydrinate 40 mg , cinnarizine ( 25 mg ) , tablet , cinnarizine ( 5 mg ) , tablet , ciprofloxacin ( 500mg ) , tablet , citicoline ( 500mg ) , tablet , clarithromycin ( 250 mg ) , tablet , clobazam ( 10 mg ) , tablet , clobazam ( 5 mg ) , tablet , clomipramine 50 mg, tablet , clonazepam 0.25 mg tab , clonazepam 0.5 mg tab , clonazepam 1 mg , clonazepam 2 mg , clonidine 100 mcg tablet , clopidogrel75 mg , clopidogrel 150mg+ aspirin 75 mg , clopidogrel 75 mg+aspirin 75 mg , clopidogrel 75 mg+atorvastatin 20 mg , clotrimazole antifungal 400mg tablet , clotrimazole vaginal tablet i.p. 500mg , clozapine ( 100 mg ) , tablet , clozapine ( 25 mg ) , tablet , clozapine ( 50 mg ) , tablet , coenzyme q 10 120 mg , cyanocobalamin 2 mg with folic acid 2.5 mg tablets , cyclophosphamide 50 mg tab , dapagliflozin 5 mg tablet , dapsone 100 mg tablet , dasatinib 50 mg , deferasirox dispersible 250 mg tab , deferasirox dispersible 500 mg tab , deflazacort 30 mg tab , deflazacort ( 6mg ) , tablet , desmopressin acetate 0.5mg tablet , dexamethasone 4 mg tab , diazepam10 mg , diazepam5 mg , diclofenac + seratopeptidase ( 50mg + 10mg ) , tablet , diclofenac sodium + paracetamol +serratiopeptidase ( 50 mg +325 mg + 10 mg ) , tablet , diclofenac sodium 50mg + paracetamol ( 500mg ) , tablet , diclofenac sodium ( 50 mg ) , tablet , dicyclomine ( 10mg ) , tablet , digoxin 0.25 mg , diltiazem 30mg , diphenylhydramine 50 mg , disulfiram 250 mg , divalproex sodium 250 mg , domperidone 10 mg + ranitidine 150mg tablets , domperidone 10 mg tab , donepezil10 mg , donepezil 5 mg , doxophylline400 mg tablet , drotaverine ( 40 mg ) , tablet , drotaverine ( 80 mg ) , tablet , duloxetine 20 mg tab , duloxetine 30 mg tab , duloxetine ( 40 mg ) , tablet , dydrogesterone 10mg , eltrombopag olamine 50 mg tablet , empagliflozin 25mg tablet , enalapril maleate 2.5 mg , enalapril maleate 5 mg , entecavir ( 0.5 mg tablet / capsule ) , tablet or capsule , entecavir ( 1 mg tablet / capsule ) , tablet or capsule , eplerenone 25mg , erlotinib 100mg , erlotinib 150mg , escitalopram 10 mg , escitalopram 20 mg , escitalopram 5 mg , esomeprazole 40mg , ethambutol tablets 400 mg , ethambutol tablets 800 mg , ethamsylate 500 mg , etizolam 0.25 mg+propranolol 20 mg, tablets , etizolam ( 0.5mg ) , tablet , etophylline ( 77 mg ) + theophylline ( 23 mg ) , tablet , etoposide 50 mg , etoricoxib 90mg , everolimus 5 mg tablets , farmalin 1gm tab ( 100 tab per box ) , febuxostat 40 mg , fenofibrate 160 mg tablets , ferrous ascorbate 100mg ( elemental iron ) +folic acid 1.5mg ( tablet ) , tablet , ferrous sulphate ip equivalent to 60 mg elemental iron & 500 mcg folic acid ip ( 60 mg + 500 mcg ) , tablet , flavoxate hcl 200mg , fluconazole 150 mg , fludrocortisone 100 mcg tablet , flunarizine 10 mg , flunarizine 10 mg+propranolol 40 mg , flunarizine 5 mg , fluvoxamine 50 mg , folic acid 5 mg , folic acid 800 mcg , formalin 1000 mg tablet , frusemide40 mg , fungal diastase 100 mg+papain 60 mg , gabapentin 400 mg+nortriptyline 10 mg , gabapentin ( 100mg ) , tablet , gabapentin ( 300mg ) , tablet , ganciclovir 1000 mg tablet , gefitinib 250mg , glibenclamide 2.5mg tab , glibenclamide 5mg tab , gliclazide 60mg , gliclazide 80 mg , glimepiride + metformin hydrocloride sr ( 1 mg + 500 mg ) , tablet , glimepiride 2 mg + metformin 500 mg + pioglitazone 15 mg , glimepiride 2 mg+metformin 500 , glimepiride ( 1 mg ) , tablet , glimepiride ( 2 mg ) , tablet , glipizide 5 mg+metformin 500 mg , glucosamine and chondroitin sulfate ( 750 mg tablet ) , haloperidol 1.5 mg , haloperidol 10 mg , haloperidol 5 mg , hydrochlorothiazide 12.5 mg , hydrochlorothiazide 25 mg , hydrocortisone 10 mg tablet , hydrocortisone tablets for usp, 20mg , hydroxychloroquine ( 200 mg ) , tablet , hydroxychloroquine ( 400 mg ) , tablet , hydroxyzine hcl 10 mg tablet , hyoscine butylbromide tab 10mg , ibuprofen 400mg+ paracetamol 325mg tablet ( ) , tablet , ibuprofen ( 400mg ) , tablet , imatinib ( 100 mg tab ) , tablet , imatinib ( 400 mg tab ) , tablet , imipramine ( 25mg ) , tablet , imipramine ( 75mg ) , tablet , indapamide hemihydrate 1.5mg , iron folic acid tab ferrous sulfate desiccated ip 333 335 mg equivalent to 100mg of elemental iron +folic acid ip 0.5mg tab ferrous sulphate of elemental iron +folic acid ip 0.5tab ferrous sulphate dessicated ip equivalent to 20mg , isoniazid 300mg tablet , isosorbide dinitrate tab ip ( 5mg ) , tablet , isosorbide mononitrate 30 mg , isosorbide 5 mononitrate ( tab.20 mg ) , tablet , itopride 150mg , itopride hydrochloride 25 mg tablets , itopride hydrochloride 50 mg tablets , ivermectin 12 mg , labetalol 100mg , lacosamide 50 mg tab , lactic acid bacillus ( 120m ) , lactic acid bacillus ( 60 million spores ) , tablet , lamotrigine dt tab ( 100 mg ) , tablet , lamotrigine dt tab ( 50 mg ) , tablet , lamotrigine dt ( 25 mg ) , tablet , lansoprazole 15 mg, tablet , lapatinib 250 mg , l carnosine 200 mg tablet , letrozole ( 2.5 mg ) , tablet , levetiracetam 250 mg , levetiracetam 500 mg , levetiracetam 750 mg tablet , levocetirizine 5mg tab , levocetirizine 5mg+ monteleukast 10 mg tab , levodopa 100 mg + carbidopa 25mg, tablets , levofloxacin tab 500mg , levofloxacin ( 750mg ) , tablet , linezolid tab ( 600 mg ) , tablet , lithium carbonate 300 mg , lithium carbonate 400 mg , loperamide hydrochloride 8 mg tablet , lorazepam ( 1 mg ) , tablet , lorazepam ( 2 mg ) , tablet , lorcaserine hydrochloride tablets ip 10 mg , losartan ( 50 mg ) + chlorthalidone ( 12.5 mg ) , losartan 50 mg tab , losartan 50 mg+hydroclorothiazide 12.5 mg tab , lurasidone hydrochloride 20mg tablet , lurasidone hydrochloride 40mg tablet , magnesium oxide 200 mg , magnesium valproate 400 mg , mebendazole 100 mg tab , meclizine hydrochloride 25 mg tablet , mefenamic acid + dicyclomine tab ( 250 mg + 10 mg ) , tablet , mefenamic acid + drotaverine hcl tab ( 250 mg+80 mg ) , tablet , megestrol acetate 40mg tablets , melatonin 3mg , melatonin 6mg , memantine 10 mg , mesalamine ( 5 aminosalicylic acid ) 400 mg tab , metformin ( 1000 mg ) + vildagliptin ( 50 mg ) , metformin + glimepiride ( 500 mg + 2 mg tablet ( sr form also acceptable ) ) , tablet , metformin 500 mg+voglibose 0.3 mg , metformin ( 1000mg ) , sr tablet , metformin ( 500 mg ) , tablet , metformine 500 mg+ gliclazide 80 mg tab , metformine 500mg + glibenclamide 5mg ( tab ) , tablet , methimazole 10 mg tab , methocarbamol500 mg tablet , methotrexate ( 10 mg ) , tablet , methotrexate ( 2.5 mg ) , tablet , methotrexate ( 5 mg ) , tablet , methotrexate ( 7.5 mg ) , tablet , methyl prednisolone ( 16mg ) , tablet , methyl prednisolone ( 4mg ) , tablet , methyl prednisolone ( 8mg ) , tablet , methylcobalamin ( 1500 mcg ) , tablet , methylcobalamin ( 1500 mcg ) + folic acid 5 mg , tablet , methylcobalamin / mecobalamin ( 500 mcg ) , tablet , methyldopa 250 mg tablet , methylphenidate 10 mg , methylphenidate 20 mg , methylphenidate 5 mg , metoclopramide ( 10mg ) , tablet , metoclopramide ( 5mg ) , tablet , metolazone 5 mg tablet , metoprolol 12.5 mg , metoprolol 50 mg+ramipril 5 mg , metoprolol ( 50mg ) , tablet , metronidazole tab ( 400mg ) , tablet , mifepristone 200mg ( 1 tab ) +misoprostol 200mcg ( 4 tab ) ( combipack ) , tablet kit , mirtazapine ( 15 mg ) , tablet , mirtazapine ( 30 mg ) , tablet , mirtazapine ( 7.5 mg ) , tablet , misoprostol ( 200mcg ) , tablet , modafinil100 mg tablet , modafinil200 mg tablet , morphine sulphate ( 10 mg ) , tablet , moxonidine 0.3 mg , multivitamin tab nfi formula sugar coated vit a 2500 iu, vit b12, vit b 6, 0.5 mg, vit c 50mg, vit d3 250iu, niacinamide 25mg, folic acid 0.2mg ( with approximateoverages ) , mycophenolate mofetil ( 250mg ) , tablet , mycophenolate mofetil ( 500mg ) , tablet , n acetyl cysteine 600 mg tablet , n acetylcysteine 300 mg , naltrexone ( 50 mg ) , tablet , naproxen 250 mg tablet , naproxen 500 mg tablet , naproxen 500mg domperidone 10mg tablets , nebivolol 5mg , nicorandil 5 mg tab , nicotinamide ( tablet 25 mg ) , tablet , nicotinamide ( tablet 50 mg ) , tablet , nicoumalone 1 mg , nicoumalone 2mg tablet , nifedepine 10mg , nifedepine r 20mg , nilotinib 200mg , nimesulide 100 mg , nimodipine 30 mg tablet , nitazoxanide 500mg tablet , nitazoxanide dispersible 200 mg tablet , nitrocontin 2.6mg , nitrofurantoin ( 100mg ) , tablet / capsule , nitroglycerin 2.5 mg , nitroglycerine ( glyceryl trinitrate ) ( sublingual tab 0.5 mg ) , tablet , norfloxacin tab. 400mg , norfloxacine 400mg and tinidazole 600mg ( tab ) , tablet , ofloxacin + ornidazole ( 200mg and 500mg ) , tablet , ofloxacin 200mg +tinidazole 600mg ( tab ) , tablet , ofloxacin tab 400 mg , olanzapine ( 10 mg ) , tablet , olanzapine ( 2.5 mg ) , tablet , olanzapine ( 20 mg ) , tablet , olanzapine ( 5 mg ) , tablet , olanzapine ( 7.5 mg ) , tablet , olmesartan 10 mg , olmesartan 20mg , olmesartan medoxomil 20 mg+amlodipine 5 mg+hydrochlorothiazide 12.5 mg , olmesartan medoxomil 40 mg+amlodipine 5 mg , olmesartan medoxomil ( 40 mg ) , tablet , ondansetron ( tab 4 mg ) , tablet , ondansetron ( tab 8 mg ) , tablet , ornidazole tab ( 500 mg ) , tablet , oxcarbazepine ( 150 mg ) , tablet , oxcarbazepine ( 300 mg ) , tablet , oxcarbazepine ( 600 mg ) , tablet , oxybutynin hydrochloride 2.5mg tablets , paliperidone extended release 1.5 mg tablet , paliperidone extended release 3 mg tablet , pantaprazole ( 40mg tab ) , tablet , pantoprazole 40 mg, domperidone 10 mg ( tab ) , tablet , pantoprazole 40 mg+domperidone 30 mg , paracetamol suppositories 250mg , paracetamol ( 500mg ) , tablet , paracetamol ( 650mg ) , tablet , paroxetine cr ( 12.5 mg ) , tablet , pazopanib 200 mg tablet , penicillin v ( phenoxymethyl penicillin potassium ) ( 250 mg ) , tablet , pentoxyfylline ( 400 mg ) , tablet , pentoxyfylline ( 400 mg ) , tablet , perampanel film coated tablets 4mg , phenobarbitone ( 30 mg ) , tablet , phenobarbitone ( 60 mg ) , tablet , phenytoin sodium ( 100mg ) , tablet , pioglitazone ( 15 mg ) , tablet , pioglitazone ( 30 mg ) , tablet , piracetam ( 400mg ) , tablet , piracetam ( 800mg ) , tablet , posaconazole 100 mg tablet , pramipexol 0.50 mg tablet , pramipexole prolonged release 0.26 mg tablet , prazosin tab ( 10 mg ) , tablet , prazosin tab ( 5 mg ) , tablet , prednisolone ( 10 mg ( dt also acceptable ) ) , tablet , prednisolone ( 5 mg ( dt also acceptable ) ) , tablet , pregabalin ( 75mg ) , capsule , primaquin ( 15mg ) , tablet , primaquin ( 7.5mg ) , tablet , procyclidine hydrochloride 5 mg tablet , promethazine 25 mg tablet , propranolol ( 10 mg ) , tablet , propranolol ( 20 mg ) , tablet , propranolol la ( 40 mg ) , tablet , propylthiouracil tablets ip 50mg , prucalopride 2 mg film coated tablets , pyridoxine ( 40 mg ) , tablet , quetiapine ( 100 mg ) , tablet , quetiapine ( 200 mg ) , tablet , quetiapine ( 50 mg ) , tablet , quinine sulphate ( 300mg ) , tablet , ramipril ( 2.5 mg ) , tablet , ramipril ( 5 mg ) , tablet , ranitidine ( 150mg ) , tablet , ranolazine er 500 mg tablet , rifaximin 550 mg tablets , risperidone ( 0.5 mg ) , tablet , risperidone ( 2 mg ) , tablet , risperidone ( 4 mg ) , tablet , rivaroxaban 10 mg tablet , rivaroxaban 15 mg tablet , rivaroxaban 5 mg tablet , rivaroxaban film coated tablets 20 mg , rosuvastatin 20 mg , rosuvastatin ( 10 mg ) , tablet , sacubitril 24 mg+valsartan 26 mg , secnidazole film coated tablets 500 mg , sertraline ( 100 mg ) , tablet , sertraline ( 50 mg ) , tablet , sevelamer ( 400 mg ) , tablet , sevelamer ( 800 mg ) , tablet , sildenafil 25 mg , sildenafil ( 50 mg ) , tablet , silodosin ( 4 mg ) , tablet or capsule , silodosin ( 8 mg ) , tablet or capsule , sitagliptin 50 mg+metformin 500 mg , sitagliptin ( 100 mg ) , tablet , sitagliptin ( 50 mg ) , tablet , sodium bicarbonate 500 mg , sodium valproate ( 200mg ) , tablet , sodium valproate ( 300mg ) , tablet , sodium valproate ( 500mg ) , tablet , solifenacin succinate 5 mg , sorafenib ( 200mg ) , tablet , spironolactone 50mg + frusemide 20mg ( tablet ) , tablet , spironolactone ( 100mg ) , tablet , spironolactone ( 25mg ) , tablet , sulfamethoxazole and trimethoprim ( 100mg + 20mg ) , tablet , sulfamethoxazole and trimethoprim ( 800mg + 160mg ) , tablet , sulfasalazine 500 mg tablet , sulphamethoxazole 800mg + trimethoprim 160mg , tadalafil tablets ip 10 mg , tadalafil tablets ip 20 mg , tamoxifen ( 10 mg ) , tablet , tamoxifen ( 20 mg ) , tablet , tamsulosin + dutasteride 0.4 mg + 0.5 mg, tablet , tamsulosin ( 0.4mg ) , tablet , tapentadol 50 mg tablet , telmisartan 40 mg+amlodipine 5 mg , telmisartan 80 mg+amlodipine 5 mg , telmisartan 80 mg+hydrochlorothiazide 12.5 mg , telmisartan ( 40 mg ) , tablet , telmisartan, hydrochlorthiazide ( 40 mg + 12.5 mg ) , tablet , teneligliptin 20 mg , tenofovir disoproxil fumarate 300 mg , terbutaline sulphate 2.5 mg tablet , tetrabenazine 12.5mg tablet , tetrabenazine 20 mg tablet , tetrabenazine 25mg tablet , thiamine hydrochloride 200 mg tablet , thyroxine sodium tab 100 mcg ( 100 tab bottle ) , tablet , thyroxine sodium tab 12.5 mcg ( 100 tab bottle ) , tablet , thyroxine sodium tab 125 mcg ( 100 tab bottle ) , tablet , thyroxine sodium tab 137 mcg ( 100 tab bottle ) , tablet , thyroxine sodium tab 150 mcg ( 100 tab bottle ) , tablet , thyroxine sodium tab 25 mcg ( 100 per bottle ) , tablet , thyroxine sodium tab 50 mcg ( 100 tab bottle ) , tablet , thyroxine sodium tab 62.5 mcg ( 100 tab bottle ) , tablet , thyroxine sodium tab 75 mcg ( 100 tab bottle ) , tablet , thyroxine sodium tab 88 mcg ( 100 tab bottle ) , tablet , tianeptine sodium tablets 12.5 mg , tofacitinib 5mg tablet , tofacitinib extended release 11mg tablet , tolperisone hydrochloride 150 mg tablets , tolvaptan 15 mg , topiramate 100 mg , tablet , topiramate 25 mg , tablet , topiramate 50 mg , tablet , torsemide 10 mg+spironolactone 50 mg , torsemide ( 10mg ) , tablet , tramadol hydrochloride 37.5 mg / acetaminophen 325 mg tablets , tramadol ( 100mg ) , tablet , tramadol ( 50mg ) , tablet , tranexamic acid ( 500 mg tab ) , tablet , trifluoperazine tablets ip5 mg , trihexyphenidyl ( 2mg ) , tablet , trypsin 48 mg+bromelain 90mg+rutoside trihydrate 100mg tablet , ulipristal acetate 5 mg , ursodeoxy cholic acid 300 mg tablet , valganciclovir usp 450 mg tablet , valganciclovir usp 500 mg tablet , valganciclovir usp 900 mg tablet , valsartan 40 mg , venlafaxine er / pr ( 37.5 mg ) , tablet or capsule , venlafaxine hydrochloride extended release 150 mg capsule , venlafaxine hydrochloride extended release 75 mg capsule , venlafaxine ( 75 mg ) , capsule , verapamil hydrochloride prolonged release 120 mg , verapamil ( 40 mg ) , tablet , vilazodone hydrochloride tablets 20 mg , vilazodone hydrochloride tablets 40 mg , vildagliptin + metformin ( 50mg + 500mg ) , tablet , vildagliptin 100 mg tablet , vildagliptin 80mg , vildagliptin tab ( 50 mg ) , tablet , vitamin b complex nfi ( prophylactic ) ( b12 mg, b22mg, b6 0.5 mg, niacinamide 25 mg, calcium pantothenate 1 mg ) , tablet , vitamin b1 ( thiamine 100 mg ) , tablet , vitamin b1 ( thiamine 75 mg ) , tablet , voglibose ( 0.2 mg ) , tablet , voglibose ( 0.3 mg ) , tablet , voriconazole ( 200mg ) , tablet , voriconazole ( 100mg ) , tablet , voriconazole ( 50mg ) , tablet , vortioxetine hydrobromide tablets 10 mg , vortioxetine hydrobromide tablets 20 mg , vortioxetine hydrobromide tablets 5 mg , warfarin sodium ( 5 mg ) , tablet , zinc sulphate dispersible ( 20mg ) , tablet , zolpidem 10 mg, tablet , zonisamide 100 mg tablets , zonisamide 50 mg tablets...

Department of Higher Education - Madhya Pradesh

39658591 bids are invited for botany lab equipment autoclave portable 12x12 , centrifuge machine 3500 rpm 4 x 15 ml , compound microscope with 100x , digital colony counter , digital ph meter with electrode , dissecting microscope , distillation app.single cap 5 litre , electronic digital balance cap.0.01gm 600 gm , heating mantle 1 l or 500 ml , hot air oven size 14x14x14 s.s.chamber , magnetic stirrer with hot plate , rotary microtome heavy pattern , slide box 100 slides , slide box 50 slides , spectrophotometer digital 340nm 960nm , water soil testing kit digital , laminar air flow , water bath 6 hole double walled s.s.chamber total quantity : 65...

Department of Higher Education - Madhya Pradesh

39623903 bids are invited for digital ph meter autoclave portable 12 x 12 , centrifuge machine 3500 rpm 4 x 15 ml , cmos camera 5 mp image projection , compound microscope with 100x lens , digital colony counter , digital ph meter with electrode , digital spectrophotometer 340 960nm , dissecting microscope , distillation app single cap 5 litre , heating mantle 1 l or 500 ml , hot air oven size 14 x 14 x 14 s s chamber , magnetic stirrer with hot plate , bod cod analytical apparatus , slide box 50 slides , tlc kit with applicator , vortex shaker , water and soil testing kit digital , water bath 12 hole double walled s s chamber , analytical weight box 100 gm , chemical balance , chromatography cabinet 6 leaves , digital colorimeter with 8 filters , digital conductivity meter , digital do meter , digital potentiometer , electronic digital balance cap 0 01 gm 600 gm , heating mantle 1 l , kipps app , kjeldah digestion app with glass parts , melting point app , melting point app digital model , polarimeter half shade , vacumm pump , water bath 6 hole double walled s s chamber , soxhlet extraction app with glass parts , digital spectrophotometer 340nm 960nm , electronic digital balance cap 0 001gm 200 gm , compound microscope with 100x , electronic digital balance cap 0 01gm 600 gm , rotary microtome heavy pattern , slide box 100 slides , spectrophotometer digital 340nm 960nm , laminar air flow , thermometer digital , weight box , digital vernier callipers , screw gauge , shperometer , stop watch digital , sltotted weights hanger , resistance box various length , rheostate verious length , ammeter d c a c required range , voltmeter d c a c reguired range , galvanometer , miliammeter milivolmeter microammeter required range , plug key one way two way , reversing key , four way key , moarse key , battery eliminator , digital multimeter , soldering iron , travelling microscope , battery charger 2 to 12 volt , ballistic 1 100microscope , battery charger 2 to 12 volt , ballistic to determine the coefficient of thermal conductivity , sodium vapour lamp , transformer for sodium vapour lamp , mercury lamp , transformer of merury lamp , biprism , complete apparatus to determine the resolving power of a telescope , biquartz are half shade polarimeter , newtons ring apparatus complete with travelling microscope power supply and sodium level , electroscope or electrometer , audio frequency genertor , cro dual trace 30 megahertz single tress 10 megahertz , use of vibration magnetometer to study a field apparatus , tangent galvanometer , apparatus to supply resonance curve for lcr circuit and to determine the resonance and inductance using impedance at different frequency , apparatus for measurement of capacitance and inductance using impedance at different frequencies , apparatus to determine the value of plancks constant complete with photocell light show set of filter and power supply , complete apparatus to determine em using thomson method , complete apparatus to determine em by milikons method , apparatus to study the absorption spectra of iodine vapour complete with white light source power supply grating and spectrometer , apparatus to draw bh curve of ferromagnetic material with the help of cro , half wave and full wave rectififer apparatus with built in power supply , transistor characteristics apparatus with built in power supply and metres , apparatus to supply characteristic of tunnel diode , apparatus to study hysteresis curve of transformer core , apparatus to study specific resistance and energy gap of a semiconductor , apparatus to study transistorized regulated power supply , apparatus to study rc coupled amlifier with built in power supply , zener diode characteristics apparatus with bulit in power supply , apparatus to study charging and dischaging of a capacitor , desktop computer for programming practicals , complete setup to find the wavelength of sodium ligth with the help of fresnel biprism rail type optical bench , study of lissajous figure trainer , barton apparatus , digital oscilloscope , adjustable hegight stand , capillary tube packets of different radii , electrical laboratory kettle with varying voltages , platinum resistance thermometer , soldering station , desoldering tool , flywheel , themocouple apparatus , jeet apparatus to study characteristic curve , hall peobe apparatus , plane transmission grating , brewster law apparatus , beam divergence apparatus of helium neon laser , diode laser , holographic diffraction grating , michelson interferometer , logic gates apparatus or and not nand nor xor , stand tool 2 100logic gates apparatus or and not nand nor xor , stand tool box , connecting lead wire for electronic apparatus , total quantity : 551...

Department of Higher Education - Madhya Pradesh

39526714 bids are invited for development analytical balance , chemical balance digital , analytical weight box , fractional weight box , physical balance , digital photoelectric colorimeter , digital ph meter with electrode lcd , digital potentiometer , digital conductometer , do meter , digital naphelo turbidity meter , polari meter half shade , melting point apparatus , digital melting point apparatus , tlc kit , centrifuge , distillation apparatus , vacuum pump oil free , mixer small , water bath cu , heating mantle with energy regulator , water bath rectangular single walled , water bath rectangular double wall , kjeldahl distillation unit , microwave oven , blower , sprayer , magnetic stirrer , hot plate rectangular with stainless , vaccum pump , autoclave vertical cap 50 litre , auxanometer , blackmans apparatus , compound microscope , digital balance , digital colony counter , digital tds meter , dissecting microscope , distillation apparatus double , farmer s potometer , ganong s potometer , ganong s respirometer , heating mentle with regulator , magnetic stirrer with hot plate , molls half leaf apparatus , micro pipette fixed 1 5 ml , micro pipette variable 1 5 ml , ocular micrometer , ph meter digital , rotatory microtome with , slide cabinet with 12 showcase , slide reader , thin layer chromatography , water analysers , water and soil testing analysis kit digital , water bath double wall 12 , wilmott s bubbler , wooden press for herbarium , quadrats , digital thermometer , normal chromatographic , binocular dissecting , aquarium kit , autoclave portable , automatic burette , blood cell calculator , chart cds related to syllabus , digital haemoglobinometer , digital ph meter , dissecting tray , glucometer , haemocytometer , heating mantle with regulator cap 1 litre , high speed centrifuge , homogenizer , hot plate , microtome rotary , models specimen, bones of ug and pg , newtons disc , permanent slides , slide cabinet with 6 showcases , slide warming table , sphygmomanometer , staining racks , syringe needle destroyer , thin layer chromatography apparatus , vortex shaker , water bath 06 holes , water bath 12 holes , electrophoresis with power , supply , monocular microscope , oven 125 litres , water distillation apparatus , fet charactrstics , photo diode characterstics app , solar cell characterstics , hartley and colpitts oscillators , series and parallel resonance circuit , impedance and power factor of lcr circuit , study of hybrid parameter of a , transistor , lee app to det.the hear conductivity , comp.setup to find the wavelength of sodium light , physical balance , weight box , vernier calliper , screw gauge total quantity : 140...

Department of Higher Education - Madhya Pradesh

39521914 bids are invited for development water bath double wall 12 , wilmott s bubbler , wooden press for herbarium , quadrats , digital thermometer , normal chromatographic , binocular dissecting , aquarium kit , autoclave portable , automatic burette , blood cell calculator , chart cds related to syllabus , digital haemoglobinometer , digital ph meter , dissecting tray , glucometer , haemocytometer , heating mantle with regulator cap 1 litre , high speed centrifuge , homogenizer , hot plate , microtome rotary , models specimen, bones of ug and pg , newtons disc , permanent slides , slide cabinet with 6 showcases , slide warming table , sphygmomanometer , staining racks , syringe needle destroyer , thin layer chromatography apparatus , vortex shaker , water bath 06 holes , water bath 12 holes , electrophoresis with power , supply , monocular microscope , oven 125 litres , water distillation apparatus , fet charactrstics , photo diode characterstics app , solar cell characterstics , hartley and colpitts oscillators , series and parallel resonance circuit , impedance and power factor of lcr circuit , study of hybrid parameter of a , transistor , lee app to det.the hear conductivity , comp.setup to find the wavelength of sodium light , physical balance , weight box , vernier calliper , screw gauge total quantity : 140...

Department of Higher Education - Madhya Pradesh

39462540 bids are invited for development analytical balance , chemical balance digital , analytical weight box , fractional weight box , physical balance , digital photoelectric colorimeter , digital ph meter with electrode lcd , digital potentiometer , digital conductometer , do meter , digital naphelo turbidity meter , polari meter half shade , melting point apparatus , digital melting point apparatus , tlc kit , centrifuge , distillation apparatus , vacuum pump oil free , mixer small , water bath cu , heating mantle with energy regulator , water bath rectangular single walled , water bath rectangular double wall , kjeldahl distillation unit , microwave oven , blower , sprayer , magnetic stirrer , hot plate rectangular with stainless , vaccum pump , autoclave vertical cap 50 litre , auxanometer , blackmans apparatus , compound microscope , digital balance , digital colony counter , digital tds meter , dissecting microscope , distillation apparatus double , farmer s potometer , ganong s potometer , ganong s respirometer , heating mentle with regulator , magnetic stirrer with hot plate , molls half leaf apparatus , micro pipette fixed 1 5 ml , micro pipette variable 1 5 ml , ocular micrometer , ph meter digital , rotatory microtome with , slide cabinet with 12 showcase , slide reader , thin layer chromatography , water analysers , water and soil testing analysis kit digital , water bath double wall 12 , wilmott s bubbler , wooden press for herbarium , quadrats , digital thermometer , normal chromatographic , binocular dissecting , aquarium kit , autoclave portable , automatic burette , blood cell calculator , chart cds related to syllabus , digital haemoglobinometer , digital ph meter , dissecting tray , glucometer , haemocytometer , heating mantle with regulator cap 1 litre , high speed centrifuge , homogenizer , hot plate , microtome rotary , models specimen, bones of ug and pg , newtons disc , permanent slides , slide cabinet with 6 showcases , slide warming table , sphygmomanometer , staining racks , syringe needle destroyer , thin layer chromatography apparatus , vortex shaker , water bath 06 holes , water bath 12 holes , electrophoresis with power , supply , monocular microscope , oven 125 litres , water distillation apparatus , fet charactrstics , photo diode characterstics app , solar cell characterstics , hartley and colpitts oscillators , series and parallel resonance circuit , impedance and power factor of lcr circuit , study of hybrid parameter of a , transistor , lee app to det.the hear conductivity , comp.setup to find the wavelength of sodium light , physical balance , weight box , vernier calliper , screw gauge total quantity : 140...

Department of Higher Education - Madhya Pradesh

39461448 bids are invited for ph meter autoclave portable 12 x 12 , centrifuge machine 3500 rpm 4 x 15 ml , cmos camera 5 mp image projection , compound microscope with 100x lens , digital colony counter , digital ph meter with electrode , digital spectrophotometer 340 960nm , dissecting microscope , distillation app single cap 5 litre , heating mantle 1 l or 500 ml , hot air oven size 14 x 14 x 14 s s chamber , magnetic stirrer with hot plate , bod cod analytical apparatus , slide box 50 slides , tlc kit with applicator , vortex shaker , water and soil testing kit digital , water bath 12 hole double walled s s chamber , analytical weight box 100 gm , chemical balance , chromatography cabinet 6 leaves , digital colorimeter with 8 filters , digital conductivity meter , digital do meter , digital potentiometer , electronic digital balance cap 0 01 gm 600 gm , heating mantle 1 l , kipps app , kjeldah digestion app with glass parts , melting point app , melting point app digital model , polarimeter half shade , vacumm pump , water bath 6 hole double walled s s chamber , soxhlet extraction app with glass parts , digital spectrophotometer 340nm 960nm , electronic digital balance cap 0 001gm 200 gm , compound microscope with 100x , electronic digital balance cap 0 01gm 600 gm , rotary microtome heavy pattern , slide box 100 slides , spectrophotometer digital 340nm 960nm , laminar air flow , thermometer digital , weight box , digital vernier callipers , screw gauge , shperometer , stop watch digital , sltotted weights hanger , resistance box various length , rheostate verious length , ammeter d c a c required range , voltmeter d c a c reguired range , galvanometer , miliammeter milivolmeter microammeter required range , plug key one way two way , reversing key , four way key , moarse key , battery eliminator , digital multimeter , soldering iron , travelling microscope , battery charger 2 to 12 volt , ballistic 1 101microscope , battery charger 2 to 12 volt , ballistic to determine the coefficient of thermal conductivity , sodium vapour lamp , transformer for sodium vapour lamp , mercury lamp , transformer of merury lamp , biprism , complete apparatus to determine the resolving power of a telescope , biquartz are half shade polarimeter , newtons ring apparatus complete with travelling microscope power supply and sodium level , electroscope or electrometer , audio frequency genertor , cro dual trace 30 megahertz single tress 10 megahertz , use of vibration magnetometer to study a field apparatus , tangent galvanometer , apparatus to supply resonance curve for lcr circuit and to determine the resonance and inductance using impedance at different frequency , apparatus for measurement of capacitance and inductance using impedance at different frequencies , apparatus to determine the value of plancks constant complete with photocell light show set of filter and power supply , complete apparatus to determine em using thomson method , complete apparatus to determine em by milikons method , apparatus to study the absorption spectra of iodine vapour complete with white light source power supply grating and spectrometer , apparatus to draw bh curve of ferromagnetic material with the help of cro , half wave and full wave rectififer apparatus with built in power supply , transistor characteristics apparatus with built in power supply and metres , apparatus to supply characteristic of tunnel diode , apparatus to study hysteresis curve of transformer core , apparatus to study specific resistance and energy gap of a semiconductor , apparatus to study transistorized regulated power supply , apparatus to study rc coupled amlifier with built in power supply , zener diode characteristics apparatus with bulit in power supply , apparatus to study charging and dischaging of a capacitor , desktop computer for programming practicals , complete setup to find the wavelength of sodium ligth with the help of fresnel biprism rail type optical bench , study of lissajous figure trainer , barton apparatus , digital oscilloscope , adjustable hegight stand , capillary tube packets of different radii , electrical laboratory kettle with varying voltages , platinum resistance thermometer , soldering station , desoldering tool , flywheel , themocouple apparatus , jeet apparatus to study characteristic curve , hall peobe apparatus , plane transmission grating , brewster law apparatus , beam divergence apparatus of helium neon laser , diode laser , holographic diffraction grating , michelson interferometer , logic gates apparatus or and not nand nor xor , stand tool 2 101logic gates apparatus or and not nand nor xor , stand tool box , connecting lead wire for electronic apparatus , total quantity : 551...

Department of Higher Education - Madhya Pradesh

39246120 bids are invited for chemical balance , paper chromatography testing kit , ph meter digital with electrodes , melting point apparatus digital , d o meter digital , oven universal , potentiometer digital , flame photometer digital , spectrophotometer 340 900 nm , water soil testing kit digital , digital thermostate , cod digestion apparatus , bod incubator , soxhlet apparatus , polarimeter half shaded , vaccum pump , water bath , double wall , measurement of wavelength of he ne laser using ruler with laser complete setup , fiber optics trainer , study of hall effect complete setup , stop watch digital , study of active and passive filter , pulse width and pulse position modulation and demodulation trainer , study of frequency modulation and demodulation trainer , 8086 microprocessor with smps , function generator b 1 hz to 10 mhz , zener regulated power supply , impedance and power factor of lcr circuit , series and parallelresonance circuit , clipping and clamping circuit using operational amplifier , power amplifier , newtons ring apparatus complete with travelling microscope power supply and sodium lamp , stop clock , vernier caliper , travelling microscope , inertia table , photo diode characterstics apparatus , dielectric constant apparatus , complete apparatus to determine em using thomsons method , lees apparatus to determine the hear conductivity of bad conductors of different geometry , mosfet characteristic apparatus , apparatus to determine the value of planks constant complete with photocell light source set of filter and power supply , apparatus to study specific resistance and energy gap of a semiconductor. , fet characteristic apparatus , transistor characteristics apparatus with built in power supply and meters , solar cell characteristic apparatus , single stage and double stage rc coupled amplifier feed back amplifier , battery charger 2 to 12 volt , apparatus to study response curve for lcr circuits and to determine the resonance frequency , study of amplitude modulation and demodulation trainer , ph meter , autoclave vertical cap 50 lit , rotary microtome with aceesories , compound microscope , dissecting microscope , oven , water and soil testing kit , flame photometer , spectrophotomeyter 340 900 nm , research microscope , thin chromatography kit , autoclave vertical , distillation apparatus single distillation capacity 3lt , water bath double wall 12 holes stainless steel , incubator stainless steel , autoclave portable , thin layer chromatography kit , vortex shaker , centrifuge machine 3500 rpm , hot air oven stainless steel , digital colony counter , binocular microscope , electronic digital balance , laminar air flow horizontal , uv single beam spectrophotometer , image projection system , backup power supply unit total quantity : 100...

Department of Higher Education - Madhya Pradesh

39246108 bids are invited for boqboq 1 28 incubator stainless steel , centrifuge machine 3500 rpm , hot air oven stainless steel , laminar air flow horizontal , image projection system , backup power supply unit , ph meter , autoclave vertical cap 50 lit , rotary microtome with aceesories , water bath double wall , research microscope , thin chromatography kit , measurement of wavelength of he ne laser using ruler with laser complete setup , study of hall effect complete setup , zener regulated power supply 2 , impedance and power factor of lcr circuit , series and parallelresonance circuit , newtons ring apparatus complete with power supply and sodium lamp , travelling microscope , inertia table , photo diode characterstics apparatus , complete apparatus to determine em using thomsons method , lees apparatus to determine the hear conductivity of bad conductors of different geometry , apparatus to determine the value of planks constant complete with photocell light source set of filter and power supply , apparatus to study specific resistance and energy gap of a semiconductor. , transistor characteristics apparatus with built in power supply and meters , battery charger 2 to 12 volt. , paper chromatography testing kit , d o meter digital , flame photometer digital , spectrophotometer 340 900 nm , water soil testing kit digital , soxhlet apparatus with all glass assimably , polarimeter half shaded , vaccum pump , water bath , double wall total quantity : 38...

Netaji Subhash Chandra Bose Medical College - Madhya Pradesh

39177951 supply of kits, chemicals, stationary and general items , supply of kits, chemicals, consumables, stationary, & glass ware , manual kits , l block ( brass ) each , hot plate each ( 37 100 degree celcius ) , copper plate ( 1.5 x 1 inch ) , amonium sulphate crystals ( 100 gms ) , d. glucose ( 100 gms ) , dextrose monohydrate ( 500 gm ) , bile salt powder ( 500 gms ) , blood urea kit ( 500 test ) kit , s. creatinine ( 500 test ) kit , s. triglycride ( 500 test ) kit , s. total protine ( 500 test ) kit , s. albumin ( 500 test ) kit , s. cholestrol ( 500 test ) kit , trisodium citrate ( 500gms ) , cupric sulphate ( 500 gms ) , sodium hydrogen carbonate ( 500 gms ) , shyphilis strip ( 100 test ) ( tulip / span / reckon / deacon ) , eeg gel ( 500 ml ) , reticlocyte count reagent ( 500 ml ) , acid phosphates kit ( 100test ) , albuminkit ( 100 gms ) , alkaline phosphates kit ( 500 gms ) , amylase ( 500 ml ) , aptt ( 500 ml ) , aso titre test ( 96 tes ) , billirubin direct ( 100 tset ) , billirubin total ( 100 test ) , mercuric sulphate ( 500 gms ) , sodium nitroprusside ( 500 gms ) , sodium meta by sulphate ( 500 gms ) , chicken gunia rapid kit igm ( 100 test ) , cholesterol kit ( 100 test ) , ck mb ( 100 test ) , cpk mb ( 100 test ) , c reactive protein ( 100 test ) , sodium n+ ( 100 test ) , crp kit ( 100 test ) , csf protein ( 100 test ) , dengue rapid kit for igg & igm ( 100 test ) , robertson cooked media ( 500 gms ) , drinking water testing ( 12 parameters ) , potasium k+ ( 100 test ) , g6pd kit ( 100 test ) , glucose kit god method ( 500 test ) , glycosylate hb% ( 100 test ) , hbsag card test ( each ) , mountax test 5 tu / ppd ( 100 test ) , pragnancy test hcg card test ( 100 test ) , pregnancy test, latex agglutination inhibition test ( 100 test ) , prothombin time kit ( 5 ml ) , ra factor test ( 100 test ) , rapid test kit for anti hcv ab ( 100 test ) , s.acid phosphtac ( 100 test ) , s.alkaline phosphate ( 100 test ) , s.analyese ( 100 test ) , s.cholestrol kit ( 100 test ) , s.glucose kit ( 100 test ) , s.h.d.l. ( 100 test ) , s.triglyceride ( 100 test ) , s.uric kit ( 100 test ) , serum bilirubin kit ( 100 test ) , serum calcium kit ( 100 test ) , serum creatinine kit ( 100 test ) , serum protein kit ( 100 test ) , serum uric acid kit ( 100 test ) , sgot ( 100 test ) , sgpt ( 100 test ) , t3 elisa test kit ( 100 test ) , t4 elisa test kit ( 100 test ) , total protein ( 100 test ) , triglyceride kit ( 100 test ) , tsh elisa test kit ( 100 test ) , urea enzymatic ( 100 test ) , sabourauds dextrose agar with chloramphenicol medium ( 500gms ) , sabourauds dextrose agar with brain heart infusion agar ( 500gms ) , lactophenol cotton blue ( 10gms ) , glycerol ( laboratory grade ) ( 500 ml ) , mccartney bottle ( 500 gms ) , edta disodium salt ( 500 gms ) , barium chloride powder ( 500 gms ) , urea kit ( 100 test ) , vdrl card test tpha ( 100 test ) , vdrl latex test / rpr ( 100 test ) , widal kit ( 100 test ) , widal test ( 100 test ) , isoamyl alchohol ( 500 ml ) , hcl ( 500 ml ) , phenol red powder ( 500 gms ) , bakout ( 20 ltr ) , finit ( 10 ltr ) , k.telurite blood agar ( himedia ) ( 100 gms ) , hi.viral tranport medium ( himedia ) ( 100 tubes ) , cetrimide agar ( himedia ) ( 100 gms ) , caryblair transport medium ( himedia ) ( 100 gms ) , wilson blair agar ( himedia ) ( 100gms ) , agar powder ( himedia ) ( 500 gms ) , sabouraud dextrose agar ( himedia ) ( 500gms ) , urea agar base ( himedia ) ( 500 gms ) , tsi agar ( himedia ) ( 500 gms ) , muller hinton medium powder ( himedia ) ( 100gms ) , ma conkey agar powder veg ( himedia ) ( 500 gms ) , nutrient agar powder veg. ( himedia ) ( 500 gms ) , t.c.b.s.agar powder veg ( himedia ) ( 500 gms ) , geletin agar ( himedia ) ( 500 gms ) , deoxycholate citrate agar ( himedia ) ( 500 gms ) , simmons citrate agar ( himedia ) ( 500 gms ) , bordet gengoue media ( himedia ) ( 500 gms ) , xld agar ( himedia ) ( 500 gms ) , hektoen enteric agar ( himedia ) ( 500 gms ) , lj media slants ( himedia ) ( 500 gms ) , lj media with first line antitubercrular drugs ( himedia ) ( 500 gms ) , cled medium ( himedia ) ( 500 gms ) , triptycase tellurite agar ( himedia ) ( 500 gms ) , brin heart infusion broth ( himedia ) ( 500 gms ) , brain heart infusion agar ( himedia ) ( 500 gms ) , columbia blood agar base ( himedia ) ( 500 gms ) , thioglycolate broth ( himedia ) ( 500 gms ) , lofflers medium base ( himedia ) ( 100 gms ) , moellers decarboxylase broth with arginine ( himedia ) ( 100 gms ) , moellers decarboxylase broth with lysine ( himedia ) ( 100 gms ) , moellers decarboxylase broth with ornithine ( himedia ) ( 100 gms ) , corn meal agar ( himedia ) ( 100 gms ) , tretrazolium reduction media ( himedia ) ( 100 gms ) , hichrome candida differential media ( himedia ) ( 100 gms ) , bile esculin agar ( himedia ) ( 100 gms ) , pvr broth ( himedia ) ( 100 gms ) , pvr reagent ( himedia ) ( 100 gms ) , kits, chemicals, strains & antibiotic sensitivity discs , iso propyl alchohol ( 1 liters ) ( merck / qualigen / fisher ) , benzene ( 1 liters ) ( merck / qualigen / fisher ) , formaline ( 1 liters ) ( merck / qualigen / fisher ) , hematoxyline powder ( fisher / loba ) ( 500 ml ) , dpx ( 500ml ) ( merck / qualigen / fisher ) , microtome blade ( leica / chile ) ( 50 nos per packet ) , alluminium potassium sulphate ( 1kg ) ( merck / qualigen / fisher ) , mercuric oxide ( 100 gm ) ( merck / qualigen / fisher ) , carbolic soap ( 500 ml ) , ammonium potassium sulphate ( 500 gm ) , nitric acid ( 500 ml ) , hiv kit elisa ( 96 test ) ( tulip / transasia / span / sd / j.mitra / meril ) , hiv kit rapid ( 96 test ) ( tulip / transasia / span / sd / j.mitra / meril ) , hcv kit elisa ( 96 test ) ( tulip / transasia / span / sd / j.mitra / meril ) , hcv kit rapid ( 96 test ) ( tulip / transasia / span / sd / j.mitra / meril ) , hbsag kit elisa ( 96 test ) ( tulip / transasia / span / sd / j.mitra / meril ) , hbsag kit rapid ( 96 test ) ( tulip / transasia / span / sd / j.mitra / meril ) , rpr ( vdrl ) kit ( 500 test ) ( tulip / span / reckon / beacon ) , rpr kit strip ( 100 test ) , malaria pf / pv test kit ( 500 test ) ( tulip / span / sd / j.mitra / meril / oscar ) ) , neomycin ( 500 discs ) , norfloxacin ( 500 discs ) , ofloxacin ( 500 discs ) , pencillin ( 500 discs ) , pipracillin + tazobactum ( 500 discs ) , tobramycin ( 500 discs ) , sterptomycin ( 500 discs ) , ticarcillin ( 500 discs ) , optochin ( 100 discs ) , bacitracin ( 500 discs ) , cefoperazone sulbactum ( 500 discs ) , clindamycin ( 500 discs ) , doxcyline ( 500 discs ) , erythromycin ( 500 discs ) , cefuroxime sodium 30mcg ( 500 discs ) , pipracillin ( 500 discs ) , netillin ( 500 discs ) , gentmycin ( 500 discs ) , levofloxacin ( 500 discs ) , cloxacillin ( 500 discs ) , imipenem10mcg ( 500 discs ) , ertapenem10mcg ( 500 discs ) , meropenem10mcg ( 500 discs ) , doripenem10mcg ( 500 discs ) , ceftazidime / clavulanic acid caz / ca 30 / 10mcg ( 500 discs ) , cefotaxime / clavulanic acid ctx / ca 30 / 10mcg ( 500 discs ) , aztreonam30mcg ( 500 discs ) , ceftazidime30mcg ( 500 discs ) , cefotaxime30mcg ( 500 discs ) , ceftriaxone 30mcg ( 500 discs ) , cefoxitin 30mcg ( 500 discs ) , cefepime30mcg ( 500 discs ) , sparfloxacin 5mcg ( 500 discs ) , novobiocin30mcg ( 200 discs ) , amoxycillin clavulanic acid 20 / 10mcg ( 500 discs ) , cephotoxime ( 500 discs ) , clarithromycin 15mcg ( 500 discs ) , co trimoxazole1.25 / 23.75mcg ( 500 discs ) , piperacillin100mcg ( 500 discs ) , vancomycin30mcg ( 500 discs ) , netilmicin30mcg ( 500 discs ) , kanamycin 30mcg ( 500 discs ) , ampicillin 10mcg ( 500 discs ) , azithromycin 15mcg ( 500 discs ) , carbenicillin100mcg ( 500 discs ) , ceacals30mcg ( 500 discs ) , cefoperazone 75mcg ( 500 discs ) , ceftizoxime30mcg ( 500 discs ) , nalidixic acid 30mcg ( 500 discs ) , ceftazidime avibactam 30 / 20mcg ( 500 discs ) , ceftolozane tazobactam 30 / 10mcg ( 500 discs ) , ceftaroline 30mcg ( 500 discs ) , amikacin30mcg ( 500 discs ) , fosfomycin 200mcg ( 500 discs ) , nitrofurantoin 30mcg ( 500 discs ) , sulfisoxazole 250mcg / 300mcg ( 500 discs ) , linezolid 30mcg ( 500 discs ) , caspofungin 5mcg ( 500 discs ) , fluconazole 25mcg ( 500 discs ) , voriconazole 1 mcg ( 500 discs ) , ltraconzaole 10mcg ( 500 discs ) , amphotericin b 100mcg ( 500 discs ) , ketoconazole 50mcg ( 500 discs ) , nystatin i00iu ( 500 discs ) , anti abd monoclonal ( igm ) 10ml , staphylococcus aureusatcc 25923 ( himedia ) , escherichia coli atcc 25922 ( himedai ) , psuedomonas aeruginosa atcc 27853 ( himeda ) , enterococcus faecalisatcc 29212 ( susceptlble ) , atcc51299 ( reslstant ) , salmonela shigella agar ( 500 gms ) , bear extract powder ( 500 gms ) , petri dish ( 100 mm glass ) , petridish big size ( glass ) ( 150 mm* 20 mm ) , petridish medium size ( glass ) ( 100 mm* 17 mm ) , toluidine blue ( 100 gm ) , ethyl alcogol ( 500 ml ) , glycerol ( reagent grade ) ( 500 ml ) , magnesium citrate ( 500 gm ) , asparagine ( 100 gm ) , boric acid ( 500 ml ) , amyl alcohol ( 500 ml ) , mono potassium phosphate ( 500 gm ) , disodium phosphate ( 500 gm ) , xylose ( 100 gm ) , iodine ( 100 gm ) , potassium tellurite ( 100 gm ) , potassium chloride ( 500 gm ) , india ink ( 100 ml ) , l.j. ( lowenstein jensen ) media ( ready to use ) ( 50 bottles ) , lacto phenol cotton blue stain ( ready to use ) ( 100 ml ) , dermatophyte test media ( 500 gm ) , bird seed agar / niger seed agar ( 500 gm ) , potato dextrose agar ( 500 gm ) , hichrome agar for candida ( 500 gm ) , cornmeal agar ( 500 gm ) , tetrazolium reduction medium ( 500 gm ) , vdrl glass slide ( 10 pieces ) , teasing / dissecting needles10 pieces , anti d blend, monoclonal ( igm + igg ) anti sera , anti a1 lectin ( 10 ml ) ( tulip / span ) , anti ab monoclanal ( 5ml ) ( tulip / span ) , anti h ( 10ml ) ( tulip / span ) , activated papain enzyme stablized solution , anti c ( 2ml ) ( tulip / span ) , anti e ( 2ml ) ( tulip / span ) , anti e ( 5ml ) ( tulip / span ) , coombs anti sera ( 5ml ) ( tulip / span ) , id gel cross match card ( ahg ) ( tulip / dimed ) test card , gel diluent tulip / dimed ( per liter ) , sterile swab stick for culture ( 100 nos per pack ) , blood lable sticker ( multiple color ) ( 8.5 x 8.5 cm ) each , blood bag double 350ml ( hll / jmitra ) ( each ) , blood bag double 450 ml ( hll / jmitra ) ( each ) , blood bag triple 350ml ( hll / jmitra ) ( each ) , single donor platelet / plasma kit, with acd a bag 500ml ( for apheresis ) , usg jelly ( 500 ml ) , mannitol ( 100 gms ) , absolute alcohol ( 500 ml ) , acetone ( 500 ml ) , albumin flakes ( 500 gms ) , alpha naphthol ( 100 gms ) , alpha naphthylamine ( 25gms ) , ammonium di hydrogen phosphate ( 500 gms ) , ammonium molybdat ( 500 gms ) , ammonium oxalate ( 100gms ) , ammonium sulphate ( 500 gms ) , barium chroride , basic fuschin ( 100 gms ) , benzidine powder ( 500 gms ) , betadin solution ( 500 gms ) , bile salt agar ( 500 gms ) , bismuth ammonium citrate ( 100 gms ) , bleaching powder ( 1 kg ) , blood group anti sera abd set monoclonal ( igm & igg ) ( 10 ml ) ( tulip ) , blood group anti sera a set monoclonal ( igm ) ( 10 ml ) ( tulip ) , blood group anti sera b set monoclonal ( igm ) ( 10 ml ) ( tulip ) , blood group anti sera d set monoclonal ( igm ) ( 10 ml ) ( tulip ) , bole billiverdin ( 500 ml ) , bromine liquid ( 25 ml ) , bromothymol blue ( 5 gms ) , calcium pure ( 500 gms ) , casein ( 500 gms ) , conc. h2so4 ( 500 ml ) , conc. hno3 ( 500 ml ) , concentrated hcl ( 500 ml ) , copper acetate ( 500 gms ) , cotton roll ( each roll ) , creatinine powder ( 500 gms ) , crystal voilet ( 500gms ) , cuso4 crystal ( 250 gms ) , d.p.x. mount , dextrose ( 500 gms ) , di methyl amino benzaldehyde ( 100 gms ) , di pot. hydrogen phosphate ( 100 gms ) , di sodium ortho phosphate ( 500 gms ) , dibasic sod. phosphate ( 100 gms ) , disodium hydrogen phosphate ( 100 gms ) , distill water 5 ltr , e.d.t.a. powder , ecg jelly 250 gm , eosin ( cdh / merck ) ( 100 gms ) , eosin stain ( for histology staining ) , ferric chloride ( fecl3 ) , field stain a&b , l moulds ( each ) , fontana stain ( 100 gms ) , formaldehyde ( formalin ) 37% , eosin spirit soluble ( himedia / qualigens / loba ) ( 1 gms ) , disposable plastic tissue capsule cover each , tissue casette steel each , tissue capsule with cover ( 20*20*10 ) ( each ) , formaldehyde 40% 200 kg pack , formaldehyde 40% 500 ml pack , fructose ( 500 gms ) , gelatin ( 500 gms ) , giemsa powder ( 500 gms ) , giemsa stain ( 500 gms ) , glacial acetic acid ( 1000 ml ) , glucose ( 500 gms ) , glycerine ( 500 gms ) , gms stain ( each kit ) , cefezolin ( 500 discs ) , hand lotion 250ml antiseptic washing , hand sanitizers ( 500 ml bottel ) , hydrogen peroxide ( 500gms ) , cefaparazone ( 500 discs ) , hydrogen peroxide soln 20% , india ink ( 5 ml ) , ciproflaxcin ( 500 discs ) , kovacs indole reagent ( 100 ml ) , l.asparagine ( 100 gms ) , lactic acid ( 1 ltr ) , lactophenol cotton blue , lactose ( 500 gms ) , lead acetate strips ( 500 gms ) , leishman stain solution ( 500ml ) , lens cleaner 2000ml , liquid paraffin heavy ( 500 gms ) , liquid praffin ( 500ml ) , liquid ammonia ( 500 ml ) , lysozyme ( 1 gms ) , malachite green ( 25gms ) , maltose ( 500 gms ) , naladixix acid ( 500 discs ) , methanol , methyl red ( ph indicator ) ( 25gms ) , methyl violet ( 100 gms ) , methylene blue ( 100 gms ) , na natroprusside , nalc powder ( 25 gms ) , neutral red indicator ( 25 gms ) , paraffin wax make merk / ran / kem / fisher / qualigen ( 500 gms ) , paraffin wax roll for test tube sealing , peptone ( 500 gms ) , reticulocytes reagent ( 500 ml ) , ph strips ( ph 1 10 ) ( 25 packets ) , sealing alumium cap 20 mm each , ctg paper roll make bpl ( each ) , urine strip 10 parameter ( 100 strip per pack ) , urine strip 2 parameter ( 100 strip per pack ) , phenol crystal ( 500 gms ) , phenolphthalein ( 100 gms ) , phenyl hydrazine hydrochloride ( 100 gms ) , phosphate pure , picric acid ( 500 gms ) , pot. dichromate ( 500 gms ) , pot. hydroxide ( 500 gms ) , potasium alum per kg , potassium iodide ( 100gms ) , rectified spirit 500 ml , ressorcinol ( 500 gms ) , saffranine ( 100 gms ) , salphate pure , silver nitrate ( 500 gms ) , sodium acetate ( 500 gms ) , sodium carbonate ( 100 gms ) , sodium chloride ( 1 kg pack ) , sodium dihydrogen phosphate ( 100 gms ) , sodium hydroxide ( 5 ltr ) , sodium hydroxide ( flakes ) , sodium hydroxide pellets ( 500gms ) , sodium hypochloride ( 500 gms ) , sodium sulphate ( 500 gms ) , sodium taurocholate ( bile salt ) ( 500 gms ) , spirit ( 400 ltr ) , starch ( 500 gms ) , sterile container ( each ) , sucrose ( 500 gms ) , sulphur powder ( 500 gms ) , sulphuric acid ( 500 ml ) , tetra methylparaphenyl diaminodihydro chloride ( oxidase reagent ) ( 25gms ) , thallus acetate ( 1 gms ) , thymol crystals ( 1 gms ) , tincture benzoin co , tri sodium citrate ( 100 gms ) , trichloro acetic acid ( 1000 ml ) , urea ( 100 gms ) , urea powder , filter paper no. ( standard size ) , xyline ( 1liters ) ( merck / qualigen / fisher ) , yeast extract powder ( 100 gms ) , molecular water ( nucleous free / rnsa dnsa free ) ( 500 ml pack ) , kh2po4 ( 500 gms ) , beaf exract powder ( 500 gms ) , magnisium sulphate ( 500 gm ) , kits, chemicals, strains & glass ware & others , tissue paper roll each , blood collection vial with color cap ( edta ) , blood collection vial with color cap ( citrate ) , blood collection vial with color cap ( plain ) , amplifire for neurograph , anaerobic gas pack for 3.5 lit capacity, disposable oxygen absorbing, carbon dioxide generating agent used in anaerobic system no need to use catalysts or pressure gauge , anaerobic indicator tables for anaerobic system ( for anaerobic system ) , anaerobic system rubber rings ( for anaerobic system ) , arnold sterilizer , needle disposal 22 gauge 1 ( each ) , b.p. blade 24 no. , beaker ( 1000cc ) , beaker ( 100cc ) , beaker ( 500cc ) , beaker ( 50cc ) , beaker 100ml , beaker 200ml , blood bag tube stripper mannual , bone marrow aspiration needle ( 16, 18, 20 no. ) , bone marrow trephine biopsy needle , bottle with clear transparent glass 50ml , capillary tube 1 mm ( long ) , capillary tube 1mm or all size , centrifuge tube 15ml , centrifuge tube 2ml ( p.p ) , seftazidime avibactum ( 500 discs ) , charging droppers , collection vail 2ml , collection vail 5ml , colony counter digital for bacteriology, digital display to cout 9999 , colorimeter cuvetts , conical flask flat bottom ( 1000cc ) , conical flask flat bottom ( 250cc ) , conical flask flat bottom ( 500cc ) , conical flask flat bottom ( 50cc ) , coplins jar50ml , coppling jars ( horizontal ) , demonstration stethoscope with multiple earpiece , distilled water plant ( all glass ) , dropping bottel , dropping bottles for stains ( plastic ) , durhams tube , e.s.r. tube , ecg roll , eeg electrodes for neurograph , esr tube ( wwstergren ) , flask bottom flask 2 ltr capaciy , flat bottom flask 5 liter capacity , flat bottom ph electrode for ph determination for use on soft moist surface like agar gel plate and both on solid and semisolid surface , funnel , glass pipetts each of each size , glass slide ( sunbeam / bluestar ) , glass slide ( size 75x25 mm ) thickness , glass slide ( size 76x26 mm ) thickness 1.35mm , glass slide ( size 76x22mm ) thickness :1.45mm ) , glass trough pneumatic , seftaroline ( 500 discs ) , haemocytometer ( each ) , haemoglobinometer ( sahils ) , hammer ( reflex ) ( each ) , hb tube ( each ) , ink well for neurograph , jar glass ( 2ltr ) , lovibond comparators , lp bone marrow needle , lp needle ( top spinal ) 22x89mm , mackartaneys bottle , maker pen for digital colony counter , measuring cylinder 1000ml , measuring cylinder 100ml , measuring cylinder 500ml , micro coverslips ( 18mmx18mm ) square , micro coverslips ( 19mmx19mm ) square , micro coverslips ( 22mmx22mm ) square , micro coverslips ( 22mmx25mm ) rectangular , micro coverslips ( 22mmx30mm ) rectangular , micro coverslips ( 22mmx40mm ) rectangular , micro coverslips ( 22mmx500mm ) rectangular ( special ) , micro coverslips ( 22mmx50mm ) rectangular , micro coverslips ( 22mmx60mm ) rectangular ( special ) , micro coverslips ( 24mmx24mm ) square ( special ) , micro coverslips ( 24mmx40mm ) rectangular ( special ) , micro coverslips ( 24mmx60mm ) rectangular ( special ) , micro coverslips ( 25mmx50mm ) rectangular ( special ) , micro coverslips ( 25mmx60mm ) rectangular ( special ) , micro coverslips 18mm circular , micro coverslips 19mm circular , micro coverslips 22 mm circular , micro coverslips 24mm circular , micro pippete 10 ul , micro pippete 20 ul , micro pippette 1000 ul , micro pippette 100ul , micro pippette 200 ul , micro pippette 50 ul , micro pippette ( 0 50ul ) , micro pippette 500ul , micro pippette tips ( 200 1000ul ) , micro pippette tips ( 2 200ul ) , micro tips yellow size small , micrometer stage , micropipate ( 00 to 210 micro litter ) , micropipate ( 00 to 1500 microlitter ) , micropipette tips 0 200 ?l , micropipette tips 1000 ?l , micropipette tips 200 ?l , microscope oil immersion moveable stage abbe condenser etc , multichannel micropipette 10?l ( fixed volume, 8 channel with built in tip ejector , multichannel micropipette 100?l ( fixed volume, 8 channel with built in tip ejector , multichannel micropipette 200?l ( fixed volume, 8 channel with built in tip ejector , multichannel micropipette 50?l ( fixed volume, 8 channel with built in tip ejector , museum jar ( rectangular with lid ) , anti sera e coli ( 5 amplues ) , anti sera shigella ( 5 amplues ) , anti sera vibrio ( 5 amplues ) , anti sera salmonella ( 5 amplues ) , patri dish 9cm glass , shigella ( lyophilized culture ( 173204 ) ( pack 2 stick ) , vibrio ( lyophilized culture ( 173204 ) ( pack 2 stick ) , klebsella ( lyophilized culture ( 173204 ) ( pack 2 stick ) , proteus ( lyophilized culture ( 173204 ) ( pack 2 stick ) , salmonella ( lyophilized culture ( 173204 ) ( pack 2 stick ) , alkaline bile salt agar ( himeda ) ( 500 gms ) , monsurs gelatin tourochalate ( himedia ) ( 100 gms ) , pcv tube ( wintrobe ) , petri plate carrier for 10 paltes anerobic system , ph meter digital each , pippete 1ml , pippete 5ml , plastic container for collection of stool, pus, sputum, with sepcimens 20ml capacity, sterile , plastic container for collection of stool, pus, sputum, with sepcimens 50ml capacity, sterile , platinum wire loop per meter , postmortem glvoes size 8 ½ pair , pricking needles per pack of 100 nos , priestley smith perimeter each , rack for patridish each , reagent bottle ( 1000cc ) , reagent bottle ( 100cc ) , reagent bottle ( 2000cc ) , reagent bottle ( 250cc ) , reagent bottle ( 500cc ) , reagent bottle ( 50cc ) , reagent bottle 100ml , reagent bottle 50ml , regent bottle 250ml , rubber bulb for pipettes big each , rubber bulb for pipettes small each , rubber teats varium volume each , single channel fixed volume micropipette 10?l , single channel fixed volume micropipette 100?l , single channel fixed volume micropipette 25?l , single channel fixed volume micropipette 50?l , single channel micropipette variable volume 100 1000?l , slide 76mmx25mm , spatula each , spirit lamp each , staining trough , stature needles ( half dozen stainless stell ) cat no. round bodied half circle size 1 , surgical gloves 7.5 pair , surgical gloves 7 pair , surgical glvoes 6 ½pair , test tube borocilicated ( 100x12mm ) each , test tube borocilicated ( 150x18mm ) each , test tube borocilicated ( 75x12mm ) each , test tube basket each , test tube glass 5ml each , test tube holder each , test tube plastic with cap 5ml each , test tube stand ( big ) each , test tube washing brush each , test tube with rim 05 cm each , test tube with rim 10cm each , digital thermometer each , analog ( mercury ) thermometer each , urinometer each , vdrl shakereach , water both ( serological ) 56c each , diamond pencil for slide marking , writing pen for neurograph each , stationary & other items , blood center master record register ( 20 cm x 32 cm ) , bio waste register ( 20cmx 32cm ) , blood and bllod components register ( 20cmx 32cm ) , blood and bllod components discardregister ( 32 cmx 20 cm ) , patient & donor cell & serum grouping register ( 20cmx 32cm ) , register of adverse blood transfusion reaction record ( 32cm x 20cm ) , register of blood transfusion transmitted infection ( tti ) test record ( 32c x 20cm ) , blood & bllod components ( packed red blood cels issue ) ( 32cmx 20cm ) , donor record register ( 20cmx32cm ) , attendance register 200 pages student each , attendance register 200 pages staffeach , calculator ( 12 digit basic large display ) each , carbon paper ( 8x13 blue ) ( 100 sheet per pack ) , chalk color ( 1x100 per pkt, non dust type ) , chalk white ( 1x100 per pkt, non dust type ) , correcting pen ( white fluid ) each , cotton tag ( 8 long ) 100 pcs per bunch ) , dak book 2qr per piece , envelope ( 11x5, laminated 100gsm ) per piece , envelope ( 11x5, white 57gsm ) per piece , envelope ( 12x16, brown paper100gsm ) per piece , envelope ( 8x10, laminated100gsm ) per piece , lamineted envelop ( 9 x4 ) per piece , lamineted envelop ( 10x12 ) per piece , paper flag ( 76mm×15mm×5 ) multi color per pack , four flapper file pad each , customized file cover with top side printed each , examination copy24 pages ( size 32x20cm ) 64 gsm with numbering neolith paper , examination supplementary copy12 pages ( size 32x20cm ) 64 gsm with numbering neolith paper , favicol 50 gms each , file cover no. 555 , index file ( liver arch file ) , file folder ( each ) , file lace ( 18 cloth green / white 924 ) ( 100 pcs ) , file pad / dak pad ( each ) , glue stick ( 18gms ) , glue stick ( 8gms ) , gum bottle ( 150ml ) , gum bottle ( 700ml ) , ink pad ( medium size ) ( each ) , paper clip ( 15mm ) , paper clip ( 41mm ) , t paper pin ( 500 pcs per box ) , paper punching machine big size ( each ) , paper weight for office desk per piece , photocopy pape a3 size ( 75gsm 500sheets ) , photocopy pape a4 size ( 75gsm 500sheets ) , photocopy pape fssize ( 75gsm 500sheets ) , pin cushion ( magnet type, standard size plastic body ) , sealing wax ( per kg ) , water damper for office use , stamp pad ( big size ) ( 7cm x 14cm metal case ) , stamp pad ( small size ) ( 5cmx9cm ) metal case , stapler big size no. 24 / 6 , stapler hp 45 , stapler pin no.10 , stapler pin no.24 / 6 , tag ( big green ) 100 pcs per bunch , a4 size color printing with 100 pages book binding with numbering on each page , a4 size color printing single side , a4 size color printing double side , a4 size printing single side , a4 size printing double side , a5 size printing single side , a5 size printing double side , a3 size printing single side , a3 size printing double side , a4 size book printing with binding ( 100 pages ) ( multiple color pages ) , ruled regiter 3 qr ( 8 ½ x 13 ½ ) , ruled regiter 6 qr ( 8 ½ x 13 ½ ) , ruled regiter 8 qr ( 8 ½ x 13 ½ ) , ruled reigter 4 qr ( size 8 ½ x 13 ½ ) , hp 12a compatible complete , mint color 75gsm a4 size ( 500 sheets per pack ) , stock register ( 100 page ) ( custom print ) , stock register ( 200 page ) ( custom print ) , fs size printing ( double side ) , fs size printing ( single side ) , marker pen ( each ) ( blue / black ) , highlighter ( each ) , dak book ( custom print ) , led bulb ( 12 watt ) ( syska / bajaj / surya / phylips ) per piece , led bulb ( 15 watt ) ( syska / bajaj / surya / phylips ) per piece , led bulb ( 09 watt ) ( syska / bajaj / surya / phylips ) per piece , tag 6’’ 100 pcs per bunch , godrej lock 7 liver , basta cloth per kg , led tube light complete set baton ( syska / bajaj / surya / phylips ) per piece , punching machine big size , pin cushion plastic box magnetic , duster for white board , duster for black board , pad ink ( 25 ml ) , scissor ( big size ) , plastic tasla / tub , dusting cloth , pen ( red, blue & black ) , poker , detergent powder ( 1 kg ) ( nirma / ghadi / tide / arieal / surf ) , soap ( lifeboy / detol / savlon ) , black phenyl ( 5 ltr pack ) , acid cleaner ( 5 ltr pack ) , naphthaline balls ( 10 no. per pack ) , dustbin small 10 ltr per piece , dustbin big ( 50 ltr ) with lid , dustbin big ( 10 ltr ) with lid, foot operated , plastic bucket ( 20 ltr ) , toilet brush with handel each , wiper with handel ( big size ) , bomboo stick ( 5 feet ) , bomboo stick ( 12 feet ) , bomboo basket , floor cleaning moper with stick big size , plastic mugs ( 1.5 ltr ) , keyboard mouse combo pack ( logitech ) , water pipe ( flexible ) ( per meter ) , date broom big size , coconut broom big size , grass broom big size...

Department of Higher Education - Madhya Pradesh

39158039 bids are invited for bh curve feromagnetic materail , power amplfier , potntiometer , viscocity of fluid using poisons met , capicator and impedance apparatus , charging and discharging capicator , analog to digital convertor , mercury lamp , he ne laser , carey foster app , mosfet characterstics , lee s app , ldr charactorstics , ketterate pendulum kit , jaegors app , ionisation potentioal of complete setup , interia table , impedance of power factor , horizontal torsion app , hartley and colphitsapp , half and full wave , galvanometer , physical balance , photo transistor , function generator , anemometer , bod incubator , flamephotometer , normal chromotography chamber , micropipete 1 5 ml , magnetic strrirer , diigtal balance , slide reader , rotary microtome , soxhlet extraction systum , digital colony counter , gel electrophoresis , autoclave 50 ltr , tissue culture rack , image projection systum , digital thermometer , digital tds meter , water bath 12 holes , incubator stainless steel , heating mentle 1 ltr , uv transluinator , autoclave portable , tlc kit , autoclave vertical 50 ltr , dissecting microscope , oven , digital ph meter , spectrophtometer 340 900 n m , electrophoresis total quantity : 96...

Department of Higher Education - Madhya Pradesh

39107785 bids are invited for lab development comp app , solar cell apparatus , rc coupled amplifier , potentiometer , lcr circuit for curve , amplitude demodulation trainer , chemical balance , ph meter digital electrode , heating mentle 7 ltr , melting point apparatus , do meter , deonizer , gel elctrophoresis , oven universal , vaccum pump , soxhlet extraction , micro centrifuge 10000 rpm , digital balance , magnetic strrirer hot plate , polarimter half shade , kjeldal digestion 6 unit , flamephotometer , rotary microtome , thermotate , bod incubator , cod digestion , distillation app single 3 ltr , distillation app sinlge 5 ltr , water bath 12 holes , colarimeter , heating mentle 500 ml , incubator ss , heating mentle 1 ltr , autoclave portable , vortex shaker , centrifuge 3500 rpm , hot air oven , colonyy counter , binocular microscope , image projection systum , laminar air flow , uv single beam spectrophotometer , refrigerator , microwave oven , energy gap , mosfet total quantity : 143...

Department of Higher Education - Madhya Pradesh

38892582 bids are invited for lab items for following department ( q3 ) image projection system 1 laminar air flow horizontal 1 incubator stainless steel 1 centrifuge machine 3500 rpm 1 hot air oven stainless steel 1 zoology 1 autoclave vertical cap 50 lit 1 rotary microtome with aceesories 1 research microscope 1 image projection system 1 water bath double wall 6 holes ss 1 thin chromatography kit 1 physics measurement of wavelength of he ne laser using ruler with laser complete setup 1 study of hall effect complete setup 1 zener regulated power supply 2 impedance and power factor of lcr circuit 1 series and parallelresonance circuit 1 newtons ring apparatus complete with travelling microscope power supply and sodium lamp 1 travelling microscope 1 inertia table 1 photo diode characterstics apparatus 1 complete apparatus to determine e / m using thomson’s method 1 lee’s apparatus to determine the hear conductivity of bad conductors of different geometry 1 apparatus to determine the value of plank’s constant complete with photocell light source set of filter and power supply 1 apparatus to study specific resistance and energy gap of a semiconductor. 1 transistor characteristics apparatus with built in power supply and meters 1 battery charger 2 to 12 volt. 2 chemistry 1 paper chromatography testing kit 1 vaccume pump 1 soxhlet extraction apparatus with glass part 1 d o meter digital 1 polarimeter half shade 1 flame photometer digital 1 total quantity : 1...

Department of Higher Education - Madhya Pradesh

38870919 bids are invited for zoology ph meter ( q3 ) , zoology autoclave vertical cap 50 lit ( q3 ) , compound microscope ( q3 ) , dissecting microscope ( q3 ) , oven ( q3 ) , water and soil testing kit ( q3 ) , spectrophotomeyter 340 900 nm ( q3 ) , water bath double wall [ 6 holes ] stainless steel ( q3 ) , thin chromatography kit ( q3 ) , measurement of wavelength of he ne laser using ruler with laser complete setup ( q3 ) , fiber optics trainer ( q3 ) , study of hall effect complete setup ( q3 ) , stop watch digital ( q3 ) , ionization potential of lithium complete setup ( q3 ) , study of active and passive filter ( q3 ) , pulse width and pulse position modulation and demodulation trainer ( q3 ) , study of frequency modulation and demodulation trainer ( q3 ) , function generator [ b ] 1 hz to 10 mhz ( q3 ) , zener regulated power supply ( q3 ) , impedance and power factor of lcr circuit ( q3 ) , series and parallelresonance circuit ( q3 ) , study of crystall oscillator ( q3 ) , study of schimtt trigger circuit ( q3 ) , power amplifier ( q3 ) , diac and triac characterstic apparatus ( q3 ) , transistorized differntial amplifier ( q3 ) , newton ring apparatus complete with travelling microscope power supply and sodium ( q3 ) , stop clock ( q3 ) , vernier caliper ( q3 ) , travelling microscope ( q3 ) , inertia table ( q3 ) , photo diode characterstics apparatus ( q3 ) , dielectric constant apparatus ( q3 ) , complete apparatus to determine e / m using thomsons method ( q3 ) , lees appartus ( q3 ) , m. o. s. f. e. t characterstic apparatus ( q3 ) , hartley and colpitts oscillator ( q3 ) , apparatus to determine the value of planks constant ( q3 ) , transistorized diffential amplifier ( q3 ) , apparatus to study specific resistance and energy gap ( q3 ) , f. e. t characterstic apparatus ( q3 ) , thermister characterstic apparatus ( q3 ) , transister characterstics apparatus with with built in power ( q3 ) , solar cell characterstic apparatus ( q3 ) , potentiometer ( q3 ) , apparatus to study response curve for lcr circuits ( q3 ) , study of amplitude modulation and demodulation trainer ( q3 ) , chemical balance ( q3 ) , paper chromatography ( q3 ) , ph meter digital with electrodes ( q3 ) , heating mentle ( q3 ) , melting point apparatus digital ( q3 ) , do meter digital ( q3 ) , deionizer with digital meter ( q3 ) , gel electrophorasis ( q3 ) , oven universal ( q3 ) , vaccum pump ( q3 ) , soxhlet extraction apparatus ( q3 ) , potentiometer digital ( q3 ) , microcentrifuge 10000rpm ( q3 ) , magnetic stirrer with hot plate ( q3 ) , polarimeter half shade ( q3 ) , kjeldal digestion unit 6 test ( q3 ) , spectrophotometer 340 900 nm ( q3 ) , water soil testing kit digital ( q3 ) , rotary microtome with accesoires ( q3 ) , digital thermotate ( q3 ) , cod digestion apparatus ( q3 ) , bod incubator ( q3 ) , distillation apparatus ( q3 ) , distillation apparatus 5lit ( q3 ) , water bath double wall ( q3 ) , colorimeter ( q3 ) , heating mantle with regulator cap 500ml ( q3 ) , heating mantle with regulator cap 1 lit ( q3 ) , autoclave portable ( q3 ) , thin layer chromatography layer ( q3 ) , vortex shaker ( q3 ) , centrifuge machine 3500 rpm ( q3 ) , ph meter ( q3 ) , hot air oven stainless stell ( q3 ) , autoclave vertical cap 50 lit ( q3 ) , digital colony counter ( q3 ) , binocular microscope ( q3 ) , electronic balance ( q3 ) , image projection system ( q3 ) , laminar air flow ( q3 ) , uv visible spectrophotometer ( q3 ) total quantity : 163...

Department of Higher Education - Madhya Pradesh

38843052 bids are invited for zoology ph meter ( q3 ) , zoology autoclave vertical cap 50 lit ( q3 ) , compound microscope ( q3 ) , oven ( q3 ) , image projection system ( q3 ) , water and soil testing kit ( q3 ) , spectrophotomeyter 340 900 ( q3 ) , water bath double wall [ 6 holes ] stainless steel ( q3 ) , thin chromatography kit ( q3 ) , fiber optics trainer ( q3 ) , study of hall effects complete setup ( q3 ) , stop watch digital ( q3 ) , ionization potential of lithium complete setup ( q3 ) , study of active and passive filter ( q3 ) , study of frequency modulation and demodulation trainer ( q3 ) , function generator [ b ] 1 hz to 10 mhz ( q3 ) , zener regulated power supply ( q3 ) , independance and power factor ( q3 ) , series and parallel resonance circuit ( q3 ) , clipping and clamping circuit using operational amplifier ( q3 ) , study of crystal oscillator ( q3 ) , study of schimtt trigger ( q3 ) , power amplifier ( q3 ) , diac and triac characterstics apparatus ( q3 ) , transistorized differential amplifier ( q3 ) , newtons rings apparatus complete with travelling microscope power supply and sodium lamp ( q3 ) , stop clock ( q3 ) , travelling microscope ( q3 ) , photo diode characterstics ( q3 ) , dielectric constant apparatus ( q3 ) , complete apparatus to determine e / m using thomsons method ( q3 ) , hartley and colpitts oscillator ( q3 ) , apparatus to determine the value of planks constant ( q3 ) , transistorized diffrential amplifier ( q3 ) , apparatus to study specific resistance and energy gap of a semiconductor ( q3 ) , f. e. t. characteristic apparatus ( q3 ) , thermister characteristic apparatus ( q3 ) , transistor characteristics apparatus with built in power supply and meters ( q3 ) , solar cell characteristic apparatus ( q3 ) , single stage and double stage r. c. coupled amplifier / feed back amplifier ( q3 ) , apparatus to study response curve for lcr circuits and to determine the resonance frequency ( q3 ) , study of amplitude modulation and demodulation trainer ( q3 ) , paper chromatography testing kit ( q3 ) , ph meter digital with electrodes ( q3 ) , heating mentle ( 7 fit ) ( q3 ) , melting point apparatus ( q3 ) , d o meter digital ( q3 ) , deionizer with digital meter ( q3 ) , gel electrophorasis ( horizontal tank ) with digital ( q3 ) , oven universal ( q3 ) , vaccum pump ( q3 ) , soxhlet extraction apparatus with glass part ( q3 ) , potential digital ( q3 ) , microcentrifuge 10000 rpm ( q3 ) , electronic digital balance ( q3 ) , magnetic stirrer with hot plate ( q3 ) , spectrophotometer 340 900 nm ( q3 ) , water soil testing kit digital ( q3 ) , rotary microtome with accessoires ( q3 ) , digital thermotate ( q3 ) , cod digestion apparatus ( q3 ) , bob incubator ( q3 ) , distillation apparatus single distillation capacity 5 ltr ( q3 ) , water bath double wall ( 12 holes ) stainless steel ( q3 ) , colorimeter ( q3 ) , heating mental with regulator cap 500 ml ( q3 ) , incubator stainless steel ( q3 ) , heating mental with regulator cap 1 ltr ( q3 ) , autoclave portable ( q3 ) , vortex shaker ( q3 ) , centrifuge machine 8500 rpm ( q3 ) , ph meter ( q3 ) , hot air oven stainless steel ( q3 ) , autoclave vertical cap 50 ltr ( q3 ) , digital colony meter ( q3 ) , binocular microscope q3 ) , laminar air flow horizontal ( q3 ) , uv single beam spectrophotometer ( q3 ) total quantity : 104...

Department of Higher Education - Madhya Pradesh

38700844 bids are invited for alumirah (q3) , fire extinguisher (q3) , digital haemoglobinomter (q3) , compound micrscope (q3) , confocal laser microscope (q3) , spectrophotomeyter 340 900 nm (q3) , vertical deep freezer (q3) , oven (125) ltr (q3) , inverter (q3) , water cooler (q3) , app to study hysteresis curve of transformer core (q3) , induction hot plate with induction pots (q3) , impedance and power factor lcr circuit (q3) , hybrid solar and wind energy trainer (q3) , fiber optics trainer (q3) , encoder and decoder circuit with built in power supply (q3) , cooling system (double door) refrigerator (q3) , deonizer with conductivity meter (q3) , digital melting point apparatus (q3) , digital polarimeter research model (q3) , tlc kit (q3) , digital tds meter (q3) , incubator stainless steel (q3) , digital balance accuracy(0.001 200 grm) (q3) , uv transiluminator (q3) , soxhlet extraction apparatus with glass part (q3) , rotary microtome with accesoires (q3) total quantity : 52...

Department of Higher Education - Madhya Pradesh

38588283 bids are invited for ph meter ( q3 ) , autoclave 45 tr ( q3 ) , rotary microtome ( q3 ) , compound microscope ( q3 ) , dissecting microscope ( q3 ) , oven ( q3 ) , image projector system ( q3 ) , water bath double wall ( q3 ) , tic kit ( q3 ) , he ne laser with complete setup ( q3 ) , fiber optics trainer ( q3 ) , study of hall effect ( q3 ) , stop watch digital ( q3 ) , ionization potential of lithium complete setup ( q3 ) , active and passive filter ( q3 ) , modulation and demodulation ( q3 ) , 8086 microprocessor with amps ( q3 ) , function generator ( q3 ) , zener regulator ( q3 ) , lcr circuit ( q3 ) , series and parallel ( q3 ) , clipping and clamping ( q3 ) , study of crystals oscillator ( q3 ) , study of schimtt trigger ( q3 ) , power amplifier ( q3 ) , diac and triac apparatus ( q3 ) , transistorised diff amplifier ( q3 ) , newtons rings apparatus ( q3 ) , stop clock ( q3 ) , vernier caliper ( q3 ) , travelling micrsocope ( q3 ) , interia table ( q3 ) , photo diode apparatus ( q3 ) , delectric constant apparatus ( q3 ) , thomson method ( q3 ) , lee apparatus ( q3 ) , mosfet app ( q3 ) , hartley and colphits ( q3 ) , planks constant ( q3 ) , transistorized diff amplifier ( q3 ) , resisitence and energy gap of energy ( q3 ) , fet app ( q3 ) , thermister app ( q3 ) , transistor characteristics apparatus with built in powder supply and meters ( q3 ) , solar cell charcteristics apparatus ( q3 ) , coupled amplifier ( q3 ) , potentiometer ( q3 ) , apparatus to determine the resonance frequency ( q3 ) , amplitude modulation and demodulation trainer ( q3 ) , chemical balance ( q3 ) , paper chromatography kit ( q3 ) , ph meter digital with electroncs ( q3 ) , heating metal ( q3 ) , melting point apparatus digital ( q3 ) , d o meter digital ( q3 ) , deionizer with digital meter ( q3 ) , eel electrophorasis ( q3 ) , oven universal ( q3 ) , vaccum pump ( q3 ) , soxihlet extraction apparatus with glass part ( q3 ) , potentiometer digital ( q3 ) , electronic digital balance ( q3 ) , magnetic stirrer with hot plate ( q3 ) , polarimeter half shade ( q3 ) , kjeldak digestion unit 6 test ( q3 ) , flame photometer digital ( q3 ) , spectrometer ( q3 ) , water soil testing kit digital ( q3 ) , rotary microtome with accessories ( q3 ) , digital thermotate ( q3 ) , cod digestion apparatus ( q3 ) , bod incubator ( q3 ) , distillation apparatus single distillation capacity ( q3 ) , water bath double stainless steel ( q3 ) , distillation apparatus 3 l ( q3 ) , colorimeter ( q3 ) , heating metal with regulator cap ( q3 ) , incubator stainless steel ( q3 ) , autoclave portable ( q3 ) , thin layer chromatography kit ( q3 ) , vortex shaker ( q3 ) , centrifuge machine 3500 rpm ( q3 ) , water and soil testing kit ( q3 ) , ph meter ( q3 ) , hot and oven stainless steel ( q3 ) , autoclave vertical cap ( q3 ) , digital colony counter ( q3 ) , dissecting microscope ( q3 ) , copmpound microscope ( q3 ) , binocular microcope ( q3 ) , image projection system ( q3 ) , laminar air flow horizontal ( q3 ) , uv single beam spectrometer ( q3 ) total quantity : 153...

Department of Higher Education - Madhya Pradesh

38578214 bids are invited for compound microscope ( q3 ) , dissecting microscope ( q3 ) , rotary microtome with aceesories ( q3 ) , water and soil testing kit ( q3 ) , water bath double wall [ 6 holes ] stainless steel ( q3 ) , thin chromatography kit ( q3 ) , measurement of wavelength of he ne laser using ruler with laser complete setu ( q3 ) , fiber optics trainer ( q3 ) , study of hall effect complete setup ( q3 ) , ionization potential of lithium complete setup ( q3 ) , study of active and passive filter ( q3 ) , pulse width and pulse position modulation and demodulation trainer ( q3 ) , study of frequency modulation and demodulation trainer ( q3 ) , function generator [ b ] 1 hz to 10 mhz ( q3 ) , zener regulated power supply ( q3 ) , impedance and power factor of lcr circuit ( q3 ) , series and parallelresonance circuit ( q3 ) , clipping and clamping circuit using operational amplifier ( q3 ) , study of crystal oscillator ( q3 ) , study of schimtt trigger circuit ( q3 ) , power amplifier ( q3 ) , diac and triac characterstics apparatus ( q3 ) , transistorized differential amplifier ( q3 ) , newtons ring apparatus complete with travelling microscope power supply and sodium lamp ( q3 ) , stop clock ( q3 ) , vernier caliper ( q3 ) , travelling microscope ( q3 ) , inertia table ( q3 ) , photo diode characterstics apparatus ( q3 ) , dielectric constant appartus ( q3 ) , complete apparatus to determine em using thomsons method ( q3 ) , lees apparatus to determine the heatconductivity of bad conductors of different geometery ( q3 ) , m. o. s. f. e. t characterstic apparatus ( q3 ) , harley and colpitt s oscillator ( q3 ) , plank constant complete with photo cell light source set of filter and power supply ( q3 ) , transistorized differential amplifier ( q3 ) , resistance and energy gap of a semiconductor ( q3 ) , f. e. t characteristic apparatus ( q3 ) , thermister characterstic apparatus ( q3 ) , 1 46 total quantity : 127...

Department of Higher Education - Madhya Pradesh

38578096 bids are invited for physical balance ( q3 ) , photo transistor characterstics apparatus ( q3 ) , function generator 1 hz to 10 mhz ( q3 ) , function generator 0.3 to 3 mhz ( q3 ) , anemometer ( q3 ) , bod incubator ( q3 ) , flame photometer ( q3 ) , normal chromatographic chamber ( q3 ) , micro pipette fixed 1 5 ml ( q3 ) , magnetic stirrer with hot plate ( q3 ) , digital balance accuracy ( 0.001 200 grm ) ( q3 ) , slide reader ( q3 ) , rotary microtome with accesoires ( q3 ) , soxhlet extraction apparatus with glass part ( q3 ) , digital colony counter ( q3 ) , gel electrophorasis ( horizontal tank ) with digital ( q3 ) , autoclave vertical cap 50 lit ( q3 ) , tissue culture rack [ caster rack ] ( q3 ) , image projection system ( q3 ) , digital thermometer ( q3 ) , water bath double wall ( 12 holes ) stainless steel ( q3 ) , incubator stainless steel ( q3 ) , heating mentle with regulator cap 1 lit ( q3 ) , uv transiluminator ( q3 ) , autoclave portable ( q3 ) , thin layer chromatography kit ( q3 ) , dissecting microscope ( q3 ) , oven ( q3 ) , digital ph meter ( q3 ) , spectrophotomeyter 340 900 nm ( q3 ) , electrophoresis with power supply ( q3 ) , water bath 12 holes ( q3 ) , magnetic strirrer ( q3 ) , app to draw bh curve feromagnetic material with the help of cro ( q3 ) , power amplifier ( q3 ) , app to determine the viscosity of fluid using poiseuille method ( q3 ) , apparatus for measurement of capacitance and inductance using impedance at different frequency ( q3 ) , app to study charging and discharging of a capacitor ( q3 ) , analog to digital converter with built in power supply ( q3 ) , mercury lamp ( q3 ) , measurement of wavelength of he ne laser complete setup ( q3 ) , measurement of low resistance by carey foster ( q3 ) , mosfet characterstics ( q3 ) , lee apparatus ( q3 ) , ldr characterstics apparatus ( q3 ) , ketterate pendulum ( q3 ) , jaeger apparatus ( q3 ) , ionization potentials of lithium complete setup ( q3 ) , inertia table ( q3 ) , impedance and power factor lcr circuit ( q3 ) , horizontal torsion apparatus ( q3 ) , hartley and colpitt oscillator ( q3 ) , half wave and full wave v ( q3 ) , galvanometer ( q3 ) total quantity : 115...

Madhya Pradesh Laghu Udyog Nigam Limited - Madhya Pradesh

37911191 laboratory equipments for biology (botany and zoology) , laboratory equipments for biology (botany & zoology) , anemo meter , auto exhaust analyzer , autoclave portable , autoclave vertical cap. 50 liter , auxanometer , binocular dissecting microscope , binocular microscope , bio fermentar5 liter (borosilicate glass) , blackman’s apparatus , bod incubator , bomb calorimeter (with oxygen cylinder) , bomb calorimeter (without oxygen cylinder) , camera leucida with filter (micro type) , camera leucida with filter (prism type) , centrifuge machine (cooling) maximum speed 24000 rpm , centrifuge machine 3500rpm , cod analyzer , compound microscope , deep freezer , digital balance (0.1 mg) , digital colony counter , digital tds meter (microcontroller based conductivity tds meter) , digital thermometer , dissecting microscope , distillation apparatus double distillation capacity 5 liter , distillation apparatus single distillation capacity 5 liter , dslr camera , electronic digital balance (read ability 0.01 mg) , farmer’s potometer , flame photometer , ganong’s potometer (borosilicate glass) , ganong’s respirometer (borosilicate glass) , gel documentation , gel electrophoresis unit with power supply (horizontal) , gramen gps , hair dryer , heating mental with regulator cap 1 liter , high volume air sampler , homogenizer , hot air oven (with digital controller) size 455 x 455 x 455 mm , hot air oven (with digital controller) size 605 x 605 x 605 mm , hplc (binary system) , image projection system (mips) , incubator stainless steel (with digital controller) , laminar air flow horizontal , magnetic stirrer with hot plate , maximum minimum thermometer , micro keldahal & distillation apparatus , micro pipette (fixed 1 5 ?l) , micro pipette (variable 1 5 ?l) , microscopic camera (digital eyepiece camera 10mp, with measuring software) , moll’s half leaf apparatus , noise level meter (digital sound & noise level meter) , normal chromatographic chamber , ocular micrometer , pcr machine (gradient thermal cycler pcr) , ph meter (digital) (microcontroller based ph meter with electrode & temp. probe) , portable air sampler unit , quadrats , rotatory microtome with accessories , slide cabinet with 12 showcase , soxhlet extraction unit (borosilicate glass) , stage micrometer , stem borer , thin layer chromatography apparatus , tissue culture rack (caster rack) , ultracentrifuge , uv trans illuminator , uv vis spectrophotometer (double beam) variable bandwidth , uv vis spectrophotometer (single beam) micro controller based , visualizer (visual presenter/ teletop camera) , vortex shaker , water & soil testing (analysis) kit , water bath double wall (12 holes) stainless steel , wilmott’s bubbler , wooden press for herbarium , aquarium kit , automatic burette , blood cell calculator , bones , biological charts as per ug & pg syllabus/ requirement , biological models as per ug & pg syllabus/ requirement , digital haemoglobinometer , dissecting tray , haemocytometer kit , induction hot plate with induction pots , permanent slides , specimens , water bath double wall stainless steel , western blotting system...

Department of Higher Education - Madhya Pradesh

37257786 bids are invited for lab equipment 2 117 analytical balance , analytical weight box , fractional weight box , physical balance , digital balance , single pan digital balance , digital photoelectric colorimeter , digital potentiometer , digital conductometer , d o meter , digital , naphelo turbidity meter , polarimeter half shade , melting point apparatus , digital melting point apparatus , abbe refracto meter , tlc kit , centrifuge , corkboring machine , distillation apparatus , oven hot air , voltage stabilizer , vertex shaker , vacuum pumpoil free , mixers mall , water bath cu , heating mantle with energy , regulator , single crucible heater , muffle furnace , water bath rectangularsingle walled , water bath rectangular , kjeldahldistillation unit , microwave oven , soleextraction unit apparatus , blower , sprayer , magneticstirrer , wateranalyser , compound microscope , dissecting microscope , distillation apparatusdouble , ganongs potometer , ganongs , slidecabinetwith 12 showcase , wilmottsbubbler , woodenpressfor herbarium , quadrats , digital thermometer , binocular dissecting , microscope , slide box for 50 slides , binocular microscope , side readar , water and soil testing analysis kit , ph meter , digital balance , analyticalbalance , aquariumkit , autoclaveportable , automaticburette , bloodcellcalculator , bodincubator , chart and cdsrelatedto syllabus , digital haemoglobinometer , digitalphmeter , digitalsinglepan balance , digital spectrophotometer , digitalthermometer , digitalturbiditymeter , dissectingmicroscope , dissecting tray electronic digital balance , electronic digital balance , electrophoresis with power supply , glucometer , haemocytometer complete box , heating mantle with regulatorcap1litre , highspeedcentrifuge , homogenizer , hotplate , laboratoryhotairoven , laminarairflow horizontal , magneticstirrerwithhot plate , medicocentrifuge machine , micropipette , microtome rotary , mips 1 117machine , micropipette , microtome rotary , mips photodiode characterstics app , solarcell characterstics , phtottransisitor characterstics app , hartleyandcolpittsoscillators , transistorized regulator powersupply , series and parallel resonance circuit , battery chrger 2to12volt , callendorandbarneapptodet the value of me chanical equivalent of heat , lee app to det thehear conductivity , physical balance , weight box , vernier calliper , screw gauge , stop watch digital , ammeter dc ac , voltmeter dc ac , photo conductivity experiments , to study the v icharactrsticsofthesolarcell , ldr charactrstics app , bending of beam , measurement of low resistance by carey foster , potentiometer , app to study responsecurve for lc circuit , zener diode asvoltageregulatorpowersupplyset , newtons ringapp with travelling microscope power , spectrometer prism , inertiatable , compound pendulum , cantilevertodeter mine young , horizontaltorson app , app to verify newtons lawof , searle apparatus to determine the coefficient of thermal , transformer sodium vapour lamp , mercury lamp , transformer of mercury lamp , comp app to determine resolving power of telescope , audio frequency generator , app for measurement of capacitance and inductanceusong , study of lissajousfiguretrainer with , cro rectifierandfiltercharactrstics , crosingletrace 10mhz , dielectricconstant , half wave and full waverectifier kit , network theorem kit , resonance wave on lcr , study of regulatedpower supply using transistor , readingtele scope , analogmultimeter , leadaccumulator , battery eliminator , resistance box , hybrid solar andwind energy trainer , frankhartzexp , thermistor charactrstics app , slotted weights hanger , rheostate various length , galvanometer , miliammeter milivolmeter microammeter , plug key one way two way , reversing key , four way key , moarse key , digital multimeter , slodering iron , travelling microscope , bar pendulum , sodium vapor lamp , use of vibration magnetometer to study a field , apparatus to determine the value of planks constant complete , jarib and lace survey set jarib lace truck compass guniya ranging rod aero , plain table survey set plain table tripod stand lace truck compass sprit lavel sahul aero renging rod , prijmetic compass survey set prijmetic compass tripod stand lace truck compass sprit lavel truck compass ranging rod aero , glob , map phycsical world political climate physical india political physical mp political climate , petrological projector , sepcimen fossils minerals crystal wooden glass , ore minerals and rocks samples , topo sheet , slides of rocks and mineral , clinometer compass total quantity : 875...

Madhya Pradesh Laghu Udyog Nigam Limited - Madhya Pradesh

36930696 tender for supply of laboratory equipments for biology ( botany & zoology ) 2 anemo meter 3 auto exhaust analyzer 4 autoclave portable 5 autoclave vertical cap. 50 liter 6 auxanometer 7 binocular dissecting microscope 8 binocular microscope 9 bio fermentar5 liter (borosilicate glass) 10 blackman’s apparatus 11 bod incubator 12 bomb calorimeter (with oxygen cylinder) 13 bomb calorimeter (without oxygen cylinder) 14 camera leucida with filter (micro type) 15 camera leucida with filter (prism type) 16 centrifuge machine (cooling) maximum speed 24000 rpm 17 centrifuge machine 3500rpm 18 cod analyzer 19 compound microscope 20 deep freezer 21 digital balance (0.1 mg) 22 digital colony counter 23 digital tds meter (microcontroller based conductivity tds meter) 24 digital thermometer 25 dissecting microscope 26 distillation apparatus double distillation capacity 5 liter 27 distillation apparatus single distillation capacity 5 liter 28 dslr camera 29 electronic digital balance (read ability 0.01 mg) 30 farmer’s potometer 31 flame photometer 32 ganong’s potometer (borosilicate glass) 33 ganong’s respirometer (borosilicate glass) 34 gel documentation 35 gel electrophoresis unit with power supply (horizontal) 36 gramen gps 37 hair dryer 38 heating mental with regulator cap 1 liter 39 high volume air sampler 40 homogenizer 41 hot air oven (with digital controller) size 455 x 455 x 455 mm 42 hot air oven (with digital controller) size 605 x 605 x 605 mm 43 hplc (binary system) 44 image projection system (mips) 45 incubator stainless steel (with digital controller) 46 laminar air flow horizontal 47 magnetic stirrer with hot plate 48 maximum minimum thermometer 49 micro keldahal & distillation apparatus 50 micro pipette (fixed 1 5 µl) 51 micro pipette (variable 1 5 µl) 52 microscopic camera (digital eyepiece camera 10mp, with measuring software) 53 moll’s half leaf apparatus 54 noise level meter (digital sound & noise level meter) 55 normal chromatographic chamber 56 ocular micrometer 57 pcr machine (gradient thermal cycler pcr) 58 ph meter (digital) (microcontroller based ph meter with electrode & temp. probe) 59 portable air sampler unit 60 quadrats 61 rotatory microtome with accessories 62 slide cabinet with 12 showcase 63 soxhlet extraction unit (borosilicate glass) 64 stage micrometer 65 stem borer 66 thin layer chromatography apparatus 67 tissue culture rack (caster rack) 68 ultracentrifuge 69 uv trans illuminator 70 uv vis spectrophotometer (double beam) variable bandwidth 71 uv vis spectrophotometer (single beam) micro controller based 72 visualizer (visual presenter/ teletop camera) 73 vortex shaker 74 water & soil testing (analysis) kit 75 water bath double wall (12 holes) stainless steel 76 wilmott’s bubbler 77 wooden press for herbarium 78 aquarium kit 79 automatic burette 80 blood cell calculator 81 bones 82 biological charts as per ug & pg syllabus/ requirement 83 biological models as per ug & pg syllabus/ requirement 84 digital haemoglobinometer 85 dissecting tray 86 haemocytometer kit 87 induction hot plate with induction pots 88 permanent slides 89 specimens 90 water bath double wall stainless steel 91 western blotting system ...

Department of Higher Education - Madhya Pradesh

36750468 bids are invited for item as per boq flame photometer , polarimeter half shade , laboratory microtome , potentiometer digital , electronic digital balance total quantity : 6...

Department of Higher Education - Madhya Pradesh

36706937 bids are invited for lab equipment mse flame photometer 0 100ppm , polarimeter half shade , laboratory microtome , potentiometer digital , electronic digital balance total quantity : 6...

Department of Higher Education - Madhya Pradesh

36648243 bids are invited for items compound microscope , dissecting microscope , bionocular microscope , image projection system , slide reader , hot air oven stainless steel , water and soil testing analysis kit , ph meter , incubator stainless steel , microscopic camera , digital tds meter , tissue culture rack caster racks , chromatro graphic chamber , conductivity meter digital with cell , hot air oven 14 14 , digital balance accuracy 0001 200 grm , digital ph meter conductivity meter and temperature meter , melting point apparatus digital , digital photoelectric colorimeter 5 liters , micro processor water soil testing kit , distillation apparatus double distillation borosilicate glass cap 5 liter , spectro photometer 340 900nm , chemical balance , chemical weight box 1mg 100gm , chromatographic cabinet 6 leaves , tds meter digital , conductivity meter digital , rotatory microtome with accessories , micro pipette fixed1 5 ml , distillation apparatus single distillation capacity 3lt , centrifuge machine 3500 rpm , flam photometer total quantity : 103...

Directorate Of Medical Education - Madhya Pradesh

36434740 kits chemical and comsumable, reagents tender regarding kits chemical and comsumable, reagents , name of department : pathology , diluent ( m 53 ) , lyse ( lh ) ( m 53 ) , leo ( ii ) ( m 53 ) , leo ( i ) ( m 53 ) , cleanser ( m 53 ) , probe cleanser ( m 53 ) , quality control ( m 53 ) , calibrator ( m 53 ) , bendedicts qualitative reagent , reticulocyte kit , leishmann stain sol. with buffer tablet ph , methanol ( acetone free ) , occult blood test kit ( haem test kit ) , drabkins solution , vaccutainer edta ( k3 vial with needles ) , immersion oil ( merck / span ) , test tube glass ( 12 x75 ) borosil / pyrex , tips ( micropipette ) ( 5 200?l ) , glass capillary tube , lancet , ( 10 ml syring ( piston with rubber bang ) , disodium hydrogen phosphate ( anhydrous ) , sodium di hydrogen phosphate , protein for csf ( calorimeter ) , albumin for csf ( albumin ) , rubber gloves 6.5, 7.0, 75 size , strips for urine albumin and sugar , hypochlorite so. ( conc. ) , ehrilichs aldehyde reagent , semen diluting fluid , wbc diluting fluid , sulphur powder , test tube holder , manual cellcounter , neubaerscounting chamber new improved , urinometer for specific gravity , h2o2 ( conc. ) , leishman staining powder , esr wintrobe tube ( glass ) , ammonia sol. , tissue paper roll , fouchets reagent , esbachsreagent , ehrlichs reagent , litmus paper , total protein reagent , filter paper , forceps 6 & 4 , tissue roll , vaccutainer needles holder , tourniquet , sodium citrate vail , cell pack , stromatolyzer 4 dl , stromatolyzer 4 ds , sulfolyzer , cell clean , g6pd kits , coombs , leishmann stain sol. with buffer tablet ph leishmans , waxparaffin ( 60 62 digree ) high grade, , formaline , microtome blade ( thermo ) m x 35 ultra 34 / 80 mm , nitric acid , filter paper sheet size 460mm x 570mm , popy lysine coated slide , poly lysine solusion , citric acid , tri sodium , sodium di hydrogen phosphate , disodium hydrogen phosphate , sodium chloride , tris ( hydroxy methyl ) amino methane , pas staining kit , microtome blades ( spencer’s rottary ) high profile , ptah staining kit , microtome blades ( thermo ) hp35 ultra 34 / 75 mm , cryomatrix gel ( thrmo ) , crytome ( fe ) cryocassette ( block hider ) , reticuline stain , messon tricrome , l mold ( brass metal ) size 6x03x02cm , cassette ( for tissue processing ) metal , dimond pencil , formic acid , runing water tray ( for histology ) , grossing nife ( ss ) , forcep 6’’ , scissors 6’’ , slide tray aluminium , coplinjar , tissue paper , cover slipe ( 22x50mm ) histology+ cytology , glycerol , con. hcl , muccuric oxide , iron alum amunium potesium sulphate , fericammonium sulphate , mucicarmine stain , alcian blue stain , congo red stain , staining rack , gold chloride , sliver nitrate , liquer ammonia , ph paper , slide filing cabinets , alcohol ( isopropyle alcohol ) histology + cytology , glass slide histology, cytology, cpl , xylene sulpher free histology + cytology , cover slips22x22 mm histology + cytology+cpl , d.p.x. 250 ml histology + cytology , haematoxyline powder 5 gm histology + cytology , glacial acetic acid histology + cytology+cpl , cover slips22x50 mm histology + cytology , cover slips22x40 mm histology + cytology , ea 50 , og 06 , eosin , carbal fuchsin , acid fast , methylene blue , cytospin filter card , cytospin filter cup with clips , plain plastic tube , glass test tube , filter paper sheet , diamond pencil , sta neoptimal cl 10 ( 00667 ) , sta ptt automate 5 ( 00595 ) , sta c.k. prest 5 ( 00597 ) , sta thrombin 2 ( 0611 ) , sta lia testd di plus ( 00662 ) , sta coag control ( n+p ) ( 00679 ) , sta lia test control n+p ( 00526 ) , sta lia test vwf:ag ( 00518 ) , sta immnodef def f viii ( 00728 ) , sta immnodef def f ix ( 00734 ) , sta pool norm ( 00539 ) , sta desorb u ( 00975 ) , sta cacl2 0.025 m ( 00367 ) , sta cleanersolution ( 00973 ) , sta cuvettes ( 38669 ) , sta cuvettes satellite ( 39430 ) , sta liquid cooling glycol ( 38640 ) , sta ptt la ( 00599 ) , sta liquid fib ( 00673 ) , sta pm kits ( 89567 ) , sta system control ( 00678 ) , sta uni calibrator ( 00675 ) , water bath measures ( with thermostate ) , aggregometer , digital stop watchs , incubator ( variable tempresure medium size ) , micro ppt ( finn pipette ) variable , ( a ) 20 200 ? l , ( b ) 05 100 ? l , ( b ) 1000 5000 ? l , ( d ) 50 500 ? l , centrifuge digital without carbon bush ( remi r 8c bc ) , thermametre ( mercury ) centrigrate , diamond pencil , semi automatic coagulometer ( 04 tube ) , cell pack , stromato lyser 4 dl , stromato lyser 4 ds , sulfo lyser , cell clean , e check trilevel , scs 1000 calibrator , g6pd kits ( qualitative ) , coombs sera , tri sodium citrate , amonium sulphate ( erba pure ( nh4 ) so4 , lieshman stain with buffer , mpo stain , iron stain ( perls ) , liquar amonia solution , sodium hypo cloride , distilled water , normal saline ( ns ) , immersion oil , methanol ( acetone free ) , chloroform ( chcl3 ) , potassium ferocyanide , sodium meta bisulfite ( ar ) , h2o2 ( hydrogen peroxide ) , dpx mountant , sodium dihydrogen phosphate , di sodium hydrogen phosphate , bovine albumin ( 22 % ) , acetone solution , syringe plastice 02 ml , piston with rubber bag 5 ml ( syringe ) , piston with rubber bag 10 ml ( syringe ) , hand gloves ( ruber ) , gauze , cotton roll , tissue paper , filter paper roundshape , hand wash shop / solution , citrate test tube ( 3.2% ) 2 ml mark , edta vial 2ml mark ( vacutainer ) , plain plastice 5 ml test tube with stopper , microtips ( unirersal type ) , micro centrifuge tubes ( 1.5ml size ) , glass slides ( blue star ) , cover slips ( blue star ) , glass test tubes ( borsil ) , glass test tubes ( borsil ) , glass ppt. ( mark up to tip ) , glass ppt. ( mark up to brosil ) , rubber bulb for ppt , glass fimmd ( borosil ) , bio rad d 10 tm dual program , lyphochek a2 control ( 553 ) l1+l2 , plastic aliquos polypropylane vials with pierceable caps ( sample vials 1.5 ml ) , micropipettes ( 100 1000 micro lt. ) , micropipettes ( 05 50 micro lt. ) , microtips+macrolips ( large ) , microtips+macrolips ( small ) , thermal printer paper ( 4 ) , rb a hu3c comlenent / fitc , rb a hu igg / fitc , rb a hu igm / fitc , rb a hu iga / fitc , miscellaneous item , igg , iga , igm , c3 , cig , c4d ( tansplant ) , fibrinogen , kappa ( kidnev only ) , lambds ( kidnev only ) , fitc ( florescent isothiayank , rhodaminc , feulgen stain , michelsmidium ( transport midium ) , er immuneo , pr immune , her 2 / neu , hpv 16 & hsv immuno stains , proliferative marker p 53 , proliferative marker kit 67 , pancytokeratin , ck 7 , ck 20 , ema , cea , hmwck , apf , vimentin , s 100 , desmin , nse , chromogranin , synaptophysin , msa , c kit / cd 117 , cd 34 , cd 31 , lca , bcl 2 , bck 6 , cd 3 , cd 5 , cd 10 , cd 20 , cd 15 , cd 1a , cd 30 , cd 68 , cd 99 , alk 1 , ca 125 , hmb 45 , gfap , myoglobin , cd 19 , plap , cd 33 , mpo , leucognost alpa , leucognost est , leucognost pas , leucognost pox , leucognost basic set , hematognost fe , basic set / reduction set , ttf 1 , p16 , mannual kits for liquid based cytology , cd 34 , cd 31 , lca , andriogenreceptro , myogenin , pten , cyclin d1 , lbc manual kits for cervical cancer screening , ihc basic kit , pap pen , humod chamber , name of department :pediatric medicine , crp ( turbidometry quantitative ) , crp slide ( latex / slide ) , urea ( modified berthelot ) , creatinine ( alkaline picrate kinetic ) , bilirubin t+d ( dmso ) , protein ( total ) { biuret } , printer paper ( thermal ) , sodium hypochlorite , tips – small ( 5 100 ul ) , tips – 1 ml ( big ) , micropipette – 1 ml , micropippete 50 ul , micropippete 10 ul , micropippete 5 50ul , dengue card , caliberator 1 and 2 , na electrode , k electrode , ca electrode , reference electrode , complete tubing set , paper roll , electrolyte filling solution , reference electrode filling solution , albumin ( bcg method ) , name of department :medicine , sterilant hot disinfectent for dialysis containing 21% ( approx ) ( citrostrile disinfectent ) for dialysis machine , sodium hypochlorite solution 5% for dialysis machine , dialyzer / a.v line reprocessing sterilant cold disinfectent for dialysiscontaining pracetic acid hydrogen peroxide acetic acid , equipment disinfecten gluteraldehyde solution 2% , bi_ carb h.d. fluid , bi_ carb potassium free h.d fluid , 1. wash cartridge 2. measurement cartridge for siemens abg machine , serum glucose kit method – god pod , blood urea kits modified birthlot method , serum creatinine method – jaffe’s kinetic method , eeg paste , eeg electrode , ncv electrode , emg needle , diluents ( abx minidil lmg ) method horiba abx micros es 60 , abx miniclean cleanser method horiba abx micros es 60 , abx mini lysevio method horiba abx micros es 60 , abx mono clair method horiba abx micros es 60 , urine strip method deka phan laura 10p make transasia , methanol , field stain a , field stain b , drabkin’s reagent method – cyanmethemoglobin , name of department : biochemistry department , murcuric sulphate , barium chloride , cupric acetate , creatinine powder , casine powder , formaldehyde , fructose powder , glucose powder , gelatin powder , lactose powder , mercuric chloride , maltose powder , phenyl hydrazine hydro chloride , resorcinol , sodium nitro prosside , sodium hydroxide , sodium tarcholate , sodium meta bisulphate , sucrose powder , starch , sodium chloride , sodium nitrite , sulphuric acid , hydro chloric acid , glacial acitic acid , nitric acid , ? napthol , phloroglucinol powder , ninhydrine powder , hydrogen peroxide , liquor ammonia , chloroform , albumin powder , ethanol ( abs.alcohol ) , amyl alcohal , ammonium molebdate , bromine ampule , burning spirit , sodium tungstate , lead oxid ( yellow ) , silver nitrate , urea powder , megnsium sulphate , uric acid , trichlora acitic acid , frerric chloride , cupper sulphate , ammonium oxalate , sulpher powder , bromocresal green ( liquid ) , picric acid , phenopthline indicator , lead acetate , orthophosphoric acid , sodium carbonate , lactic acid , barium nitrate , barium hydroxide , potassium chloride , sodium phosphatase ( hydrated ) , sodium pyrophosphate , n butanol , ether , phenol ( carbolic acid ) , phaspho molybdic acid , phasphotungstate , potassium hydroxide , sodium acetate , sodium carbonate , sodium hypo chloride , sodium tungstate , acetone , calcium chloride , ferrous sulphate , bilirubin powder , sodium benzoate , sodium dihydrogen phosphate monohydrate , thioberbituric acid , sodium citrate , sodium meta bisulphate , methanol , tannic acid , acitic anhydride , sodium diethyle dithio carbamate , sodium sulphate , ferric ammonium sulphate , perchloric acid , adrenaline bi tartrate , l tyrophan , l alanine , l arginine , l aspartic acid , l cysteine , l glycine , l tyrisine , l serine , l histidine , l methionine , l phenyl alanine , pera nitrophynele phosphate , sodium citrate dihydrate , filter paper 1, 2, 3 , filter paper circular 1, 2 ( circular ) , filter paper plane , cellulose strip ( for electrophoresis ) , beaker , beaker , beaker , beaker , beaker , beaker , volumetric flask , volumetric flask , volumetric flask , funnel ( plastic ) , flat bottom flask , flat bottom flask , merking acid bottles ( hcl ) , merking acid bottles ( h2so4 ) , merking acid bottles ( hno3 ) , dropping bottles brown , dropping bottles plane , reagent bottle , test tube , test tube , spirit lamp , test tubes holder , fallin uw tube , slide glass , cover slip , doramess urea meter , measuring clyinder , measuring clyinder , measuring clyinder , measuring clyinder , test tube stand ( bigsize hole 12 test tubes ) , drapper ( big size ) , glucose god pod , urea birth lot , uric acidpap method , cholesterolchod pap method , total protein biurate , albuminbcg colorimetric test , csf protein ( end point ) , sgotifcc / uv kinetic method , sgptifcc / uv kinetic method , alkaline phosphatase pnpp amp kinetic assay , triglyceride , hdl cholestrol , serum bilirubinjendrassik & grof method , serum creatinine jeff s reaction ( alkaline picric method ) , serum calcium , serum phophorus , calibrator solution 1& 2 ( carelyte electrolyte analyzer ) ( electrode method ) , enzyme cleaning solution , sodium conditioner , reagent pack ( careline electrolyte analyzer ) ( electrode method ) , control level 1 , control level 2 , d proteinization solution , sodium conditioner , cleaning solution , glucose god pod ( ba 400 ) , urea urease / glumate dehydrogenase , serum creatinine jaffe compensated , sgotifcc , sgpt ifcc , alkaline phosphate amp2 amino 2 methly 1 propanal , total bilirubindicholophenyl dizo buffer ( ifcc ) , serum direct bilirubindicholophenyl dizonium , serum protein biuret , serum albumin bromocresol green , cholesterol cholesterol peroxidase method , triglyceride glycerol phaphate oxidase / peroxidase , hdl cholesteroldirect , hdl / ldl standard , ldl cholesterol direct , serum uric acid uricase peroxidase , serum calcium arsenazo iii , serum phosphorus , serum amylase direct substract , serum lipase colour method , cpk ( ck ) ifcc , ck mb ifcc , serum ferritinlatex , serum ferritin standard , hba1c direct , hba1c standard , crp , crp standard , ldh kit , magnesium kit , biochemistry calibrator , biochemistry control , wash solution concentrate , reaction rotor , pd cups , extran ma 02 , protein electrophoresis in blood ( serum kit ) code no.7004058 , normal control serumcode no.58305 , wash solution code no. 58595 , destaining solution code no.58694 , hb electrophoresis , d 10 hemoglobin a1c program recorder pack ( code no 220 0101 ) , d 10printer paper ( code no 220 0375 ) , liquichek diabetes control level 1 ( code no 171 ) , liquichek diabetes control level 2 ( code no 172 ) , tips ( 10 200 ul ) , tips ( 10 1000 ul ) , allicates , clot vaccutainer , distill water ( ltr ) , tissue paper roll , t3 elisa , t4 elisa , tsh elisa...

Indian Army - Madhya Pradesh

36386482 tender for supply of expendable medical stores kit ck mb erba semi autho 2 kit prothrombin time 1x5 ml ( tulip ) 3 ethyl alcohol ( std ) 4 kit dengue ns1ag comb card test ) ( tulip ) 5 cell pack pack of 20 ltr ( sysmex ) 6 stromatolyser 500 ml bott ( sysmex ) 7 cell clean 1x50 ml bott ( sysmex ) 8 sterile urine container10 ml 9 glass slides pkt of 100 ( 5 star ) 10 blood agar plate 11 mha agar plate 12 kit uristick ( protein & sugar ) 13 urine multi strip siemens bott of 100 strip 14 hi media zn stain ( readymade ) 15 hi media gram stain ( readymade ) 16 hi media methylene blue for retic stain 17 sample cup pack of 100 cup em 200 18 upt ( hcg ) 2x50 test kit 19 kit hiv rapid 4th gen cardtest ( sd, j mitra ) 20 kit vdrl card test ( tulip ) 21 kit salmonella typhi card test ( tulip ) 22 kit aso titer 1x2 ml ( kit of 35 test ) ( tulip ) 23 print roll 24 anti sera a bott of 10 ml antigen igm ( tulip ) 25 anti sera b bott of 10 ml antigen igm ( tulip ) 26 anti sera ab bott of 10 ml antigen igm ( tulip ) 27 anti sera d bott of 10 ml antigen igm ( tulip ) 28 ketostick 29 hi media sugar set ( biochemical reaction ) 30 rapid covid 19 antigen test 31 viral transport medium 3 ml ( vtm ) 32 kit d dimer 1x7 ml 33 feder hish profile microtome blades ( 1x50 ) 34 edta vaccutainer ( bd ) 35 sodium citrate ( bd ) 36 gel vaccutainer sterile tube of 5 ml ( bd ) 37 sterilevaccutainer sterile ( bd ) 38 sodium flouride...

Department of Higher Education - Madhya Pradesh

36365952 bids are invited for boqboq compound microscope , binocular microscope , image projection system , slide reader , water and soil testing kit , incubator ss , uv vis spectrophotometer , rotatory microtome with accessories , digital balance 01 mg , conductivity meter digital with cell , d o meter digital , electronic digital balance , deionizer with digital meter , ph meter digital , micro certifuge 10 rpm , paper chromatography testing kit , magnetic strirrer with hot plate , water bath double wall 6 holes ss , pcr machine total quantity : 38...

Directorate Of Medical Education - Madhya Pradesh

36184405 tender for supply of chemical and reagents for mdru dep , item name , mdru kits and reagents , ammonium chloride 500gm , potassium bi carbonate 500gm , sodium chloride 500gm , tris hcl 500gm , sds 500gm , saturated phenol 500ml , chloroform 500ml , sodium acetate 250gm , isoamyl alcohol 500ml / 1ltr , glacial acetic acid 500ml / 1ltr , molecular biology grade agarose powder 250gm , bromophenol blue dye 2ml*5=1pack , ethidium bromide 10ml , molecular weight ( dna ladder ) 100bp & 1kb 1 vial , molecular weight ( dna ladder ) 50bp 1 vial , molecular weight ( dna ladder ) 25bp 1 vial , taq polymerase 500units / vial , amplitaq gold dna polymerase master mix 500units / vial , mgcl2 5ml , dntp mix 1ml , dnase 1000 unit , rnase 1000 unit , proteinase k 1000 unit , tris edta 500 gm , edta 250gm / 500gm , boric acid 250gm / 500gm , teepol5 liter , xylene cynol 10 gm , dmso 50 ml , tips i. 0.2 20 ?l tips , superscript ii rnase reverse transcriptase / episcript™ rnase h reverse transcriptase ( episcript rt ) 400 / 500 reaction pack. , power sybrgreen pcr master mix 5 ml , power sybrgreen rt pcr reagent kit 5 ml , oligo ( dt ) 12 18 primer25ug ( 0.5ug / ul ) , absolute ethanol 500ml , pcr plates ( light cycler 480 compatible ) pack of 50 / pack of 100 , sealing foil ( rt pcr / qpcr grade ) ( light cycler 480 compatible ) pack of 50 / pack of 100 , filter tips each pack contains 1000 psc. , mct variable tubes each pack contains 1000 psc. , i. 20 200?l tubes , ii. 200 600 ?l tubes , iii. 500 2000 ?l tubes , nitrile autodextorous gloves each pack contains 1000 psc. , mctstands for variable tubes sizes each pack contains 10 psc. , i. 20 200?l tubes stand , ii. 200 600 ?l tubes stand , iii. 500 2000 ?l tubes stand , filter tip boxes each pack contains 10 psc. , i. 0.2 20 ?l filter barrier tip box , ii. 20 200 ?l filter barrier tip box , iii. 200 1000 ?l filter barrier tip box , rt pcr grade water pack size of 20ml ( 20 ml * 5 ) , tip discard box ( 1 2 liter capacity ) each , graduated measuring cylinders 50, 100, 500, 1000 ml each , graduated beakers 50, 100, 500, 1000 ml each , flat bottom tube 5ml ( with screw cap ) pack size of 500 psc. , tube stand ( 15ml falcon, 5ml, 2ml, 0.5ml, 0.2ml mct ) pack size of 10 psc. , graduated conical flask 50, 100, 500, 1000ml pack size of 5 psc. , test tube 5, 10 ml each pack contains 100 psc. , slide+cover slips ( 25mm*75mm ) each pack contains 100 psc. , tissue paper roll pack size of 12 psc. , fine tissue cloth roll pack size of 12 psc. , cotton pack size of 10 psc. , wash bottle / dropping bottle, 200ml, 500ml, 1ltr each , funnels variable range each , plastic bottle, 200, 500, 1000ml each , syringe + needle 2 ml, 5 ml pack size of 100 psc. each , nitrile gloves; medium and large size box pack size of 1000 psc. , dna isolation kit { blood } per kit , rna isolation kit per kit , phenol 500 ml , hno3 ( nitric acid ) 500 ml , propionaldehyde pure ( 97% ) 500 ml , phthalic anhydride 500 ml , glacialacetic acid ar 500 ml , hydrochloric acid ar 500 ml , sulfuric acid ar 500 ml , 2 amino ethanol 500 ml , pyridine ar 500 ml , ammonia solution ar 500 ml , ammonia chloride ar 500 ml , acetyl salicylic acid 500 ml , acetone ar 500 ml , anthranilic acid ar 500 ml , activated charcoal 500 ml , silica gel g 500 ml , benzoicacid ar 500 ml , sds 500 gm , colin ( cleaning detergent solution ) 500 ml , sterilium ( hand sanitizer ) 100 ml * 5 , dettol / lifeboy alcohol based hand sanitizer 100 ml * 5 , floor cleaner phenyl 1 l * 5 , cleaning mop per psc , broom per psc , microwave gloves per pair , brown paper for autoclaving per roll , liquid nitrogen 10 / 25 ltr. , phosphate buffer saline ( 10x; ph 7.4; rnase free ) 500 ml , formalin ( formaldehyde aqueous solution; lab grade ) 500 ml , paraffin wax ( 58 600c for histology ) 500 gm , xylene ( molecular lab grade ) 500 ml , glycerol500 ml , ammonia ( nh4oh; extra pure ) 250 ml / 500 ml , methanol ( methyl alcohol, ch3oh ) 500 ml , acrylamide / bis ar 500 ml , 10x tbe buffer 500 ml , urea ( ultra pure; mol bio grade ) 500 gm / 1kg , ammonium persulfate 100 gm , temed ( ultra pure; mol bio grade ) 100 ml / 250 ml , 4’, 6 diamidino 2 phenylindole 50 ml , diethyl pyrocarbonate 5 gm / 25 gm , tae buffer , sybr gold 100ul , restriction enzyme – mnl i250 / 300 / 500 units , restriction enzyme – bcli1000 / 1500 / 2500 / 3000 units , restriction enzyme – hpych4v100 / 500 units , restriction enzyme – hpych4iii200 / 250 / 1000 / 1250 units , restriction enzyme – sau96i 1000 units , restriction enzyme – sfci200 / 1000 units , restriction enzyme – bcci1000 units , restriction enzyme – scrfi500 / 1000 / 2500 units , restriction enzyme – afliii250 / 1250 units , restriction enzyme – scai500 / 1000 / 1250 units , restriction enzyme – avai1000 / 2000 units , restriction enzyme – bsmi200 / 500 / 1000 / 2500 units , restriction enzyme – tspri ( also share cleavage site withtscai ) 1000 units , restriction enzyme – mboii250 / 300 / 1250 / 1500 units , restriction enzyme – bsh1236i500 / 1000 / 2500 units , restriction enzyme – banii1000 / 1500 / 2000 units , restriction enzyme – mph1103i1000 / 5000 units , restriction enzyme – dde i200 / 500 / 1000 / 2500 units , restriction enzyme – bsmb i ( also share cleavage site withesp3i ) 200 / 400 / 1000 units , restriction enzyme – afa i ( also share cleavage site withrsa i ) 1000 / 5000 units , restriction enzyme – bal i ( also share cleavage site withmlu ni ) 50 / 100 / 200 / 250 units , restriction enzyme – fspi ( also share cleavage site withnsbi ) 400 / 500 / 1000 / 2500 units , restriction enzyme – hpa ii ( also share cleavage site withmspi ) 1000 / 2000 / 4000 / 5000 / 10000 units , restriction enzyme hinf i , restriction enzyme hpych4 , restriction enzyme mboii , restriction enzyme bstui , restriction enzyme mvai , primers , fmr1 set 1 –f5 tcaggcgctcagctccgtttcggtttca 3 r5 5 aagcgccattggagccccgcacttcc 3 , mecp2 exon 1 set 1 f5 gttatgtctttagtctttgg–3´ r5 tgtgtttatcttcaaaatgt–3´ , exon 2set 1 f5 cctgcctctgctcacttgtt–3´ r5 ggggtcatcatacatgggtc–3´ , exon 2set 2 f5 agcccgtgcagccatcagcc–3´ r5 gttccccccgaccccaccct–3´ , exon 3 set 1 –f5 tttgtcagagcgttgtcacc–3´ r5 cttcccaggacttttctcca–3´ , exon 3 set 2 f5 aaccacctaagaagcccaaa–3´ r5 ctgcacagatcggatagaagac–3´ , exon 3 set 3 f5 ggcaggaagcgaaaagctgag–3´, r5 tgagtggtggtgatggtggtgg–3´ , exon 3 set 4 – f5 5´–tggtgaagcccctgctggt–3´ r5 ctccctcccctcggtgtttg–3´ , exon 3 set 5 f5ggagaagatgcccagaggag–3´ r5 cggtaagaaaaacatccccaa–3´ , exon3 ( l100v ) f5 aaccacctaagaagcccaaa 3 r5 gcttaagcttccgtgtccagccttcaggta 3 , putative promoter and exon 1. f5 gggtgcaatgaaacgctta 3 r5 tttaccacagccctctctcc 3 , mc4r rs17782313 f 5 aagttctacctaccatgttcttgg 3 r 5 ttccccctgaagcttttcttgtcattttgat 3 fto rs9939609 f 5 aactggctcttgaatgaaataggattcaga 3 r5 agagtaacagagactatccaagtgcagtac 3 , adipoqrs2241766 – f5 tgtgtgtgtggggtctgtct 3 r 5 tgtgatgaaagaggccagaa 3 , rs1501299 f5 ctacactgatataaactatatggag 3 r5 ccccaaatcacttcaggttg 3 , pcsk1 rs155971 – f5’tatatgcagccaccaatcca 3’ r5’aaaatgaagggagaagcacaaa3’ , pomcrs6232 f5 ttgtgcccttcatctgaaca 3 r5 tgtagcaactttggcatgga 3 , rs155971 f5tatatgcagccaccaatcca 3 r5 aaaatgaagggagaagcacaaa 3 , ppar g ( pro12ala ) f5gcc aat tcaagc cca gtc 3r5gat atgttt gca gac agt gta tca gtg aaggaa tcg ctttcc g 3 , kcnj11 ( rs5219 ) f5 gactctgcagtgaggcccta 3’ r5 acgttgcagttgcctttctt 3’ , capn10 ( rs3792267 ) f5 cacgcttgctgtgaagtaatgc 3’r5 tgattcc catggtctgtagcac 3’pik3ca set 1 forward 5’ ggagtatttcatgaaacaaatgaatgatgcg 3’ reverse 5’ gagctttcattttctcagttatctt 3’ , bat 25 set 1 f 5’ tcgcctccaagaatgtaagt 3’r 5’ tctgcattttaactatggctc 3’bat 26 set 1 f5’ tgactacttttgacttcagcc 3’r5’ aaccattcaacatttttaaccc 3’ , d2s123 set 1 f5’ aaacaggatgcctgccttta 3’ r5’ ggactttccacctatgggac 3’ , d5s346 set 1 f 5’ actcactctagtgataaatcggg 3’ r5 agcagataagacagtattactagtt 3 , d17s250 – set 1 f5’ ggaagaatcaaatagacaat 3’ r5’ gctggccatatatatatttaaacc 3’ , impdh2 set 1 f5 gtttctgcggtatcccaatc 3 r5 cgagcaagtccagcctat 3 bmp6 rs73719353 f5’ gctcctttgcacttcgctgt 3’ , r5’ aggctctgctg agctcctac 3’ , bmp6 rs73719341 f 5’tgaacttcccattcccctct 3’ r5’ataaaattagcattgatcca 3’ , bmp6 rs73719318 f5’caggtgctgtgcaacttctt 3’ r 5’agagggcaccatggttgcct 3’ , bmp6 rs73381662 f 5’ ctgagattcaattaggccca 3’ r 5’taaagaacagcaaaagtctg 3’ , bmp6 rs73381650 f 5’cacataaagattgctgcatt 3’ r 5’tagtaatcctaaaaatggga 3’ , anxa2 rs7170178 f 5’ ttcacagcagttcaaaatac 3’ r 5’ ctgggtttccagagatggaa 3’ , anxa2 rs73435133 f 5’ gagtgcaaggtgctgaggat 3’ r 5’ gatttcagacagcccttgca 3’ , anxa2 rs73418020 f 5’ tctgagagtgaaaggtgcac 3’ r 5’ tcccatcccctgaatccctg 3’ , anxa2 rs72746635 f 5’ cctgactcattgtcacatca 3’ r 5’ aagtggctttccactgccc 3’ , anxa2 rs73418025 f 5’ cttctcatcttactttt 3’ r 5’ agggaaggatacagaggaga 3’ , hsp 70 primer sequence5 agcgt aacac cacca ttcc 3 ( forward ) 5 tggct cccac cctat ctc 3 ( reverse ) , the gapdh sequence forward primer 5 agc cac atc gct gag aca c 3, reverse primer 5 gcc caa tac gaccaa atcc 3. , mthfr f:5 tgtggtctcttcatccctcgc 3;r: 5 ccttttggtgatgcttgttggc 3. , dpyd f:5 actcaatatctttactctttcatcaggac 3. r: 5 acattcaccaacttatgccaattct 3. , tyms f:5’ ggtacaatccgcatccaactatta 3’ r:5’ ctgataggtcacggacagattt 3’ , imp3 forward:5’atgactcctccctacccg3’ reverse:5’gaaagctgcttgatgtgc3’ , cxcl1forward: 5’ccagacccgcctgctg 3’and reverse:5’cctcctcccttctggtcagtt 3’ , cox 2 forward: 5 cagccatacagcaaatcc 3; reverse: 5 tcgcacttatactggtcaa 3 , hmlh1f 5 ttt tga tgt aga tgt ttt att agg gtt gt 3r 5 acc acc tcatcataa cta ccc aca 3 , ppar g ( pro12ala ) , f5gcc aat tcaagc cca gtc 3 , r5gat atgttt gca gac agt gta tca gtg aaggaa tcg ctt tcc g 3 , methylated ( hmlh1 ) f 5 acg tagacg ttt tat tag ggt cgc 3 r 5 cct catcgtaac tac ccg cg 3 , hmsh2 f 5 ggt tgt tgt ggt tgg atg ttg ttt 3 r 5 caa cta caa cat ctc ctt caa cta cac ca 3 , methylated ( hmsh2 ) f 5 tcg tgg tcg gac gtc gtt c 3 r 5 caa cgt ctc ctt cga cta cac cg 3 , ? actin: forward: 5’ ctacgtcgccctggacttcgagc 3’ ß actin: reverse: 5’ gatggagccgccgatccacacgg 3’ , kras forward: 5 gactgaatataaacttgtggtagttggacct 3.reverse: 5 ctattgttggatcatattcgtcc 3. , braf forward: 5 tcataatgcttgctgatagga 3. reverse: 5 ggccaaaaatttaatcagtgga 3. , mthfr ( c677t ) ‘‘5 gcacttgaaggagaaggtgtc 3” and reverse primer ‘‘5 aggacggtgcggtgagagtg 3” , mthfr ( a1298c ) forward ‘‘5 ctt tgg gga gct gaa gga cta cta c 3” and reverse ‘‘5 cac ttt gtg acc att ccg gtt tg 3” primers. , total rna isolation mini kit ( from human skin tissue ) / rneasy fibrous tissue mini kit ( for rna extraction from human skin tissue ) ( qiagen ) per kit ( each kit pack is for 50 reactions ) , purospin™ fibrous tissue rna purification kit ( luna nanotech ) ( for rna extraction from human skin tissue ) per kit ( each kit pack is for 250 reactions ) , aurum™ total rna fatty and fibrous tissue kit ( biorad ) / mp biomedicals fastrna pro green kitper kit ( each kit pack is for 50 reactions ) , human leptin elisa kit per kit ( each kit pack is for 96 reactions ) , human adiponectin elisa kit per kit ( each kit pack is for 96 reactions ) , human adipsin elisa kit per kit ( each kit pack is for 96 reactions ) , human resistin elisa kit per kit ( each kit pack is for 96 reactions ) , human iron elisa kit ( serum iron ) per kit ( each kit pack is for 96 reactions ) , human ferritin elisa kit ( serum / ferritin ) per kit ( each kit pack is for 96 reactions ) , gdf15 human elisa kit per kit ( each kit pack is for 96 reactions ) , spexin human elisa kit per kit ( each kit pack is for 96 reactions ) , human pai 1 elisa kit per kit ( each kit pack is for 96 reactions ) , thyroid estimation kit per kit ( each kit pack is for 96 reactions ) , ice maker machine for laboratory purpose 1 unit , microwave gloves each packet contains one pair of gloves. , pcr mini cooler / coolcube microplate and pcr tube cooler each , horizontal gel apparatus: 18 – 20 cm ( length ) x 25 – 30 ( breadth ) x 5 7.5 cm ( height ) , 40 60 samples, multichannel pipette compatible combs and gel caste each , mini horizontal gel apparatus: 9 cm w x 11 cm l with grooves ( 8.7 cm l x 1.2 cm h ) on the side for gripping the gel tray. it should have two comb slots on the same tray area. buffer capacity should be 600 ml for the buffer tanks and optimum gel runs with a fill line indicator for buffer levels along the unit side each , multi size forceps lab set each packet containsmulti size forceps lab set , liquid nitrogen sample storage tanks each , liquid nitrogen sample handling gloves each packet contains one pair of gloves. , l mold each , tissue cassette steel each , electric tissue float bath ( thermostate ) each , coupling jar each pack contains 2 psc. , staining rack each , whatman filter paper grade 1 & 2 each packet contains 50 psc.. , harri’s hematoxylin powder 25 / 50 / 100 / 250 / 500 gm , yellow eosin powder 25 / 50 / 100 / 250 / 500 gm , coverslip 18x18 ( microscopic ) each packet contains 100 psc.. , dpx mount 100 ml / 250 ml , hot plate each , mx35 premier microtome blade ( 34 / 80mm ) 50 blades each box contains 50 psc.. , diamond point marker pen ( histopathology use ) each , embedding mold and embedding ring each , qiamp dna ffpe tissue kit ( 50 rxns ) , genomic dna purification kit ( promega ) , rna extraction kit from tissue , cdna synthesis kit , superscript ii rnase reverse transcriptase , sybr green pcr master mix , sodium bisulphite , page loading dye , formamide , n’n’ methylene bisacrylamide , ammonium persulfate , temed , polyacrylamide , wizard dna clean up system ( promega ) , 2 mercaptoethanol , silver stain , hydroquinone , urea , blotting paper , dna ladder 10 bp , pas stain , histopathology plastic cassettes , poly – l – lysine coated slides , deep well mortar and pestle homogenizers ( medium size ) , deep well mortar and pestle ( small size ) , rneasy minielute cleanup kit , phase – lock gel heavy5 prime phase – lock gel heavy5 prime , qiazol lysis reagent , rneasy minielute cleanup kit , cryo vial 1 pkt contains 50 psc. , deep well mortar and pestle ( small size ) ...

Department of Higher Education - Madhya Pradesh

36156982 bids are invited for boqboq compound microscope , dissecting microscope , bionocular microscope , image projection system , slide reader , hot air oven stainless steel , water and soil testing analysis kit , ph meter , incubator stainless steel , microscopic camera , digital tds meter , tissue culture rack caster racks , chromatro graphic chamber , conductivity meter digital with cell , hot air oven 14 14 , digital balance accuracy 0001 200 grm , digital ph meter conductivity meter and temperature meter , melting point apparatus digital , digital photoelectric colorimeter 5 liters , micro processor water soil testing kit , distillation apparatus double distillation borosilicate glass cap 5 liter , spectro photometer 340 900nm , chemical balance , chemical weight box 1mg 100gm , chromatographic cabinet 6 leaves , tds meter digital , conductivity meter digital , rotatory microtome with accessories , micro pipette fixed1 5 ml , distillation apparatus single distillation capacity 3lt , centrifuge machine 3500 rpm , flam photometer total quantity : 103...

Department of Higher Education - Madhya Pradesh

36137359 bids are invited for boqboq laboratry equipement mosfet chara cteristics apparatus 5 photo transistor char. apparatus 5 e / m by milikans oil drop method 2 constent deviation spectrograph 1 ujt char. apparatus 5 hartely and colpitts apparatus 5 cro dual trace 30 mhz 1 zener regulated power supply 5 compound microscope 20 dissecting microscope 10 binocular microscope 1 slide reader 1 water bath double wall 1 water and soil testing kit 1 ph meter 5 electronic digital balance 1 oven 1 tissue culture rack 1 thin layer chromatography 1 chrometographic chamber 2 oven 1 electronic digital balance 5 tds meter digital 5 microprocessor water soil testing kit 1 chemical balance 4 water and soil testing kit 5 thin layer chromatography 2 rotary microtome tih accessories 1 binocular microscope 1 research microscope 1 flame photometer 1 digital tds meter 4 ph meter 5 heating mental with regular cap 2 compound microscope 20 hot air oven ss 2 vortex shaker 1 image projection system 2...

Indian Army - Madhya Pradesh

35954331 purchase of medical stores as per tender documents , medicines : , pregnancy test card , ana kit (kit of 1x25 tests) , troponin i (pack of 1x25 tests) , aso titre (1x25 tests) , widal kit (4x5ml) , crp kit (1x25tets) , dengue (ns1ag, igg & igm) rapid test , malaria antigen test , fecal occult blood test kit (1x10 tests) , g6 pd test kit , pttk reagent (pack of 12x5 ml) , prothrombin time (pack of 12x5ml) , cuvette for stago start 4 (pack of 150x4) , biorad level 1 chemistry control (pack of 12x5ml) , biorad level 2 chemistry control (pack of 12x5ml) , diabetes control biorad level 1 & 2 , leishman stain ready to use (pack of 500ml with buffer) , reticulocyte stain (bott of 100ml) , drabkins solution (1 ltr) , zn stain ready to use , indian ink stain (50ml) , lacto phenol cotton blue stain , haemotoxyllin ehrlich (ready to use) bott of 500ml , haematoxillin stain harris (ready to use) bott of 500ml , pap stain , ethanol (bott of 500ml) , methanol (bott of 500ml) , formalin , xylene (bott of 500ml) , chloroform (bott of 500ml) , glycerine (bott of 500ml) , paraffin wax (pack of 500gm) , microtome blade s 35 high profile type (pack of 50 blades) feather microtome , plastic tissue embedding ring , plastic tissue cassette , cled agar (500gm) , urochrome agar (500gm) , muller hinton agar (500gm) , blood agar bass (500gm) , sabauraud dextose agar (500gm) , salmonella, shigella agar (bott of 500gm) , vacutainer edta , vacutainer sodium fluoride , vacutainer sterile with gel 5ml , vacutainer sterile plain without gel 3ml , vacutainer sodium citrate 3ml , microscope bulbs , glass marking pen (diamond marker) , milk adulterants test kit , tourniquet , pedridish disposable , urine container plastic 50ml , typhoid igg/igm rapid test (pack of 1x25 tests) , ra factor (1x25 tests) , calcium chloride 0.025m (vial of 5ml) , steel balls for start 4 stago semi auto coagulation analyzer (pack of 1850) , gram stain ready to use , acetone (bottle of 500ml) , filter paper 60x60cm (pack of 50) , l shape embeding mould (brass) => limited...

Department of Higher Education - Madhya Pradesh

35805947 bids are invited for boqboq compound microscope , dissecting microscope , bionocular microscope , image projection system , slide reader , hot air oven stainless steel , water and soil testing analysis kit , ph meter , incubator stainless steel , microscopic camera , digital tds meter , tissue culture rack caster racks , chromatro graphic chamber , conductivity meter digital with cell , hot air oven 14 14 , digital balance accuracy 0001 200 grm , digital ph meter conductivity meter and temperature meter , melting point apparatus digital , digital photoelectric colorimeter 5 liters , micro processor water soil testing kit , distillation apparatus double distillation borosilicate glass cap 5 liter , spectro photometer 340 900nm , chemical balance , chemical weight box 1mg 100gm , chromatographic cabinet 6 leaves , tds meter digital , conductivity meter digital , rotatory microtome with accessories , micro pipette fixed1 5 ml , distillation apparatus single distillation capacity 3lt , centrifuge machine 3500 rpm , flam photometer total quantity : 103...

Government Medical College - Madhya Pradesh

35627530 supply for central lab and cssd consumables and other item supply for central lab and cssd consumables and other items in gmc raltam , three part automated cell counter model : swelab alfa plus basic , swelab alfa plus diluents , swelab alfa plus lyser , boule control normal , boule control low , boule control high , five part fully automated cell counter model : bc 6800 , m 68lh lyse , m 68 lb lyse , m 68 dr diluent , m68 ld lyse , m 68 ln lyse , m 68 ds diluent , 68 fd dys , 68 fr dys , 68 fn dys , probe cleanser , controls and calibrators , aspen bc – 6d control set (6x4.5ml (2l, 2n, 2h)) , aspen bc – ret control set (6x4.5ml (2l, 2n, 2h)) , aspen sc – cal plus calibrator , automatic coagulation analyzer model : sta compact max 3 , stac cacl20, 0025m (00367) , sta cephascreen 10(00310) , sta cleanser solution 6x2500ml(00973) , sta coag control n+p(00679) , sta desorb u24x15ml (00975) , sta liatest control n+p (00526) , sta liatest d di (00662) , sta @ neoptimal 5. (01163) , sta owren koller 24x15ml(00360) , chemicals , ethanol (99.9%) , xylene (sulphar free) , paraffin wax (58 60 temperature) , acetone , hematoxyline , eosin (2%) , distyrene plasticizer xylene (dpx mountant) , glacial acetic acid , formic acid (100%) , nitric acid (100%) , propanol (45%) , oil immersion , n/10 hcl , sodium metabisulphate , urine strip 10 para , sodium nitroprusside , liquor ammonia , ammonium sulphate , sulphosalicilic acid solution , sulphur powder , leishmen stain , wbc diluting fluid , rbc diluting fluid , og 6 , ea 50 , semen analysis diluting fluid , formaline , spirit alcohol , sulphuric acid , reticulocyte count fluid , distilled water , barium chloride , sodium hypochloride , methanol , glucose pouch , perls stain (long expiray) , pas stain (long expiray) , mpo sstain (long expiray) , benzidine solution (long expiray) , kits , reticulocyte count kit , pt kit , aptt kit , field stain kit , rapid pap stain kit , giemsa stain kit , g6pd kit , antisera a , antisera b , antisera d , sickle cell test kit , pt/inr kit , reagent , benedict reagent (long expiray) , ehrlich’s reagent (long expiray) , esbech’s reagent (long expiray) , fouchet reagent (long expiray) , other consumable items , microscopic glass slide (75x25) , jam microscopic cover glass (22x50) , casset , microtome blade , slide box , tissue paper roll , plastic dropper (small) , plastic dropper (big) , test tube 5ml , coupling jar , test tube 10ml , slide carrying tray , aluminium slide tray , slide staining stand , glass dish staining jar , test tube stand , measuring cylinder (10 ml borosilicate) , glass tube brush , hand wash , beaker glass (100 ml borosilicate) , beaker glass (500 ml borosilicate) , conical flask (100 ml borosilicate) , conical flask (500 ml borosilicate) , bubbler (plastic screw) , graduate pipette (borosilicate ) 10ml , volumetric flask 100ml , filter paper 12.5dm , diamond pencil , capillary tube for bt ct (glass) , k3 edta vial , urine container , knife (grossing) , speciman jar with lid (glass) (200x200x70 mm) , speciman jar with lid (glass) (150x150x60mm) , museum jar with lid (glass) (220x150x100mm) , museum jar with lid (glass) (220x195x80mm) , museum jar with lid (glass) (250x165x140mm) , museum jar with lid (glass) (360x150x100mm) , museum jar with lid (glass) (150x150x80mm) , museum jar with lid (glass) (250x250x120mm) , museum jar (10x10x15 inches) , museum jar (18x12x12 inches) , museum jar (25x15x10 inches) , pippette 1 ml (borosilicate) , pippette 5 ml (borosilicate) , glass rod (solid ) , slide holder (steel) , slide staining rack , urinestripe 4 parameter (1.ph 2.specific gravity3. sugar 4.albumin(protein)) , sodium citrate vial , esr tube (wintrobe) , esr western green tube , cover slip10 gm , application plastic stick , sprit lamp glass , tube holder , rbc pipette , wbc pipette , wester green stand , wintrobe stand , pasture pipette , disposable pap smear kit , torniqute , tissue embedding mold , embedding o ring , test tube 15 ml , test tube 20 ml , centrifuge tube 15ml , centrifugr graduated tube 15 ml , reagent bottle 100 ml , reagent bottle 250ml , reagent bottle 500 ml , measuring cylinder 100 ml , measuring cylinder 5 ml , dropping bottle 250 ml , detergent powder , culture media , agar powder , alkaline peptone water , anhydrous barium chloride , arabinose , arginine dihydrolase powder , automated blood culture bottle (adult) compatible withbact/alert 3d 480, bio merieux , automated blood culture bottle (paediatrics) compatible withbact/alert 3d 480, bio merieux , bile esculin agar , blood agar powder , brain heart infusion broth , candida crome agar , cary blair medium base , christensens urea agar base , cled agar , corn meal agar , decarboxylase broth moeller , dermatophyte test medium , glucose , glucose phosphate broth , hugh leifson medium , lowenstein jansens medium(ready prepared) , lactose , lysine decarboxylase , macconkey agar without crystal violet , macconckeys agar with crystal violet , macconkey broth double strength (for water testing) , macconkey broth single strength (for water testing) , maltose , manitolmotility test medium , mannitol , mannitol salt agar , manual blood culture bottle with sds (adult) 70ml , manual blood culture bottle with sds (paediatrics) 20ml , muller hinton agar , nutrient agar , nutrient broth , peptone powder , phenyl alanine agar , pyr agar , robertson cooked meat medium base , sabouraud dextrose agar with chloramphenicol with cycloheximide , sabourauds dextrose agar powder , sabroud dextrose agar with chlorophenicol , selenite f broth , simmons citrate agar , sodium deoxycholate , sucrose , tcbs agar , triple sugar iron agar , xld agar , antibiotic disc , amikacin 30 mcg , amoxicillin , amoxycillin clav 20/10ug , ampicillin 10 mcg , ampicillin sulbactam(10/10 ?g) , azithromycin 15 mcg , aztreonam(30 ?g) , cefazoline 30 mcg , cefepime 50ug , cefoperazone / sulbactum , cefoperazone 75 mcg , cefotaxime(30 ?g) , cefotaxime+clavulanate , cefoxitin 30ug , cefpodoxime , ceftazidime 30 mcg , ceftazidime+clavulanate , ceftriaxone 30 mcg , ceftriaxone sulbactum 30/15ug , cefuroxime 30 mcg , chloramphenicol 30 mcg , ciprofloxacin 5mcg , clarithromycin(15 ?g) , clindamycin 2 mcg , co trimoxazole(sulpha/trimethoprim) 25 mcg (23.75/1.25) , colistin (0.016 256 mcg/ml) , colistin 10 mcg , cotrimoxazole(25 ?g) , doripenem(10 ?g) , doxycycline hydrochloride 30 mcg , ertapenem(10 ?g) , erythromycin 15 mcg , gatifloxacin(5?g) , gemifloxacin(5 ?g) , gentamicin 10 mcg , imipenem 10 mcg , linezolid(30 ?g) , lomefloxacin(10 ?g) , meropenam 10ug , minocycline(30 ?g) , moxifloxacin(5 ?g) , nitrofurantion 300 mcg , norfloxacin 10 mcg , novobiocin(5 ?g) , ofloxacin(5 ?g) , oxacillin(1 ?g) , penicillin 10 units , piperacillin 100 mcg , piperacillin/tazobactam 100/10 mcg , polymyxin b , quinopristin dalfopristin(15 ?g) , teicoplanin , teicoplanin 30 mcg , tetracycline 30 mcg , ticarcillin clavulanate(75/10 ?g) , tobramycin 10 mcg , trimenthoprim(5 ?g) , vancomycin (0.016 256 mcg/ml) , vancomycin 30 mcg , bacitracin(0.4 u) , sterile disc , v factor , x factor , x+v factor , optochin(5 ?g) , kits & chemical , acetone solution , acid fast staining kit , albert’s metachromatic stain kit , andrade’s indicator , anti hav igm (elisa kit) , anti hav igm (rapid test) , anti hcv antibody kits (elisa kit) , aso kit(25 test/packet),consumable , basic carbol fuchsin for afb staining(powder) , conc hcl , crp test kit , crystal violet powder , dengue ns 1 elisa , formaldehyde solution , field stain a , field stain b , filarial antigen card test , ferric chloride (500 gm) , formaldehyde 40% (conc. formaline) , giemsa stain (merck / span) , glycerol , gram iodine , gram staining kit , h2so4 (sulphuric acid) 25% , hbv elisa test kit , hepatitis e virus anti hev igm antibody (elisa) , hiv (rapid)(whole blood finger prick test kit) , hiv elisa test kit , hydrogen peroxide 6% solution , india ink , kovac’s reagent (indole) , lacto phenol cottons blue stain , lead acetate strip , leishman stain , liquid paraffin , malaria bivalent antigen detecting rapid diagonstic tests(rdts) , methyl blue for (z n) , methyl alcohol , methyl red indicator , methylene blue powder , nitrate reagent a , nitrate reagent b , occult blood test kit (haem test kit) , oxidase disc , oxidase reagent (tetra methyl para phenylene di amine di hydro chloride) , phenol crystals , pyr reagent , ra factor rapid kit , rpr test kit , safranine (gram stain) , urea 40% supplement (for urea agar base) , voges proskauer reagent a , voges proskauer reagent b , widal slide test(4x5ml with control) , xylene , zinc dust , chemical indicator for autoclave (indicator tape) , biological indicator for autoclave (indicator vial) , glassware, plasticware& other item , autoclavable aluminium foil , autoclavable glass bottle with screw cap for culture media (1000ml (borosilicate glass autoclavable)) , autoclavable glass bottle with screw cap for culture media (500ml (borosilicate glass autoclavable)) , autoclavable glass bottle with screw cap for culture media (50ml (borosilicate glass autoclavable)) , autoclavable petri plate (100mm) plastic , autoclavable petri plate (150mm) plastic , autoclavable petri plate (90mm) plastic , autoclavable reusable transparent bags , bcg(1 ml each) , beaker 1000ml (borosilicate glass autoclavable) , bloting paper (paper) , burning sprit , cedar wood oil , concavity slide , conical flask (glass) 1000ml , conical flask (glass) 100ml , conical flask (glass) 2000ml , conical flask (glass) 500ml , conical flask (glass) 50ml , cover slip , cryogenic vial , disposable plastic loop 2mm , disposable plastic loop 4mm , disposable sharp collection containers(5 ltr) , dropping bottle plastic 100 120 ml capacity , durham’s tube , falcon tube sterile, (conical bottom)(50ml each plastic containers with air tight screw cap printed graduation) , filter paper sheet((whatmann no 01) , filter paper(12.5 cm, 0.1 micron) , forceps small , gaspak (3.5 liter) , glass marking pen (diamond ) , glass reagent bottle (5 litre) , glass test tube 12 x 100 (medium size) heavy quality 100/pkt(no.) , glass test tube 12 x 50 borocilicate glass autoclavable , glass test tube 15 x 125 borocilicate glass autoclavable , measuring cylinder plastic (100 ml) , measuring cylinder plastic (1000 ml) , measuring cylinder plastic (50 ml) , measuring cylinder plastic (500 ml) , metal loop holder , micropipette tips (10 ul )(for serology) , micropipette tips (100 ul )(for serology) , micropipette tips (1000 ul )(for serology) , micropipette tips (20 ul ) , micropipette tips (200 ul ) , microscope lens cleaner kit , para film sealing film , ph paper strip range (1 10) , soap , sterile cotton swab wooden stick(individually packed) , sterile disposable/hypodermic syringe for single use(5ml ) , sterile disposable/hypodermic syringe with needle for single use(2ml ) , sterile disposable/hypodermic syringe with needle for single use(10ml ) , sterile urine collection container 50ml disposable , individually packed , swab stick with tube sterile , test tube holder , test tube stand (aluminum) 10x10 holes for 12mm diameter test tube , test tube stand 10x10 holesfor 18mm diameter test tube , test tube stand 10x10 holes for 12mm diameter test tube , test tube stand, polypropylene, 3 tier(for keeping 10 ml vtm vials/ tier) , urine container size of the container shall be 30ml disposable , utility gloves(medium) , atcc strain & antisera , acinetobacter baumannii nctc 13304 , enterococcus faecalis atcc 29212 , klebsiella pneumoniae atcc 700603 , pseudomonas aeruginosa atcc 27853 , staphylococcus aureus 25923 , escheriachia coli 25922 , staphylococcus aureus atcc43300 (mrsa) , shigella boydii polyvalent c antisera , shigella dysentriae polyvalent a antisera , shigella flexneri polyvalent b antisera , shigella sonnei polyvalent d antisera , vibrio cholera o1(ogawa)antisera , vibrio cholera o1( inaba)antisera , vibrio cholera (o139 )antisera , salmonella typhi poly o antisera , salmonella typhi o 2 antisera , salmonella typhi o 7 antisera , salmonella typhi o 9 antisera , rt pcr kits, chemical & consumable , 0.2 ml pcr tube (sterile, flat cap shaped) dnase/rnase free , 15 ml polypropylene centrifuge tubes, sterile, {certified nonpyrogenic and dnase /rnase free, disposable conical bottom with seal caps(the tubes should have printed graduations and a large white marking spots)} , alcohol 70% (laboratory grade) , bio medical waste bins red (15 ltr) , bio medical waste bins red (25 ltr) , bio medical waste bins red (40 ltr) , bio medical waste bins yellow (15 ltr) , bio medical waste bins yellow (25 ltr) , bio medical waste bins yellow (40 ltr) , bmw polybags red colour (18 kg capacity) , bmw polybags red colour (28 kg capacity) , bmw polybags red colour(45 kg capacity) , bmw polybags red colour (05 kg capacity) , bmw polybags yellow colour (18 kg capacity) , bmw polybags yellow colour (28 kg capacity) , bmw polybags yellow colour (45 kg capacity) , cryotags / freezer labels, for 1.5 2.0 ml cryovials {ability to withstand cryogenic temperatures upto minus 80 degree c for a wide variety of plastic and glass vials, test tubes, cryogenic boxes and plates} , diluent for dna extraction/ ethanol, molecular(biology grade) , filter barrier tips 20 ul (in box packing, sterile dnase rnase pyrogenfree compatible with nichipet ex2 pipette (make nichiriyo)) , filter barriertips 10 ul (sterile dnase rnase pyrogenfree compatible with nichipet ex2 pipette (make nichiriyo)) , filter barriertips 1000 ul (sterile dnase rnase pyrogenfree compatible with nichipet ex2 pipette (make nichiriyo)) , filter barriertips 200 ul (sterile dnase rnase pyrogenfree compatible with nichipet ex2 pipette (make nichiriyo)) , micro centrifuge tube 0.5 ml (polypropylene tubes, resistance to chemicals, mechanical stress and temperature extremes,(autoclavable, dnase, rnase/endotoxin free)) , micro centrifuge tube 1.5 ml(polypropylene tubes, resistance to chemicals, mechanical stress and temperature extremes,(autoclavable, dnase, rnase/endotoxin free)) , micro centrifuge tube 2 ml(polypropylene tubes, resistance to chemicals, mechanical stress and temperature extremes,(autoclavable, dnase, rnase/endotoxin free)) , micro pipette tips 5 300ul , microcentrifuge tube rack (20 tube/24 tube capacity)(for 1.5/2ml tube) , microcentrifuge tube rack (80 tube/96 tube capacity) reversible one side for 1.5ml tube and other( side with 0.2 ml pcr tubes) , non latex purple nitrile gloves (large) (sterile dnase rnase pyrogenfree ) , non latex purple nitrile gloves (medium) (sterile dnase rnase pyrogenfree ) , optical adhesive covers for pcr 96 well rxn plates 0.2ml (compatible with biorad cfx 97 dx opm) , optical adhesive covers for pcr 96 well rxn plates 0.2ml (compatible with thermo fisher a28574 quant studiort pcr machine) , parafilm roll (size approx 2 inch width and 250 inch length) , pcr 96 well rxn plates 0.2ml (compatible with biorad cfx 97 dx opm) , pcr 96 well rxn plates 0.2ml (compatible with thermo fisher a28574 quant studiort pcr machine) , pcr strips 0.1 ml (strip of 4) (compatible with qiagen 5plex rotorgene rt pcr machine) , pcr strips 0.2 ml with attached cap (strip of 8) (compatible with thermo fisher a28574 quant studiort pcr machine) , pcr strips 0.2 ml with attached cap (strip of 8) (compatible with biorad cfx 97 dx opm) , rnase/ dnase away solution (for complete removal of rnase/ dnase contamination from work surfaces, pipettes and equipments(should be stable at room temperature)) , sterile pasteurppipettes 3ml , viral transport media with swabs (3ml vial with 2 regular swabs i.e. one nasal swab and one throat swab (1.viral transport medium (vtm) with swab with complete directions for collection, storage, transport and carrying. 2.sterile dacron, polyester or rayon sterile swabs with plastic shafts)) , aluminium foil (9 meters length) thickness 11 microns, width 30 cm , compertable with transasia xl 1000fully automated biochemistry analyser , erba ada kit (1x20 ml/1x10 ml) , erbaalbumin kit (10x44 ml) , erba alakaline phosphatase kit (2x44 ml /2x11 ml) , erba amylase kit (3x22 ml) , erba autowash kit (10x100 ml) , erba bilirubin total (btdca) kit (6x44 ml /3x22 ml) , erba bilirubin direct (btdca) kit (6x44 ml /3x22 ml) , erba calcium (arsenazo) kit (10x12 ml) , erba cholestrol kit (10x44 ml) , erba ck nac kit (2x44 ml /2x11 ml) , erba ck mb kit (2x44 ml /2x11 ml) , erba direct hdl cholestrol with calibrator kit (4x30ml/4x10ml) , erba direct ldl cholestrol with calibrator kit (2x30//2x10 ml) , erbacreatinine (enzymetic) kit (5x30 ml/5x10 ml) , erba gamma gt kit (5x44ml/5x11 ml ) , erba glucose kit (10x44 ml) , erba fe 125 kit (r1 4x25 ml/r2 2x12.5 ml/calibrator/2x2ml) , erba hba1c kit (r1.2x15 ml/r2 2x5 ml/5x0.5 ml) , erba ldh p kit (2x44 ml /2x11 ml) , erba lipase xl kit (1x44 ml/1x11 ml) , erba magnesium kit (2x44 ml) , erba mal kit (1x10/5x25 ml) , erba microprotein kit (10x12 ml) , erba phosphorus kit (10x12 ml) , erba total protein kit (10x44 ml) , erba sgot el kit (6x44/3x22 ml) , erba sgpt el kit (6x44/3x22 ml) , erba triglycerides kit (5x44 ml/5x11ml) , erba urea kit (5x44 ml/5x11ml) , erba uibc125 kit (r1 4x25ml, r2 2x12.5ml, calibrator 2x12.5ml ) , erba uric acid kit (5x44 ml/5x11ml) , xl turbi crp kit (2x22 ml/1x11 ml) , xl turbi rf kit (1x22/1x5.5 ml) , erba ada cail kit (1x1ml) , erba ada control kit (1x1ml) , erba hba1c con h kit (1x.0.5ml) , erbahba1c con l kit (1x.0.5ml) , erba xl multical kit (4x3 ml) , erba norm kit (1x5ml) , erbapath kit (1x5ml) , apo a1 kit , apo b kit , hs crp kit , lp(a) kit , xl auto wash ac/al kit (5x44 ml /5x44 ml) , sample cups kit , sample cup vol: 1.0 ml unique type kit , thermal paper roll (108 mm x 3 m)kit , ise module reagent pack na+/k+/cl./li+(4 channel pack) kit , ise cleaning solution kit , compertable with transasia semi auto analyzer erba chem 5x , glucose kit , urea kit , creatinine kit , total bilirubin kit , total protein kit , albumin kit , total cholesterol kit , sgpt/alt kit , sgot/ast kit , ldh kit , ck mb kit , trop i kit (qualitative) , alp kit , triglycerides tg kit , hdl kit , disposable plastic test tube , clot activater tube (plan tube) , fluoride tube , micropipette tip1000ul , micropipette tip100ul , micropippte((0.5 50 ul)) , micropippte (100 1000ml) , external quality control vial for routine biochemistry (erba chem 5x) , protein csf kit , lamp. (erba chem 5x) , calcium (50x1 ml) , uric acid , ada , ark diagnosis electrolyte analyzer , electrolyte analyzer reagent , electrolyte daily cleaner , electrolyte quality control 1,2,3 (1 box ( serum: l1 3, l2 4, l3 3,urin: l1 1, l2 1)) , pm kit , reference housing , electrode (na,k,cl) , compertable with elisa reader (tecan infinite f50 & hydroflex) , t3 , t4 , tsh , sterilizer item compertable with cisa 8 stu model no. 6412 , printer paper , door gasket , heating element , microbiological filter , print ink ribbon for washer , sterilizer item compertable withcisa 4 stu model no. 4212 , printer paper , door gasket , heating element , microbiological filter , print ink ribbon for washer , table topitem compertable with table top sterilizer 23 ltr , door gasket , microbiological filter , heating element , printer paper , washer kf 155item compertable with cisa washer 12 din , liquid alkaline detergent , liquid neutralising agent , lubrication spray , enzamatic detergent , cleaning indicator (level 1) , cleaning indicator (level 2) , cleaning indicator (level 3) , cleaning indicator (level 4) , print ink ribbon for washer , air filter (hepa) , heater element , gasket , ultrasonic washeritem compertable with cisa ultrasonic washer 30 ltr , cleaning agent for ultrasonic cleaner , heat sealeritem compertable with cisa heat sealer , print ink ribbon for heat sealer ( pack of 10 ) , consumables for operation for cssd equipmentitem compatible with cisa cssd machines , 3 line label steam , bowie dick strip , batch monitoring strip , chemical indicator class 4 , chemical indicator class 5 , biological indication steam , wrapping paper 40x40 cm , wrapping paper 50x50 cm , wrapping paper 60x60 cm , wrapping paper 75x75 cm , wrapping paper 90x90 cm , wrapping paper 100x100 cm , wrapping paper 120x120 cm , sterilization reel 50x200m , sterilization reel 75x200m , sterilization reel 100x200m , sterilization reel 120x200m , sterilization reel 150x200m , sterilization reel 200x200m , sterilization reel 250x200m , sterilization reel 300x300m , sterilization reel 350x200m , sterilization reel 400x200m , sterilization reel 500x200m , autoclave tape ( 18x50 meter ) , autoclave tape ( 24x50 meter ) , packing tape (18x50 meter) , packing tape (24x50 meter) , packing tape (36x50 meter) , packing tape (48x50 meter) , process indicator ( external labeling ) for every pack , sms paper non woven material(90 x90 mm) , sms paper non woven material (100 x100 mm) , sms paper non woven material (100 x120 mm) , sms paper non woven material (120 x 120 mm) , labelling ink role , ro plant consumables for cssd , anti scaling chemical , cip chemical , chemical for flushing , jumbo catridge filter , r.o. membrane 8040 , water softener consumables for cssd , resin , air compressor consumables for cssd , check valve kit , intake filter element , crankase filter element with felet , grease kit , piston ring set , filter , operational consumables for cssd compertable , apron heavy duty water proof , brushes for instrument cleaner , devices for cssd , pcd device for bms test , pcd device for bds test , gun for labeling , aqua zero vacuum pump (devices for cssd 8 stu) , aqua zero vacuum pump (devices for cssd 6 stu) , aqua zero vacuum pump (devices for cssd 4 stu)...

Department of Higher Education - Madhya Pradesh

35445150 bids are invited for boqboq laboratry equipement equipement mosfet chara cteristics apparatus 2 laboratry equipement photo transistor char apparatus 3 laboratry equipement e m by milikans oil drop method 4 laboratry equipement constent deviation spectrograph 5 laboratry equipement ujt char apparatus 6 laboratry equipement hartely and colpitts apparatus 7 laboratry equipement cro dual trace 30 mhz 8 laboratry equipement zener regulated power supply 9 laboratry equipement compound microscope 10 laboratry equipement dissecting microscope 11 laboratry equipement binocular microscope 12 laboratry equipement slide reader 13 laboratry equipement water bath double wall 14 laboratry equipement water and soil testing kit 15 laboratry equipement ph meter 16 laboratry equipement electronic digital balance 17 laboratry equipement oven 18 laboratry equipement tissue culture rack 19 laboratry equipement thin layer chromatography 20 laboratry equipement chrometographic chamber 21 laboratry equipement oven 22 laboratry equipement electronic digital balance 23 laboratry equipement tds meter digital 24 laboratry equipement microprocessor water soil testing kit 25 laboratry equipement chemical balance 26 laboratry equipement water and soil testing kit 27 laboratry equipement thin layer chromatography 28 laboratry equipement rotary microtome tih accessories 29 laboratry equipement binocular microscope 30 laboratry equipement research microscope 31 laboratry equipement flame photometer 32 laboratry equipement digital tds meter 33 laboratry equipement ph meter 34 laboratry equipement heating mental with regular cap 35 laboratry equipement compound microscope 36 laboratry equipement hot air oven ss 37 laboratry equipement vortex shaker 38 laboratry equipement image projection system...

Department of Higher Education - Madhya Pradesh

35405184 bids are invited for compound microscope , dissecting microscope , bionocular microscope , image projection system , slide reader , hot air oven stainless steel , water and soil testing analysis kit , ph meter , incubator stainless steel , microscopic camera , digital tds meter , tissue culture rack caster racks , chromatro graphic chamber , conductivity meter digital with cell , hot air oven 14 14 , digital balance accuracy 0001 200 grm , digital ph meter conductivity meter and temperature meter , melting point apparatus digital , digital photoelectric colorimeter 5 liters , micro processor water soil testing kit , distillation apparatus double distillation borosilicate glass cap 5 liter , spectro photometer 340 900nm , chemical balance , chemical weight box 1mg 100gm , chromatographic cabinet 6 leaves , tds meter digital , conductivity meter digital , rotatory microtome with accessories , micro pipette fixed1 5 ml , distillation apparatus single distillation capacity 3lt , centrifuge machine 3500 rpm , flam photometer total quantity : 89...

Department of Higher Education - Madhya Pradesh

35380761 bids are invited for procurement articles 1 auto clave 2 do meter digital 3 digital meter counductivity meter and temp meter 4 digital photoelectric colorimeter 5lit 5 digital app double distilation cap ss 6 electronic blance0.01mg to 220g 7 flame photometer digital 8 heating metel 5lit 9 heating metal 2 lit 500w 10 hotplate with energy regulator 11 centrifuge machine 12 laboratory mixer 13 magnetic stirrer with hot plate 14 muffle furness 9x4x4 15 shaking machine with wrist action 16 bod incubator 17 uv b3chromatrographic chamber 18 vortex mixer 19 digital colony counter 4 digit 20 digital turbidity meter 3.5 digit 21 tds meter digital 22 test tube stand 23 test tube mid 24 test tube big 25 beaker100ml 26 beaker 50ml 27 volumetric flask 100ml 28 volumetric flask 50ml 29 water bath double 12 holes 30 water soil analysis kit 7 para meter 31 shaking machine 32 petri disk 4” 33 rotatory flask shaker 34 rotatory light vacuum pump 25 lit /per min 35 ph meter with electrodes 36 burett 50ml 37 measuring cylinder100ml 38 flask 250ml 39 flask 100 40 polorimeter half shaade 41 flask 50ml 42 hot air oven 43 melting point apparatus digital 44 micropipette variable 45 compound microscope 46 dissecting microscope with bull lences 47 binocular microscope 48 betrological oven 49 rotatory microtome with accessories 50 plant collection set 51 digital spectrophotometer 52 ph meter 53 homogenizer 54 gel electroproshish with power supply(vertical) 55 laminar air flow horizontal 56 tissu culture rack 57 human plastic skeleton imported 58 blood pressure machine 59 insect collection net 60 parmanent slide sample 10pices set 61 fet characteristic apparatus 62 mosfet characteristic app 63 ujt characteristic app 64 s.c.r characteristic app 65 thermistor characteristic app 66 diac and tiac characteristic app 67 photo diode characteristic app 68 photo transistor characteristic app 69 power amplifier 70 hartley and colpitts oscillator 71 study of hybrid parameters circuits 72 zanier regulated power supply 73 newton ring app complete with travelling microscope power supply 74 series and parailal resonrnce circuits 75 study of multivibrators using omamp 76 clipping and clamping circuits using operational amplifire 77 spectrometer 6/7 78 die electric constant apparatus 79 screw gauge electronic 80 verniear calipers electronics 81 bi prism assembly 82 ac ammeter 83 dc voltmeter 84 pnp/npn tranistor dual 4 meter 85 boyle law app heavey metal 86 torsion pendulum 87 reading telescop 88 jeager apparatus 89 milimeter/milivplter 90 daniel cell 91 digital multimeter 92 travelling microscope 93 spectrometer prism(crown/flint glass) 94 galvanometer 95 apparatus to study cheracteristic tunnel diode 96 ldr charecterritics app 97 study of smps 98 four probe methods 99 solar cell characteristic apparatus 100 single stage double stage rc coupled amplifife 101 transistorized differential amplifire 102 f e t amplifire 103 study of schmitt trigger circuits 104 8056 microprocessor with smps 105 cro digital 30 mhz/40mhz 106 multiplexer and demultiplexer built in power supply 107 professional large formate display ...

Department of Higher Education - Madhya Pradesh

35360517 bids are invited for boq purchase laser experimental setup with he ne laser , lcr impedance circuit apparatus , left right shift register , magnetic stirrer with hot plate , melting point app digital , microscope camera 5 mp image projection system , milli ammeter mill voltmeter , morse key , mosfet app , paper chromatography , ph meter digital with electrode microprocessor based , photo diode ch app , photo transistor ch app , plug key , plug key four way , rc coupled , resistance box , rotary microtome , scr ch app , screw gauge 25 mm , slide box 100 slides , slide box 50 slides , slotted weight 5 x 50 gm , solar cell apparatus , soldering iron , spectrometer 6 , spectrometer prism crown , spectrometer prism flint , spectrophotometer digital 340nm 960 nm , sphreometer , stop clock , stop watch digital , thermister ch app , tlc kit with applicator , transistor ch app , travelling microscope v h , ujt app , variable micropipette , vernier callipers , vertical gel electrophoresis system , water soil testing kit digital briefcase model , water bath 12 holes double walled , weight box total quantity : 352...