Madhya Pradesh Laghu Udyog Nigam Limited - Madhya Pradesh

37911191 laboratory equipments for biology (botany and zoology) , laboratory equipments for biology (botany & zoology) , anemo meter , auto exhaust analyzer , autoclave portable , autoclave vertical cap. 50 liter , auxanometer , binocular dissecting microscope , binocular microscope , bio fermentar5 liter (borosilicate glass) , blackman’s apparatus , bod incubator , bomb calorimeter (with oxygen cylinder) , bomb calorimeter (without oxygen cylinder) , camera leucida with filter (micro type) , camera leucida with filter (prism type) , centrifuge machine (cooling) maximum speed 24000 rpm , centrifuge machine 3500rpm , cod analyzer , compound microscope , deep freezer , digital balance (0.1 mg) , digital colony counter , digital tds meter (microcontroller based conductivity tds meter) , digital thermometer , dissecting microscope , distillation apparatus double distillation capacity 5 liter , distillation apparatus single distillation capacity 5 liter , dslr camera , electronic digital balance (read ability 0.01 mg) , farmer’s potometer , flame photometer , ganong’s potometer (borosilicate glass) , ganong’s respirometer (borosilicate glass) , gel documentation , gel electrophoresis unit with power supply (horizontal) , gramen gps , hair dryer , heating mental with regulator cap 1 liter , high volume air sampler , homogenizer , hot air oven (with digital controller) size 455 x 455 x 455 mm , hot air oven (with digital controller) size 605 x 605 x 605 mm , hplc (binary system) , image projection system (mips) , incubator stainless steel (with digital controller) , laminar air flow horizontal , magnetic stirrer with hot plate , maximum minimum thermometer , micro keldahal & distillation apparatus , micro pipette (fixed 1 5 ?l) , micro pipette (variable 1 5 ?l) , microscopic camera (digital eyepiece camera 10mp, with measuring software) , moll’s half leaf apparatus , noise level meter (digital sound & noise level meter) , normal chromatographic chamber , ocular micrometer , pcr machine (gradient thermal cycler pcr) , ph meter (digital) (microcontroller based ph meter with electrode & temp. probe) , portable air sampler unit , quadrats , rotatory microtome with accessories , slide cabinet with 12 showcase , soxhlet extraction unit (borosilicate glass) , stage micrometer , stem borer , thin layer chromatography apparatus , tissue culture rack (caster rack) , ultracentrifuge , uv trans illuminator , uv vis spectrophotometer (double beam) variable bandwidth , uv vis spectrophotometer (single beam) micro controller based , visualizer (visual presenter/ teletop camera) , vortex shaker , water & soil testing (analysis) kit , water bath double wall (12 holes) stainless steel , wilmott’s bubbler , wooden press for herbarium , aquarium kit , automatic burette , blood cell calculator , bones , biological charts as per ug & pg syllabus/ requirement , biological models as per ug & pg syllabus/ requirement , digital haemoglobinometer , dissecting tray , haemocytometer kit , induction hot plate with induction pots , permanent slides , specimens , water bath double wall stainless steel , western blotting system...

Department of Higher Education - Madhya Pradesh

37257786 bids are invited for lab equipment 2 117 analytical balance , analytical weight box , fractional weight box , physical balance , digital balance , single pan digital balance , digital photoelectric colorimeter , digital potentiometer , digital conductometer , d o meter , digital , naphelo turbidity meter , polarimeter half shade , melting point apparatus , digital melting point apparatus , abbe refracto meter , tlc kit , centrifuge , corkboring machine , distillation apparatus , oven hot air , voltage stabilizer , vertex shaker , vacuum pumpoil free , mixers mall , water bath cu , heating mantle with energy , regulator , single crucible heater , muffle furnace , water bath rectangularsingle walled , water bath rectangular , kjeldahldistillation unit , microwave oven , soleextraction unit apparatus , blower , sprayer , magneticstirrer , wateranalyser , compound microscope , dissecting microscope , distillation apparatusdouble , ganongs potometer , ganongs , slidecabinetwith 12 showcase , wilmottsbubbler , woodenpressfor herbarium , quadrats , digital thermometer , binocular dissecting , microscope , slide box for 50 slides , binocular microscope , side readar , water and soil testing analysis kit , ph meter , digital balance , analyticalbalance , aquariumkit , autoclaveportable , automaticburette , bloodcellcalculator , bodincubator , chart and cdsrelatedto syllabus , digital haemoglobinometer , digitalphmeter , digitalsinglepan balance , digital spectrophotometer , digitalthermometer , digitalturbiditymeter , dissectingmicroscope , dissecting tray electronic digital balance , electronic digital balance , electrophoresis with power supply , glucometer , haemocytometer complete box , heating mantle with regulatorcap1litre , highspeedcentrifuge , homogenizer , hotplate , laboratoryhotairoven , laminarairflow horizontal , magneticstirrerwithhot plate , medicocentrifuge machine , micropipette , microtome rotary , mips 1 117machine , micropipette , microtome rotary , mips photodiode characterstics app , solarcell characterstics , phtottransisitor characterstics app , hartleyandcolpittsoscillators , transistorized regulator powersupply , series and parallel resonance circuit , battery chrger 2to12volt , callendorandbarneapptodet the value of me chanical equivalent of heat , lee app to det thehear conductivity , physical balance , weight box , vernier calliper , screw gauge , stop watch digital , ammeter dc ac , voltmeter dc ac , photo conductivity experiments , to study the v icharactrsticsofthesolarcell , ldr charactrstics app , bending of beam , measurement of low resistance by carey foster , potentiometer , app to study responsecurve for lc circuit , zener diode asvoltageregulatorpowersupplyset , newtons ringapp with travelling microscope power , spectrometer prism , inertiatable , compound pendulum , cantilevertodeter mine young , horizontaltorson app , app to verify newtons lawof , searle apparatus to determine the coefficient of thermal , transformer sodium vapour lamp , mercury lamp , transformer of mercury lamp , comp app to determine resolving power of telescope , audio frequency generator , app for measurement of capacitance and inductanceusong , study of lissajousfiguretrainer with , cro rectifierandfiltercharactrstics , crosingletrace 10mhz , dielectricconstant , half wave and full waverectifier kit , network theorem kit , resonance wave on lcr , study of regulatedpower supply using transistor , readingtele scope , analogmultimeter , leadaccumulator , battery eliminator , resistance box , hybrid solar andwind energy trainer , frankhartzexp , thermistor charactrstics app , slotted weights hanger , rheostate various length , galvanometer , miliammeter milivolmeter microammeter , plug key one way two way , reversing key , four way key , moarse key , digital multimeter , slodering iron , travelling microscope , bar pendulum , sodium vapor lamp , use of vibration magnetometer to study a field , apparatus to determine the value of planks constant complete , jarib and lace survey set jarib lace truck compass guniya ranging rod aero , plain table survey set plain table tripod stand lace truck compass sprit lavel sahul aero renging rod , prijmetic compass survey set prijmetic compass tripod stand lace truck compass sprit lavel truck compass ranging rod aero , glob , map phycsical world political climate physical india political physical mp political climate , petrological projector , sepcimen fossils minerals crystal wooden glass , ore minerals and rocks samples , topo sheet , slides of rocks and mineral , clinometer compass total quantity : 875...

Madhya Pradesh Laghu Udyog Nigam Limited - Madhya Pradesh

36930696 tender for supply of laboratory equipments for biology ( botany & zoology ) 2 anemo meter 3 auto exhaust analyzer 4 autoclave portable 5 autoclave vertical cap. 50 liter 6 auxanometer 7 binocular dissecting microscope 8 binocular microscope 9 bio fermentar5 liter (borosilicate glass) 10 blackman’s apparatus 11 bod incubator 12 bomb calorimeter (with oxygen cylinder) 13 bomb calorimeter (without oxygen cylinder) 14 camera leucida with filter (micro type) 15 camera leucida with filter (prism type) 16 centrifuge machine (cooling) maximum speed 24000 rpm 17 centrifuge machine 3500rpm 18 cod analyzer 19 compound microscope 20 deep freezer 21 digital balance (0.1 mg) 22 digital colony counter 23 digital tds meter (microcontroller based conductivity tds meter) 24 digital thermometer 25 dissecting microscope 26 distillation apparatus double distillation capacity 5 liter 27 distillation apparatus single distillation capacity 5 liter 28 dslr camera 29 electronic digital balance (read ability 0.01 mg) 30 farmer’s potometer 31 flame photometer 32 ganong’s potometer (borosilicate glass) 33 ganong’s respirometer (borosilicate glass) 34 gel documentation 35 gel electrophoresis unit with power supply (horizontal) 36 gramen gps 37 hair dryer 38 heating mental with regulator cap 1 liter 39 high volume air sampler 40 homogenizer 41 hot air oven (with digital controller) size 455 x 455 x 455 mm 42 hot air oven (with digital controller) size 605 x 605 x 605 mm 43 hplc (binary system) 44 image projection system (mips) 45 incubator stainless steel (with digital controller) 46 laminar air flow horizontal 47 magnetic stirrer with hot plate 48 maximum minimum thermometer 49 micro keldahal & distillation apparatus 50 micro pipette (fixed 1 5 µl) 51 micro pipette (variable 1 5 µl) 52 microscopic camera (digital eyepiece camera 10mp, with measuring software) 53 moll’s half leaf apparatus 54 noise level meter (digital sound & noise level meter) 55 normal chromatographic chamber 56 ocular micrometer 57 pcr machine (gradient thermal cycler pcr) 58 ph meter (digital) (microcontroller based ph meter with electrode & temp. probe) 59 portable air sampler unit 60 quadrats 61 rotatory microtome with accessories 62 slide cabinet with 12 showcase 63 soxhlet extraction unit (borosilicate glass) 64 stage micrometer 65 stem borer 66 thin layer chromatography apparatus 67 tissue culture rack (caster rack) 68 ultracentrifuge 69 uv trans illuminator 70 uv vis spectrophotometer (double beam) variable bandwidth 71 uv vis spectrophotometer (single beam) micro controller based 72 visualizer (visual presenter/ teletop camera) 73 vortex shaker 74 water & soil testing (analysis) kit 75 water bath double wall (12 holes) stainless steel 76 wilmott’s bubbler 77 wooden press for herbarium 78 aquarium kit 79 automatic burette 80 blood cell calculator 81 bones 82 biological charts as per ug & pg syllabus/ requirement 83 biological models as per ug & pg syllabus/ requirement 84 digital haemoglobinometer 85 dissecting tray 86 haemocytometer kit 87 induction hot plate with induction pots 88 permanent slides 89 specimens 90 water bath double wall stainless steel 91 western blotting system ...

Department of Higher Education - Madhya Pradesh

36706937 bids are invited for lab equipment mse flame photometer 0 100ppm , polarimeter half shade , laboratory microtome , potentiometer digital , electronic digital balance total quantity : 6...

Department of Higher Education - Madhya Pradesh

36648243 bids are invited for items compound microscope , dissecting microscope , bionocular microscope , image projection system , slide reader , hot air oven stainless steel , water and soil testing analysis kit , ph meter , incubator stainless steel , microscopic camera , digital tds meter , tissue culture rack caster racks , chromatro graphic chamber , conductivity meter digital with cell , hot air oven 14 14 , digital balance accuracy 0001 200 grm , digital ph meter conductivity meter and temperature meter , melting point apparatus digital , digital photoelectric colorimeter 5 liters , micro processor water soil testing kit , distillation apparatus double distillation borosilicate glass cap 5 liter , spectro photometer 340 900nm , chemical balance , chemical weight box 1mg 100gm , chromatographic cabinet 6 leaves , tds meter digital , conductivity meter digital , rotatory microtome with accessories , micro pipette fixed1 5 ml , distillation apparatus single distillation capacity 3lt , centrifuge machine 3500 rpm , flam photometer total quantity : 103...

Directorate Of Medical Education - Madhya Pradesh

36434740 kits chemical and comsumable, reagents tender regarding kits chemical and comsumable, reagents , name of department : pathology , diluent ( m 53 ) , lyse ( lh ) ( m 53 ) , leo ( ii ) ( m 53 ) , leo ( i ) ( m 53 ) , cleanser ( m 53 ) , probe cleanser ( m 53 ) , quality control ( m 53 ) , calibrator ( m 53 ) , bendedicts qualitative reagent , reticulocyte kit , leishmann stain sol. with buffer tablet ph , methanol ( acetone free ) , occult blood test kit ( haem test kit ) , drabkins solution , vaccutainer edta ( k3 vial with needles ) , immersion oil ( merck / span ) , test tube glass ( 12 x75 ) borosil / pyrex , tips ( micropipette ) ( 5 200?l ) , glass capillary tube , lancet , ( 10 ml syring ( piston with rubber bang ) , disodium hydrogen phosphate ( anhydrous ) , sodium di hydrogen phosphate , protein for csf ( calorimeter ) , albumin for csf ( albumin ) , rubber gloves 6.5, 7.0, 75 size , strips for urine albumin and sugar , hypochlorite so. ( conc. ) , ehrilichs aldehyde reagent , semen diluting fluid , wbc diluting fluid , sulphur powder , test tube holder , manual cellcounter , neubaerscounting chamber new improved , urinometer for specific gravity , h2o2 ( conc. ) , leishman staining powder , esr wintrobe tube ( glass ) , ammonia sol. , tissue paper roll , fouchets reagent , esbachsreagent , ehrlichs reagent , litmus paper , total protein reagent , filter paper , forceps 6 & 4 , tissue roll , vaccutainer needles holder , tourniquet , sodium citrate vail , cell pack , stromatolyzer 4 dl , stromatolyzer 4 ds , sulfolyzer , cell clean , g6pd kits , coombs , leishmann stain sol. with buffer tablet ph leishmans , waxparaffin ( 60 62 digree ) high grade, , formaline , microtome blade ( thermo ) m x 35 ultra 34 / 80 mm , nitric acid , filter paper sheet size 460mm x 570mm , popy lysine coated slide , poly lysine solusion , citric acid , tri sodium , sodium di hydrogen phosphate , disodium hydrogen phosphate , sodium chloride , tris ( hydroxy methyl ) amino methane , pas staining kit , microtome blades ( spencer’s rottary ) high profile , ptah staining kit , microtome blades ( thermo ) hp35 ultra 34 / 75 mm , cryomatrix gel ( thrmo ) , crytome ( fe ) cryocassette ( block hider ) , reticuline stain , messon tricrome , l mold ( brass metal ) size 6x03x02cm , cassette ( for tissue processing ) metal , dimond pencil , formic acid , runing water tray ( for histology ) , grossing nife ( ss ) , forcep 6’’ , scissors 6’’ , slide tray aluminium , coplinjar , tissue paper , cover slipe ( 22x50mm ) histology+ cytology , glycerol , con. hcl , muccuric oxide , iron alum amunium potesium sulphate , fericammonium sulphate , mucicarmine stain , alcian blue stain , congo red stain , staining rack , gold chloride , sliver nitrate , liquer ammonia , ph paper , slide filing cabinets , alcohol ( isopropyle alcohol ) histology + cytology , glass slide histology, cytology, cpl , xylene sulpher free histology + cytology , cover slips22x22 mm histology + cytology+cpl , d.p.x. 250 ml histology + cytology , haematoxyline powder 5 gm histology + cytology , glacial acetic acid histology + cytology+cpl , cover slips22x50 mm histology + cytology , cover slips22x40 mm histology + cytology , ea 50 , og 06 , eosin , carbal fuchsin , acid fast , methylene blue , cytospin filter card , cytospin filter cup with clips , plain plastic tube , glass test tube , filter paper sheet , diamond pencil , sta neoptimal cl 10 ( 00667 ) , sta ptt automate 5 ( 00595 ) , sta c.k. prest 5 ( 00597 ) , sta thrombin 2 ( 0611 ) , sta lia testd di plus ( 00662 ) , sta coag control ( n+p ) ( 00679 ) , sta lia test control n+p ( 00526 ) , sta lia test vwf:ag ( 00518 ) , sta immnodef def f viii ( 00728 ) , sta immnodef def f ix ( 00734 ) , sta pool norm ( 00539 ) , sta desorb u ( 00975 ) , sta cacl2 0.025 m ( 00367 ) , sta cleanersolution ( 00973 ) , sta cuvettes ( 38669 ) , sta cuvettes satellite ( 39430 ) , sta liquid cooling glycol ( 38640 ) , sta ptt la ( 00599 ) , sta liquid fib ( 00673 ) , sta pm kits ( 89567 ) , sta system control ( 00678 ) , sta uni calibrator ( 00675 ) , water bath measures ( with thermostate ) , aggregometer , digital stop watchs , incubator ( variable tempresure medium size ) , micro ppt ( finn pipette ) variable , ( a ) 20 200 ? l , ( b ) 05 100 ? l , ( b ) 1000 5000 ? l , ( d ) 50 500 ? l , centrifuge digital without carbon bush ( remi r 8c bc ) , thermametre ( mercury ) centrigrate , diamond pencil , semi automatic coagulometer ( 04 tube ) , cell pack , stromato lyser 4 dl , stromato lyser 4 ds , sulfo lyser , cell clean , e check trilevel , scs 1000 calibrator , g6pd kits ( qualitative ) , coombs sera , tri sodium citrate , amonium sulphate ( erba pure ( nh4 ) so4 , lieshman stain with buffer , mpo stain , iron stain ( perls ) , liquar amonia solution , sodium hypo cloride , distilled water , normal saline ( ns ) , immersion oil , methanol ( acetone free ) , chloroform ( chcl3 ) , potassium ferocyanide , sodium meta bisulfite ( ar ) , h2o2 ( hydrogen peroxide ) , dpx mountant , sodium dihydrogen phosphate , di sodium hydrogen phosphate , bovine albumin ( 22 % ) , acetone solution , syringe plastice 02 ml , piston with rubber bag 5 ml ( syringe ) , piston with rubber bag 10 ml ( syringe ) , hand gloves ( ruber ) , gauze , cotton roll , tissue paper , filter paper roundshape , hand wash shop / solution , citrate test tube ( 3.2% ) 2 ml mark , edta vial 2ml mark ( vacutainer ) , plain plastice 5 ml test tube with stopper , microtips ( unirersal type ) , micro centrifuge tubes ( 1.5ml size ) , glass slides ( blue star ) , cover slips ( blue star ) , glass test tubes ( borsil ) , glass test tubes ( borsil ) , glass ppt. ( mark up to tip ) , glass ppt. ( mark up to brosil ) , rubber bulb for ppt , glass fimmd ( borosil ) , bio rad d 10 tm dual program , lyphochek a2 control ( 553 ) l1+l2 , plastic aliquos polypropylane vials with pierceable caps ( sample vials 1.5 ml ) , micropipettes ( 100 1000 micro lt. ) , micropipettes ( 05 50 micro lt. ) , microtips+macrolips ( large ) , microtips+macrolips ( small ) , thermal printer paper ( 4 ) , rb a hu3c comlenent / fitc , rb a hu igg / fitc , rb a hu igm / fitc , rb a hu iga / fitc , miscellaneous item , igg , iga , igm , c3 , cig , c4d ( tansplant ) , fibrinogen , kappa ( kidnev only ) , lambds ( kidnev only ) , fitc ( florescent isothiayank , rhodaminc , feulgen stain , michelsmidium ( transport midium ) , er immuneo , pr immune , her 2 / neu , hpv 16 & hsv immuno stains , proliferative marker p 53 , proliferative marker kit 67 , pancytokeratin , ck 7 , ck 20 , ema , cea , hmwck , apf , vimentin , s 100 , desmin , nse , chromogranin , synaptophysin , msa , c kit / cd 117 , cd 34 , cd 31 , lca , bcl 2 , bck 6 , cd 3 , cd 5 , cd 10 , cd 20 , cd 15 , cd 1a , cd 30 , cd 68 , cd 99 , alk 1 , ca 125 , hmb 45 , gfap , myoglobin , cd 19 , plap , cd 33 , mpo , leucognost alpa , leucognost est , leucognost pas , leucognost pox , leucognost basic set , hematognost fe , basic set / reduction set , ttf 1 , p16 , mannual kits for liquid based cytology , cd 34 , cd 31 , lca , andriogenreceptro , myogenin , pten , cyclin d1 , lbc manual kits for cervical cancer screening , ihc basic kit , pap pen , humod chamber , name of department :pediatric medicine , crp ( turbidometry quantitative ) , crp slide ( latex / slide ) , urea ( modified berthelot ) , creatinine ( alkaline picrate kinetic ) , bilirubin t+d ( dmso ) , protein ( total ) { biuret } , printer paper ( thermal ) , sodium hypochlorite , tips – small ( 5 100 ul ) , tips – 1 ml ( big ) , micropipette – 1 ml , micropippete 50 ul , micropippete 10 ul , micropippete 5 50ul , dengue card , caliberator 1 and 2 , na electrode , k electrode , ca electrode , reference electrode , complete tubing set , paper roll , electrolyte filling solution , reference electrode filling solution , albumin ( bcg method ) , name of department :medicine , sterilant hot disinfectent for dialysis containing 21% ( approx ) ( citrostrile disinfectent ) for dialysis machine , sodium hypochlorite solution 5% for dialysis machine , dialyzer / a.v line reprocessing sterilant cold disinfectent for dialysiscontaining pracetic acid hydrogen peroxide acetic acid , equipment disinfecten gluteraldehyde solution 2% , bi_ carb h.d. fluid , bi_ carb potassium free h.d fluid , 1. wash cartridge 2. measurement cartridge for siemens abg machine , serum glucose kit method – god pod , blood urea kits modified birthlot method , serum creatinine method – jaffe’s kinetic method , eeg paste , eeg electrode , ncv electrode , emg needle , diluents ( abx minidil lmg ) method horiba abx micros es 60 , abx miniclean cleanser method horiba abx micros es 60 , abx mini lysevio method horiba abx micros es 60 , abx mono clair method horiba abx micros es 60 , urine strip method deka phan laura 10p make transasia , methanol , field stain a , field stain b , drabkin’s reagent method – cyanmethemoglobin , name of department : biochemistry department , murcuric sulphate , barium chloride , cupric acetate , creatinine powder , casine powder , formaldehyde , fructose powder , glucose powder , gelatin powder , lactose powder , mercuric chloride , maltose powder , phenyl hydrazine hydro chloride , resorcinol , sodium nitro prosside , sodium hydroxide , sodium tarcholate , sodium meta bisulphate , sucrose powder , starch , sodium chloride , sodium nitrite , sulphuric acid , hydro chloric acid , glacial acitic acid , nitric acid , ? napthol , phloroglucinol powder , ninhydrine powder , hydrogen peroxide , liquor ammonia , chloroform , albumin powder , ethanol ( abs.alcohol ) , amyl alcohal , ammonium molebdate , bromine ampule , burning spirit , sodium tungstate , lead oxid ( yellow ) , silver nitrate , urea powder , megnsium sulphate , uric acid , trichlora acitic acid , frerric chloride , cupper sulphate , ammonium oxalate , sulpher powder , bromocresal green ( liquid ) , picric acid , phenopthline indicator , lead acetate , orthophosphoric acid , sodium carbonate , lactic acid , barium nitrate , barium hydroxide , potassium chloride , sodium phosphatase ( hydrated ) , sodium pyrophosphate , n butanol , ether , phenol ( carbolic acid ) , phaspho molybdic acid , phasphotungstate , potassium hydroxide , sodium acetate , sodium carbonate , sodium hypo chloride , sodium tungstate , acetone , calcium chloride , ferrous sulphate , bilirubin powder , sodium benzoate , sodium dihydrogen phosphate monohydrate , thioberbituric acid , sodium citrate , sodium meta bisulphate , methanol , tannic acid , acitic anhydride , sodium diethyle dithio carbamate , sodium sulphate , ferric ammonium sulphate , perchloric acid , adrenaline bi tartrate , l tyrophan , l alanine , l arginine , l aspartic acid , l cysteine , l glycine , l tyrisine , l serine , l histidine , l methionine , l phenyl alanine , pera nitrophynele phosphate , sodium citrate dihydrate , filter paper 1, 2, 3 , filter paper circular 1, 2 ( circular ) , filter paper plane , cellulose strip ( for electrophoresis ) , beaker , beaker , beaker , beaker , beaker , beaker , volumetric flask , volumetric flask , volumetric flask , funnel ( plastic ) , flat bottom flask , flat bottom flask , merking acid bottles ( hcl ) , merking acid bottles ( h2so4 ) , merking acid bottles ( hno3 ) , dropping bottles brown , dropping bottles plane , reagent bottle , test tube , test tube , spirit lamp , test tubes holder , fallin uw tube , slide glass , cover slip , doramess urea meter , measuring clyinder , measuring clyinder , measuring clyinder , measuring clyinder , test tube stand ( bigsize hole 12 test tubes ) , drapper ( big size ) , glucose god pod , urea birth lot , uric acidpap method , cholesterolchod pap method , total protein biurate , albuminbcg colorimetric test , csf protein ( end point ) , sgotifcc / uv kinetic method , sgptifcc / uv kinetic method , alkaline phosphatase pnpp amp kinetic assay , triglyceride , hdl cholestrol , serum bilirubinjendrassik & grof method , serum creatinine jeff s reaction ( alkaline picric method ) , serum calcium , serum phophorus , calibrator solution 1& 2 ( carelyte electrolyte analyzer ) ( electrode method ) , enzyme cleaning solution , sodium conditioner , reagent pack ( careline electrolyte analyzer ) ( electrode method ) , control level 1 , control level 2 , d proteinization solution , sodium conditioner , cleaning solution , glucose god pod ( ba 400 ) , urea urease / glumate dehydrogenase , serum creatinine jaffe compensated , sgotifcc , sgpt ifcc , alkaline phosphate amp2 amino 2 methly 1 propanal , total bilirubindicholophenyl dizo buffer ( ifcc ) , serum direct bilirubindicholophenyl dizonium , serum protein biuret , serum albumin bromocresol green , cholesterol cholesterol peroxidase method , triglyceride glycerol phaphate oxidase / peroxidase , hdl cholesteroldirect , hdl / ldl standard , ldl cholesterol direct , serum uric acid uricase peroxidase , serum calcium arsenazo iii , serum phosphorus , serum amylase direct substract , serum lipase colour method , cpk ( ck ) ifcc , ck mb ifcc , serum ferritinlatex , serum ferritin standard , hba1c direct , hba1c standard , crp , crp standard , ldh kit , magnesium kit , biochemistry calibrator , biochemistry control , wash solution concentrate , reaction rotor , pd cups , extran ma 02 , protein electrophoresis in blood ( serum kit ) code no.7004058 , normal control serumcode no.58305 , wash solution code no. 58595 , destaining solution code no.58694 , hb electrophoresis , d 10 hemoglobin a1c program recorder pack ( code no 220 0101 ) , d 10printer paper ( code no 220 0375 ) , liquichek diabetes control level 1 ( code no 171 ) , liquichek diabetes control level 2 ( code no 172 ) , tips ( 10 200 ul ) , tips ( 10 1000 ul ) , allicates , clot vaccutainer , distill water ( ltr ) , tissue paper roll , t3 elisa , t4 elisa , tsh elisa...

Indian Army - Madhya Pradesh

36386482 tender for supply of expendable medical stores kit ck mb erba semi autho 2 kit prothrombin time 1x5 ml ( tulip ) 3 ethyl alcohol ( std ) 4 kit dengue ns1ag comb card test ) ( tulip ) 5 cell pack pack of 20 ltr ( sysmex ) 6 stromatolyser 500 ml bott ( sysmex ) 7 cell clean 1x50 ml bott ( sysmex ) 8 sterile urine container10 ml 9 glass slides pkt of 100 ( 5 star ) 10 blood agar plate 11 mha agar plate 12 kit uristick ( protein & sugar ) 13 urine multi strip siemens bott of 100 strip 14 hi media zn stain ( readymade ) 15 hi media gram stain ( readymade ) 16 hi media methylene blue for retic stain 17 sample cup pack of 100 cup em 200 18 upt ( hcg ) 2x50 test kit 19 kit hiv rapid 4th gen cardtest ( sd, j mitra ) 20 kit vdrl card test ( tulip ) 21 kit salmonella typhi card test ( tulip ) 22 kit aso titer 1x2 ml ( kit of 35 test ) ( tulip ) 23 print roll 24 anti sera a bott of 10 ml antigen igm ( tulip ) 25 anti sera b bott of 10 ml antigen igm ( tulip ) 26 anti sera ab bott of 10 ml antigen igm ( tulip ) 27 anti sera d bott of 10 ml antigen igm ( tulip ) 28 ketostick 29 hi media sugar set ( biochemical reaction ) 30 rapid covid 19 antigen test 31 viral transport medium 3 ml ( vtm ) 32 kit d dimer 1x7 ml 33 feder hish profile microtome blades ( 1x50 ) 34 edta vaccutainer ( bd ) 35 sodium citrate ( bd ) 36 gel vaccutainer sterile tube of 5 ml ( bd ) 37 sterilevaccutainer sterile ( bd ) 38 sodium flouride...

Department of Higher Education - Madhya Pradesh

36365952 bids are invited for boqboq compound microscope , binocular microscope , image projection system , slide reader , water and soil testing kit , incubator ss , uv vis spectrophotometer , rotatory microtome with accessories , digital balance 01 mg , conductivity meter digital with cell , d o meter digital , electronic digital balance , deionizer with digital meter , ph meter digital , micro certifuge 10 rpm , paper chromatography testing kit , magnetic strirrer with hot plate , water bath double wall 6 holes ss , pcr machine total quantity : 38...

Directorate Of Medical Education - Madhya Pradesh

36184405 tender for supply of chemical and reagents for mdru dep , item name , mdru kits and reagents , ammonium chloride 500gm , potassium bi carbonate 500gm , sodium chloride 500gm , tris hcl 500gm , sds 500gm , saturated phenol 500ml , chloroform 500ml , sodium acetate 250gm , isoamyl alcohol 500ml / 1ltr , glacial acetic acid 500ml / 1ltr , molecular biology grade agarose powder 250gm , bromophenol blue dye 2ml*5=1pack , ethidium bromide 10ml , molecular weight ( dna ladder ) 100bp & 1kb 1 vial , molecular weight ( dna ladder ) 50bp 1 vial , molecular weight ( dna ladder ) 25bp 1 vial , taq polymerase 500units / vial , amplitaq gold dna polymerase master mix 500units / vial , mgcl2 5ml , dntp mix 1ml , dnase 1000 unit , rnase 1000 unit , proteinase k 1000 unit , tris edta 500 gm , edta 250gm / 500gm , boric acid 250gm / 500gm , teepol5 liter , xylene cynol 10 gm , dmso 50 ml , tips i. 0.2 20 ?l tips , superscript ii rnase reverse transcriptase / episcript™ rnase h reverse transcriptase ( episcript rt ) 400 / 500 reaction pack. , power sybrgreen pcr master mix 5 ml , power sybrgreen rt pcr reagent kit 5 ml , oligo ( dt ) 12 18 primer25ug ( 0.5ug / ul ) , absolute ethanol 500ml , pcr plates ( light cycler 480 compatible ) pack of 50 / pack of 100 , sealing foil ( rt pcr / qpcr grade ) ( light cycler 480 compatible ) pack of 50 / pack of 100 , filter tips each pack contains 1000 psc. , mct variable tubes each pack contains 1000 psc. , i. 20 200?l tubes , ii. 200 600 ?l tubes , iii. 500 2000 ?l tubes , nitrile autodextorous gloves each pack contains 1000 psc. , mctstands for variable tubes sizes each pack contains 10 psc. , i. 20 200?l tubes stand , ii. 200 600 ?l tubes stand , iii. 500 2000 ?l tubes stand , filter tip boxes each pack contains 10 psc. , i. 0.2 20 ?l filter barrier tip box , ii. 20 200 ?l filter barrier tip box , iii. 200 1000 ?l filter barrier tip box , rt pcr grade water pack size of 20ml ( 20 ml * 5 ) , tip discard box ( 1 2 liter capacity ) each , graduated measuring cylinders 50, 100, 500, 1000 ml each , graduated beakers 50, 100, 500, 1000 ml each , flat bottom tube 5ml ( with screw cap ) pack size of 500 psc. , tube stand ( 15ml falcon, 5ml, 2ml, 0.5ml, 0.2ml mct ) pack size of 10 psc. , graduated conical flask 50, 100, 500, 1000ml pack size of 5 psc. , test tube 5, 10 ml each pack contains 100 psc. , slide+cover slips ( 25mm*75mm ) each pack contains 100 psc. , tissue paper roll pack size of 12 psc. , fine tissue cloth roll pack size of 12 psc. , cotton pack size of 10 psc. , wash bottle / dropping bottle, 200ml, 500ml, 1ltr each , funnels variable range each , plastic bottle, 200, 500, 1000ml each , syringe + needle 2 ml, 5 ml pack size of 100 psc. each , nitrile gloves; medium and large size box pack size of 1000 psc. , dna isolation kit { blood } per kit , rna isolation kit per kit , phenol 500 ml , hno3 ( nitric acid ) 500 ml , propionaldehyde pure ( 97% ) 500 ml , phthalic anhydride 500 ml , glacialacetic acid ar 500 ml , hydrochloric acid ar 500 ml , sulfuric acid ar 500 ml , 2 amino ethanol 500 ml , pyridine ar 500 ml , ammonia solution ar 500 ml , ammonia chloride ar 500 ml , acetyl salicylic acid 500 ml , acetone ar 500 ml , anthranilic acid ar 500 ml , activated charcoal 500 ml , silica gel g 500 ml , benzoicacid ar 500 ml , sds 500 gm , colin ( cleaning detergent solution ) 500 ml , sterilium ( hand sanitizer ) 100 ml * 5 , dettol / lifeboy alcohol based hand sanitizer 100 ml * 5 , floor cleaner phenyl 1 l * 5 , cleaning mop per psc , broom per psc , microwave gloves per pair , brown paper for autoclaving per roll , liquid nitrogen 10 / 25 ltr. , phosphate buffer saline ( 10x; ph 7.4; rnase free ) 500 ml , formalin ( formaldehyde aqueous solution; lab grade ) 500 ml , paraffin wax ( 58 600c for histology ) 500 gm , xylene ( molecular lab grade ) 500 ml , glycerol500 ml , ammonia ( nh4oh; extra pure ) 250 ml / 500 ml , methanol ( methyl alcohol, ch3oh ) 500 ml , acrylamide / bis ar 500 ml , 10x tbe buffer 500 ml , urea ( ultra pure; mol bio grade ) 500 gm / 1kg , ammonium persulfate 100 gm , temed ( ultra pure; mol bio grade ) 100 ml / 250 ml , 4’, 6 diamidino 2 phenylindole 50 ml , diethyl pyrocarbonate 5 gm / 25 gm , tae buffer , sybr gold 100ul , restriction enzyme – mnl i250 / 300 / 500 units , restriction enzyme – bcli1000 / 1500 / 2500 / 3000 units , restriction enzyme – hpych4v100 / 500 units , restriction enzyme – hpych4iii200 / 250 / 1000 / 1250 units , restriction enzyme – sau96i 1000 units , restriction enzyme – sfci200 / 1000 units , restriction enzyme – bcci1000 units , restriction enzyme – scrfi500 / 1000 / 2500 units , restriction enzyme – afliii250 / 1250 units , restriction enzyme – scai500 / 1000 / 1250 units , restriction enzyme – avai1000 / 2000 units , restriction enzyme – bsmi200 / 500 / 1000 / 2500 units , restriction enzyme – tspri ( also share cleavage site withtscai ) 1000 units , restriction enzyme – mboii250 / 300 / 1250 / 1500 units , restriction enzyme – bsh1236i500 / 1000 / 2500 units , restriction enzyme – banii1000 / 1500 / 2000 units , restriction enzyme – mph1103i1000 / 5000 units , restriction enzyme – dde i200 / 500 / 1000 / 2500 units , restriction enzyme – bsmb i ( also share cleavage site withesp3i ) 200 / 400 / 1000 units , restriction enzyme – afa i ( also share cleavage site withrsa i ) 1000 / 5000 units , restriction enzyme – bal i ( also share cleavage site withmlu ni ) 50 / 100 / 200 / 250 units , restriction enzyme – fspi ( also share cleavage site withnsbi ) 400 / 500 / 1000 / 2500 units , restriction enzyme – hpa ii ( also share cleavage site withmspi ) 1000 / 2000 / 4000 / 5000 / 10000 units , restriction enzyme hinf i , restriction enzyme hpych4 , restriction enzyme mboii , restriction enzyme bstui , restriction enzyme mvai , primers , fmr1 set 1 –f5 tcaggcgctcagctccgtttcggtttca 3 r5 5 aagcgccattggagccccgcacttcc 3 , mecp2 exon 1 set 1 f5 gttatgtctttagtctttgg–3´ r5 tgtgtttatcttcaaaatgt–3´ , exon 2set 1 f5 cctgcctctgctcacttgtt–3´ r5 ggggtcatcatacatgggtc–3´ , exon 2set 2 f5 agcccgtgcagccatcagcc–3´ r5 gttccccccgaccccaccct–3´ , exon 3 set 1 –f5 tttgtcagagcgttgtcacc–3´ r5 cttcccaggacttttctcca–3´ , exon 3 set 2 f5 aaccacctaagaagcccaaa–3´ r5 ctgcacagatcggatagaagac–3´ , exon 3 set 3 f5 ggcaggaagcgaaaagctgag–3´, r5 tgagtggtggtgatggtggtgg–3´ , exon 3 set 4 – f5 5´–tggtgaagcccctgctggt–3´ r5 ctccctcccctcggtgtttg–3´ , exon 3 set 5 f5ggagaagatgcccagaggag–3´ r5 cggtaagaaaaacatccccaa–3´ , exon3 ( l100v ) f5 aaccacctaagaagcccaaa 3 r5 gcttaagcttccgtgtccagccttcaggta 3 , putative promoter and exon 1. f5 gggtgcaatgaaacgctta 3 r5 tttaccacagccctctctcc 3 , mc4r rs17782313 f 5 aagttctacctaccatgttcttgg 3 r 5 ttccccctgaagcttttcttgtcattttgat 3 fto rs9939609 f 5 aactggctcttgaatgaaataggattcaga 3 r5 agagtaacagagactatccaagtgcagtac 3 , adipoqrs2241766 – f5 tgtgtgtgtggggtctgtct 3 r 5 tgtgatgaaagaggccagaa 3 , rs1501299 f5 ctacactgatataaactatatggag 3 r5 ccccaaatcacttcaggttg 3 , pcsk1 rs155971 – f5’tatatgcagccaccaatcca 3’ r5’aaaatgaagggagaagcacaaa3’ , pomcrs6232 f5 ttgtgcccttcatctgaaca 3 r5 tgtagcaactttggcatgga 3 , rs155971 f5tatatgcagccaccaatcca 3 r5 aaaatgaagggagaagcacaaa 3 , ppar g ( pro12ala ) f5gcc aat tcaagc cca gtc 3r5gat atgttt gca gac agt gta tca gtg aaggaa tcg ctttcc g 3 , kcnj11 ( rs5219 ) f5 gactctgcagtgaggcccta 3’ r5 acgttgcagttgcctttctt 3’ , capn10 ( rs3792267 ) f5 cacgcttgctgtgaagtaatgc 3’r5 tgattcc catggtctgtagcac 3’pik3ca set 1 forward 5’ ggagtatttcatgaaacaaatgaatgatgcg 3’ reverse 5’ gagctttcattttctcagttatctt 3’ , bat 25 set 1 f 5’ tcgcctccaagaatgtaagt 3’r 5’ tctgcattttaactatggctc 3’bat 26 set 1 f5’ tgactacttttgacttcagcc 3’r5’ aaccattcaacatttttaaccc 3’ , d2s123 set 1 f5’ aaacaggatgcctgccttta 3’ r5’ ggactttccacctatgggac 3’ , d5s346 set 1 f 5’ actcactctagtgataaatcggg 3’ r5 agcagataagacagtattactagtt 3 , d17s250 – set 1 f5’ ggaagaatcaaatagacaat 3’ r5’ gctggccatatatatatttaaacc 3’ , impdh2 set 1 f5 gtttctgcggtatcccaatc 3 r5 cgagcaagtccagcctat 3 bmp6 rs73719353 f5’ gctcctttgcacttcgctgt 3’ , r5’ aggctctgctg agctcctac 3’ , bmp6 rs73719341 f 5’tgaacttcccattcccctct 3’ r5’ataaaattagcattgatcca 3’ , bmp6 rs73719318 f5’caggtgctgtgcaacttctt 3’ r 5’agagggcaccatggttgcct 3’ , bmp6 rs73381662 f 5’ ctgagattcaattaggccca 3’ r 5’taaagaacagcaaaagtctg 3’ , bmp6 rs73381650 f 5’cacataaagattgctgcatt 3’ r 5’tagtaatcctaaaaatggga 3’ , anxa2 rs7170178 f 5’ ttcacagcagttcaaaatac 3’ r 5’ ctgggtttccagagatggaa 3’ , anxa2 rs73435133 f 5’ gagtgcaaggtgctgaggat 3’ r 5’ gatttcagacagcccttgca 3’ , anxa2 rs73418020 f 5’ tctgagagtgaaaggtgcac 3’ r 5’ tcccatcccctgaatccctg 3’ , anxa2 rs72746635 f 5’ cctgactcattgtcacatca 3’ r 5’ aagtggctttccactgccc 3’ , anxa2 rs73418025 f 5’ cttctcatcttactttt 3’ r 5’ agggaaggatacagaggaga 3’ , hsp 70 primer sequence5 agcgt aacac cacca ttcc 3 ( forward ) 5 tggct cccac cctat ctc 3 ( reverse ) , the gapdh sequence forward primer 5 agc cac atc gct gag aca c 3, reverse primer 5 gcc caa tac gaccaa atcc 3. , mthfr f:5 tgtggtctcttcatccctcgc 3;r: 5 ccttttggtgatgcttgttggc 3. , dpyd f:5 actcaatatctttactctttcatcaggac 3. r: 5 acattcaccaacttatgccaattct 3. , tyms f:5’ ggtacaatccgcatccaactatta 3’ r:5’ ctgataggtcacggacagattt 3’ , imp3 forward:5’atgactcctccctacccg3’ reverse:5’gaaagctgcttgatgtgc3’ , cxcl1forward: 5’ccagacccgcctgctg 3’and reverse:5’cctcctcccttctggtcagtt 3’ , cox 2 forward: 5 cagccatacagcaaatcc 3; reverse: 5 tcgcacttatactggtcaa 3 , hmlh1f 5 ttt tga tgt aga tgt ttt att agg gtt gt 3r 5 acc acc tcatcataa cta ccc aca 3 , ppar g ( pro12ala ) , f5gcc aat tcaagc cca gtc 3 , r5gat atgttt gca gac agt gta tca gtg aaggaa tcg ctt tcc g 3 , methylated ( hmlh1 ) f 5 acg tagacg ttt tat tag ggt cgc 3 r 5 cct catcgtaac tac ccg cg 3 , hmsh2 f 5 ggt tgt tgt ggt tgg atg ttg ttt 3 r 5 caa cta caa cat ctc ctt caa cta cac ca 3 , methylated ( hmsh2 ) f 5 tcg tgg tcg gac gtc gtt c 3 r 5 caa cgt ctc ctt cga cta cac cg 3 , ? actin: forward: 5’ ctacgtcgccctggacttcgagc 3’ ß actin: reverse: 5’ gatggagccgccgatccacacgg 3’ , kras forward: 5 gactgaatataaacttgtggtagttggacct 3.reverse: 5 ctattgttggatcatattcgtcc 3. , braf forward: 5 tcataatgcttgctgatagga 3. reverse: 5 ggccaaaaatttaatcagtgga 3. , mthfr ( c677t ) ‘‘5 gcacttgaaggagaaggtgtc 3” and reverse primer ‘‘5 aggacggtgcggtgagagtg 3” , mthfr ( a1298c ) forward ‘‘5 ctt tgg gga gct gaa gga cta cta c 3” and reverse ‘‘5 cac ttt gtg acc att ccg gtt tg 3” primers. , total rna isolation mini kit ( from human skin tissue ) / rneasy fibrous tissue mini kit ( for rna extraction from human skin tissue ) ( qiagen ) per kit ( each kit pack is for 50 reactions ) , purospin™ fibrous tissue rna purification kit ( luna nanotech ) ( for rna extraction from human skin tissue ) per kit ( each kit pack is for 250 reactions ) , aurum™ total rna fatty and fibrous tissue kit ( biorad ) / mp biomedicals fastrna pro green kitper kit ( each kit pack is for 50 reactions ) , human leptin elisa kit per kit ( each kit pack is for 96 reactions ) , human adiponectin elisa kit per kit ( each kit pack is for 96 reactions ) , human adipsin elisa kit per kit ( each kit pack is for 96 reactions ) , human resistin elisa kit per kit ( each kit pack is for 96 reactions ) , human iron elisa kit ( serum iron ) per kit ( each kit pack is for 96 reactions ) , human ferritin elisa kit ( serum / ferritin ) per kit ( each kit pack is for 96 reactions ) , gdf15 human elisa kit per kit ( each kit pack is for 96 reactions ) , spexin human elisa kit per kit ( each kit pack is for 96 reactions ) , human pai 1 elisa kit per kit ( each kit pack is for 96 reactions ) , thyroid estimation kit per kit ( each kit pack is for 96 reactions ) , ice maker machine for laboratory purpose 1 unit , microwave gloves each packet contains one pair of gloves. , pcr mini cooler / coolcube microplate and pcr tube cooler each , horizontal gel apparatus: 18 – 20 cm ( length ) x 25 – 30 ( breadth ) x 5 7.5 cm ( height ) , 40 60 samples, multichannel pipette compatible combs and gel caste each , mini horizontal gel apparatus: 9 cm w x 11 cm l with grooves ( 8.7 cm l x 1.2 cm h ) on the side for gripping the gel tray. it should have two comb slots on the same tray area. buffer capacity should be 600 ml for the buffer tanks and optimum gel runs with a fill line indicator for buffer levels along the unit side each , multi size forceps lab set each packet containsmulti size forceps lab set , liquid nitrogen sample storage tanks each , liquid nitrogen sample handling gloves each packet contains one pair of gloves. , l mold each , tissue cassette steel each , electric tissue float bath ( thermostate ) each , coupling jar each pack contains 2 psc. , staining rack each , whatman filter paper grade 1 & 2 each packet contains 50 psc.. , harri’s hematoxylin powder 25 / 50 / 100 / 250 / 500 gm , yellow eosin powder 25 / 50 / 100 / 250 / 500 gm , coverslip 18x18 ( microscopic ) each packet contains 100 psc.. , dpx mount 100 ml / 250 ml , hot plate each , mx35 premier microtome blade ( 34 / 80mm ) 50 blades each box contains 50 psc.. , diamond point marker pen ( histopathology use ) each , embedding mold and embedding ring each , qiamp dna ffpe tissue kit ( 50 rxns ) , genomic dna purification kit ( promega ) , rna extraction kit from tissue , cdna synthesis kit , superscript ii rnase reverse transcriptase , sybr green pcr master mix , sodium bisulphite , page loading dye , formamide , n’n’ methylene bisacrylamide , ammonium persulfate , temed , polyacrylamide , wizard dna clean up system ( promega ) , 2 mercaptoethanol , silver stain , hydroquinone , urea , blotting paper , dna ladder 10 bp , pas stain , histopathology plastic cassettes , poly – l – lysine coated slides , deep well mortar and pestle homogenizers ( medium size ) , deep well mortar and pestle ( small size ) , rneasy minielute cleanup kit , phase – lock gel heavy5 prime phase – lock gel heavy5 prime , qiazol lysis reagent , rneasy minielute cleanup kit , cryo vial 1 pkt contains 50 psc. , deep well mortar and pestle ( small size ) ...

Department of Higher Education - Madhya Pradesh

36156982 bids are invited for boqboq compound microscope , dissecting microscope , bionocular microscope , image projection system , slide reader , hot air oven stainless steel , water and soil testing analysis kit , ph meter , incubator stainless steel , microscopic camera , digital tds meter , tissue culture rack caster racks , chromatro graphic chamber , conductivity meter digital with cell , hot air oven 14 14 , digital balance accuracy 0001 200 grm , digital ph meter conductivity meter and temperature meter , melting point apparatus digital , digital photoelectric colorimeter 5 liters , micro processor water soil testing kit , distillation apparatus double distillation borosilicate glass cap 5 liter , spectro photometer 340 900nm , chemical balance , chemical weight box 1mg 100gm , chromatographic cabinet 6 leaves , tds meter digital , conductivity meter digital , rotatory microtome with accessories , micro pipette fixed1 5 ml , distillation apparatus single distillation capacity 3lt , centrifuge machine 3500 rpm , flam photometer total quantity : 103...

Department of Higher Education - Madhya Pradesh

36137359 bids are invited for boqboq laboratry equipement mosfet chara cteristics apparatus 5 photo transistor char. apparatus 5 e / m by milikans oil drop method 2 constent deviation spectrograph 1 ujt char. apparatus 5 hartely and colpitts apparatus 5 cro dual trace 30 mhz 1 zener regulated power supply 5 compound microscope 20 dissecting microscope 10 binocular microscope 1 slide reader 1 water bath double wall 1 water and soil testing kit 1 ph meter 5 electronic digital balance 1 oven 1 tissue culture rack 1 thin layer chromatography 1 chrometographic chamber 2 oven 1 electronic digital balance 5 tds meter digital 5 microprocessor water soil testing kit 1 chemical balance 4 water and soil testing kit 5 thin layer chromatography 2 rotary microtome tih accessories 1 binocular microscope 1 research microscope 1 flame photometer 1 digital tds meter 4 ph meter 5 heating mental with regular cap 2 compound microscope 20 hot air oven ss 2 vortex shaker 1 image projection system 2...

Indian Army - Madhya Pradesh

35954331 purchase of medical stores as per tender documents , medicines : , pregnancy test card , ana kit (kit of 1x25 tests) , troponin i (pack of 1x25 tests) , aso titre (1x25 tests) , widal kit (4x5ml) , crp kit (1x25tets) , dengue (ns1ag, igg & igm) rapid test , malaria antigen test , fecal occult blood test kit (1x10 tests) , g6 pd test kit , pttk reagent (pack of 12x5 ml) , prothrombin time (pack of 12x5ml) , cuvette for stago start 4 (pack of 150x4) , biorad level 1 chemistry control (pack of 12x5ml) , biorad level 2 chemistry control (pack of 12x5ml) , diabetes control biorad level 1 & 2 , leishman stain ready to use (pack of 500ml with buffer) , reticulocyte stain (bott of 100ml) , drabkins solution (1 ltr) , zn stain ready to use , indian ink stain (50ml) , lacto phenol cotton blue stain , haemotoxyllin ehrlich (ready to use) bott of 500ml , haematoxillin stain harris (ready to use) bott of 500ml , pap stain , ethanol (bott of 500ml) , methanol (bott of 500ml) , formalin , xylene (bott of 500ml) , chloroform (bott of 500ml) , glycerine (bott of 500ml) , paraffin wax (pack of 500gm) , microtome blade s 35 high profile type (pack of 50 blades) feather microtome , plastic tissue embedding ring , plastic tissue cassette , cled agar (500gm) , urochrome agar (500gm) , muller hinton agar (500gm) , blood agar bass (500gm) , sabauraud dextose agar (500gm) , salmonella, shigella agar (bott of 500gm) , vacutainer edta , vacutainer sodium fluoride , vacutainer sterile with gel 5ml , vacutainer sterile plain without gel 3ml , vacutainer sodium citrate 3ml , microscope bulbs , glass marking pen (diamond marker) , milk adulterants test kit , tourniquet , pedridish disposable , urine container plastic 50ml , typhoid igg/igm rapid test (pack of 1x25 tests) , ra factor (1x25 tests) , calcium chloride 0.025m (vial of 5ml) , steel balls for start 4 stago semi auto coagulation analyzer (pack of 1850) , gram stain ready to use , acetone (bottle of 500ml) , filter paper 60x60cm (pack of 50) , l shape embeding mould (brass) => limited...

Department of Higher Education - Madhya Pradesh

35805947 bids are invited for boqboq compound microscope , dissecting microscope , bionocular microscope , image projection system , slide reader , hot air oven stainless steel , water and soil testing analysis kit , ph meter , incubator stainless steel , microscopic camera , digital tds meter , tissue culture rack caster racks , chromatro graphic chamber , conductivity meter digital with cell , hot air oven 14 14 , digital balance accuracy 0001 200 grm , digital ph meter conductivity meter and temperature meter , melting point apparatus digital , digital photoelectric colorimeter 5 liters , micro processor water soil testing kit , distillation apparatus double distillation borosilicate glass cap 5 liter , spectro photometer 340 900nm , chemical balance , chemical weight box 1mg 100gm , chromatographic cabinet 6 leaves , tds meter digital , conductivity meter digital , rotatory microtome with accessories , micro pipette fixed1 5 ml , distillation apparatus single distillation capacity 3lt , centrifuge machine 3500 rpm , flam photometer total quantity : 103...

Government Medical College - Madhya Pradesh

35627530 supply for central lab and cssd consumables and other item supply for central lab and cssd consumables and other items in gmc raltam , three part automated cell counter model : swelab alfa plus basic , swelab alfa plus diluents , swelab alfa plus lyser , boule control normal , boule control low , boule control high , five part fully automated cell counter model : bc 6800 , m 68lh lyse , m 68 lb lyse , m 68 dr diluent , m68 ld lyse , m 68 ln lyse , m 68 ds diluent , 68 fd dys , 68 fr dys , 68 fn dys , probe cleanser , controls and calibrators , aspen bc – 6d control set (6x4.5ml (2l, 2n, 2h)) , aspen bc – ret control set (6x4.5ml (2l, 2n, 2h)) , aspen sc – cal plus calibrator , automatic coagulation analyzer model : sta compact max 3 , stac cacl20, 0025m (00367) , sta cephascreen 10(00310) , sta cleanser solution 6x2500ml(00973) , sta coag control n+p(00679) , sta desorb u24x15ml (00975) , sta liatest control n+p (00526) , sta liatest d di (00662) , sta @ neoptimal 5. (01163) , sta owren koller 24x15ml(00360) , chemicals , ethanol (99.9%) , xylene (sulphar free) , paraffin wax (58 60 temperature) , acetone , hematoxyline , eosin (2%) , distyrene plasticizer xylene (dpx mountant) , glacial acetic acid , formic acid (100%) , nitric acid (100%) , propanol (45%) , oil immersion , n/10 hcl , sodium metabisulphate , urine strip 10 para , sodium nitroprusside , liquor ammonia , ammonium sulphate , sulphosalicilic acid solution , sulphur powder , leishmen stain , wbc diluting fluid , rbc diluting fluid , og 6 , ea 50 , semen analysis diluting fluid , formaline , spirit alcohol , sulphuric acid , reticulocyte count fluid , distilled water , barium chloride , sodium hypochloride , methanol , glucose pouch , perls stain (long expiray) , pas stain (long expiray) , mpo sstain (long expiray) , benzidine solution (long expiray) , kits , reticulocyte count kit , pt kit , aptt kit , field stain kit , rapid pap stain kit , giemsa stain kit , g6pd kit , antisera a , antisera b , antisera d , sickle cell test kit , pt/inr kit , reagent , benedict reagent (long expiray) , ehrlich’s reagent (long expiray) , esbech’s reagent (long expiray) , fouchet reagent (long expiray) , other consumable items , microscopic glass slide (75x25) , jam microscopic cover glass (22x50) , casset , microtome blade , slide box , tissue paper roll , plastic dropper (small) , plastic dropper (big) , test tube 5ml , coupling jar , test tube 10ml , slide carrying tray , aluminium slide tray , slide staining stand , glass dish staining jar , test tube stand , measuring cylinder (10 ml borosilicate) , glass tube brush , hand wash , beaker glass (100 ml borosilicate) , beaker glass (500 ml borosilicate) , conical flask (100 ml borosilicate) , conical flask (500 ml borosilicate) , bubbler (plastic screw) , graduate pipette (borosilicate ) 10ml , volumetric flask 100ml , filter paper 12.5dm , diamond pencil , capillary tube for bt ct (glass) , k3 edta vial , urine container , knife (grossing) , speciman jar with lid (glass) (200x200x70 mm) , speciman jar with lid (glass) (150x150x60mm) , museum jar with lid (glass) (220x150x100mm) , museum jar with lid (glass) (220x195x80mm) , museum jar with lid (glass) (250x165x140mm) , museum jar with lid (glass) (360x150x100mm) , museum jar with lid (glass) (150x150x80mm) , museum jar with lid (glass) (250x250x120mm) , museum jar (10x10x15 inches) , museum jar (18x12x12 inches) , museum jar (25x15x10 inches) , pippette 1 ml (borosilicate) , pippette 5 ml (borosilicate) , glass rod (solid ) , slide holder (steel) , slide staining rack , urinestripe 4 parameter (1.ph 2.specific gravity3. sugar 4.albumin(protein)) , sodium citrate vial , esr tube (wintrobe) , esr western green tube , cover slip10 gm , application plastic stick , sprit lamp glass , tube holder , rbc pipette , wbc pipette , wester green stand , wintrobe stand , pasture pipette , disposable pap smear kit , torniqute , tissue embedding mold , embedding o ring , test tube 15 ml , test tube 20 ml , centrifuge tube 15ml , centrifugr graduated tube 15 ml , reagent bottle 100 ml , reagent bottle 250ml , reagent bottle 500 ml , measuring cylinder 100 ml , measuring cylinder 5 ml , dropping bottle 250 ml , detergent powder , culture media , agar powder , alkaline peptone water , anhydrous barium chloride , arabinose , arginine dihydrolase powder , automated blood culture bottle (adult) compatible withbact/alert 3d 480, bio merieux , automated blood culture bottle (paediatrics) compatible withbact/alert 3d 480, bio merieux , bile esculin agar , blood agar powder , brain heart infusion broth , candida crome agar , cary blair medium base , christensens urea agar base , cled agar , corn meal agar , decarboxylase broth moeller , dermatophyte test medium , glucose , glucose phosphate broth , hugh leifson medium , lowenstein jansens medium(ready prepared) , lactose , lysine decarboxylase , macconkey agar without crystal violet , macconckeys agar with crystal violet , macconkey broth double strength (for water testing) , macconkey broth single strength (for water testing) , maltose , manitolmotility test medium , mannitol , mannitol salt agar , manual blood culture bottle with sds (adult) 70ml , manual blood culture bottle with sds (paediatrics) 20ml , muller hinton agar , nutrient agar , nutrient broth , peptone powder , phenyl alanine agar , pyr agar , robertson cooked meat medium base , sabouraud dextrose agar with chloramphenicol with cycloheximide , sabourauds dextrose agar powder , sabroud dextrose agar with chlorophenicol , selenite f broth , simmons citrate agar , sodium deoxycholate , sucrose , tcbs agar , triple sugar iron agar , xld agar , antibiotic disc , amikacin 30 mcg , amoxicillin , amoxycillin clav 20/10ug , ampicillin 10 mcg , ampicillin sulbactam(10/10 ?g) , azithromycin 15 mcg , aztreonam(30 ?g) , cefazoline 30 mcg , cefepime 50ug , cefoperazone / sulbactum , cefoperazone 75 mcg , cefotaxime(30 ?g) , cefotaxime+clavulanate , cefoxitin 30ug , cefpodoxime , ceftazidime 30 mcg , ceftazidime+clavulanate , ceftriaxone 30 mcg , ceftriaxone sulbactum 30/15ug , cefuroxime 30 mcg , chloramphenicol 30 mcg , ciprofloxacin 5mcg , clarithromycin(15 ?g) , clindamycin 2 mcg , co trimoxazole(sulpha/trimethoprim) 25 mcg (23.75/1.25) , colistin (0.016 256 mcg/ml) , colistin 10 mcg , cotrimoxazole(25 ?g) , doripenem(10 ?g) , doxycycline hydrochloride 30 mcg , ertapenem(10 ?g) , erythromycin 15 mcg , gatifloxacin(5?g) , gemifloxacin(5 ?g) , gentamicin 10 mcg , imipenem 10 mcg , linezolid(30 ?g) , lomefloxacin(10 ?g) , meropenam 10ug , minocycline(30 ?g) , moxifloxacin(5 ?g) , nitrofurantion 300 mcg , norfloxacin 10 mcg , novobiocin(5 ?g) , ofloxacin(5 ?g) , oxacillin(1 ?g) , penicillin 10 units , piperacillin 100 mcg , piperacillin/tazobactam 100/10 mcg , polymyxin b , quinopristin dalfopristin(15 ?g) , teicoplanin , teicoplanin 30 mcg , tetracycline 30 mcg , ticarcillin clavulanate(75/10 ?g) , tobramycin 10 mcg , trimenthoprim(5 ?g) , vancomycin (0.016 256 mcg/ml) , vancomycin 30 mcg , bacitracin(0.4 u) , sterile disc , v factor , x factor , x+v factor , optochin(5 ?g) , kits & chemical , acetone solution , acid fast staining kit , albert’s metachromatic stain kit , andrade’s indicator , anti hav igm (elisa kit) , anti hav igm (rapid test) , anti hcv antibody kits (elisa kit) , aso kit(25 test/packet),consumable , basic carbol fuchsin for afb staining(powder) , conc hcl , crp test kit , crystal violet powder , dengue ns 1 elisa , formaldehyde solution , field stain a , field stain b , filarial antigen card test , ferric chloride (500 gm) , formaldehyde 40% (conc. formaline) , giemsa stain (merck / span) , glycerol , gram iodine , gram staining kit , h2so4 (sulphuric acid) 25% , hbv elisa test kit , hepatitis e virus anti hev igm antibody (elisa) , hiv (rapid)(whole blood finger prick test kit) , hiv elisa test kit , hydrogen peroxide 6% solution , india ink , kovac’s reagent (indole) , lacto phenol cottons blue stain , lead acetate strip , leishman stain , liquid paraffin , malaria bivalent antigen detecting rapid diagonstic tests(rdts) , methyl blue for (z n) , methyl alcohol , methyl red indicator , methylene blue powder , nitrate reagent a , nitrate reagent b , occult blood test kit (haem test kit) , oxidase disc , oxidase reagent (tetra methyl para phenylene di amine di hydro chloride) , phenol crystals , pyr reagent , ra factor rapid kit , rpr test kit , safranine (gram stain) , urea 40% supplement (for urea agar base) , voges proskauer reagent a , voges proskauer reagent b , widal slide test(4x5ml with control) , xylene , zinc dust , chemical indicator for autoclave (indicator tape) , biological indicator for autoclave (indicator vial) , glassware, plasticware& other item , autoclavable aluminium foil , autoclavable glass bottle with screw cap for culture media (1000ml (borosilicate glass autoclavable)) , autoclavable glass bottle with screw cap for culture media (500ml (borosilicate glass autoclavable)) , autoclavable glass bottle with screw cap for culture media (50ml (borosilicate glass autoclavable)) , autoclavable petri plate (100mm) plastic , autoclavable petri plate (150mm) plastic , autoclavable petri plate (90mm) plastic , autoclavable reusable transparent bags , bcg(1 ml each) , beaker 1000ml (borosilicate glass autoclavable) , bloting paper (paper) , burning sprit , cedar wood oil , concavity slide , conical flask (glass) 1000ml , conical flask (glass) 100ml , conical flask (glass) 2000ml , conical flask (glass) 500ml , conical flask (glass) 50ml , cover slip , cryogenic vial , disposable plastic loop 2mm , disposable plastic loop 4mm , disposable sharp collection containers(5 ltr) , dropping bottle plastic 100 120 ml capacity , durham’s tube , falcon tube sterile, (conical bottom)(50ml each plastic containers with air tight screw cap printed graduation) , filter paper sheet((whatmann no 01) , filter paper(12.5 cm, 0.1 micron) , forceps small , gaspak (3.5 liter) , glass marking pen (diamond ) , glass reagent bottle (5 litre) , glass test tube 12 x 100 (medium size) heavy quality 100/pkt(no.) , glass test tube 12 x 50 borocilicate glass autoclavable , glass test tube 15 x 125 borocilicate glass autoclavable , measuring cylinder plastic (100 ml) , measuring cylinder plastic (1000 ml) , measuring cylinder plastic (50 ml) , measuring cylinder plastic (500 ml) , metal loop holder , micropipette tips (10 ul )(for serology) , micropipette tips (100 ul )(for serology) , micropipette tips (1000 ul )(for serology) , micropipette tips (20 ul ) , micropipette tips (200 ul ) , microscope lens cleaner kit , para film sealing film , ph paper strip range (1 10) , soap , sterile cotton swab wooden stick(individually packed) , sterile disposable/hypodermic syringe for single use(5ml ) , sterile disposable/hypodermic syringe with needle for single use(2ml ) , sterile disposable/hypodermic syringe with needle for single use(10ml ) , sterile urine collection container 50ml disposable , individually packed , swab stick with tube sterile , test tube holder , test tube stand (aluminum) 10x10 holes for 12mm diameter test tube , test tube stand 10x10 holesfor 18mm diameter test tube , test tube stand 10x10 holes for 12mm diameter test tube , test tube stand, polypropylene, 3 tier(for keeping 10 ml vtm vials/ tier) , urine container size of the container shall be 30ml disposable , utility gloves(medium) , atcc strain & antisera , acinetobacter baumannii nctc 13304 , enterococcus faecalis atcc 29212 , klebsiella pneumoniae atcc 700603 , pseudomonas aeruginosa atcc 27853 , staphylococcus aureus 25923 , escheriachia coli 25922 , staphylococcus aureus atcc43300 (mrsa) , shigella boydii polyvalent c antisera , shigella dysentriae polyvalent a antisera , shigella flexneri polyvalent b antisera , shigella sonnei polyvalent d antisera , vibrio cholera o1(ogawa)antisera , vibrio cholera o1( inaba)antisera , vibrio cholera (o139 )antisera , salmonella typhi poly o antisera , salmonella typhi o 2 antisera , salmonella typhi o 7 antisera , salmonella typhi o 9 antisera , rt pcr kits, chemical & consumable , 0.2 ml pcr tube (sterile, flat cap shaped) dnase/rnase free , 15 ml polypropylene centrifuge tubes, sterile, {certified nonpyrogenic and dnase /rnase free, disposable conical bottom with seal caps(the tubes should have printed graduations and a large white marking spots)} , alcohol 70% (laboratory grade) , bio medical waste bins red (15 ltr) , bio medical waste bins red (25 ltr) , bio medical waste bins red (40 ltr) , bio medical waste bins yellow (15 ltr) , bio medical waste bins yellow (25 ltr) , bio medical waste bins yellow (40 ltr) , bmw polybags red colour (18 kg capacity) , bmw polybags red colour (28 kg capacity) , bmw polybags red colour(45 kg capacity) , bmw polybags red colour (05 kg capacity) , bmw polybags yellow colour (18 kg capacity) , bmw polybags yellow colour (28 kg capacity) , bmw polybags yellow colour (45 kg capacity) , cryotags / freezer labels, for 1.5 2.0 ml cryovials {ability to withstand cryogenic temperatures upto minus 80 degree c for a wide variety of plastic and glass vials, test tubes, cryogenic boxes and plates} , diluent for dna extraction/ ethanol, molecular(biology grade) , filter barrier tips 20 ul (in box packing, sterile dnase rnase pyrogenfree compatible with nichipet ex2 pipette (make nichiriyo)) , filter barriertips 10 ul (sterile dnase rnase pyrogenfree compatible with nichipet ex2 pipette (make nichiriyo)) , filter barriertips 1000 ul (sterile dnase rnase pyrogenfree compatible with nichipet ex2 pipette (make nichiriyo)) , filter barriertips 200 ul (sterile dnase rnase pyrogenfree compatible with nichipet ex2 pipette (make nichiriyo)) , micro centrifuge tube 0.5 ml (polypropylene tubes, resistance to chemicals, mechanical stress and temperature extremes,(autoclavable, dnase, rnase/endotoxin free)) , micro centrifuge tube 1.5 ml(polypropylene tubes, resistance to chemicals, mechanical stress and temperature extremes,(autoclavable, dnase, rnase/endotoxin free)) , micro centrifuge tube 2 ml(polypropylene tubes, resistance to chemicals, mechanical stress and temperature extremes,(autoclavable, dnase, rnase/endotoxin free)) , micro pipette tips 5 300ul , microcentrifuge tube rack (20 tube/24 tube capacity)(for 1.5/2ml tube) , microcentrifuge tube rack (80 tube/96 tube capacity) reversible one side for 1.5ml tube and other( side with 0.2 ml pcr tubes) , non latex purple nitrile gloves (large) (sterile dnase rnase pyrogenfree ) , non latex purple nitrile gloves (medium) (sterile dnase rnase pyrogenfree ) , optical adhesive covers for pcr 96 well rxn plates 0.2ml (compatible with biorad cfx 97 dx opm) , optical adhesive covers for pcr 96 well rxn plates 0.2ml (compatible with thermo fisher a28574 quant studiort pcr machine) , parafilm roll (size approx 2 inch width and 250 inch length) , pcr 96 well rxn plates 0.2ml (compatible with biorad cfx 97 dx opm) , pcr 96 well rxn plates 0.2ml (compatible with thermo fisher a28574 quant studiort pcr machine) , pcr strips 0.1 ml (strip of 4) (compatible with qiagen 5plex rotorgene rt pcr machine) , pcr strips 0.2 ml with attached cap (strip of 8) (compatible with thermo fisher a28574 quant studiort pcr machine) , pcr strips 0.2 ml with attached cap (strip of 8) (compatible with biorad cfx 97 dx opm) , rnase/ dnase away solution (for complete removal of rnase/ dnase contamination from work surfaces, pipettes and equipments(should be stable at room temperature)) , sterile pasteurppipettes 3ml , viral transport media with swabs (3ml vial with 2 regular swabs i.e. one nasal swab and one throat swab (1.viral transport medium (vtm) with swab with complete directions for collection, storage, transport and carrying. 2.sterile dacron, polyester or rayon sterile swabs with plastic shafts)) , aluminium foil (9 meters length) thickness 11 microns, width 30 cm , compertable with transasia xl 1000fully automated biochemistry analyser , erba ada kit (1x20 ml/1x10 ml) , erbaalbumin kit (10x44 ml) , erba alakaline phosphatase kit (2x44 ml /2x11 ml) , erba amylase kit (3x22 ml) , erba autowash kit (10x100 ml) , erba bilirubin total (btdca) kit (6x44 ml /3x22 ml) , erba bilirubin direct (btdca) kit (6x44 ml /3x22 ml) , erba calcium (arsenazo) kit (10x12 ml) , erba cholestrol kit (10x44 ml) , erba ck nac kit (2x44 ml /2x11 ml) , erba ck mb kit (2x44 ml /2x11 ml) , erba direct hdl cholestrol with calibrator kit (4x30ml/4x10ml) , erba direct ldl cholestrol with calibrator kit (2x30//2x10 ml) , erbacreatinine (enzymetic) kit (5x30 ml/5x10 ml) , erba gamma gt kit (5x44ml/5x11 ml ) , erba glucose kit (10x44 ml) , erba fe 125 kit (r1 4x25 ml/r2 2x12.5 ml/calibrator/2x2ml) , erba hba1c kit (r1.2x15 ml/r2 2x5 ml/5x0.5 ml) , erba ldh p kit (2x44 ml /2x11 ml) , erba lipase xl kit (1x44 ml/1x11 ml) , erba magnesium kit (2x44 ml) , erba mal kit (1x10/5x25 ml) , erba microprotein kit (10x12 ml) , erba phosphorus kit (10x12 ml) , erba total protein kit (10x44 ml) , erba sgot el kit (6x44/3x22 ml) , erba sgpt el kit (6x44/3x22 ml) , erba triglycerides kit (5x44 ml/5x11ml) , erba urea kit (5x44 ml/5x11ml) , erba uibc125 kit (r1 4x25ml, r2 2x12.5ml, calibrator 2x12.5ml ) , erba uric acid kit (5x44 ml/5x11ml) , xl turbi crp kit (2x22 ml/1x11 ml) , xl turbi rf kit (1x22/1x5.5 ml) , erba ada cail kit (1x1ml) , erba ada control kit (1x1ml) , erba hba1c con h kit (1x.0.5ml) , erbahba1c con l kit (1x.0.5ml) , erba xl multical kit (4x3 ml) , erba norm kit (1x5ml) , erbapath kit (1x5ml) , apo a1 kit , apo b kit , hs crp kit , lp(a) kit , xl auto wash ac/al kit (5x44 ml /5x44 ml) , sample cups kit , sample cup vol: 1.0 ml unique type kit , thermal paper roll (108 mm x 3 m)kit , ise module reagent pack na+/k+/cl./li+(4 channel pack) kit , ise cleaning solution kit , compertable with transasia semi auto analyzer erba chem 5x , glucose kit , urea kit , creatinine kit , total bilirubin kit , total protein kit , albumin kit , total cholesterol kit , sgpt/alt kit , sgot/ast kit , ldh kit , ck mb kit , trop i kit (qualitative) , alp kit , triglycerides tg kit , hdl kit , disposable plastic test tube , clot activater tube (plan tube) , fluoride tube , micropipette tip1000ul , micropipette tip100ul , micropippte((0.5 50 ul)) , micropippte (100 1000ml) , external quality control vial for routine biochemistry (erba chem 5x) , protein csf kit , lamp. (erba chem 5x) , calcium (50x1 ml) , uric acid , ada , ark diagnosis electrolyte analyzer , electrolyte analyzer reagent , electrolyte daily cleaner , electrolyte quality control 1,2,3 (1 box ( serum: l1 3, l2 4, l3 3,urin: l1 1, l2 1)) , pm kit , reference housing , electrode (na,k,cl) , compertable with elisa reader (tecan infinite f50 & hydroflex) , t3 , t4 , tsh , sterilizer item compertable with cisa 8 stu model no. 6412 , printer paper , door gasket , heating element , microbiological filter , print ink ribbon for washer , sterilizer item compertable withcisa 4 stu model no. 4212 , printer paper , door gasket , heating element , microbiological filter , print ink ribbon for washer , table topitem compertable with table top sterilizer 23 ltr , door gasket , microbiological filter , heating element , printer paper , washer kf 155item compertable with cisa washer 12 din , liquid alkaline detergent , liquid neutralising agent , lubrication spray , enzamatic detergent , cleaning indicator (level 1) , cleaning indicator (level 2) , cleaning indicator (level 3) , cleaning indicator (level 4) , print ink ribbon for washer , air filter (hepa) , heater element , gasket , ultrasonic washeritem compertable with cisa ultrasonic washer 30 ltr , cleaning agent for ultrasonic cleaner , heat sealeritem compertable with cisa heat sealer , print ink ribbon for heat sealer ( pack of 10 ) , consumables for operation for cssd equipmentitem compatible with cisa cssd machines , 3 line label steam , bowie dick strip , batch monitoring strip , chemical indicator class 4 , chemical indicator class 5 , biological indication steam , wrapping paper 40x40 cm , wrapping paper 50x50 cm , wrapping paper 60x60 cm , wrapping paper 75x75 cm , wrapping paper 90x90 cm , wrapping paper 100x100 cm , wrapping paper 120x120 cm , sterilization reel 50x200m , sterilization reel 75x200m , sterilization reel 100x200m , sterilization reel 120x200m , sterilization reel 150x200m , sterilization reel 200x200m , sterilization reel 250x200m , sterilization reel 300x300m , sterilization reel 350x200m , sterilization reel 400x200m , sterilization reel 500x200m , autoclave tape ( 18x50 meter ) , autoclave tape ( 24x50 meter ) , packing tape (18x50 meter) , packing tape (24x50 meter) , packing tape (36x50 meter) , packing tape (48x50 meter) , process indicator ( external labeling ) for every pack , sms paper non woven material(90 x90 mm) , sms paper non woven material (100 x100 mm) , sms paper non woven material (100 x120 mm) , sms paper non woven material (120 x 120 mm) , labelling ink role , ro plant consumables for cssd , anti scaling chemical , cip chemical , chemical for flushing , jumbo catridge filter , r.o. membrane 8040 , water softener consumables for cssd , resin , air compressor consumables for cssd , check valve kit , intake filter element , crankase filter element with felet , grease kit , piston ring set , filter , operational consumables for cssd compertable , apron heavy duty water proof , brushes for instrument cleaner , devices for cssd , pcd device for bms test , pcd device for bds test , gun for labeling , aqua zero vacuum pump (devices for cssd 8 stu) , aqua zero vacuum pump (devices for cssd 6 stu) , aqua zero vacuum pump (devices for cssd 4 stu)...

Department of Higher Education - Madhya Pradesh

35445150 bids are invited for boqboq laboratry equipement equipement mosfet chara cteristics apparatus 2 laboratry equipement photo transistor char apparatus 3 laboratry equipement e m by milikans oil drop method 4 laboratry equipement constent deviation spectrograph 5 laboratry equipement ujt char apparatus 6 laboratry equipement hartely and colpitts apparatus 7 laboratry equipement cro dual trace 30 mhz 8 laboratry equipement zener regulated power supply 9 laboratry equipement compound microscope 10 laboratry equipement dissecting microscope 11 laboratry equipement binocular microscope 12 laboratry equipement slide reader 13 laboratry equipement water bath double wall 14 laboratry equipement water and soil testing kit 15 laboratry equipement ph meter 16 laboratry equipement electronic digital balance 17 laboratry equipement oven 18 laboratry equipement tissue culture rack 19 laboratry equipement thin layer chromatography 20 laboratry equipement chrometographic chamber 21 laboratry equipement oven 22 laboratry equipement electronic digital balance 23 laboratry equipement tds meter digital 24 laboratry equipement microprocessor water soil testing kit 25 laboratry equipement chemical balance 26 laboratry equipement water and soil testing kit 27 laboratry equipement thin layer chromatography 28 laboratry equipement rotary microtome tih accessories 29 laboratry equipement binocular microscope 30 laboratry equipement research microscope 31 laboratry equipement flame photometer 32 laboratry equipement digital tds meter 33 laboratry equipement ph meter 34 laboratry equipement heating mental with regular cap 35 laboratry equipement compound microscope 36 laboratry equipement hot air oven ss 37 laboratry equipement vortex shaker 38 laboratry equipement image projection system...

Department of Higher Education - Madhya Pradesh

35405184 bids are invited for compound microscope , dissecting microscope , bionocular microscope , image projection system , slide reader , hot air oven stainless steel , water and soil testing analysis kit , ph meter , incubator stainless steel , microscopic camera , digital tds meter , tissue culture rack caster racks , chromatro graphic chamber , conductivity meter digital with cell , hot air oven 14 14 , digital balance accuracy 0001 200 grm , digital ph meter conductivity meter and temperature meter , melting point apparatus digital , digital photoelectric colorimeter 5 liters , micro processor water soil testing kit , distillation apparatus double distillation borosilicate glass cap 5 liter , spectro photometer 340 900nm , chemical balance , chemical weight box 1mg 100gm , chromatographic cabinet 6 leaves , tds meter digital , conductivity meter digital , rotatory microtome with accessories , micro pipette fixed1 5 ml , distillation apparatus single distillation capacity 3lt , centrifuge machine 3500 rpm , flam photometer total quantity : 89...

Department of Higher Education - Madhya Pradesh

35380761 bids are invited for procurement articles 1 auto clave 2 do meter digital 3 digital meter counductivity meter and temp meter 4 digital photoelectric colorimeter 5lit 5 digital app double distilation cap ss 6 electronic blance0.01mg to 220g 7 flame photometer digital 8 heating metel 5lit 9 heating metal 2 lit 500w 10 hotplate with energy regulator 11 centrifuge machine 12 laboratory mixer 13 magnetic stirrer with hot plate 14 muffle furness 9x4x4 15 shaking machine with wrist action 16 bod incubator 17 uv b3chromatrographic chamber 18 vortex mixer 19 digital colony counter 4 digit 20 digital turbidity meter 3.5 digit 21 tds meter digital 22 test tube stand 23 test tube mid 24 test tube big 25 beaker100ml 26 beaker 50ml 27 volumetric flask 100ml 28 volumetric flask 50ml 29 water bath double 12 holes 30 water soil analysis kit 7 para meter 31 shaking machine 32 petri disk 4” 33 rotatory flask shaker 34 rotatory light vacuum pump 25 lit /per min 35 ph meter with electrodes 36 burett 50ml 37 measuring cylinder100ml 38 flask 250ml 39 flask 100 40 polorimeter half shaade 41 flask 50ml 42 hot air oven 43 melting point apparatus digital 44 micropipette variable 45 compound microscope 46 dissecting microscope with bull lences 47 binocular microscope 48 betrological oven 49 rotatory microtome with accessories 50 plant collection set 51 digital spectrophotometer 52 ph meter 53 homogenizer 54 gel electroproshish with power supply(vertical) 55 laminar air flow horizontal 56 tissu culture rack 57 human plastic skeleton imported 58 blood pressure machine 59 insect collection net 60 parmanent slide sample 10pices set 61 fet characteristic apparatus 62 mosfet characteristic app 63 ujt characteristic app 64 s.c.r characteristic app 65 thermistor characteristic app 66 diac and tiac characteristic app 67 photo diode characteristic app 68 photo transistor characteristic app 69 power amplifier 70 hartley and colpitts oscillator 71 study of hybrid parameters circuits 72 zanier regulated power supply 73 newton ring app complete with travelling microscope power supply 74 series and parailal resonrnce circuits 75 study of multivibrators using omamp 76 clipping and clamping circuits using operational amplifire 77 spectrometer 6/7 78 die electric constant apparatus 79 screw gauge electronic 80 verniear calipers electronics 81 bi prism assembly 82 ac ammeter 83 dc voltmeter 84 pnp/npn tranistor dual 4 meter 85 boyle law app heavey metal 86 torsion pendulum 87 reading telescop 88 jeager apparatus 89 milimeter/milivplter 90 daniel cell 91 digital multimeter 92 travelling microscope 93 spectrometer prism(crown/flint glass) 94 galvanometer 95 apparatus to study cheracteristic tunnel diode 96 ldr charecterritics app 97 study of smps 98 four probe methods 99 solar cell characteristic apparatus 100 single stage double stage rc coupled amplifife 101 transistorized differential amplifire 102 f e t amplifire 103 study of schmitt trigger circuits 104 8056 microprocessor with smps 105 cro digital 30 mhz/40mhz 106 multiplexer and demultiplexer built in power supply 107 professional large formate display ...

Department of Higher Education - Madhya Pradesh

35360517 bids are invited for boq purchase laser experimental setup with he ne laser , lcr impedance circuit apparatus , left right shift register , magnetic stirrer with hot plate , melting point app digital , microscope camera 5 mp image projection system , milli ammeter mill voltmeter , morse key , mosfet app , paper chromatography , ph meter digital with electrode microprocessor based , photo diode ch app , photo transistor ch app , plug key , plug key four way , rc coupled , resistance box , rotary microtome , scr ch app , screw gauge 25 mm , slide box 100 slides , slide box 50 slides , slotted weight 5 x 50 gm , solar cell apparatus , soldering iron , spectrometer 6 , spectrometer prism crown , spectrometer prism flint , spectrophotometer digital 340nm 960 nm , sphreometer , stop clock , stop watch digital , thermister ch app , tlc kit with applicator , transistor ch app , travelling microscope v h , ujt app , variable micropipette , vernier callipers , vertical gel electrophoresis system , water soil testing kit digital briefcase model , water bath 12 holes double walled , weight box total quantity : 352...

Department of Higher Education - Madhya Pradesh

35150561 bids are invited for boq bid study of various network theorems , solar cell characteristic apparatus , photo diade charatterttic apparatus , rectifier and filter charecteristic apparatus , study of lissajous figure trainer , vernier callipers , ammeter d c a c required range , voltmeter d c a c required range , galvanomerer , screw gauge , spherometer , digtal multimeter , resistance box various range , audio frequency generator , rhcostate various length , soldring lron , ballistic galvanometer with amp and scale arrangement , lachianche cell , spectrometer prism crown flint glass , cantilever to detgrmine young modules , callendor and barne apparatus to determine the value of mechanic equlva , lee apparatus to cetermine the hear conductivity of bad conductors of diffe , digital multimeter , reading telescope , electron spin resonance spectrometer , lonization potential of lithium complete setup , study of hall effect complete setup. , apparatus to verify newton law of cooling , four way key , magnetic stirrer with hot plate , sokhlet extraction apparatus with glass part , digital balance accuracy 0 001 200 grm , laboratory mixer , tds meter digital , paper chromatography testing kit , slide box for 100 slide , laminar air flow horizantal , tissue culture racs caster rachs , uv vis spectrophotemeter double beam , laminar air flow vartical , get electophorosis unit with power supply horizontal , micro plpecte varlable 0 5 ml , rotalory microcome with accessorias , digital colony counter , digital turbidtimeter , digital tds meter , research microscope , microscope cemera , electronic digital balance , vorter shaker , magnatic strirrer with hot plate , autoclave portable , ph meter , water and soil testing anatsis kit , bod incubater , compound microscope , dissecting microssope , thin layar chromatography kit , water and soil testing analysis kit , binocular microscope , ph meter , bod incubater , micro pipette variable 1 5 ml , rotatory microtome with accessories total quantity : 261...

Department of Higher Education - Madhya Pradesh

34965557 bids are invited for sl. no. item title item description 1 1 containers 2 2 sauce pan with lid 3 3 fry pan 4 4 tava roti/ tava dosa 5 5 parrat 6 6 grater(multipurpose) 7 7 patila with lid 8 8 kadchhi 9 9 knife all types 10 10 peeler/ chamcha/ chimta/jhara/ masala dabba 11 11 cutlery set 12 12 chakla belan 13 13 kadahi with lid 14 14 dinner set (steel) 15 15 bucket/ dustbin/ tub 16 16 pressure cooker 17 17 lighter 18 18 tray 19 19 crockeries (tea set borosil glasses) 20 20 namak daniset 21 21 stiching material—needle box 22 22 gas chula with cylinder/ chimini 23 23 indection 24 24 paper napkins/ cloth napkin/ table mat 25 25 model parts of flower/ kidney/brain/heart/human eye& ear 26 26 weighting machine digital 27 27 sonometer sccale 28 28 scale electronice 29 29 weight sclae 6kg 30 30 calcium oxide 31 31 clycerol 32 32 iodine solution 33 33 phenol 34 34 glacial acetic acid 35 35 safferemine 36 36 potassium mydroxide 37 37 canada balson 38 38 fehling solution 39 39 calcium chloride 40 40 acid accumulator 41 41 cylender noggel/ regulator/rubber set 42 42 bottele opener 43 43 sweing machine 44 44 washing machine 45 45 fabric colour set 46 46 bad sheet 47 47 soffa set cover 48 48 dinning table cover 49 49 vacume cleaner 50 50 hair cap/ aprin 51 51 microwave 52 52 phillips otg 53 53 toster 54 54 grill sandwich maker 55 55 hand grinder 56 56 steel bartan set 57 57 coffe maker 58 58 mixer /grider/ juicer 59 59 all types seaser 60 60 water coler 20 l 61 61 aquagurd 62 62 modular kitchen 63 63 autoclave portable 21l 64 64 autoclave portable50l 65 65 dissecting microscope 66 66 binocular microscope 67 67 deep freezer 68 68 compoundmicroscope 69 69 high defination microscope 70 70 microscopic eye pic 71 71 triangular microscope 72 72 ganong respirometer 73 73 hot air oven 14x14x14 74 74 magnetic stirrer with hot plate 75 75 maximum minimum thermometer 76 76 micro pipette variable 1 5ml 77 77 uv chromatographic chamber 78 78 ph meter ( digital ) with elctrodes 79 79 thin layer chromatography apparatus 80 80 water bath double wall ( 12 holes) ss 81 81 bod incubator 82 82 digital colony counter 83 83 digital tds meter 84 84 flame photometer 85 85 interactive led panel 86 86 digital thermometer 87 87 projection microscope 88 88 betological incubator stainless steel 89 89 laminar air flow horizontal 90 90 hair dryer 91 91 homogenizer 92 92 distillation apparatus doubledistillation 93 93 micro kjeldahl & distillation apparatus 94 94 soxhlet extraction unit 95 95 vortex shaker 96 96 auxanometer 97 97 computer system with licenced operating system internet facility 98 98 farmer potometer / ganog potometer 99 99 water and soil analysis testing kit (digital ) 100 100 tissue culture rack ( caster rack ) 101 101 blackman apparatus 102 102 gel electrophoresis unit with power supply 103 103 heating mantle with regulator cap 1 litre 104 104 occular micrometer/ stage micrometer 105 105 stem borer 106 106 cod analyzer multi parameter beanch 107 107 oxygen electrode 108 108 rotatory microtome 109 109 specimen 20pices 110 110 botany/zoology/physics/chemistry/home science map 111 111 digital spectrophotometer 112 112 blood pressure machine 113 113 plant collection net 114 114 centrifuge machine 115 115 glucometer 116 116 inverter 117 117 laboratory stirrer 118 118 insect collection net 119 119 chemical blance digital 0.01 to 600gm 120 120 chemical cabinet storage 121 121 rotary vane vaccume pump 122 122 oil free vacuum pump 123 123 muffle furnace 124 124 refrigerator 125 125 digital melting pint apparatus 126 126 karl fisher titrator 127 127 student polarimeter 128 128 digital conductivity meter 129 129 digital photo colorimeter 130 130 dissolved oxygen meter 131 131 flask shaker ( wrist action type ) 132 132 screw guage/ vernier calipers 133 133 ammeter dc/ac 134 134 stop watch digital / stop clock 135 135 analog multimeter /digital multi meter 136 136 voltmeter dc/ac / galvanometer 137 137 spectrometer prism ( crown/ flint glass) 138 138 thermometer different range 139 139 analog to digital converter power supply 140 140 rheostat ( various length ) 141 141 battery eliminator 142 142 apparatus to study specific resistance energy gap 143 143 apparatus to study characteristics tunnel 144 144 apparatus to study characteristics of zener diode 145 145 anderson/schering/hay/kelvin/maxwell 146 146 apparatus to study rc coupled amplifier power supply 147 147 audio frequency generator 148 148 laclanche cell 149 149 function generator 1 hz to 10 mhz 150 150 battery charger 2 to 12 volt 151 151 apparatus to study response curve for lcr 152 152 apparatus to draw b h curve of ferromagnetic 153 153 complete apparatus to determine the heating 154 154 potentiometer 155 155 mos fet/ fet characteristics apparatus 156 156 half adder /full adder/half subtractor 157 157 half wave and full wave rectifier apparatus 158 158 zener regulated power supply 159 159 8085/8086 microprocessor kit 160 160 photo diode characteristics apparatus 161 161 digital to analog converter with built in power 162 162 travelling microscope 163 163 series and parallel resonance circuit 164 164 solar cell characteristics apparatus 165 165 encoder and decoder circuit with built in power 166 166 cro dual trace 30/40 mhz 167 167 plancks constant using solar cell apparatus 168 168 function generator 0 3 to 30 mhz 169 169 vibration magnetometer 170 170 single stage and double stage r c couple 171 171 power amplifier ( trainer board) 172 172 variable regulated dc power supply 0 30v range 173 173 scr / ujt characteristics apparatus 174 174 horizontal torsion apparatus 175 175 multiplexers and demultiplexers with built in 176 176 stefan constant apparatus 177 177 regulated power supply trainer board 178 178 dielectric constant apparatus 179 179 thermistor characteristic apparatus 180 180 drill machine with all size bits (hammer) 181 181 bread board (trainer kit) 182 182 study of amplitude modulation and demodulation 183 183 digital ic trainer kit 184 184 study of crystal oscillator 185 185 four probe method 186 186 induction hot plate with induction ports 187 187 op amp as voltage follower trainer board 188 188 youngs modulus apparatus 189 189 frank hartz experiment setup using argon gas 190 190 thyratron characteristics apparatus 191 191 transistorized push pull amplifier 192 192 michelson interferometer apparatus 193 193 study of frequency modulation and demodulation 194 194 op amp as voltage to frequency/frequency to 195 195 study of active and passive filters 196 196 zeeman effect experiment 197 197 fresnel biprism diffraction apparatus 198 198 study of tdm pcm reciever/ transmitter 199 199 study of smps ...

Department of Higher Education - Madhya Pradesh

34700671 bids are invited for laboratory equipment 1 mosfet chara cteristics apparatus 2 photo transistor char apparatus 3 e m by milikans oil drop method 4 constent deviation spectrograph 5 ujt char apparatus 6 hartely and colpitts apparatus 7 cro dual trace 30 mhz 8 zener regulated power supply 9 compound microscope 10 dissecting microscope 11 binocular microscope 12 slide reader 13 water bath double wall 14 water and soil testing kit 15 ph meter 16 electronic digital balance 17 oven 18 tissue culture rack 19 thin layer chromatography 20 chrometographic chamber 21 oven 22 electronic digital balance 23 tds meter digital 24 microprocessor water soil testing kit 25 chemical balance 26 water and soil testing kit 27 thin layer chromatography 28 rotary microtome tih accessories 29 binocular microscope 30 research microscope 31 flame photometer 32 digital tds meter 33 ph meter 34 heating mental with regular cap 35 compound microscope 36 hot air oven ss 37 vortex shaker 38 image projection system total quantity : 137...

Department of Higher Education - Madhya Pradesh

34588406 bids are invited for lab item compound microscope , dissecting microscope , autoclave portable , heating mental with regulator cap 1 ltrs , incubator stainless steel , digital colony counter , heating mental with regulator cap 500 ml , autoclave vertical cap 50ltrs , magnetic strirrer with hot plate , laminar air flow horizontal , binocular microscope , water bath double wall 6 holes stainless steel , hot air oven stainless steel , ph meter , water and soil testing analysis kit , vortex shaker , colorimeter , image projection system , slide readar , thin layer chromatography apparatus , laminar air flow vertical , electronic digital balance 0.01mg , deonizer with digital meter , d o meter digital , melting point apparatus digital , heating mentle 7 ltrs , water soil testing kit digital , spectrophotometer 340 900 nm , water bath 12 holes , sodium vapor lamp , ph meter digital , paper chromatography testing kit , chemical balance , chromatrographic chamber , digital balance accuracy 0.001 200grm , microprocessor flame photometer , thin layer chromatography kit , oven , water bath double wall , rotatory microtome with 12 holes stainless steel accessories , hot air oven stainless , magnetic strirrer with hot , water and soil testing , apparatus to study charging and discharging of a capacitor , e m by milikans oil drop , zener diode characteristics apparatus with built in power supply , weight box , compound pendulum bar pendulum , jaegers apparatus to determine the surface tension , spectrometer 6 7 inches , transformer of mercury lamp , transformer for sodium vapor lamp , transistorized push pull amplifier , power amplifier , study of schmitt trigger circuit , study of hall effect compl1ete setup , ionization potential of lithium complete setup , fiber optics trainer , 8086 microprocessor with smps , complete apparatuses to determine e by milikons method , mosfet characteristic apparatus , lees apparatus to determine the hear conductivity of bad conductors of different geometry , complete apparatus to determine elm using thomsons method , dielectric constant apparatus , photo diode characteristic apparatus , inertia table , travelling microscope , vernier callipers , stop watch digital , newtons rings apparatus complete complete with travelling microscope power supply and sodium lamp , transistorized differential amplifier , study of amplitude modulation and demodulation trainer , apparatus to study response curve for lcr circuits and to determine the resonance frequency , battery charger 2 to 12 volt , potentiometer , single stage and double stage r.c. coupled amplifier feed back amplifier , solar cell characteristic apparatus , transistor characteristics apparatus with built in power supply and meters , physical balance , thermister characteristic apparatus , voltmeter dc ac required range , zener regulated power supply , transistorized regulated power supply , rheostate various length , diac and triac characteristic apparatus , fet characteristic apparatus , apparatus to study specific resistance and energy gap of a semiconductor , apparatus to determine the value of planks constant complete with photocell light source set of filter and power supply , hartley and colpitts oscillator...

Department of Higher Education - Madhya Pradesh

34514561 bids are invited for lab development autoclave portable , binocular microscope , bod incubator , centrifuge machine 3500 rpm , chemical balance , choromotography chamber , compound micrscope , conductivity meter with cell , cork boring machine , digital balance accuracy 0.001 200 , digital colony counter , digital ph meter conductivity , digital tds meter , digital turbidity meter , dissecting micro scope , distillation appratus 5 ltr , electronic balance 0.1 600 grm , flame photo meter digital , gel electrophoresis , heating mentle 7 ltr , heating mentle regular 1000ml , heating mentle regular 500 ml , hot air oven 14 x 14 , hot air oven stainless steel , image projection system , incubator stainless steel , kjeldal digestion 6 test, kjeldl digesition unit 6 test , laminar air flow horizontal, magnetic strirrer , melting point apparatus digital ,micro pippette fixed 1 5 ml , micro pippette variable, micropipette variable 1 5 ml , micro water and soil kit, oven , oven universal , paper choromotgraphytesting kit , ph meter , ph meter digital with electrodes ,potentio meter digital , rotary microtome withaccessories , single pan balance 0.01 300gr , slide box100 slide , slide box 50 slide , spectrophotometer340 900 , tds meter digital , thin layer chromatographykit , vortex shaker , water and soil testing , waterbath 12 holes , water bath 12 holes ss , water bath6 holes ss total quantity : 64...

Department of Higher Education - Madhya Pradesh

34435002 bids are invited for 1 auto clave 2 bod incubator 3 cromatographic chamber 4 spectrophotometer 5 do meter digital 6 counductivity meter digital with cell 7 digital ph metr conductivity meter and temperature meter 8 digital photoelectric colorimeter 5lit 9 double distilation apperatus cap4lit 10 electronic blance0.01mg to 600gm 11 flame photometer digital 12 heating metel 4lit 13 hotplate with energy regulator 1500w 25x40cm 14 laboratory stirer 15 melting point apparatus digital 16 muffle furness 9*4*4 17 ph meter digital with electrodes 18 potantiometer digital 19 rotatory flask shaker 20 vacuum pump 21 water bath double 12 holes 22 water soil analysis kit 7 para meter 23 conductivity meter digital 24 compound microscope 25 dissecting microscope with bull lences 26 slide box 50 slides 27 binocular microscope 28 image projection system projection microscope 29 water bath double wall 12holes 30 double distilation apperatus cap2lit 31 hot air oven stainless steel 32 heating mental with regulator 1 lit cap 33 magnetic strirrer with hot plate 34 vortex shaker 35 water and soil testing analysis kit 36 ph meter with electrodes 37 digital colony counter 38 rotatory microtome with accessories 39 centrifuge machine 3500 rpm 40 thin layer chromotograhic chamber 41 oven 42 gel electroproshish with power supply(vertical) 43 bod 44 compound microscope 45 dissecting microscope with bull lences 46 image projection system projection microscope 47 binocular microscope 48 digital colony counter 49 rotatory microtom with accessories 50 bod incubator ss steel 51 ph meter...

Directorate Of Medical Education - Madhya Pradesh

34429793 tender for supply of chemical and reagent for mdru department third call , mdru kits and reagents , ammonium chloride 500gm , potassium bi carbonate 500gm , sodium chloride 500gm , tris hcl 500gm , sds 500gm , saturated phenol 500ml , chloroform 500ml , sodium acetate 250gm , isoamyl alcohol 500ml / 1ltr , glacial acetic acid 500ml / 1ltr , molecular biology grade agarose powder 250gm , bromophenol blue dye 2ml*5=1pack , ethidium bromide 10ml , molecular weight ( dna ladder ) 100bp & 1kb 1 vial , molecular weight ( dna ladder ) 50bp 1 vial , molecular weight ( dna ladder ) 25bp 1 vial , taq polymerase 500units / vial , amplitaq gold dna polymerase master mix 500units / vial , mgcl2 5ml , dntp mix 1ml , dnase 1000 unit , rnase 1000 unit , proteinase k 1000 unit , tris edta 500 gm , edta 250gm / 500gm , boric acid 250gm / 500gm , teepol5 liter , xylene cynol 10 gm , dmso 50 ml , tips i. 0.2 20 ?l tips , tips ii. 20 200 ?l tips , tips iii. 200 1000 ?l tips , superscript ii rnase reverse transcriptase / episcript™ rnase h reverse transcriptase ( episcript rt ) 400 / 500 reaction pack. , power sybrgreen pcr master mix 5 ml , power sybrgreen rt pcr reagent kit 5 ml , oligo ( dt ) 12 18 primer25ug ( 0.5ug / ul ) , absolute ethanol 500ml , pcr plates ( light cycler 480 compatible ) pack of 50 / pack of 100 , sealing foil ( rt pcr / qpcr grade ) ( light cycler 480 compatible ) pack of 50 / pack of 100 , filter tips each pack contains 1000 psc. , i. 0.2 20 ?l filter barrier tips , ii. 20 200 ?l filter barrier tips , iii. 200 1000 ?l filter barrier tips , mct variable tubes each pack contains 1000 psc. , i. 20 200?l tubes , ii. 200 600 ?l tubes , iii. 500 2000 ?l tubes , nitrile autodextorous gloves each pack contains 1000 psc. , mctstands for variable tubes sizes each pack contains 10 psc. , i. 20 200?l tubes stand , ii. 200 600 ?l tubes stand , iii. 500 2000 ?l tubes stand , filter tip boxes each pack contains 10 psc. , i. 0.2 20 ?l filter barrier tip box , ii. 20 200 ?l filter barrier tip box , iii. 200 1000 ?l filter barrier tip box , rt pcr grade water pack size of 20ml ( 20 ml * 5 ) , tip discard box ( 1 2 liter capacity ) each , graduated measuring cylinders 50, 100, 500, 1000 ml each , graduated beakers 50, 100, 500, 1000 ml each , flat bottom tube 5ml ( with screw cap ) pack size of 500 psc. , tube stand ( 15ml falcon, 5ml, 2ml, 0.5ml, 0.2ml mct ) pack size of 10 psc. , graduated conical flask 50, 100, 500, 1000ml pack size of 5 psc. , edta blood collection tube 5ml each pack contains 100 psc. , plain vial ( for clot activator ) each pack contains 100 psc. , fluoride vial each pack contains 100 psc. , test tube 5, 10 ml each pack contains 100 psc. , slide+cover slips ( 25mm*75mm ) each pack contains 100 psc. , tissue paper roll pack size of 12 psc. , fine tissue cloth roll pack size of 12 psc. , cotton pack size of 10 psc. , wash bottle / dropping bottle, 200ml, 500ml, 1ltr each , funnels variable range each , plastic bottle, 200, 500, 1000ml each , syringe + needle 2 ml, 5 ml pack size of 100 psc. each , nitrile gloves; medium and large size box pack size of 1000 psc. , dna isolation kit { blood } per kit , rna isolation kit per kit , phenol 500 ml , hno3 ( nitric acid ) 500 ml , propionaldehyde pure ( 97% ) 500 ml , phthalic anhydride 500 ml , glacialacetic acid ar 500 ml , hydrochloric acid ar 500 ml , sulfuric acid ar 500 ml , 2 amino ethanol 500 ml , pyridine ar 500 ml , ammonia solution ar 500 ml , ammonia chloride ar 500 ml , acetyl salicylic acid 500 ml , acetone ar 500 ml , anthranilic acid ar 500 ml , activated charcoal 500 ml , silica gel g 500 ml , benzoicacid ar 500 ml , sds 500 gm , colin ( cleaning detergent solution ) 500 ml , sterilium ( hand sanitizer ) 100 ml * 5 , dettol / lifeboy alcohol based hand sanitizer 100 ml * 5 , hypo 4% 5 l , floor cleaner phenyl 1 l * 5 , serum separator vial 3.5 ml ( vacutainer tube, 3.5ml, 13 x 75mm, plastic, additive: clot activator / polymer gel, gold hemogard closure, paper label ) pack size of 100 psc. each , labolene 1 l / 5 l , cleaning mop per psc , broom per psc , microwave gloves per pair , brown paper for autoclaving per roll , liquid nitrogen 10 / 25 ltr. , phosphate buffer saline ( 10x; ph 7.4; rnase free ) 500 ml , formalin ( formaldehyde aqueous solution; lab grade ) 500 ml , paraffin wax ( 58 600c for histology ) 500 gm , xylene ( molecular lab grade ) 500 ml , glycerol500 ml , ammonia ( nh4oh; extra pure ) 250 ml / 500 ml , methanol ( methyl alcohol, ch3oh ) 500 ml , acrylamide / bis ar 500 ml , 10x tbe buffer 500 ml , urea ( ultra pure; mol bio grade ) 500 gm / 1kg , ammonium persulfate 100 gm , temed ( ultra pure; mol bio grade ) 100 ml / 250 ml , 4’, 6 diamidino 2 phenylindole 50 ml , diethyl pyrocarbonate 5 gm / 25 gm , tae buffer , sybr gold 100ul , restriction enzyme – mnl i250 / 300 / 500 units , restriction enzyme – bcli1000 / 1500 / 2500 / 3000 units , restriction enzyme – hpych4v100 / 500 units , restriction enzyme – hpych4iii200 / 250 / 1000 / 1250 units , restriction enzyme – sau96i 1000 units , restriction enzyme – sfci200 / 1000 units , restriction enzyme – bcci1000 units , restriction enzyme – scrfi500 / 1000 / 2500 units , restriction enzyme – afliii250 / 1250 units , restriction enzyme – scai500 / 1000 / 1250 units , restriction enzyme – avai1000 / 2000 units , restriction enzyme – bsmi200 / 500 / 1000 / 2500 units , restriction enzyme – tspri ( also share cleavage site withtscai ) 1000 units , restriction enzyme – mboii250 / 300 / 1250 / 1500 units , restriction enzyme – bsh1236i500 / 1000 / 2500 units , restriction enzyme – banii1000 / 1500 / 2000 units , restriction enzyme – mph1103i1000 / 5000 units , restriction enzyme – dde i200 / 500 / 1000 / 2500 units , restriction enzyme – bsmb i ( also share cleavage site withesp3i ) 200 / 400 / 1000 units , restriction enzyme – afa i ( also share cleavage site withrsa i ) 1000 / 5000 units , restriction enzyme – bal i ( also share cleavage site withmlu ni ) 50 / 100 / 200 / 250 units , restriction enzyme – fspi ( also share cleavage site withnsbi ) 400 / 500 / 1000 / 2500 units , restriction enzyme – hpa ii ( also share cleavage site withmspi ) 1000 / 2000 / 4000 / 5000 / 10000 units , restriction enzyme hinf i , restriction enzyme hpych4 , restriction enzyme mboii , restriction enzyme bstui , restriction enzyme mvai , primers , fmr1 set 1 –f5 tcaggcgctcagctccgtttcggtttca 3 r5 5 aagcgccattggagccccgcacttcc 3 , mecp2 exon 1 set 1 f5 gttatgtctttagtctttgg–3´ r5 tgtgtttatcttcaaaatgt–3´ , exon 2set 1 f5 cctgcctctgctcacttgtt–3´ r5 ggggtcatcatacatgggtc–3´ , exon 2set 2 f5 agcccgtgcagccatcagcc–3´ r5 gttccccccgaccccaccct–3´ , exon 3 set 1 –f5 tttgtcagagcgttgtcacc–3´ r5 cttcccaggacttttctcca–3´ , exon 3 set 2 f5 aaccacctaagaagcccaaa–3´ r5 ctgcacagatcggatagaagac–3´ , exon 3 set 3 f5 ggcaggaagcgaaaagctgag–3´, r5 tgagtggtggtgatggtggtgg–3´ , exon 3 set 4 – f5 5´–tggtgaagcccctgctggt–3´ r5 ctccctcccctcggtgtttg–3´ , exon 3 set 5 f5ggagaagatgcccagaggag–3´ r5 cggtaagaaaaacatccccaa–3´ , exon3 ( l100v ) f5 aaccacctaagaagcccaaa 3 r5 gcttaagcttccgtgtccagccttcaggta 3 , putative promoter and exon 1. f5 gggtgcaatgaaacgctta 3 r5 tttaccacagccctctctcc 3 , mc4r rs17782313 f 5 aagttctacctaccatgttcttgg 3 r 5 ttccccctgaagcttttcttgtcattttgat 3 fto rs9939609 f 5 aactggctcttgaatgaaataggattcaga 3 r5 agagtaacagagactatccaagtgcagtac 3 , adipoqrs2241766 – f5 tgtgtgtgtggggtctgtct 3 r 5 tgtgatgaaagaggccagaa 3 , rs1501299 f5 ctacactgatataaactatatggag 3 r5 ccccaaatcacttcaggttg 3 , pcsk1 rs155971 – f5’tatatgcagccaccaatcca 3’ r5’aaaatgaagggagaagcacaaa3’ , pomcrs6232 f5 ttgtgcccttcatctgaaca 3 r5 tgtagcaactttggcatgga 3 , rs155971 f5tatatgcagccaccaatcca 3 r5 aaaatgaagggagaagcacaaa 3 , ppar g ( pro12ala ) f5gcc aat tcaagc cca gtc 3r5gat atgttt gca gac agt gta tca gtg aaggaa tcg ctttcc g 3 , kcnj11 ( rs5219 ) f5 gactctgcagtgaggcccta 3’ r5 acgttgcagttgcctttctt 3’ , capn10 ( rs3792267 ) f5 cacgcttgctgtgaagtaatgc 3’r5 tgattcc catggtctgtagcac 3’pik3ca set 1 forward 5’ ggagtatttcatgaaacaaatgaatgatgcg 3’ reverse 5’ gagctttcattttctcagttatctt 3’ , bat 25 set 1 f 5’ tcgcctccaagaatgtaagt 3’r 5’ tctgcattttaactatggctc 3’bat 26 set 1 f5’ tgactacttttgacttcagcc 3’r5’ aaccattcaacatttttaaccc 3’ , d2s123 set 1 f5’ aaacaggatgcctgccttta 3’ r5’ ggactttccacctatgggac 3’ , d5s346 set 1 f 5’ actcactctagtgataaatcggg 3’ r5 agcagataagacagtattactagtt 3 , d17s250 – set 1 f5’ ggaagaatcaaatagacaat 3’ r5’ gctggccatatatatatttaaacc 3’ , impdh2 set 1 f5 gtttctgcggtatcccaatc 3 r5 cgagcaagtccagcctat 3 bmp6 rs73719353 f5’ gctcctttgcacttcgctgt 3’ , r5’ aggctctgctg agctcctac 3’ , bmp6 rs73719341 f 5’tgaacttcccattcccctct 3’ r5’ataaaattagcattgatcca 3’ , bmp6 rs73719318 f5’caggtgctgtgcaacttctt 3’ r 5’agagggcaccatggttgcct 3’ , bmp6 rs73381662 f 5’ ctgagattcaattaggccca 3’ r 5’taaagaacagcaaaagtctg 3’ , bmp6 rs73381650 f 5’cacataaagattgctgcatt 3’ r 5’tagtaatcctaaaaatggga 3’ , anxa2 rs7170178 f 5’ ttcacagcagttcaaaatac 3’ r 5’ ctgggtttccagagatggaa 3’ , anxa2 rs73435133 f 5’ gagtgcaaggtgctgaggat 3’ r 5’ gatttcagacagcccttgca 3’ , anxa2 rs73418020 f 5’ tctgagagtgaaaggtgcac 3’ r 5’ tcccatcccctgaatccctg 3’ , anxa2 rs72746635 f 5’ cctgactcattgtcacatca 3’ r 5’ aagtggctttccactgccc 3’ , anxa2 rs73418025 f 5’ cttctcatcttactttt 3’ r 5’ agggaaggatacagaggaga 3’ , hsp 70 primer sequence5 agcgt aacac cacca ttcc 3 ( forward ) 5 tggct cccac cctat ctc 3 ( reverse ) , the gapdh sequence forward primer 5 agc cac atc gct gag aca c 3, reverse primer 5 gcc caa tac gaccaa atcc 3. , mthfr f:5 tgtggtctcttcatccctcgc 3;r: 5 ccttttggtgatgcttgttggc 3. , dpyd f:5 actcaatatctttactctttcatcaggac 3. r: 5 acattcaccaacttatgccaattct 3. , tyms f:5’ ggtacaatccgcatccaactatta 3’ r:5’ ctgataggtcacggacagattt 3’ , imp3 forward:5’atgactcctccctacccg3’ reverse:5’gaaagctgcttgatgtgc3’ , cxcl1forward: 5’ccagacccgcctgctg 3’and reverse:5’cctcctcccttctggtcagtt 3’ , cox 2 forward: 5 cagccatacagcaaatcc 3; reverse: 5 tcgcacttatactggtcaa 3 , hmlh1f 5 ttt tga tgt aga tgt ttt att agg gtt gt 3r 5 acc acc tcatcataa cta ccc aca 3 , ppar g ( pro12ala ) , f5gcc aat tcaagc cca gtc 3 , r5gat atgttt gca gac agt gta tca gtg aaggaa tcg ctt tcc g 3 , methylated ( hmlh1 ) f 5 acg tagacg ttt tat tag ggt cgc 3 r 5 cct catcgtaac tac ccg cg 3 , hmsh2 f 5 ggt tgt tgt ggt tgg atg ttg ttt 3 r 5 caa cta caa cat ctc ctt caa cta cac ca 3 , methylated ( hmsh2 ) f 5 tcg tgg tcg gac gtc gtt c 3 r 5 caa cgt ctc ctt cga cta cac cg 3 , ? actin: forward: 5’ ctacgtcgccctggacttcgagc 3’ ß actin: reverse: 5’ gatggagccgccgatccacacgg 3’ , kras forward: 5 gactgaatataaacttgtggtagttggacct 3.reverse: 5 ctattgttggatcatattcgtcc 3. , braf forward: 5 tcataatgcttgctgatagga 3. reverse: 5 ggccaaaaatttaatcagtgga 3. , mthfr ( c677t ) ‘‘5 gcacttgaaggagaaggtgtc 3” and reverse primer ‘‘5 aggacggtgcggtgagagtg 3” , mthfr ( a1298c ) forward ‘‘5 ctt tgg gga gct gaa gga cta cta c 3” and reverse ‘‘5 cac ttt gtg acc att ccg gtt tg 3” primers. , total rna isolation mini kit ( from human skin tissue ) / rneasy fibrous tissue mini kit ( for rna extraction from human skin tissue ) ( qiagen ) per kit ( each kit pack is for 50 reactions ) , purospin™ fibrous tissue rna purification kit ( luna nanotech ) ( for rna extraction from human skin tissue ) per kit ( each kit pack is for 250 reactions ) , aurum™ total rna fatty and fibrous tissue kit ( biorad ) / mp biomedicals fastrna pro green kitper kit ( each kit pack is for 50 reactions ) , human leptin elisa kit per kit ( each kit pack is for 96 reactions ) , human adiponectin elisa kit per kit ( each kit pack is for 96 reactions ) , human adipsin elisa kit per kit ( each kit pack is for 96 reactions ) , human resistin elisa kit per kit ( each kit pack is for 96 reactions ) , human iron elisa kit ( serum iron ) per kit ( each kit pack is for 96 reactions ) , human ferritin elisa kit ( serum / ferritin ) per kit ( each kit pack is for 96 reactions ) , gdf15 human elisa kit per kit ( each kit pack is for 96 reactions ) , spexin human elisa kit per kit ( each kit pack is for 96 reactions ) , human pai 1 elisa kit per kit ( each kit pack is for 96 reactions ) , thyroid estimation kit per kit ( each kit pack is for 96 reactions ) , ice maker machine for laboratory purpose 1 unit , microwave gloves each packet contains one pair of gloves. , pcr mini cooler / coolcube microplate and pcr tube cooler each , pipette 0.5 10ul, 02 20ul, 10 100ul, 20 200ul and 100 1000ul. each , horizontal gel apparatus: 18 – 20 cm ( length ) x 25 – 30 ( breadth ) x 5 7.5 cm ( height ) , 40 60 samples, multichannel pipette compatible combs and gel caste each , mini horizontal gel apparatus: 9 cm w x 11 cm l with grooves ( 8.7 cm l x 1.2 cm h ) on the side for gripping the gel tray. it should have two comb slots on the same tray area. buffer capacity should be 600 ml for the buffer tanks and optimum gel runs with a fill line indicator for buffer levels along the unit side each , multi size forceps lab set each packet containsmulti size forceps lab set , liquid nitrogen sample storage tanks each , liquid nitrogen sample handling gloves each packet contains one pair of gloves. , slide tray / rack each , l mold each , tissue cassette steel each , electric tissue float bath ( thermostate ) each , coupling jar each pack contains 2 psc. , staining rack each , whatman filter paper grade 1 & 2 each packet contains 50 psc.. , harri’s hematoxylin powder 25 / 50 / 100 / 250 / 500 gm , yellow eosin powder 25 / 50 / 100 / 250 / 500 gm , coverslip 18x18 ( microscopic ) each packet contains 100 psc.. , dpx mount 100 ml / 250 ml , hot plate each , mx35 premier microtome blade ( 34 / 80mm ) 50 blades each box contains 50 psc.. , diamond point marker pen ( histopathology use ) each , embedding mold and embedding ring each , qiamp dna ffpe tissue kit ( 50 rxns ) , genomic dna purification kit ( promega ) , rna extraction kit from tissue , cdna synthesis kit , superscript ii rnase reverse transcriptase , sybr green pcr master mix , sodium bisulphite , page loading dye , formamide , n’n’ methylene bisacrylamide , ammonium persulfate , temed , polyacrylamide , wizard dna clean up system ( promega ) , 2 mercaptoethanol , silver stain , hydroquinone , urea , blotting paper , dna ladder 10 bp , pas stain , histopathology plastic cassettes , poly – l – lysine coated slides , deep well mortar and pestle homogenizers ( medium size ) , deep well mortar and pestle ( small size ) , rneasy minielute cleanup kit , phase – lock gel heavy5 prime phase – lock gel heavy5 prime , qiazol lysis reagent , rneasy minielute cleanup kit , cryo vial 1 pkt contains 50 psc. , deep well mortar and pestle ( small size ) ...

Department of Higher Education - Madhya Pradesh

34338126 bids are invited for boq bid autoclave , chromatrographic chamber , cod digestion apparatus , distillation apparatus double distillation borosilicate glass cap 5 liter , electronic balance 0 1 grm to 600 grm , heating mentle 2 lit 500 w , hot air oven 14 14 , melting point apparatus digital , paper chromatographytesting kit , rotary microtome with accessories ,soxhlet extraction apparatus with glass part , tdsmeter digital , thin layer chromatography kit ,water bath 6 holes total quantity : 34...

Directorate Of Medical Education - Madhya Pradesh

34145016 supply of medicine / surgical / iv fluid / surgical suture / surgical stapler / chemical kits aceborophylline 100 mg amantadine 100mg capsule apripitant capsule 125mg & 80mg calcitrol 0.25 mg cap calcitrol 0.5mg capsule calcitrol calcium carbonate and zinc capsule chloramphenicol 250mg capsule chloramphenicol 500mg capsule crizotinib 250mg capsule cyclosporine 100 mg cyclosporine 50 mg deferiprone 500 mg cap. imatinib mesylate 100 mg oseltamivir ( 45mg ) , capsule palbociclib 100 mg cap palbociclib 75 mg cap sildenafil 20mg tetracycline capsules 250 mg tetracycline capsules 500 mg ulipristal acetate capsules 5mg acyclovir 3% ear drop beclomethasone ( 0.025% ) + clotrimazole 1% +neomycin sulphate 0.5% 5 ml ear drop fluromethanol eye drop gentamycin eye drop homatropine hydrobromide eye drop ip 5ml sterile lignocaine hcl 4% eye drop natamycin eye drop polyethelene glycol 400 & propylene glycol ophthalmic solution 10ml polyvinyl alcohol 1.4% 5 ml prednisolone eye / drop. proparacaine hydrochloride 0.5% eye drops 5ml sodium chloride opthalmic solution 5% eye drop acyclovir 3% eye oint.5 gm tube atropine eye oint. 3gm tube chloramphenicol eye ointment 5 gm tube ciprofloxacin eye ointment 5 gm tube hydroxypropylmethylcellulose 2% w / v ophthalmic solution ocular lubricant 5gm ointment tobramycin eye oint.3gm tube benzocain gel chlorhexadine gel choline salicyclic gel triamadone accetate gel sterile collogen granules nephro steril ( alanine 6.3 gm+l arginine 4.9 gm+l histidine 4.3 gm+l isoleucine 5.1 mg+l leucine 10.3 mg+l lysine 10.01 gm+l phenylalanine 3.8 gm+l threonine 4.8 gm+l valine 6.2 gm+methionine 2.8 gm+n acetylcarnosine 0.5 gm+proline 4.3 gm+serine 4.5 gm+tryptophan 1.9 gm ) 250ml infusion normal saline 1.6% 500 ml bottle parenteral nutrition two chamber bags without lipid ornidazole iv infusion 100ml bottle ringer lactate i / v 0.24 % v / v of lactic acid ( eq. to0.32% w / v of sodium lactate ) , 0.6 % w / v sodium chloride, 0.04 %w / v potassium chloride and 0.027 % w / v calcium chloride 500 ml ffs bottle ringer lactate i / v 0.24 % v / v of lactic acid ( eq. to0.32% w / v of sodium lactate ) , 0.6 % w / v sodium chloride, 0.04 %w / v potassium chloride and 0.027 % w / v calcium chloride 500 ml glass bottle sodium chloride hyper tonic n / 2 ( 0.45% ) 500 ml ffs bottle sodium chloride ( 1 / 2 n ) + dextrose 0.45% + 5% 500 ml ffs bottle desflurane 240ml bottle solution usp inhalation anaesthetic adalimumab 20mg / 0.4ml inj adalimumab 40mg / 0.8ml inj adenosine 3 mg / ml 2 ml amp ado trastuzumab emtansine 100 mg inj alteplase 50mg inj amidotrizoate meglumine; sodium amidotrizoate ( 76% ) dye 50 ml bottle aminophylline 25 mg / ml 10 ml vial ampicillin+sulbactum 1.5 mg inj anti d. immunoglobulin ( monoclonal ) ( 150mcg / vial ) human anti d, anti d. immunoglobulin ( monoclonal ) ( 300mcg / vial ) , human anti d anti human thymocyte immunoglobulin 25 mg anti scorpion venom inj <120mg total protein and >150 ld50 [ mouse ] neutralizing units / vial benfothiamine + folic acid + mecobalamin + pregabalin + vit b6 inj benzathine penicilline 12 lac iu / vial betamethasone sodium phosphate 4 mg / ml 1 ml amp biphasic insulin aspart ip penfill 100 iu inj 3 ml cartridge bortezomib 3 .5 mg / vial botalinin 100iu inj botalinin 200iu inj botulinum toxin type a injection buprenorphine hydrochloride 0.3mg base / ml 1ml amp inj butorphanol 1mg / ml 1ml amp carboprost tromethamin 250 mcg / ml 1ml amp cefuroxime 1.5gm inj cefuroxime 500mg inj cetuximab 100mg 2mg / ml vial cetuximab 200mg 2mg / ml vial cetuximab 50mg 2mg / ml vial chloramphenicol 500mg inj chlorpromazine ip 25mg vial cholecalciferol 600000 iu / ml injection cis atracurium 2mg / ml vail cladribine 10 mg / 10ml inj clonidine hydrochloride 100 mcg / ml 10 ml vial contrast urograffin inj cytarabine 1000 mg iv cytarabine 100mg injection cytarabine 1gm inj daunorubicin 50 mg / vial dexamethasone sodium phosphate ( 8mg / 2ml ( 2ml vial ) dextron 40 inj diatrizoate meglumine & diatrizoate sodium ( 37% ) vial diatrizoic acid 60% amp diatrizoic acid 65% amp diatrizoic acid 76% ( urographin dye ) injection diazepam 5 mg / ml 2 ml amp dicyclomine 10mg / ml 2 ml vial digoxin i.p. 0.5mg / 2 ml amp diltiazem 25mg / 5ml vial diphtheria antitoxin 1000 iu vial doxorubicin 500mg injection doxycyclin 100 mg injection edaravone 60 mg inj enalapril maleate inj 1.25 mg per ml 2ml vial ephedrine 30mg / ml 1ml inj esmolol / 40mg / ml 5 ml vial etanercept 25mg inj etanercept 50mg inj etomidate 2 mg / ml emulsion with mct 10ml vial fentanyl 100 microgran 2 ml amp fentanyl 50 microgran 2 ml amp fluorescein 20% 5 ml amp flupentixol 20 mg inj flupentixol 25 mg inj fluphenazine 25 mg / ml 1 ml amp ganciclovir 500 mg vial gas gangrene antitoxin 10, 000 iu / ml 40000 iu 4ml amp gatifloxacin vial gentamycin 80mg / 2ml amp glutathion 600mg inj granulocyte colony stimulating factor ( gcsf ) inj haemocoagulase 1 iu inj haemophilus influenzae type b vaccine hepatitis b vaccine / 1ml hyaluronidase 1500 iu / 2ml amp ifosfamide + mesna 1gm inj infliximab 100mg inj insulin glargine injection iohexol ( non ionic contrast medium in sterile aqueous solution ) 300 mg iodine / ml 100 ml bottle isobaric levobupivacaine 0.5% inj isoprenalin inj 1ml amp isoxsuprine hcl 5mg / ml 2ml amp ketamine hydrochloride 50 mg / ml 10 ml ketoprolac tromethamine 30 mg inj l aspiraginase 10000iu inj leuprolide 6.25mg inj levobupivacaine hyperbaric 0.5% lidocaine 4%, 5 ml vial lignocaine ( preservative free ) 2% 50 ml vial lignocaine 10% injection lignocaine 4% 30 ml vial lignocaine for spinal anaesthesia lignocaine 5% + destrose 7.5% 2 ml amp heavy lorazepam 2 mg / ml, 1 ml vial low molecular weight dextran 40000 vial mannicoccal acwy 0.5 ml inj meningococcal polysaccharide vaccine groupe a, c, y and w 135 combined vial mephentermine 30 mg / ml 10 ml mesna 200mg injection methacarbamol 100 mg. / 10ml vial methotrexate 500mg injection metoprolol 5mg / ml 5ml vial micafungin 100 mg micronised progesterone 50mg / ml 2ml amp micronized progesterone 100mg / ml 2ml amp milrinone 1mg / ml solution for injection / infusion mitomycin c 40mg inj mitoxantrone 15 mg inj morphine sulphate 10mg / ml 1ml amp naloxone 0.4 mg / ml, 1 ml nikethamide amp nimodipine 10mg / 50ml injection nitrofurantoin injection olanzapine 10 mg inj olanzapine depot inj panitumumab 100mg / 5ml inj pembrolizumab 100mg / 4ml ( 25mg / ml ) penicillin v 125 mg inj pentoxiphylline 20 mg / ml pertuzumab 30mg / ml ( 420mg / 14ml ) phenobarbitone 100mg / ml 1ml amp. phenobarbitone 200mg / ml 1ml amp. pilocarpine 0.5 % / 1ml amp piperacillin 2 gm+tazobactam 250 mg placenta extract 2 ml injection pneumococcal vaccine 10 ml vial pregabalin inj progesterone b.p.100mg vial promethazine 2 ml / 2.5% vial protamine sulphate 1%, 10mg / 5ml amp quinine sulphate 300 mg / ml, 2 ml amp romiplostim 250 mg injection romiplostim 500 mg injection ropivacaine 0.5% 20 ml vial ropivacaine 0.75% 4ml amp ropivacaine 10mg / ml 2.5ml vial ropivacaine hydrochloride 0.2% 40mg / 20ml vial ( 2mg / ml ) ropivacaine hydrochloride 0.75% 150 mg / 20 ml vial ( 7.5mg / ml ) sargramostim 500 mg inj soluble insulin penfill 3 ml injection surfactant ( porcine lung surfectant extract 80mg / ml ) terbutaline 0.5mg / ml aml amp teriparatide 600mcg 3 ml amp tetanus immunoglobulin usp 500 iu / vial thiamine 400mg inj thiamine hydrochloride inj.100mg / ml 2ml vial multiple dose ( vit.b1 ) thiopentone sodium 0.5gm powder / vial, 20 ml vial tobramycine 80 mg vial tocilizumab 400 mg inj torsemide inj 2ml amp trypan blue opthalmic solution 0.06% pre filled syringe ulinastatin 100000iu injection urokinase 500000 iu vial vasopressine 40 iu / ml amp verapamil hydrochloride 2.5 mg / ml 2ml amp vinblastine 10 mg / 10 ml amp vinorolbine 50mg inj vit d3 injection vit. cynocobalamin 500mcg +folic acid 15mg+niacinamide 200 mg + ascorbic acid inj vit. cynocobalamin 500mcg +folic acid 15mg+niacinamide 200 mg inj vit. methylcobalamin 1500 mcg +folic acid 0.7mg+ niacinamide 12 mg inj water for injection 10 ml amp zuclopenthixol acuphase 50 mg inj zuclopenthixol decanoate 200 mg inj acetic acid solution 3% 100ml acetone detection kit ada kit ae 1 / ae 3 aluminium ammonium sulphate powder 500gm amacr ana test kit anti a lactin 05ml anti ab sera 10ml anti d igg+ igm 10ml anti d igm 10ml anti h lactin 05ml anti her / erbb2 monoclonal anti human globulin ( ahg ) 05ml anti a sera 10 ml anti b sera 10 ml banded use in blood bank barium chloride 10 % 500 ml bcl 2 benedict reagent 5 lit cane bismark brown stain 100 gm blood culture media aerobic for adult ( bac t / alert pf plus blood culture media anaerobic for pediatric ( bac t / alert pf plus ) blotting paper 50 / pkt bovine albumin 22% 05ml buffer solution for hiv 50ml ca 125 calcium chloride 05ml / vail capillary tube cd34 combined spinal epidural ( cse ) kit couplin jar cover slips size 18x18mm cover slips size 22x22mm cox 2 csf protein kit cyclin d 1 cyto fix spray desmin disposable microtome blade ( 50 blades in one ) dpx mount 250ml ehlrich aldehyde reagent 125 ema estrogen receptor epi monoclonal filter paper 12.5 cm 0.1 micron ( 50 per pkt ) fouchet reagent 250ml glacial acetic acid 100 ml glial fibrillary acidic protein ( gfap ) h2so4 25 % 500 ml bottle haematoxylene 5gm haemoglobin strip hbv elisa test kit 4th generation 96 test hbv rapid test kit hpr polymerr kit with dab chromogen hydro chloride acid about 36.46% i.d. microtyping abd card i.d. microtyping gel card ahg immersion oil iso propyl alcohol ki67 / mib 1 06 ml antibody kit leishman stain 500 ml leucoreductionfilter ( bed side ) light green stain 100 gm liquid ammonia 500 ml liss diluent for gel card malaria parasite elisa test kit massons trichrome stain mercuri oxide 25gm methanol 2.5lit mgg 480ml multi parameter urine strips ( 100 in 1 box ) myogenin n / 10 hcl 500ml nfp nitric acid 500 ml nkx 3 1 p 53 pandys reagent 125ml pap pen papanicalou ea 125ml pea 030 papanicalou og 6 125ml pea 010 paraffin wax 58 60c pas stain pasture pipette poly l ltsin solution p8920 polythene gloves pricking lancet progestron receptor monoclonal retic stain 125ml s 100 sharp collection containers disposable 5 ltrs sharp collection containers disposable 1.5 ltrs single donor platelet kit make haemonotics / terumo penpol ( close system ) slide tray sma sodium chloride for analysis steel cassets for tissue processing sulpgar powder 500 gm sulpho salicylic acid 500ml synaptophysin tips for auto pippets ( 2 to 100 micron yellow 1000 / pkt ) tips for auto pippets ( 200 to 1000 micron blue 500 / pkt ) tissue paper roll titriplexiii pure ( edta ) tris buffer gr tween 20 for synthesis vdrl elisa test kit vimentin wafers cutting blade for tube welders xylene chlorhexidine mouthwash 0.2% 50 ml sterile haemocoagulase solution topical solution 0.2 cu nasal drop saline nasal gel 15 gm tube budesonide nasal spray 32mcg / spray methylcobalamin nasal spray 250 mcg saline nasal wash 3gm kit sodium chloride nasal wash betamethasone 0.5mg, gentamicin 1mg betamethasone valerate cream 0.05% 15gm betamethasone valerate ointment 0.1%, 15 gm tube centella asiatica extract based skin moisturization and antiscar gel 30gm clindamycin ointment 10gm fluconazole ointment 20 gm tube fusidic acid 2%, 15 gm heparin 20gm oint human placental extract ointment ketoconazole cream lidocaine zinc oxide ointment luliconazole cream la magnesium sulphate, sulphacetamide, urea, proflavin ( in glycerine base ) ointment75 gm neomycin sulphate 5 mg + bacitracin zinc 500 iu / gm, 15 gm papain urea and silk protein based debriding ointment and cream 100 gm papain urea and silk protein based debriding ointment and cream 25 gm papain urea and silk protein based debriding ointment and cream 50 gm papain urea 15 gm tube povidone iodine ointment 7.5%, 500 gm salicylic acid 2%, 30 gm silk protein based antimicrobial wound healing ointment loaded with asiaticoside and silver 100 gm silk protein based antimicrobial wound healing ointment loaded with asiaticoside and silver 25 gm silk protein based antimicrobial wound healing ointment loaded with asiaticoside and silver 250 gm silk protein based antimicrobial wound healing ointment loaded with asiaticoside and silver 50 gm silver sulphadiazine cream usp 1% w / w 250gm clotrimazole+beclomethasone oral paint triamcinolone oromucosal paste bp 0.1% ketocanazole oral paste triamcinolone acetonide dental paste usp 0.1% barium sulphate powder 250 gm clotrimazole powder neomycin sulphate+polymycin b powder polyethylene glycol + electrolyte powder protein powder silk protein and antimicrobial nano silver based surgical particle wound dressing 5ml vial n acetylcysteine solution for inhalation respules tiotropium ( 18 mcg ) + formoterol ( 12 mcg ) fostomycin sachet 3gm orodispersible probiotic sachet acyclovir lotion beclomethasone lotion citric acid 500 ml bottle compound benzointincture, benzoin, aloe, storax, tolu balsam and enough alcohol to make a tincture ( 74 80% alcohol ) , 100 ml feracrylum solution 1% 100 ml gention violet l / a glycerine 15% and sodium chloride 15% enema 20ml sodium hypochloride solution 5% 5 ltr topical heparin solution 5ml vial benzocaine +cetramide spray lignocaine spray 10% absorbable 2 0 endo suture cartridge 48 length advance rf energy hand instrument of 5 mm shaft diameter for laproscopic procedures with shaft length 35 cm and should be both hand and foot activated. compatible with ultrasonic vessel sealing dissector system installed in myh advance rf energy hand instrument of 5 mm shaft diameter for open procedures with shaft length 14 cm and should be both hand and foot activated. compatible with ultrasonic vessel sealing dissector system installed in myh circular stapler for end to end anastomosis with 31 mm diameter having varied staple height of 3.5 4 4.5mm circular stapler for end to end anastomosis with 31 mm diameter having varied staple height of 4 4.5 5mm circular stapler for end to end anastomosis with 33 mm diameter having varied staple height of 3.5 4 4.5mm circular stapler for end to end anastomosis with 33 mm diameter having varied staple height of 4 4.5 5mm disposable circular stapler 31mm diameter disposable circular stapler – 32mm diameter disposable circular stapler 33mm diameter disposable circular stapler iii rows disposable circular stapler 25 / 26mm diameter disposable circular stapler 28 / 29mm diameter disposable clip applier medium 10mm with 20 clips disposable clip applier medium 5mm with 16 clips disposable curved cutter stapler disposable hemorrhoidal stapler iiirows disposable hemorrhoidal stapler with detachable anvil. disposable linear stapler with fixed staple height 75mm 90mm size disposable linear stapler with fixed staple height 55mm 60mm size disposable trocar 05mm disposable trocar 10mm disposable trocar 12mm disposable trocar 15mm distal tip closure titanium ligation clip large size distal tip closure titanium ligation clip medium size distal tip closure titanium ligation clip small size endoscopic cutter & stapler 60mm long length endoscopic cutter & stapler 60mm regular length endosuturing device 10mm with toggle lever handpiece ( blue ) compatible with ultrasonic vessel sealing dissector system installed in myh handpiece ( transducer ) compatible with ultrasonic vessel sealing dissector installed in myh hemorrhoid stapler 33.5 mm diameter with detachable anvil, bridged anoscope, housing of 20 cc locking clip cartridge medium / large mesh fixation device with non absorbable titatinum tacks 20 multifire clip applier long size 15 clip multifire clip applier small size 20 clip non absorbable 2 0 endo suture cartridge 48 length open clip applicator 100 20cm length open clip applicator 200 20cm length open clip applicator 300 open clip applicator 400 open disposable clip applier for medium clip size 9.75 having 20 clips open linear cutter reload with 3 rows of staple line having varied satple height of 3.5 4 4.5 mm in reload having 60mm length open linear cutter reload with 3 rows of staple line having varied satple height of 4 4.5 5 mm in reload having 60mm length open linear cutter stapler compatible with 3 rows of staple line having varied satple height of 3.5 4 4.5 mm in reload having 60mm length open linear cutter stapler compatible with 3 rows of staple line having varied satple height of 4 4.5 5 mm in reload having 60mm length plastic locking clip applicator medium / large polycearbonte bladeless trocar with reducer seal 10mm polycearbonte bladeless trocar with reducer seal 12mm polycearbonte bladeless trocar with reducer seal 5mm polyproplene with polyglecaprone 25 partially absorbable mesh 7.6cm x 15cm polyproplene with polyglecaprone 25 partially absorbable mesh 10cm x 15cm reload 55 60mm for medium thick tissue blue compatible with linear cutter. reload 55 60mm for thin / vascular tissue white compatible with linear cutter. reload 75 80mm for medium thick tissue blue compatible with linear cutter. reload 75 80mm for thick tissue green compatible with linear cutter. reload compatible with curved cutter reload endoscopic cutter & stapler 45mm purple reload endoscopic cutter & stapler 60mm purple reload endoscopic cutter & staplter 45mm blue reload endoscopic cutter & staplter 45mm green reload endoscopic cutter & staplter 60mm / black reload endoscopic cutter & staplter 60mm blue reload endoscopic cutter & staplter 60mm gold reload endoscopic cutter & staplter 60mm green reload endoscopic cutter & staplter 60mm white reload for linear stapler with fixed staple height 35mm 45mm size blue reload for linear stapler with fixed staple height 35mm 45mm size green reload for linear stapler with fixed staple height 55mm 60mm size blue reload for linear stapler with fixed staple height 55mm 60mm size green reusable laparoscopic clip applicator for large titanium clips with 15cm 20cm length reusable laparoscopic clip applicator for large titanium clips with non detachable jaw assembly reusable laparoscopic clip applicator for large titanium clips. reusable laparoscopic clip applicator for medium large titanium clips with 28cm 30 cm length reusable laparoscopic clip applicator for medium large titanium clips with non detachable jaw assembly reusable linear cutter 55 60mm with 200 firing reusable linear cutter 75 80mm with 200 firing single use clip applier with 16 clips, 5mm diameter having display counter instrument u shaped clip suture locking autolock titanium clip 100 titanium clip 400 universal reload cartridge for 55 mm / 75mm new linear cutter for tissue thickness ranging from 1 mm to 2 mm with 6 rows of staples 3 on either side of cut line, 440 grade stainless steel knife integrated in the cartridge , 88 titanium staples / 118 titanium staples. universal stapler 55mm / 75mm new linear cutter along with staple height selector and 3d staple technology with ambidextrous firing with 6 rows of stapler height range of 1.5 mm to 2.00 m. paracetamol suppository abdominal drain no 8 abdominal drain bag accessory spikes amorphous hydrogel with colloidal silver antimicrobial , liquid parafin based silver sulphate antiseptic tulle 10cmx12cm antimicrobial incise drape 3 meter antimicrobial, liquid paraffin based chlorhexidien antiseptic tulle 10cmx12cm arterial pressure bag 1000ml arterial pressure bag 500ml ash brace m size barium sulphate liquid 1 liter bionet connector biopsy forceps type with / without spike / hot biopsy, length : 110cm / 160 cm / 210 cm, sterile for single use only, diameter – 1.8 mm / 2.5 mm as ordered bipolar forceps cable bis monitor electrode black monofilament 2 / 0 rc loop black thread ( stitching ) big bleaching powder gr ii 25 kg bag blood bag double 350 ml cpd solu blood bag double 350 ml with sagam blood bag quadruple 350 ml top bottom with cpd sagam solu blood bag quadruple 450 ml top bottom with cpd sagam solu blood bag single 350 ml blood bag transfer 350 ml blood bag triple 350 ml blood bag triple 350 ml sagam blood culture bottles bone marrow aspiration needles ( 14 ) bone marrow aspiration needles ( 15 ) bone marrow aspiration needles ( 16 ) bone marrow aspiration needles 13 g bone marrow biopsy needle bp cuff adult & pediatric carbolic acid 500 ml cardiovascular angiographic catheter 100cm, 4fr ( 1.35mm ) catheter single lumen 6.6 no catheter single lumen 7.7 no cautery patient plate disposable central venous line 4f cerebral catheter reservoir 12mm dia chamber cerebral catheter reservoir 18mm dia chamber cervical soft collar chlorhexidine gluconate dressing material chlorinated lime with boric acid solution 400ml cling drape 15x500cm closed suction trachostomy suction tube with pro s collegen patch collogen sheet 10x10 collogen sheet 15x15 colostomy kit condom catheter small, meadium, large conjugated drain craniotomy cutter blade cresol with soap solution 5ltr jar cvp manometer cylinder connection nut dermatome blade disposable haemorrhoidal circular stapler with dual safety with transparent housing size 34 dj stent 6 / 26 double monitoring pressure transducer dry collagen patch , non adhesive absorbalbe porus lyophilized fish origin collogen 10x10cm. dry collagen patch , non adhesive absorbalbe porus lyophilized fish origin collogen 30x30cm. dura guide for neuro surgery ecg paper 80mmx20 mtr roll ecg paper computerized triple channel 20m elastomeric pump for post operative analgesia endo stich lap suturing device 10 mm endotracheal tube with secondary lumen for surfactant therapy, size 2, 2.5, 3, 3.5, 4, 4.5 exchange transfusion catheter with four way adaptor size 4cm, l 40 cm extra ventricular drain ( evd ) fibrin & tissue glue fluorescein strips pkt foam sclerotherapy fibre fogartis catheter 4 fr gasket for vaccume jar 1000 ml gasket for vaccume jar 600 ml gasket for humidifier bottel guide wire m 0.89mm, 150cm halogen bulb holder ( heavy duty ) hemodialysis fluid for bicarb made ( part a 10 ltr + part b 500gm ) hip u drape humbys knife disposable blade hydrocephalus shunt medium pressur ( vp shunt ) hydrogen peroxide 21% w / w, paracetic acid 4% w / w, acetic acid 10% w / w ( cold st disinfectant for dialysis ) icd bag implantable pain port with epidural catheter for long term pain management impregnated antimicrobial latex two way foleys catheter with silicon coated.it should be impregnated with silver nano particles to prevent catheter associated uti and catheter blockage should have strong drainage funnel, double fixed non return valve for free inflation and deflation. size 14 balloon capacity between 1ml to 30ml, 50ml impregnated antimicrobial latex two way foleys catheter with silicon coated.it should be impregnated with silver nano particles to prevent catheter associated uti and catheter blockage should have strong drainage funnel, double fixed non return valve for free inflation and deflation. size 16 balloon capacity between 1ml to 30ml, 50ml impregnated antimicrobial latex two way foleys catheter with silicon coated.it should be impregnated with silver nano particles to prevent catheter associated uti and catheter blockage should have strong drainage funnel, double fixed non return valve for free inflation and deflation. size 18 balloon capacity between 1ml to 30ml, 50ml impregnated antimicrobial latex two way foleys catheter with silicon coated.it should be impregnated with silver nano particles to prevent catheter associated uti and catheter blockage should have strong drainage funnel, double fixed non return valve for free inflation and deflation. size 20 balloon capacity between 1ml to 30ml, 50ml impregnated antimicrobial latex two way foleys catheter with silicon coated.it should be impregnated with silver nano particles to prevent catheter associated uti and catheter blockage should have strong drainage funnel, double fixed non return valve for free inflation and deflation. size 22 balloon capacity between 1ml to 30ml, 50ml impregnated antimicrobial latex two way foleys catheter with silicon coated.it should be impregnated with silver nano particles to prevent catheter associated uti and catheter blockage should have strong drainage funnel, double fixed non return valve for free inflation and deflation. size 24 balloon capacity between 1ml to 30ml, 50ml impregnated antimicrobial latex two way foleys catheter with silicon coated.it should be impregnated with silver nano particles to prevent catheter associated uti and catheter blockage should have strong drainage funnel, double fixed non return valve for free inflation and deflation. size 26 balloon capacity between 1ml to 30ml, 50ml intraocular lens 14 30d dioptre intravenous drip set pediatric size introducer sheath 0.97mm 6fr, ( 2.0mm ) , 11 cm introducer sheath 0.97mm, 7 fr, ( 2.3mm ) , 11cm j r c bag 1 ltr j r c bag 1.5 ltr j r c bag 1 / 2 ltr 500ml kehr t tube laser radial fibre 600 micron and 400 micron liga clip 200mm, 300mm, 400mm liver biopsy gun long length quincke spinal needle for pain management, size – g 22, length – 120mm & 150mm mackintosh double colour water proof roll ( 20 meter per roll ) malecot rubber catheter no 12 malecot rubber catheter no 16 malecot rubber catheter no 20 malecot rubber catheter no 22 malecot rubber catheter no 24 medical dry imaging film 10x12 medical dry imaging film 14x17 medical dry imaging film 8x10 methacrylate based oxygen permeable non adherent 3 dimensional transforming powder dressing size 4 x 4 microlaryngeal surgery tube no 5 monopolar cautry wire disposable neonatal urine collection and measurement bag 100 ml omaya reservoir large size oxygen adaptor 5 type oxygen catheter oxygen connection with flow meter for central line oxygen connection with flow meter for cylinder oxygen high pressure hose pipe oxygen penal regulator for oxygen liquied tank ( 1 25 kg ) oxygen regulator for control penal board ( oxygen pipe line ) oxygen tailpipe ( flexible metalic ) pacing leads 6 fr paediatric double lumen polyurethan cvc line, 3 fr, l 10cm, 15cm, paraffin gauze dressing material 10x10cm pediatric diapers peritonial dialysis catheter 200mm pediatric peritonial dialysis catheter 280mm adult peritonial dialysis fluid 1ltr. pigtail catheter 6 fr ( 150 cm ) pigtail catheter with needle 6 fr ( 30 cm ) plaster of paris powder ip 1 kg pkt plastic nozel cap post exposure prophylaxis kits ( pep kits ) pressure regulated v p shunt for peadtric probe for oxygen radiopaque polyurethane catheter with fixation wings and integral extension tube 2f, 5f ( leader flex ) rectified sprit 4.5 ltr. scrotals support short pencil point spinal needle g 25 / 22, l 38mm. sics kit ( small incision cataract surgery ) silicon / double nasal prong with universal connector. all sizes silicon cautery plate silicon folyes catheter 14 fr silicon folyes catheter no 12 silicon tubing set for endoflaton silk protein and antimicrobial nano silver based sterile surgical wound dressing sheet 10 cmx 25 cm silk protein and antimicrobial nano silver based sterile surgical wound dressing sheet 20 cmx 25 cm silk protein and antimicrobial nano silver based sterile surgical wound dressing sheet 20 cmx 40 cm silk protein and antimicrobial nano silver based sterile surgical mesh wound dressing 10 cmx 25 cm silk protein and antimicrobial nano silver based sterile surgical mesh wound dressing 20 cmx 25 cm silk protein and antimicrobial nano silver based sterile surgical mesh wound dressing 20 cmx 40 cm silk protein based sterile surgical wound dressing sheet 20 cmx 40 cm silk protein based sterile surgical pu foam dressing 20cmx20cm silkolatex nasopharyngeal airway, with adjustable flange and widen end. sterilized sizes 20, 22, 24, 26, 28, 30, 32, 34, 36 fr soda lime for anesthesia workstation 5kg spatula for papsmear sterilant cold disinfectant for dialysis containing peraetic acid hydrogen peroxide acetic acid 5 ltr. sterile post‐operative surgical dressing surgical kit drape gown t.piece circuit with oxygen tubing set ( complete set ) tear test strip ( 100 strips in box ) terrimo guide wire thomas splint tmt graph paper tommy syringe tounge depresser wooden tracheostomy filter transducer set for invasive b.p. triway folyes catheter no 22 turp set ureteric catheter urine collecting bag with urometer 1 ltr. vaccum adaptor 5 type vaccum pump belt vaccum pump oil vaccum regulator ventilator circuit ( heated wire ) ventilator mask water bed wipes wound protector extra small incision size 2 4 cm wound protector large incision size 9 14 cm wound protector large incision size 9 14 cm with retraction ring wound protector medium incision size 5 9 cm wound protector small incision size 2.5 6 cm x ray casset 12x15 x ray casset 10x12 x ray casset 8x10 x ray developer 22.5 lit. x ray films size 10x12 50film per pkt blue sensitive x ray films size 12x15 50film per pkt blue sensitive x ray films size 8x10 50film per pkt blue sensitive x ray fixer 22.5 lit x ray hangers ( clip type ) 10x12 x ray hangers ( clip type ) 12x15 x ray hangers ( clip type ) 8x10 x ray screen high speed 12x15 x ray screen high speed 8x10 x rayscreen high speed 10x12 180 absorbable polyglyconate knotless wound closure device with unidirectional 0 30cm , green 37mm 1 / 2 circle taper point 180 absorbable polyglyconate knotless wound closure device with unidirectional 2 0 30cm , green 37mm 1 / 2 circle taper point 3 dimentional polyester mesh with micro porosity, x stich macro porosicty and multidirectional elasticity with optimesed atello collagen 1 absorbable anti adhesive barrier 12cm 3 dimentional polyester mesh with micro porosity, x stich macro porosicty and multidirectional elasticity with optimesed atello collagen 1 absorbable anti adhesive barrier 15cm 3 dimentional polyester mesh with micro porosity, x stich macro porosicty and multidirectional elasticity with optimesed atello collagen 1 absorbable anti adhesive barrier 20cm 5 mm helical shaped non absorbable titanium tacker for laproscopic mesh fixation device with 30 tacks 5 mm screw shaped polyglycolic lactic acid absorbable tacker for laproscopic mesh fixation fevice with min 30 tacks absorbable gelatin based topical absorbable flowable hemostat with 6cc syringe pre filled with hemostatic matrix. with 14.3 cm white applicator tip & 14.6 cm blue flexible applicator tip absorbable intraperitoneal umbilical patch of polyester mesh with collagen barrier and having absorbable pgla expanders with size 6 cm circle fda approved absorbable intraperitoneal umbilical patch of polyester mesh with collagen barrier and having absorbable pgla expanders with size 8 cm circle, fda approved absorbable unidirectional barbed device polydioxanone size 1, 40 mm 1 / 2 circle taper point needle 45 cm absorbable unidirectional barbed device symmetric anchoring pattern, triclosan coated polydioxanone size 1, 40 mm 1 / 2 circle taper point needle 45 cm absorbable unidirectional barbed device, symmetric anchoring pattern, triclosan coated polydioxanone, size 1, 36mm 1 / 2 circle taper point needle, 45 cm black braided silk 2 0 rb 5333 suture 17mm 1 / 2c taper black braided silk 3 0 rb suture 17mm 1 / 2c taper black braided silk 5 0 rb suture 17mm 1 / 2c taper black braided silk eyeless needled suture usp, size 8 0 suture length 76cm, needlelength & description 3 / 8 circle round bodied 30mm blackbraided silk eyeless needled suture usp, size 6 0 suturelength 76cm, needlelength & description 1 / 2 circle round bodied 30mm bovine collagen and glycosaminoglycan ( chondroitin 6 sulfate ) and silicone layer ( bilayer ) dermal regeneration template 2 in x 2 in bovine collagen and glycosaminoglycan ( chondroitin 6 sulfate ) and silicone layer ( bilayer ) dermal regeneration template 4 in x 10 in bovine collagen and glycosaminoglycan ( chondroitin 6 sulfate ) and silicone layer ( bilayer ) dermal regeneration template 4 in x 5 in bovine collagen and glycosaminoglycan ( chondroitin 6 sulfate ) and silicone layer ( bilayer mashed ) mashed dermal regeneration template 2 in x 2 in bovine collagen and glycosaminoglycan ( chondroitin 6 sulfate ) and silicone layer ( bilayer mashed ) mashed dermal regeneration template 4 in x 10 in bovine collagen and glycosaminoglycan ( chondroitin 6 sulfate ) and silicone layer ( bilayer mashed ) mashed dermal regeneration template 4 in x 5 in braided synthetic absorbable eyeless needled suture usp code 2423, size 1 0 suture ( os ) copolymer of glycolied and e caprolactone, 1 0 ct 1 needle and 45cm suture length unidirectional spiral. copolymer of glycolied and e caprolactone, 2 0 ct 1 needle and 45cm suture length unidirectional spiral. copolymer of glycolied and e caprolactone, 3 0 rb 1 needle and 20cm suture length unidirectional spiral. copolymer of glycolied and e caprolactone, 3 0 rb 1 needle and 45cm suture length unidirectional spiral. knotless wound closure device with unidirectional 2 0 45cm , undyed 24mm 3 / 8 circle reverse cutting knotless wound closure device with unidirectional 3 0 58cm , undyed 24mm 3 / 8 circle reverse cutting macro porus partially absorbable mesh made up of approximately equal parts of polypropylene monofilament fiber ( 6 0 ) and poliglecaprone 25 monofilament fiber ( 5 0 ) with pore size 2.7 mm having a weight of 39 g / m2 and containing blue orientation stripes of polypropylene. 15cmx15cm monofilament glycomer 0, 90cm , violet 40mm 1 / 2 circle taper point monofilament glycomer 1 , 90cm , violet 40mm 1 / 2 circle taper point monofilament glycomer 2 0 , 75cm , violet 27mm 1 / 2 circle taper point monofilament glycomer 3 0 75cm , undyed 24mm 3 / 8 circle reverse cutting monofilament glycomer 3 0 75cm , violet 22mm 1 / 2 circle taper point patient return electrode with current limiting nature & hence eliminate patient pad site burns based on capacitive coupling principle & made of akton polymer can be used for all patient’s weight >350 grams, radiolucent & latex free, no adhesive related irritation to patient skin.can be used any side up for easy handling in or and us fda approved compatible to any electrosurgical generator, size: 36” l x 20”w x 1 / 8”thickness. perforator 14mm pistol grip curved coagulating shears with ergonomic handle in the following shaft length 36cm. can seal blood vessel up to and including 5mm in diameter compatible with ultrasonic vessel sealing dissector system polydioxanone 122cm , no 1 size loop sgle with 65 mm needle and 1 / 2 circle tp needle. polydioxanone barbed suture 1 0 polydioxanone suture voilet monofilament 17mm 1 / 2c taper no 4 0 90cm polydioxanone suture voilet monofilament 40mm 1 / 2c blunt point 1 240cm polydioxanone suture voilet monofilament double armed trocar point 2 0 70cm polydioxanone suture clear monofilament 36mm 1 / 2c taper 3 0 70cm polydioxanone suture voilet monofilament 17mm 1 / 2c 5 0 70cm polyglactin 4 0suture undyed braided 1 / 2c reverse cutting polyglactin 910 with triclosan no. 0 x 90 36mm hc rb polyglactin 910 with triclosan no. 1 x 100 55mm hc rb polyglactin 910 with triclosan no. 1 x 90 36mm hc tc progrip self fixating mesh 12*08cm progrip self fixating mesh 14*9cm progrip self fixating mesh 15*15cm progrip self fixating mesh 20*15cm progrip self fixating mesh 30*15cm protective disk with chg hydrophilic polyurethane absorptive foam with 92 g chlorhexidine gluconate ( chg ) 1 disk ( 2.5 cm ) 7mm center hole with radial slit usfda approved protective disk with chg hydrophilic polyurethane absorptive foam with 92 g chlorhexidine gluconate ( chg ) 1 disk ( 2.5 cm ) 4.0 mm center hole with radial slit usfda approved scissor grip curved coagulating shears with curved tapered tip for precise dissection and with 240 degree activation triggers that support multiple hand position in the following shaft length 17cm. can seal blood vessels up to & including 5mm in diameter with ultrasonic vessel sealing dissector . self gripping polyester / polypropylene monofilament mesh pre cut with pla grips with size 14 x 09 cm for left side , fda approved self gripping polyester / polypropylene monofilament mesh pre cut with pla grips with size 14 x 09 cm for right side, fda approved self gripping polyester / polypropylene monofilament mesh pre cut with pla grips with size 12 x 08 cm for left side, fda approved self gripping polyester / polypropylene monofilament mesh pre cut with pla grips with size 12 x 08 cm for right side, fda approved sterilised surgical needled suture 8mm 1 / 4 spatulated micropoint double 5 0 sterlized monofilament polyamide eyeless needled suture uspsize 6 0 suture length in cm 70cm needle length & description 3 / 8 circle reverse cutting cutting 12mm sterlized surgical chromic gutsutue eyeless needied usp, code 4268, size5 / 0, suture length in cm 76cm, needle length & description 3 / 8 circle reverse cutting 12mm. suture dyed polyester poly ( p dioxxanone ) 1 0, 24x4cm, 1 / 2 circle 36mm rb 20 anchors / inch bidirctional. synthetic absorbable surgical suture triclosan coated violet monofilament polydioxanone suture with 70 cm size 2 0 with 1 / 2 circle taper point sh, 25mm to 26 mm needle usfda approved synthetic absorbable surgical suture triclosan coated monofilament poliglecaprone 25 suture, length 70 cm, size 2 0 with 3 / 8 circle oval round body visi black jb needle 26 mm synthetic absorbable surgical suture triclosan coated violet monofilament polydioxanone suture with 90 cm size 1 with 1 / 2 circle taper point ct 1 40 mm needle usfda approved transducer with unlimited counts compatible with ultrasonic vessel sealing dissector system v shape clip applicators large v shape clip applicators medium v shape clip applicators small v shape ligation clip large v shape ligation clip medium v shape ligation clip small aciclovir 200mg / 5ml oral suspension 100ml bottle albendazole suspension 200 mg / 5ml bottle baclofen oral solution ip 1mg / ml syp calcium phosphate, 2:1 ratio, 100 ml bottle carbamazepine oral suspension usp 100ml syp chloramphenicol palmitate oral suspension ip 125mg / ml 100ml syp chloroquine phosphate , 160 mg / 10 ml ( 50 mg / 5 ml base ) , 60 ml bottle ciprofloxacin 125mg / 5ml syp 60 ml bottle co trimoxazole 30 ml cyanocobalamin 7.5 mcg+ferrous ammonium citrate 160 mg+folic acid 0.5 mg / 10ml cyclosporine oral solution usp 100mg / ml 50ml syrup cyproheptadine + lycine and vitamins 200ml syp cyproheptadine hcl 2 mg + tricholine citrate 275 mg, 200 ml bottle domperidon suspension 1mg / ml 30 ml bottle etiophylline + theophylline pediatric syp. ( 46.5+14mg / 5ml ) 60 ml bottle ibuprofen oral suspension bp 100mg / 5ml 100ml syp iron+zinc syp metronidazole 200mg / 5ml suspension 60ml bottle nitazoxanide 100mg / 5ml 30 ml bottle norfloxacine suspension ( 30 ml bottle ) oxetacaine 10mg + aluminium hydroxide 291mg + milk of magnesia 98 mg per 5ml 200 ml bottle paracetamol oral solution 150mg / ml 15 ml bottle with dropper paracetamol syrup / suspension 125 mg / 5ml ( 60ml bottle ) phenobarbitone syp 30ml. 20mg / 5ml. phenytoin sodium suspension 30mg / 5ml 100 ml bottle prednisolone sodium phosphate solution 5mg / 5ml 60ml syp salbutamol sulphate , 2 mg / 5 ml , 60 ml bottle sodium valporate oral solution 100ml syp sorbitol 7.15 gm+tricholine citrate 0.55 gm sulfamethoxazole and trimethoprim suspension ( 200mg+ 40mg / 5ml ) 100 ml bottle trypsin bromelain & rutoside trihydrate tablets 6 mercaptopurine , 50mg acarbose 25 mg aceclofenac 100mg+paracetamol 500mg , tablet aceclofenac+thiocolchicoside 100mg+4mg tablet aceclofenace 100mg+serratiopeptidase 15mg tab acenocoumarol 2 mg tab acenocoumarol 1mg acyclovir 200mg tab ademetionine 100mg tab afatinib 40 mg agomelantine 025 mg tab alpha lipoic acid 100 mg+folic acid 1.5 mg+mecobalamin 1.5 mg+vitamin b6 3 mg ambroxol hydrochloride 30mg tab amitriptyline 10 mg amlodipine ( 5 mg ) + metoprolol ( 50 mg ) artemether 80mg tab artesunate 50 mg+sulphadoxine 500 mg+pyrimethamine 25 mg tab aspirin 75 mg aspirin 150 mg aspirin 75 mg+clopidogrel 75 mg+rosuvastatin 10 mg aspirin 75 mg+prasugrel 10 mg atorvastatin 10 mg+aspirin 75 mg. baclofen 5mg tab benfothiamin 150mg betahistine 4mg tab betamethasone 0.5 mg bisoprolol 2.5 mg+hydrochlorothiazide 6.25 mg bisoprolol 5 mg+amlodipine 5 mg bosentan 62.5 mg tab brivaracetam 50mg tab bromocriptine 2.5mg tab buprinorphine 4mg buprinorphine 8 mg bupropion 300 cabargolin 0.25 mg cefadroxil 500 mg chlorthalidon 50 mg tab cilostazole 50mg tab cilostazole100mg tab cinnarizine 20 mg and dimenhydrinate 40 mg citicoline 500mg tab clopidogrel 75 mg+aspirin 75 mg clopidogrel 75 mg+atorvastatin 20 mg clotrimazole 400mg tab co trimoxazole tab cyclophosphamide 50 mg tab cyclosporine 300mg tab cynocobalmin + folic acid tab dapagliflozin 5mg tab dapsone 100 mg tab deferasirox dispersible 500mg tab deflazacort 6mg tab desmopressin 0.5mg tab dexamethasone 4 mg tab diphenylhydramine 50 mg domperidone+ranitidine 150mg tab drotaverine 40 mg tab drotaverine 80mg duloxetine 40mg dydrogesterone 10mg eltrombopag olamine 150mg tab empagliflozin 25mg tablet entecavir 0.5mg tab entecavir 1mg tab eplerenone 25mg erlotinib tablets ip 100mg escitalopram 10 mg tab esomeprazole 40mg ethambutol hydrochloride 400mg tab ethambutol hydrochloride 800mg tab etizolam+propranolol 20mg tab etophylline 77 mg+ theophyllin 23 mg etoposide 50 mg etoricoxib 90mg farmalin 1gm tab ( 100 tab per box ) fenofibrate 160mg tab ferrous sulphate tab. 200mg ( equivalent to 60mg elemental iron ) fludrocortisone 0.1mg tab folic acid 800 mcg fungal diastase 100 mg+papain 60 mg gabapentin 400 mg+nortriptyline 10 mg ganciclovir 1000mg tab glibenclamide 2.5mg tab gliclazide 60mg glimepiride 2 mg + metformin 500 mg + pioglitazone 15 mg glimepiride 2 mg+metformin 500 glipizide 5 mg+metformin 500 mg glucagon 0.1mg tablet glyceryl trinitrate 0.5 mg sublingual tab hydrocortisone 10 mg hydrocortisone 20mg tab hydroxyzine 10 mg tab hyoscine butylbromide tab 10mg ibuprofen 400 mg indapamide hemihydrate 1.5mg isoniazid 200 mg tab isosorbide 5 mononitrate 20 mg isosorbide mononitrate 30 mg itopride 150mg itopride hydrochloride 25 mg tab itopride hydrochloride 50 mg tab l carnosine 200mg tablet lactobacillus 120 lamotrigine 25mg tab lansoprazole 15mg tab lapatinib 250 mg levetiracetam 750mg tab levodopa + carbidopa 100+25mg levofloxacin 750mg tab loperamide 8 mg tab lorcaserine 10 mg tab losartan ( 50 mg ) + chlorthalidone ( 12.5 mg ) lurasidone 20 magnesium oxide 200 mg magnesium valproate 400 mg mebendazole 100 mg tab meclizine hydrochloride 25 mg mefenamic acid 250mg+dicyclomine 10mg tab megestrol acetate 40mg melatonin 3mg melatonin 6mg mercaptopurine 50mg tab mesalamine ( 5 aminosalicylic acid ) 400 mg tab metaclopramide 10 mg tab metformin ( 1000 mg ) + vildagliptin ( 50 mg ) metformin 500 mg+voglibose 0.3 mg methimazole 10 mg tab methocarbamol 500 mg. methotrexate 10 mg methotrexate 5 mg tab methylcobalamin +folic acid tab methylcobalamin 1500mg tab methyldopa 250 mg tab methylphenidate 10 mg methylphenidate 20 mg methylphenidate 5 mg metoclopramide 05 mg metoprolol 12.5 mg metoprolol 50 mg+ramipril 5 mg misoprostol 200 mg modafinil 200mg tab morphine sulphate 10mg tablet moxonidine 0.3 mg multivitamin tab nfi formula sugar coated vit a 2500 iu, vit b12 , vit b 6, 0.5 mg, vit c 50mg vit d3 200iu, niacinamide 25mg folic acid 0.2mg ( with approximateoverages ) mycophenolate mofetil, 500 mg n acetylcysteine 300mg tab naproxen 250 mg tab naproxen 500mg + domperidone 10mg tab naproxen 500mg tab nebivolol 5mg nicorandil 5 mg tab nicotinamide 250mg tab nicoumalone 1 mg nimesulide 100 mg nimodipine 30mg tablet nitazoxanide 200 mg nitazoxanide 500mg tab nitrocontin 2.6 nitroglycerin 2.5 mg ofloxacin 200mg +tinidazole 600mg tab ofloxacin 400mg tab olmesartan 10 mg olmesartan 20mg olmesartan medoxomil 20 mg+amlodipine 5 mg+hydrochlorothiazide 12.5 mg olmesartan medoxomil 40 mg+amlodipine 5 mg oxcarbazepine 150 mg tab oxcarbazepine 300 mg tab oxybutynin 2.5mg tab pancreatic enzyme 1000mg tab pancreatic enzyme 2000mg tab pancreatic enzyme 500mg tab pantoprazole 40 mg+domperidone 30 mg paracetamol, chlorpheniramine maleate, phenylephrine hydrochloride & caffeine tablets pazopanib 200mg / 400mg penicillin v 250 mg tab ( phenoxymethyl penicillin potassium ) pentoxifylline 400mg perampanel 4mg phenobarbitone 30 mg. pramipexol 0.26 sr pramipexol 0.50mg prazosin 10mg tab propranolol hydrochloride 40mg+flunarizine 10mg tab propylthiouracil 50mg prucalopride 2mg tab quetiapine 50mg tab racecadotril 100mg ranolazine sustained release 500mg tab rifaximin 550 mg tablet rivaroxaban 10mg tab rivaroxaban 15mg tab rivaroxaban 5mg tab rosuvastatin 20 mg sacubitril 24 mg+valsartan 26 mg secnidazole 500 mg tab sevelamer carbonate 400mg tab sevelamer carbonate 800mg tab sildenafil 25 mg silodosin 8mg tab sitagliptin 50 mg+metformin 500 mg sodamint tab solifenacin 5mg tab sulfamethoxazole and trimethoprim ( 100mg+ 20mg ) tab sulfasalazine 500mg tab sunitinib 50 mg tapentadol 50mg tab telmisartan 40 mg+amlodipine 5 mg telmisartan 80 mg+amlodipine 5 mg telmisartan 80 mg+hydrochlorothiazide 12.5 mg teneligliptin 20 mg tenofovir disoproxil 300mg tab terbutaline sulphate 2.5mg tab tetrabenazine 12.5mg tab tetrabenazine 20 mg tab tetrabenazine 25mg tab thiamine 200mg tab thiamine 75mg thyroxine sodium 137 mcg thyroxine sodium 62.5 mcg thyroxine sodium 12.5 mcg thyroxine sodium 150 mcg thyroxine sodium 125 mcg thyroxine sodium 88mcg tablet tianeptine 12.5 mg tolperisone hydrochloride 150 mg tab tolvaptan 15 mg topotecan 1 mg torsemide 10 mg+spironolactone 50 mg tramadol 37.5mg and acetaminophen 325mg tablet valganciclovir 450mg tab valganciclovir 500mg tab valganciclovir 900mg tab valsartan 40 mg venlafaxine 75 verapamil 120mg tab vidagliptin 100mg tab vidagliptin 80mg vilazodon 20mg vilazodon 40mg voriconazole 100mg tab voriconazole 150mg tab voriconazole 200 mg voriconazole 50mg tab vortioxetine 20mg vortioxetine 10mg vortioxetine 5 mg warfarin sodium 5 mg tab zonisamide 100 mg tab zonisamide 50 mg tab...

Department of Higher Education - Madhya Pradesh

33756753 bids are invited for binocular microscope , water and soil testing kit , rotary microtome , ph meter , image projection system , tlc kit , centrifuge , spectrophotmeter , bod incubator , colarimeter , autoclave , polarimeter , compound microscope , distillation 5ltr , flamephotometer , colony counter total quantity : 36...

Department of Higher Education - Madhya Pradesh

33579391 bids are invited for boq1 analytical blance ( chemical blance ) student lavel , boq2 autoclave portable , boq3 automatic burette ( karl fisher titrator , boq4 bod incubator 2c to 60c , boq5 digital haemoglobi nometer , boq6 digital ph meter , boq7 digital spectrophotometer , boq8 digital thermometer double beam , boq9 digital nephalo turbidity meter , boq10 dissecting microscope , boq11 electrophoresisi with power suply , boq12 fire extinguisher , boq13 interactive panel 65 inch , boq14 glucometer retraction of needle into , boq15 horizontal deep freezer , boq16 hotplate , boq17 inverter , boq18 laboratory hot air oven , boq19 micropipette , boq20 microwave oven , boq21 refregerator , boq22 sphygmomanometer ( student lavel ) , boq23 uv transilluminator , boq24 vortex shaker , boq25 compound microscope , boq26 binocular microscope , boq27 tringular microscope , boq28 water distillationapparatus ( double distillation unit ) , boq29 water distillationapparatus ( single distillation unit ) , boq30 thermostatic water bath , boq31 heating mantle , boq32 magnetic stirrer ( with hot plate ) , boq33 laboratory stirrer , boq34 water bath 12 holes , boq35 betrological incubator , boq36 centrifuge machine , boq37 electronic balance , boq38 electrophoresis unit , boq39 zoology models , boq40 human palstic skeleton , boq41 dna model , boq42 zoology map , boq43 digital colony counter , boq44 research microscope , boq45 water / soil testing kits , boq46 digital flame photometer , boq47 insects collection net , boq48 permanent slides sample 20pices , boq49 ph meter , boq50 rotatory microtome , boq51 projection microscopesystem , boq52 laminer air flow , boq53 tissue culture rack total quantity : 203...

Department of Higher Education - Madhya Pradesh

33574677 bids are invited for boq1 autoclave portable , boq2 dissecting microscope , boq3 binocular microscope , boq4 cooling centrifuge , boq5 deep freezer , boq6 digital balance 0.1mg , boq7 compoundmicroscope , boq8 high defination microscope , boq9 microscopic eye pic , boq10 triangular microscope , boq11 ganong respirometer , boq12 hot air oven , boq13 magnetic stirrer with hot plate , boq14 maximum minimum thermometer , boq15 micro pipettevariable 1 5ml , boq16 uv chromatographic chamber , boq17 ph meter digital , boq18 slide cabinet with 12 showcase , boq19 thin layer chromatography apparatus , boq20 water bath double wall12 holes ss , boq21 wilmotts bubbler , boq22 bod incubator , boq23 digital colony counter , boq24 digital tds meter , boq25 flame photometer , boq26 interacticv led panel , boq27 compound microscope , boq28 digital thermometer , boq29 projection microscope , boq30 cetological incubator stainless steel , boq31 laminar air flow horizontal , boq32 rotary microtome , boq33 visualizervisual presenter teletop camera , boq34 autoclave vertical , boq35 hair dryer , boq36 homogenizer , boq37 distillation apparatus single distillation , boq38 distillation apparatus doubledistillation , boq39 micro kjeldahl & distillation apparatus , boq40 soxhlet extraction unit , boq41 vortex shaker , boq42 auxanometer , boq43 computer system with licenced operating system internet facility , boq44 farmer potometer , boq45 ganong potometer , boq46 water and soil analysis testing kit digital , boq47 wooden press for herbarium , boq48 tissue culture rackcaster rack , boq49 blackman apparatus , boq50 camera lucida with filter micro type , boq51 camera lucida with filterprism type , boq52 gel electrophoresis unit with power supply , boq53 heating mantle with regulator cap 1 litre , boq54 microscopic camera , boq55 noise level meter , boq56 occular micrometer , boq57 stage micrometer , boq58 stem borer , boq59 tisuue culture rackcaster rack , boq60 auxanometer , boq61 cod analyzer multi parameter beanch photometer , boq62 oxygen electrode , boq63 rotatory microtome , boq64 specimen 20pices , boq65 botany map , boq66 digital colony counter , boq67 digital flame photometer , boq68 digital spectrophotometer , boq69 blood pressure machine , boq70 plant collection net , boq71 centrifuge machine , boq72 electronic balance , boq73 electrophoresis unit total quantity : 240...

Indian Army - Madhya Pradesh

33555938 supply of expendable medical stores dextrose monohydrate for oral use , grouping sera anti’a’ ( monoclonal ) bott of 10 ml , grouping sera anti’b’ ( monoclonal ) bott of 10 ml , grouping sera anti’d’ ( monoclonal ) igm, bott of 10 ml , weak anti ‘d’ ( igg ) , bott of 10 ml , anti human globulin, bott of 5 ml , serum anti h, bott of 5 ml , serum anti a1, bott of 5 ml , vacuatainer ( sodium flouride ) with needle 2 ml , vacuatainer ( k3 edta ) with needle 2 ml , vacuatainer ( strile / plain gel ) with needle 4ml , 3.2% sodium citrate vacuatainer 1.8ml , pregnancy test ( rapid card method ) pkt of 50 test , disposable blade for microtome pkt of 50 blade , diluent erba h560, pack of 20 ltrs , lyse 1 erba h560, bott of 200ml , lyse 2 erba h560, bott of 500 ml , h clean erba h560, bott of 50 ml , elite h5 for erba h560 control for erba haematology analyser , hiv i & ii rapid test kit , hbsag rapid test kit , anti hcv rapid test kit , kit for estimation of c reactive protein ( 25 test ) , prothrombine time test , bott of 5 ml , micropipettes tips ( 05 100ul ) , micropipette tips ( 100 1000ul ) , dengue kit ( ns1ag, igg / igm ) kit of 10 test , em 200 xl hba1c with cal set ( 2x15ml / 2x5ml ) , em 200 amylase small system pack 5x11ml , em 200 bilirubin total system pack 6x44ml / 3x22ml , em 200 bilirubin direct system pack6x44ml / 3x22ml , em 200 caclcium ( a ) system pack10x22ml , em 200 cholesterol system pack 10x44ml , em 200 ck nac small system pack2x44ml / 2x11ml , em 200 gamma gt small system pack 2x22ml / 2x6.8ml , em 200 glucose ( god – pod ) system pack 10x44ml , em 200 hdl cholesterol with calibrator 4x30ml / 4x10ml , em 200 ldh – psystem pack 2x44ml / 2x11ml , em 200 ldl cholesterol with calibrator 2x30ml / 2x10ml , em 200 micro albumin control1x1ml , em 200 micro albuminwith cal 1x10ml / 5x25ml , em 200 sgot – elsystem pack 6x44ml / 3x22ml , em 200 sgpt – elsystem pack 6x44ml / 3x22ml , em 200 urea system pack5x44ml / 5x11ml , em 200 total protein system pack10x44ml , em 200 triglycerides system pack5x44ml / 5x11ml , em 200 xl autowash ac / al kit 5x44ml / 5x44ml , em 200 creatinine –enzymaticsystem pack 5x30ml / 5x10ml , em 200 erba auto wash system pack 10 x100ml , em 200 xl multical 4x3ml , em 200 uric acid 5x44ml / 5x11ml , em 200 quanitative crp tulbilatex calibrator 2x22 / 1x11 ml , sterile urine container 20 50ml , lyphochek assayed bio chemistry control level 1 ( siemens / roche / biorad ) , lyphochek assayed bio chemistry control level 2 ( siemens / roche / biorad ) , biorad lyphochek assayed diabetes control ( level 1&2 ) 06 x 0.5ml , medica easylyte plus na / k / clsolutions pack ( ref 2121 ) with probe wipers ( 800 ml ) , medica easylyte na / k / cl ( 90ml x 0.50g ) daily rinse / cleaning solution kit ( ref 2118 ) , urinalysis reagent strips 2 para ( protein & glucose ) bott of 100 strips , urinalysis reagent strips 2 para ( ketone & glucose ) bott of 100 strips , urinalysis reagent strips 10 para ( multistix 10sg ) bott of 100 strips for siemens urine analyser , sodium chloride ar nacl 500gm , glycerine , pm kit for erba em 200 , ethanol absolute 500ml , em 200 lipase xl system pack ( 1x44ml / 1x11ml ) , tissue paper roll , ra factor ( 25 test ) , aso ( 25 test ) , typhi dot pack of 50 test ( tulip ) , esr tube pack of 100 , syphilis test pack of 50 , cr film 17 x 14 ( fuji ) , cr film 12 x 10 ( fuji ) , cr film 10 x 08 ( fuji ) , inj iohexol 350 mg , 50 ml water soluble nonionic contrast media ( contrapaque ) , inj iohexol 300 mg , 50 ml water soluble nonionic contrast media ( contrapaque ) , usg thermal printer paper roll size 110 mm x 20 mm type 5 highloss sony , liquid developer for automamatic film processor , em microprotein small system pack of 5 x 6 ml / 1 x 1 ml , three level elctrolyte analyser control low / normal / high 1 x 3 ml , mpo stain 50 ml => limited...

Directorate Of Medical Education - Madhya Pradesh

33336734 tender for supply of chemical and reagents for mdru department of sgm hospital rewa , mdru chemical and reagents , ammonium chloride 250gm , potassium bi carbonate 250gm , sodium chloride 250gm , tris hcl 250gm , sds 250gm , saturated phenol 500ml , chloroform 500ml , sodium acetate 250gm , isoamyle alcohol 500ml , glacial acetic acid 500ml , molecular biology grade agarose powder 250gm , bromophenol blue dye 2ml , ethidium bromide 5ml , molecular weight ( dna ladder ) 100bp & 1kb 50ug , molecular weight ( dna ladder ) 50bp 50ug , molecular weight ( dna ladder ) 25bp 50ug , taq polymerase 5000unit , amplitaq gold dna polymerase master mix 500 unit , mgcl2 100 ul , dntp mix 100 ul , dnase 100 unit , rnase 100 unit , proteinase k 100 unit , triss 250gm , edta 250gm , boric acid 250gm , teepol 5 liter , xylene cynol 5 ml , dmso 500 ml , tips i. 0.2 20 ?l tips 2 pack ( pack size of 1000 psc. each ) , tips ii. 20 200 ?l tips 2 pack ( pack size of 1000 psc. each ) , tips iii. 200 1000 ?l tips 2 pack ( pack size of 1000 psc. each ) , superscript ii rnase reverse transcriptase 10000 u ( 200u / ul ) , power sybrgreen pcr master mix 2.5 ml , power sybrgreen rt pcr reagent kit 5 ml , oligo ( dt ) 12 18 primer25 ?g , absolute ethanol 500 ml , pcr plates pack of 50 , sealing foil ( rt pcr / qpcr grade ) pack of 50 , filter tips i. 0.2 20 ?l filter barrier tips 2 pack ( pack size of 1000 psc. each ) , filter tips ii. 20 200 ?l filter barrier tips 2 pack ( pack size of 1000 psc. each ) , filter tips iii. 200 1000 ?l filter barrier tips 2 pack ( pack size of 1000 psc. each ) , mct variable tubes i. 20 200?l tubes 2 pack ( pack size of 1000 psc. each ) , mct variable tubes ii. 200 600 ?l tubes 2 pack ( pack size of 1000 psc. each ) , mct variable tubes iii. 500 2000 ?l tubes 2 pack ( pack size of 1000 psc. each ) , nitrile autodextorous gloves 2 pack ( pack size of 1000 psc. ) , mctstands for variable tubes sizes i. 20 200?l tubes stand pack size of 1000 psc. each , mctstands for variable tubes sizes ii. 200 600 ?l tubes stand pack size of 1000 psc. each , mctstands for variable tubes sizes iii. 500 2000 ?l tubes stand pack size of 1000 psc. each , filter tip boxes i. 0.2 20 ?l filter barrier tip box 2 pack ( pack size of 1000 psc. each ) , filter tip boxes ii. 20 200 ?l filter barrier tip box 2 pack ( pack size of 1000 psc. each ) , filter tip boxes iii. 200 1000 ?l filter barrier tip box 2 pack ( pack size of 1000 psc. each ) , rt pcr grade water 20 ml , tip discard box ( 1 2 liter capacity ) 10 each , graduated measuring cylinders 50, 100, 500, 1000 ml 05each , graduated beakers 50, 100, 500, 1000 ml 05 each , flat bottom tube 5ml ( with screw cap ) 500 psc. , tube stand ( 15ml falcon, 5ml, 2ml, 0.5ml, 0.2ml mct ) pack size of 500 psc. , graduated conical flask 50, 100, 500, 1000ml pack size of 5 psc. each , edta blood collection tube 5ml 100 psc. , plain vial ( for clot activator ) 100psc. , fluoride vial 100 psc. , test tube 5, 10ml 100 psc. , slide+cover slips 50 psc. , tissue paper roll 10 psc. , fine tissue cloth roll 10 psc. , cotton 10 psc. , wash bottle / dropping bottle, 200ml, 500ml, 1ltr 5 psc. , funnels variable range 5 psc. , plastic bottle, 200, 500, 1000ml 5 psc. , syringe + needle 2ml, 5ml pack size of 100 psc. each , nitrile gloves; medium and large size pack size of 1000 psc. , dna isolation kit pack size for 100 reaction , rna isolation kit pack size for 100 reaction , phenol 500 ml , hno3 ( nitric acid ) 500 ml , propionaldehyde pure ( 97% ) 500 ml , phthalic anhydride 500 ml , glacialacetic acid ar 500ml , hydrochloric acid ar 500 ml , sulfuric acid ar 500 ml , 2 amino ethanol 500 ml , pyridine ar 500 ml , ammonia solution ar 500 ml , ammonia chloride ar 500 ml , acetyl salicylic acid 500 ml , acetone ar 500 ml , anthranilic acid ar 500 ml , activated charcoal 500 ml , silica gel g 500ml , benzoicacid ar 500ml , sds 250 gm , colin ( cleaning detergent solution ) 500 ml , sterilium ( hand sanitizer ) 500 ml , dettol / lifeboy alcohol based hand sanitizer 500 ml , hypo 4% 1000ml , floor cleaner phenyl 500 ml , serum separator vial 3 ml 100 psc. , labolene 1000 ml , cleaning mop 5 psc. , broom 5 psc. , microwave gloves 2 pkt. , brown paper for autoclaving 10 rolls , liquid nitrogen 5ltrpkt. , phosphate buffer saline 500 ml , formalin 500 ml , paraffin wax ( 58 60c ) 250 gm , xylene , glycerol 250 ml , ammonia 100 ml , methanol 250 ml , acrylamide / bis ar 250 ml. , 10x tbe buffer 500 gm , urea 100 ml , ammonium persulfate 100 ml , temed 100 ml , 4’, 6 diamidino 2 phenylindole 100 ml , diethyl pyrocorbonate 100ug , pbs 500ml , mnl i 500 unit , bcli 1500 unit , hpych4v 100 unit , hpych4iii 250 unit , sau96i 500 unit , sfci 200 unit , bcci 500 unit , scrfi 500 unit , afliii 250 unit , scai 500 unit , avai 500 unit , bsmi 250 unit , tspri 500 unit , mboii 300 unit , bsh1236i 500 unit , banii 1000 unit , mph1103i 500 unit , dde i 500 unit , bsmb i 200 unit , afa i 500 unit , bal i 250 unit , fspi 500 unit , primers 5 od , fmr1 set 1 – f5 tcaggcgctcagctccgtttcggtttca 3 r5 5 aagcgccattggagccccgcacttcc 3 5 od , mecp2 exon 1 set 1 f5 gttatgtctttagtctttgg–3´ r5 tgtgtttatcttcaaaatgt–3´ 5 od , exon 2set 1 f5 cctgcctctgctcacttgtt–3´ r5 ggggtcatcatacatgggtc–3´ 5 od , exon 2set 2 f5 agcccgtgcagccatcagcc–3´ r5 gttccccccgaccccaccct–3´ 5 od , exon 3 set 1 – f5 tttgtcagagcgttgtcacc–3´ r5 cttcccaggacttttctcca–3´ 5 od , exon 3 set 2 f5 aaccacctaagaagcccaaa–3´ r5 ctgcacagatcggatagaagac–3´ 5 od , exon 3 set 3 f5 ggcaggaagcgaaaagctgag–3´, r5 tgagtggtggtgatggtggtgg–3´ 5 od , exon 3 set 4 – f5 5´–tggtgaagcccctgctggt–3´ r5 ctccctcccctcggtgtttg–3´ 5 od , exon 3 set 5 f5ggagaagatgcccagaggag–3´ r5 cggtaagaaaaacatccccaa–3´ 5 od , exon3 ( l100v ) f5 aaccacctaagaagcccaaa 3 r5 gcttaagcttccgtgtccagccttcaggta 3 5 od , putative promoter and exon 1. f5 gggtgcaatgaaacgctta 3 r5 tttaccacagccctctctcc 3 5 od , mc4r rs17782313 f 5 aagttctacctaccatgttcttgg 3 r 5 ttccccctgaagcttttcttgtcattttgat 3 5 od , fto rs9939609 f 5 aactggctcttgaatgaaataggattcaga 3 r5 agagtaacagagactatccaagtgcagtac 3 5 od , adipoqrs2241766 – f5 tgtgtgtgtggggtctgtct 3 r 5 tgtgatgaaagaggccagaa 3 5 od , rs1501299 f5 ctacactgatataaactatatggag 3 r5 ccccaaatcacttcaggttg 3 5 od , pomcrs6232 f5 ttgtgcccttcatctgaaca 3 r5 tgtagcaactttggcatgga 3 rs155971 f5tatatgcagccaccaatcca 3 r5 aaaatgaagggagaagcacaaa 3 5 od , ppar g ( pro12ala ) f5gcc aat tcaagc cca gtc 3 r5gat atgttt gca gac agt gta tca gtg aaggaa tcg ctt tcc g 3 5 od , kcnj11 ( rs5219 ) f5 gactctgcagtgaggcccta 3’ r5 acgttgcagttgcctttctt 3’ 5 od , capn10 ( rs3792267 ) f5 cacgcttgctgtgaagtaatgc 3’ r5 tgattcc catggtctgtagcac 3’ 5 od , pik3ca set 1 forward 5’ ggagtatttcatgaaacaaatgaatgatgcg 3’ 5 od , pik3ca set 1 reverse 5’ gagctttcattttctcagttatctt 3’ 5 od , bat 25 set 1 f 5’ tcgcctccaagaatgtaagt 3’ r 5’ tctgcattttaactatggctc 3’ 5 od , bat 26 set 1 f5’ tgactacttttgacttcagcc 3’ r5’ aaccattcaacatttttaaccc 3’ 5 od , d2s123 set 1 f5’ aaacaggatgcctgcctttta 3’ r5’ gtttggactttccacctatgggac 3’ 5 od , d5s346 set 1 f 5’ actcactctagtgataaatcg 3 r5 agcagataagacagtattactagtt 3 5 od , d17s250 – set 1 f5’ ggaagaatcaaatagacaat 3’ r5’ gctggccatatatatatttaaacc 3’ 5 od , impdh2 set 1 f5 gtttctgcggtatcccaatc 3 r5 cgagcaagtccagcctat 3 5 od , bmp6 rs73719353 f5’ gctcctttgcacttcgctgt 3’ r5’ aggctctgctg agctcctac 3’ 5 od , bmp6 rs73719341 f 5’tgaacttcccattcccctct 3’ r5’ataaaattagcattgatcca 3’ 5 od , bmp6 rs73719318 f5’caggtgctgtgcaacttctt 3’ r 5’agagggcaccatggttgcct 3’ 5 od , bmp6 rs73381662f 5’ ctgagattcaattaggccca 3’r 5’taaagaacagcaaaagtctg 3’ 5 od , bmp6 rs73381650 f 5’cacataaagattgctgcatt 3’ r 5’tagtaatcctaaaaatggga 3’ 5 od , anxa2 rs7170178 f 5’ ttcacagcagttcaaaatac 3’ r 5’ ctgggtttccagagatggaa 3’ 5 od , anxa2 rs73435133 f 5’ gagtgcaaggtgctgaggat 3’ r 5’ gatttcagacagcccttgca 3’ 5 od , anxa2 rs73418020 f 5’ tctgagagtgaaaggtgcac 3’ r 5’ tcccatcccctgaatccctg 3’ 5 od , anxa2 rs72746635 f 5’ cctgactcattgtcacatca 3’ r 5’ aagtggctttccactgccc 3’ 5 od , anxa2 rs73418025 f 5’ cttctcatcttactttt 3’ r 5’ agggaaggatacagaggaga 3’ 5 od , hsp 70 primer sequence 5 agcgt aacac cacca ttcc 3 ( forward ) 5 tggct cccac cctat ctc 3 ( reverse ) 5 od , the gapdh sequence forward primer 5 agc cac atc gct gag aca c 3, reverse primer 5 gcc caa tac gaccaa atcc 3. 5 od , total rna mini kit ( from human skin tissue ) 2 pack ( pack size for 100 reaction ) , human leptin elisa kit pack size for 96 reaction , human adiponectin elisa kit pack size for 96 reaction , human adipsin elisa kit pack size for 96 reaction , human resistin elisa kit pack size for 96 reaction , human iron elisa kit ( serum iron ) pack size for 96 reaction , human ferritin elisa kit ( serum / ferritin ) pack size for 96 reaction , thyroid estimation kit pack size for 96 reaction , ice maker machine for laboratory purpose 1 psc. , microwave gloves 2 pkt. , pcr mini cooler 03 psc. , pipette 0.5 10ul, 02 20ul, 10 100ul, 20 200ul and 100 1000ul. 1 psc. each , horizontal gel apparatus: 18 – 20 cm ( length ) x 25 – 30 ( breadth ) x 5 7.5 cm ( height ) , 40 60 samples, multichannel pipette compatible combs and gel caste 1 psc. each , mini horizontal gel apparatus: 9 cm w x 11 cm l with grooves ( 8.7 cm l x 1.2 cm h ) on the side for gripping the gel tray. it should have two comb slots on the same tray area. 1 psc. each , buffer capacity should be 600 ml for the buffer tanks and optimum gel runs with a fill line indicator for buffer levels along the unit side , multi size forceps lab set 01 pkt. , liquid nitrogen sample storage tanks 5 tanks ( 3, 5, 10, 20, 25 ltrs ) , liquid nitrogen sample handling gloves 5 sets of gloves , slide tray / rack pack of 3psc. , l mold pack of 2 psc. , tissue cassette steel pack of 2 psc. , electric tissue float bath ( thermostate ) 1 psc. , coupling jar pack of 2 psc. , staining rack pack of 3 psc. , whatman filter paper grade 1 & 2 2 pack ( pack size of 50 psc. ) , harri’s hematoxylin powder 2 pack of 50 gm , yellow eosin powder 2 pack of 50 gm , coverslip 18x18 ( microscopic ) 2pack ( pack size of 100 psc ) . , dpx mount 50 ml , thymol crystals 250 gm , plastic boxes 5 boxes , steel / aluminium boxes 3 boxes , hot plate 1 psc. , mx35 premier microtome blade ( 34 / 80mm ) 50 blades 1 box , diamond pen ( histopathology use ) 1 pen , embedding mold and embedding ring 5 psc. , human pai 1 elisa kit pack size of 96 reactions , mortar and pestle homogenizers 1 psc....

Department of Higher Education - Madhya Pradesh

33319767 bids are invited for bod incubator , flame photometer , tissue culture rack caster racks , electronic digital balance 0 1 mg , soxhlet extraction unit , bionocularmicroscope , autoclave vertical cap 50lt , colorimeter , distillation apparatus single distillation capacity 3lt , thin layer chromatography apparatus , centrifuge machine 3500 rpm , dissecting microscope , slide box for 100 slides , magnetic strirrer with hot plate , ph meter , hot air oven stainless steel , rotatory microtome with accessories , water bath double wall 6 holes stainless steel , gel electophorosis unit with power supply vertical , digital turbiditimeter , digital tds meter , water and soil testing analysis kit , digital colony counter , distillation apparatus double distillation capacity 5lt , laminar air flow horizontal , spectrophotometer 340 900nm range , compound microscope , chromatrographic chamber , spectrophotometer 340 900 nm , autoclave , paper chromatography testing kit , chemical balance , bod incubator , water soil testing kit digital , heating mentle 2 lit 500 w , distillation apparatus double distillation borosilicate glass cap 5 liter , water bath 6 holes , rotary microtome with accessories , tds meter digital , magnetic stirrer with hot plate , laboratory mixer , hot air oven 14 14 , electronic digital balance , conductivity meter digital with cell , d o meter digital , electronic balance 0 1 grm to 600 grm , flame photometer digital , single beam uv vis spectrometer without pc 200 1100 nm , thin layer chromatography kit , binocular microscope , distillation apparatus single distillation capacity 5lt , water bath double wall 12 holes stainless steel , oven...

Indian Army - Madhya Pradesh

33311037 supply of expendable medical store , betnovate n oint contain betamethasone 0.10% w / w , neomycin sulphate 0.5%w / w and chlorocresol 0.1%w / w, tube of 20 gm , cough lozenges tab contain dichlorobenzyl alcohol and amylmetacresol with ascorbic acid , levonorgesrel 0.15mg + ethinylestradiol 0.03mg ( pack of 21 tab ) , liquid developer for autoprocessor, 5 ltr , ondansetron 8 mg tab , levodopa + carvidopa 110mg tab , tab diethylcarbamazine citrate 100 mg , protene powder contain skimmed milk powder, malt extract , soy protein isolate , cocoa powder 10 %, minerals , calcium phosphate , ferric pyrophosphate , zinc sulphate, vitamins , nicotinamide , riboflavin , thiamine , calcium pantothenate artificial sweetnerjar of 250 gm , sodium bicarbonate 7.5% amp of 10 ml , tab resperidone 0.5mg , stimuflex ultra 360 degree needle for nerve blocks 5 cm , stimuflex ultra 360 degree needle for nerve blocks 10 cm , dvt stockings above knee size large , dvt stockings below knee size large , moxifloxacin eye ointment 0.5% tube of 5 gm , disposable blade for microtome pkt of 50 blade , cartridge for bar code printer type wax 333plus size 55mm x 75mm , lyphochek assayed bio chemistry control evel 1 ( siemens / roche / biorad ) , lyphochek assayed bio chemistry control evel 2 ( siemens / roche / biorad ) , biorad lyphochek assayeddiabetes control ( level 1&2 ) 06 x 0.5ml , medica easylyte na / k / cl ( 500ml ) urine diluent ( ref 2111 ) , sterile urine container 20 50ml , weak anti ‘d’ ( igg ) , bott of 10 ml , vicryl rapid fasting absorbing 4 0 round body 20 mm ( pack of 12 peces ) , polypropylene suture 4 0 3 / 8 circle cutting needle – 16mm ( pack of 12 peces ) , polyproplene suture 2 0 on round body 3 / 8 circle – 22 mm needle ( pack of 12 peces ) , polypropylene suture with needle 2 0 round body 22mm 3 / 8 circle ( pack of 12 peces ) , polypropylene suture with needle 3 0 round body 25mm 3 / 8 circle ( pack of 12 peces ) , polypropylene suture with needle 3 0 round body 22mm 3 / 8 circle ( pack of 12 peces ) , polypropylene suture with needle 4 0 round body 17mm 3 / 8 circle ( pack of 12 peces ) , polypropylene suture with needle 4 0 cutting body 16mm 3 / 8 circle ( pack of 12 peces ) , polypropylene suture with needle 5 0 cutting body 17mm 3 / 8 circle ( pack of 12 peces ) , polypropylene suture with needle 5 0 round body 12mm 3 / 8 circle ( pack of 12 peces ) , nylon ( polyamide ) suture with needle 2 0 round body 22mm 3 / 8 circle ( pack of 12 peces ) , nylon ( polyamide ) suture with needle 2 0 cutting body 22mm 3 / 8 circle ( pack of 12 peces ) , nylon ( polyamide ) suture with needle 3 0 round body3 / 8 circle , nylon ( polyamide ) suture with needle 3 0 cutting body 26mm 3 / 8 circle , nylon ( polyamide ) suture with needle 4 0 round body3 / 8 circle , nylon ( polyamide ) suture with needle 4 0 cutting body 16mm 3 / 8 circle ( pack of 12 , pds polydioxane suture with needle 1 0 round body 30mm ( pack of 12 ) , pds polydioxane suture with needle 2 0 round body 30mm ( pack of 12 , polydioxane pds loop 1 0 ronud body 40mm ( pack of 12 ) , vicryl ( polyglactin 910 ) suture with needle 2 0 round body 25mm ( pack of 12 , vicryl ( polyglactin 910 ) suture with needle 3 0 round body 25mm ( pack of 12 , vicryl ( polyglactin 910 ) suture with needle 3 0 cutting body 22mm 3 / 8 circle ( pack of 12 , vicryl ( polyglactin 910 ) suture with needle 4 0 round body 20mm ( pack of 12 , monocryl ( polyglecaprone ) suture with needle3 0 cutting body 25mm ( pack of 12 ) , monocryl ( polyglecaprone ) suture with needle4 0 cuttong body 16mm 3 / 8 circle ( pack of 12 , monocryl ( polyglecaprone ) suture with needle5 0 cb 16mm 3 / 8 circle ( pack of 12 , silk suture with no3 0 ( for seton ) ( pack of 12 ) , silk suture with needle no 0 cutting body 45mm ½ circle ( pack of 12 ) , silk suture with needle no 0 round body 30mm 3 / 8circle ( pack of 12 ) , silk suture with needle no 2 0 cutting body 30mm 3 / 8 circle ( pack of 12 ) , silk suture with needle no 2 0 round body 30mm 1 / 2circle ( pack of 12 ) , silk suture with needle no 3 0 round body 30mm 3 / 8 circle ( pack of 12 ) , foley catheter 3 way 16 fr , ot skin marker pen ( black ) , polypropylene mesh 7.5 x 15 cm , polypropylene mesh 15 x 15 cm , polypropylene mesh 30 x 30 cm , skin stapler 35 mm , cast fibreglass , saccharomyces boulardii capsule 250 mg , lignocaine and prilocaine cream ( local lignocaine and prilocaine cream ( local anaesthetic ) of 50 gm , sterile collagen wet sheet size 10x10 cm pkt of 05 , papain urea debridement oint of 15 gm , recombinant human epidermal growth factor+silver sulfadiazine+chlorhexidine gluconate cream of gm , combined spinal epidural set size 18 ( b braun ) , epidural set size 18 ( b braun ) => limited...

Department of Higher Education - Madhya Pradesh

33263572 bids are invited for binocular microscope , water and soil testing kit , rotary microtome , ph meter , image projection system , tlc kit , centrifuge , spectrophoto meter , bod , colarimeter , autoclave , polari meter , compound microscope , distillation 5ltr , flame photo meter , colony counter total quantity : 36...

Department of Higher Education - Madhya Pradesh

33218675 bids are invited for magnetic strirrer with hot plate , hot air oven stainless steel , ph meter , digital tds meter , water and soil testing analysis kit , digital colony counter , gel electophorosis unit with power supply horizontal , water bath double wall 6 holes stainless steel , rotatory microtome with accessories , autoclave vertical cap 50lt , distillation apparatus single distillation capacity 3lt , distillation apparatus double distillation capacity 5lt , laminar airflow horizontal , colorimeter , spectrophotometer 340 900nm range , bod incubator , soxhlet extraction unit , compound microscope , dissecting microscope , bionocularmicroscope , slide box for 100 slides , centrifugemachine 3500 rpm , thin layer chromatography apparatus , electronic digital balance 01 mg , research microscope , tissue culture rack caster racks , flame photometer total quantity : 66...

Department of Higher Education - Madhya Pradesh

33179014 bids are invited for title 01 auto clave title 02 do meter digital title 03 counductivity meter digital with cell title 04 digital photoelectric colorimeter 5lit title 05 double distilation apperatus cap2lit title 06 electronic blance0.01mg to 600gm title 07 flame photometer digital title 08 heating metel 7lit title 09 hotplate with energy regulator 1500w title 10 centrifuge machine title 11 thin layer chromatograpy app title 12 magnetic stirrer with hot plate title 13 muffle furness title 14 shaking machine with wrist action title 15 bod incubator title 16 vortex mixer title 17 digital colony counter 4 digit title 18 digital turbidity meter 3.5 digit title 19 tds meter digital title 20 digital ph metr conductivity meter and temperature meter title 21 water bath double 12 holes title 22 water soil analysis kit 7 para meter title 23 ph meter digital with electrodes title 24 rotatory flask shaker title 25 vacuum pump title 26 melting point apparatus digital title 27 micropipette variable title 28 polarimeter half shades title 29 compound microscope title 30 dissecting microscope with bull lences title31 binocular microscope title 32 image projection system tringular microscope title 33 thin layer chromotograhic chamber title 34 water and soil testing analysis kit title 35 digital colony counter title 36 rotatory microtome with accessories title 37 digital spectrophotometer title 38 ph meter with electrodes title 39 gel electroproshish with power supply ( vertical ) title 40 hot air oven stainless steel title41 high defination microscope title 42 bod incubulator title 43 digital tds meter title 44 compound microscope title 45 dissecting microscope with bull lences title 46 image projection system tringular microscope title 47 oven title 48 beteriological incubator ss steel title 49 digital colony counter title 50 centrifuge machine3500 rpm title 51 binocular microscope title 52 rotatory microtom with accessories title 53 computer for zoology lab title 54 dna model 3d title55 human plastic skeleton title 56 blood pressure machine title 57 digital spectrophotometer title 58 fet characteristic apparatus title 59 mosfet characteristic app title 60 ujt characteristic app title 61 s.c.r characteristic app title 62 thermistor characteristic app title 63 diac and tiac characteristic app title 64 photo diode characteristic app title 65 photo transistor characteristic app title 66 power amplifier title 67 hartley and colpitts oscillator title 68 study of crystall oscillator title 69 high defination microscope title 70 newton ring app complete with travelling microscope power title 71 series and parailal resonrnce circuits title 72 reading telescop title 73 four probe methods title 74 spectrometer 6 / 7 title 75 die electric constant apparatus title 76 screw gauge electronic title 77 verniear calipers electronics title 78 ac ammeter title 79 dc voltmeter title 80 milimeter / milvoltameter / micrometer title 81 daniel cell title 82 jeager apparatus title 83 ldr cheracteristic apparatus title 84 cro digital 30 mhz / 40mhz title 85 high defination microscope title 86 travelling microscope title 87 digital multimeter total quantity : 236...

Department of Higher Education - Madhya Pradesh

33160930 bids are invited for title 1 ph meter title 2 oven title 3 thin layer chromatography apparatus title 4 flame photometer title 5 soxhlet extraction unit title 6 autoclave vertical cap 50lit title 7 compound microscope title 8 dissecting microscope title 9 slid box for 50 slides title 10 binocular microscope title 11 bod title 12 image projection microscope system title 13 digital high defination microscope title 14 water bath double wall 12 holesss title15 distillation apparatus single distillation cap title16 hot air oven title 17 heating mental with regulator cap 1lit title 18 heating mental with regulator cap 5oml title 19 vortex shaker title 20 water and soil testing analysiskit title 21 spectrophotometer340 900nmrange title 22 digital colony counter title 23 rotator microtome with acessories title 24 autoclave portable title 25 centrifuge machine 350rpm title 26 homegenizer title 27 digital turbiditimeter title 28 electric digital blance0.01mg title 29 micro pipette 1 5ml title 30 laminer air flow title 31 beteriological incubator stainless steel title 32 compound microscope title33 dissecting microscope title 34 slide box for 50 slides title35 hot air oven ss title 25 heating metal with regulatorcapn500ml title36 vortex shaker title37 water and soil testing analysiskit title38 rotator microtome with accessories title39 autoclave phortable title40 thin layer chromatography apparatus title41 binocular microscope title42 beteriological incubator stainless steel title43 autoclave vertical cap 50lit title44 micro pipette title 45 micro pipette title 46 digital high defination microscope title47 bod total quantity : 104...

Indian Army - Madhya Pradesh

32853308 expendable medical stores expendable medical stores , betnovate n oint contain betamethasone 0.10% w / w , neomycin sulphate 0.5%w / w and chlorocresol 0.1%w / w, tube of 20 gm , cough lozenges tab contain dichlorobenzyl alcohol and amylmetacresol with ascorbic acid , levonorgesrel 0.15mg + ethinylestradiol 0.03mg ( pack of 21 tab ) , liquid developer for autoprocessor, 5 ltr , ondansetron 8 mg tab , levodopa + carvidopa 110mg tab , tab diethylcarbamazine citrate 100 mg , protene powder contain skimmed milk powder, malt extract , soy protein isolate , cocoa powder 10 %, minerals , calcium phosphate , ferric pyrophosphate , zinc sulphate, vitamins , nicotinamide , riboflavin , thiamine , calcium pantothenate artificial sweetnerjar of 250 gm , sodium bicarbonate 7.5% amp of 10 ml , tab resperidone 0.5mg , stimuflex ultra 360 degree needle for nerve blocks 5 cm , stimuflex ultra 360 degree needle for nerve blocks 10 cm , dvt stockings above knee size large , dvt stockings below knee size large , moxifloxacin eye ointment 0.5% tube of 5 gm , single piece iol lens with uv protection size : 17.0 ds , single piece iol lens with uv protection size : 18.0 ds , single piece iol lens with uv protection size : 19.0 ds , single piece iol lens with uv protection size : 19.5 ds , single piece iol lens with uv protection size : 20.0 ds , single piece iol lens with uv protection size : 21.0 ds , single piece iol lens with uv protection size : 22.0 ds , single piece iol lens with uv protection size : 23.0 ds , single piece hydrophobic pmma lens size : 17.0 ds , single piece hydrophobic pmma lens size : 18.0 ds , single piece hydrophobic pmma lens size : 19.0 ds , single piece hydrophobic pmma lens size : 20.0 ds , single piece hydrophobic pmma lens size : 21.0 ds , single piece hydrophobic pmma lens size : 22.0 ds , disposable blade for microtome pkt of 50 blade , cartridge for bar code printer type wax 333plus size 55mm x 75mm , lyphochek assayed bio chemistry control level 1 ( siemens / roche / biorad ) , lyphochek assayed bio chemistry control level 2 ( siemens / roche / biorad ) , biorad lyphochek assayeddiabetes control ( level 1&2 ) 06 x 0.5ml , medica easylyte na / k / cl ( 500ml ) urine diluent ( ref 2111 ) , sterile urine container 20 50ml , single piece hydrophobic pmma lens size : 22.0 ds , weak anti ‘d’ ( igg ) , bott of 10 ml , vicryl rapid fasting absorbing 4 0 round body 20 mm ( pack of 12 peces ) , polypropylene suture 4 0 3 / 8 circle cutting needle – 16mm ( pack of 12 peces ) , polyproplene suture 2 0 on round body 3 / 8 circle – 22 mm needle ( pack of 12 peces ) , polypropylene suture with needle 2 0 round body 22mm 3 / 8 circle ( pack of 12 peces ) , polypropylene suture with needle 3 0 round body 25mm 3 / 8 circle ( pack of 12 peces ) , polypropylene suture with needle 3 0 round body 22mm 3 / 8 circle ( pack of 12 peces ) , polypropylene suture with needle 4 0 round body 17mm 3 / 8 circle ( pack of 12 peces ) , polypropylene suture with needle 4 0 cutting body 16mm 3 / 8 circle ( pack of 12 peces ) , polypropylene suture with needle 5 0 cutting body 17mm 3 / 8 circle ( pack of 12 peces ) , polypropylene suture with needle 5 0 round body 12mm 3 / 8 circle ( pack of 12 peces ) , nylon ( polyamide ) suture with needle 2 0 round body 22mm 3 / 8 circle ( pack of 12 peces ) , nylon ( polyamide ) suture with needle 2 0 cutting body 22mm 3 / 8 circle ( pack of 12 peces ) , nylon ( polyamide ) suture with needle 3 0 round body3 / 8 circle , nylon ( polyamide ) suture with needle 3 0 cutting body 26mm 3 / 8 circle , nylon ( polyamide ) suture with needle 4 0 round body3 / 8 circle , nylon ( polyamide ) suture with needle 4 0 cutting body 16mm 3 / 8 circle ( pack of 12 , pds polydioxane suture with needle 1 0 round body 30mm ( pack of 12 , pds polydioxane suture with needle 2 0 round body 30mm ( pack of 12 , polydioxane pds loop 1 0 ronud body 40mm ( pack of 12 , vicryl ( polyglactin 910 ) suture with needle 2 0 round body 25mm ( pack of 12 , vicryl ( polyglactin 910 ) suture with needle 3 0 round body 25mm ( pack of 12 , vicryl ( polyglactin 910 ) suture with needle 3 0 cutting body 22mm 3 / 8 circle ( pack of 12 , vicryl ( polyglactin 910 ) suture with needle 4 0 round body 20mm ( pack of 12 , monocryl ( polyglecaprone ) suture with needle3 0 cutting body 25mm ( pack of 12 ) , monocryl ( polyglecaprone ) suture with needle4 0 cuttong body 16mm 3 / 8 circle ( pack of 12 , monocryl ( polyglecaprone ) suture with needle5 0 cb 16mm 3 / 8 circle ( pack of 12 , silk suture with no3 0 ( for seton ) ( pack of 12 ) , silk suture with needle no 0 cutting body 45mm ½ circle ( pack of 12 ) , silk suture with needle no 0 round body 30mm 3 / 8circle ( pack of 12 ) , silk suture with needle no 2 0 cutting body 30mm 3 / 8 circle ( pack of 12 ) , silk suture with needle no 2 0 round body 30mm 1 / 2circle ( pack of 12 ) , silk suture with needle no 3 0 round body 30mm 3 / 8 circle ( pack of 12 ) , foley catheter 3 way 16 fr , ot skin marker pen ( black ) , polypropylene mesh 7.5 x 15 cm , polypropylene mesh 15 x 15 cm , polypropylene mesh 30 x 30 cm , skin stapler 35 mm , cast fibreglass , saccharomyces boulardii capsule 250 mg , lignocaine and prilocaine cream ( local lignocaine and prilocaine cream ( local anaesthetic ) of 50 gm , sterile collagen wet sheet size 10x10 cm pkt of 05 , papain urea debridement oint of 15 gm , recombinant human epidermal growth factor+silver sulfadiazine+chlorhexidine gluconate cream of gm => limited...

Central Council For Research In Ayurvedic Sciences - Madhya Pradesh

32670762 bids are invited for alanine amino transferase , aspartate amino transferase , alkaline phosphatase , albumin , blood urea nitrogen , calcium , chloride , creatinine , glucose , gamma glutamyl transferase , phosphorus , potassium , sodium , total plasma protein , total cholesterol , triglycerides , total bilirubin , rodent thyroid stimulating hormone , rodent thyroxin , rodent triiodothyronine , dekaphan laura urine strips , prothrombin time , activated partial thromboplastin time , micro pipette tips , glass slides , cover slips , btct capillary tubes , nitrile gloves small , nitrile gloves medium , nitrile gloves large , micro centrifuge tubes 0.5 , microcentrifuge tubes 1.5 , micro centrifuge tubes 2 , oralgavage set , magnetic stirrer beads small , magnetic stirrerbeads medium , microtome blades slee , blotting papers ,bottle corks , diethyl ether , potassium iodide , isoflurane ,propanol , ethanol , xylene , hematoxylin stain solution ,eosin stain solution , paraffin wax , formaldehyde ,propylene glycol , sodium chloride , sodium dihydrogenphosphate , dihydrogen sodium phosphate , gum acacia ,giemsa stain solution , cell clean cl 50 , disodium edta total quantity : 53051...

Department of Higher Education - Madhya Pradesh

32465961 bids are invited for 1 auto clave 2 do meter digital 3 digital meter counductivity meter and temp meter 4 digital photoelectric colorimeter 5lit 5 digital app double distilation cap 6 electronic blance0.01mg to 220g 7 flame photometer digital 8 heating metel 7lit 9 heating metal 2 lit 500w 10 humidity chamber 11 hotplate with energy regulator 500w 12 centrifuge machine 13 laboratory mixer 14 magnetic stirrer with hot plate 15 muffle furness 9*4*4 16 shaking machine with wrist action 17 bod incubator 18 uv b3chromatrographic chamber 19 vortex mixer 20 digital colony counter 4 digit 21 digital turbidity meter 3.5 digit 22 tds meter digital 23 test tube stand 24 test tube mid 25 test tube big 26 beaker100ml 27 beaker 50ml 28 volumetric flask 100ml 29 volumetric flask 50ml 30 water bath double 12 holes 31 water soil analysis kit 7 para meter 32 ph blance b56 33 hot plate 34 shaking machine 35 petri disk 4” 36 rotatory flask shaker 37 rotatory light vacuum pump 25 lit / per min 38 ph meter with electrodes 39 burett 50ml 40 measuring cylinder100ml 41 bursan burner 42 flask 250ml 43 flask 100 44 polorimeter half shaade 45 vacuum dessicator 46 flask 50ml 47 hot air oven 48 compuetr for chemistry 49 melting point apparatus digital 50 micropipette variable 1 compound microscope 2 dissecting microscope with bull lences 3 binocular microscope 4 research microscope with digital eye computer i31 tb 21.5 5 betrological oven 6 thin layer chromotograhic chamber 7 magnetic stirrers with hot plate digital 8 water and soil testing analysis kit 9 digital colony counter 10 rotatory microtome with accessories 11 plant collection set 12 digital spectrophotometer 13 ph meter 14 homogenizer 15 colorimeter 16 gel electroproshish with power supply ( vertical ) 17 hot air oven stainless steel 18 bod incubulator 19 map botany 20 heating mental with regulator cap 1lit 21 magnetic stirrers with hot plate 22 speciman of botany 23 water bath double wall 6 holes stainless stell 24 digital tds meter 1 compound microscope 2 dissecting microscope with bull lences 3 water bath double wall 4 water and soil testing analysis kit 5 heating mantel with regulator cap 1 6 spectrophotometer 7 digital colony counter 8 rotatory microtom with accessories 9 centrifuge machine3500 rpm 10 research microscope with digital eye computer 11 binocular microscope 12 dna model 3d 13 human plastic skeleton 14 blood pressure machine 15 insect collection net 16 parmanent slide sample 10pices set 17 zoology map 18 eupletella models 19 hylonema models 20 euspongia models 21 obelia models 22 velella models+b128 23 aurelia 24 pennatula 25 faciola 26 teniasolium 27 earthworm 28 octopus 29 starfish 30 autoclave portable 31 colony counter digital 32 endo skeleton of rabbit 33 silde ( parmanent slide ) hydra 34 chik embryo wm of 16 hrs incubation 35 ls of 18 hrs embryo 36 whole mount of toys embryo 37 double appratus single ditilation+b19 38 bod incubator 39 laminar air flow horizontal 40 tissu culture rack 41 autoclave portable 1 fet characteristic apparatus 2 mosfet characteristic app 3 ujt characteristic app 4 s.c.r characteristic app 5 thermistor characteristic app 6 diac and tiac characteristic app 7 photo diode characteristic app 8 photo transistor characteristic app 9 power amplifier 10 hartley and colpitts oscillator 11 study of hybrid parameters circuits 12 zanier regulated power supply 13 newton ring app complete with travelling microscope power 14 series and parailal resonrnce circuits 15 study of multivibrators using omamp 16 clipping and clamping circuits using operational amplifire 17 spectrometer 6 / 7 18 die electric constant apparatus 19 screw gauge electronic 20 verniear calipers electronics 21 bi prism assembly 22 ac ammeter 23 dc voltmeter 24 pnp / npn tranistor dual 4 meter 25 boyle law app heavey metal 26 torsion pendulum 27 reading telescop 28 jeager apparatus 29 milimeter / milivplter 30 daniel cell 31 digital multimeter 32 travelling microscope 33 spectrometer prism ( crown / flint glass ) 34 galvanometer 35 apparatus to study cheracteristic tunnel diode 36 ldr charecterritics app 37 study of smps 38 four probe methods 39 solar cell characteristic apparatus 40 single stage double stage rc coupled amplifife 41 transistorized differential amplifire 42 f e t amplifire 43 study of schmitt trigger circuits 44 rectifier and filter characteristic app 45 8056 microprocessor with smps 46 cro digital 30 mhz / 40mhz 47 study of hybrid parameters resonces circuits 48 study of transission line 49 digitalto analog converter with power supply 50 multiplexer and demultiplexer built in power supply 51 bcd to seven segment decoderr with built in power supply 52 pulse width pluse position modulation and demodulation 53 computer for physics lab 54 sodium lamp with smaps 55 mercury lamp with smps total quantity : 883...

Department of Higher Education - Madhya Pradesh

32463737 bids are invited for magnetic strirrer with hot plate , hot air oven stainless steel , ph meter , digital tds meter , water and soil testing analysis kit , digital colony counter , digital turbiditimeter , gel electophorosis unit with power supply vertical , water bath double wall 6 holes stainless steel , rotatory microtome with accessories , autoclave vertical cap. 50lt , distillation apparatus single distillation capacity 3lt , distillation apparatus double distillation capacity 5lt , laminar air flow horizontal , colorimeter , bod incubator , spectrophotometer 340 900nm range , soxhlet extraction unit , compound microscope , dissecting microscope , bionocularmicroscope , slide box for 100 slides , centrifuge machine 3500 rpm , thin layer chromatography apparatus , electronic digital balance 0 1 mg , tissue culture rack caster racks , flame photometer , function generator b1hz to 10 mhz , function generator a 0 3 to 3 mhz , series and parallel resonance circuit , spectrometer 6 7 30 sec , weight box , battery eliminator , digital multimeter , travelling microscope , ldr characteristics apparatus , study of hall effect complete setup , e m by milikan s oil drop method , newton s rings apparatus complete complete with travelling microscope power supply and sodium lamp , vernier callipers , sodium vapor lamp , mercury lamp , photo diode characteristic apparatus , u j t characteristic apparatus , f e t characteristic apparatus , m o s f e t characteristic apparatus , s c r characteristic apparatus , diac and triac characteristic apparatus , solar cell characteristic apparatus , single stage and double stage r c coupled amplifier feed back amplifier , transistorized push pull amplifier , f e t amplifier , power amplifier , zener regulated power supply , study of various a c bridges e g anderson schering hay kelvin maxwell de sauty wien s bridges , transistorized regulated power supply , study of various network theorems , clipping and clamping circuit using operational amplifier , impedance and power factor of lcr circuit , 8085 microprocessor with smps , half wave and full wave rectifier apparatus with built in power supply , study of lissajous figure trainer. , apparatus to study rc coupled amplifier with built in power supply , to study the vi characteristics of the solar cell , apparatus to study characteristics of tunnel diode , binocular microscope , oven , autoclave portable , thin layer chromatography kit , incubator stainless steel , water bath double wall 12 holes stainless steel , tissue culture rack...

Department of Higher Education - Madhya Pradesh

32434017 bids are invited for digital colony counter , oven , heating mental with regulator cap 1 lt , gel electophorosis unit with power supply vertical , laminar air flow horizontal , spectrophotometer 340 900nm range , colorimeter , dissecting microscope , compound microscope , bionocularmicroscope , bod incubator , water bath double wall 6 holes stainless steel , distillation apparatus single distillation capacity 3lt , distillation apparatus double distillation capacity 5lt , hot air oven stainless steel , water and soil testing analysis kit , centrifuge machine 3500 rpm , flame photometer , ph meter , digital tds meter , electronic digital balance 0.1 mg , thin layer chromatography apparatus , function generator b 1hz to 10 mhz , function generator a 0 3 to 3 mhz , measurement of wave length of hene laser using ruler with laser complete setup , physical balance , weight box , vernier callipers , stop clock , ammeter d c a c required range , voltmeter d c a c required range , galvanometer , battery eliminator , digital multimeter , resistance box various range , optical bench with riders double bar heavy , inertia table , lee s apparatus to determine the hear conductivity of bad conductors of different geometry , zener diode characteristics apparatus with built in power supply. , plug key one way two way , four way key , moarse key , lachlanche cell , analog multimeter , soldering iron , rheostate various length , spectrometer prism crown flint glass , sodium vapor lamp , transformer of mercury lamp , screw gauge , f e t characteristic apparatus , m o s f e t characteristic apparatus , u j t characteristic apparatus , solar cell characteristic apparatus , single stage and double stage r c coupled amplifier feed back amplifier , zener regulated power supply , ic 7805 regulated power supply , study of various network theorems , study of various a c bridges e g anderson schering hay kelvin maxwell de sauty wien s bridges , series and parallel resonance circuit , impedance and power factor of lcr circuit , e m by milikan s oil drop method , spectrometer 6 7 , photo diode characteristic apparatus , research microscope , autoclave portable , rotatory microtome with accessories , thin layer chromatography kit , binocular microscope , magnetic strirrer with hot plate , electronic digital balance , soxhlet extraction unit , spectrophotometer 340 900nm range , autoclave vertical cap 50lt...

Indian Army - Madhya Pradesh

32207014 supply of expendable medical stores , brimonidine tartrate 0.2%, eye drops , bott of 5ml , brinzolamide eye drop 1% w/v bott of 5ml , ciprofloxacineye drop 0.3% bott of 5 ml , dorzolamide 2% + timolol0.5% eye drop bott of 5 ml , dorzolamide 2%, eye drops (5ml) , fluoromethonole 0.1% eye drop, bott of 5 ml , flurbiprofen sodium ophthalmic sol 0.03% bott of 5 ml , homatropine hydrochloride,sol 2% eye drop bott of 5 ml , loteprednol etabonate 0.5% w/v eye drop bott of 5 ml , moxifloxacin 0.5% eye drop bott of 5ml , nepafenac 0.1% eye drop,bott of 5 ml , olapatadine eye drop 0.1% w/v bott of 5 ml , prednisolone acetate 1 %eye drop bott of 5 ml , sodium hyaluronate opthalmic sol(14mg/ml) pre filled solution , tropicamide 1% eye drop bott of 15 ml , trypan blue opthalmic solution0.6%in vialof 1 ml , crescent knife , irrigation & aspiration tubing set for eye , set of 10 , single piece iol lens with uv protection size : 17.0 ds , single piece iol lens with uv protection size : 18.0 ds , single piece iol lens with uv protection size : 19.0 ds , single piece iol lens with uv protection size : 19.5 ds , single piece iol lens with uv protection size : 20.0 ds , single piece iol lens with uv protection size : 21.0 ds , single piece iol lens with uv protection size : 22.0 ds , single piece iol lens with uv protection size : 23.0 ds , single piece hydrophobic pmma lens size : 17.0 ds , single piece hydrophobic pmma lens size : 18.0 ds , single piece hydrophobic pmma lens size : 19.0 ds , single piece hydrophobic pmma lens size : 20.0 ds , single piece hydrophobic pmma lens size : 21.0 ds , single piece hydrophobic pmma lens size : 22.0 ds , e/d proparacaine 0.5 % w/v bott of 5 ml , eye drape (for surgery) , eye pads/patch , inj trypan blue 0.06% , hydroxy propyl methyl cellulose 0.5% opthalmic soln (pre filled)(visco) , dextrose monohydrate for oral use,pkt of 100 gm , grouping sera anti’a’ (monoclonal) bott of 10 ml , grouping sera anti’b’ (monoclonal) bott of 10 ml , grouping sera anti’d’ (monoclonal)igm, bott of 10 ml , weak anti ‘d’ (igg), bott of 10 ml , anti human globulin, bott of 5 ml , serum anti h, bott of 5 ml , serum anti a1, bott of 5 ml , vacuatainer ( sodium flouride) with needle 2 ml , vacuatainer ( k3 edta) with needle 2 ml , vacuatainer (strile/plain gel ) with needle 4ml , 3.2% sodium citrate vacuatainer 1.8ml , pregnancy test (rapid card method) pkt of 50 test , disposable blade for microtome pkt of 50 blade , diluent erba h560, pack of 20 ltrs , lyse 1 erba h560, bott of 200ml , lyse 2 erba h560, bott of 500 ml , h clean erba h560, bott of 50 ml , eliteh5forerbah560controlforerba haematology analyser , cell pack (transasia ) xp 100, pack of 20 ltrs , stomatolyser (transasia) xp 100, bott of 500ml , cell clean (transasia)xp 100, bott of 50ml , hiv i & ii rapid test kit , hbsag rapid test kit , anti hcv rapid test kit , kit for estimation of c reactive protein (50 test) , prothrombine time test , bott of 5 ml , micropipettes tips (05 100ul) , micropipette tips (100 1000ul) , paper filter round 9cm, pkt of 100 , paper fitler square 51cm x 51cm (pkt of 100) , slide microscope. thickness 1.15mm 1.35mm size 76mm x 50mm , blood culture bottle systems (aerobic/anaerobic ) 20 ml , blood culture bottle systems (aerobic/anaerobic ) 50 ml , macconkey agar , blood agar base , cled agar , muller hilton agar , nutrient agar , dengue kit (ns1ag, igg/igm) kit of 10 test , malaria antigen rapid kit of 50 test , eight check xp 100 control for sysmex haematology analyser , em 200 xl hba1c with cal set (2x15ml / 2x5ml) , em 200 albumin small system pack (10x44ml) , em 200 alkaline phosphatise small system pack 2x44ml / 2x11ml , em 200 amylase small system pack 5x11ml , em 200 bilirubin total system pack 6x44ml / 3x22ml , em 200 bilirubin direct system pack 6x44ml / 3x22ml , em 200 caclcium (a) small system pack 5x6ml , em 200 cholesterol system pack 10x44ml , em 200 ck mb small system pack 2x12ml / 2x3ml , em 200 ck nac small system pack 2x12ml / 2x3ml , em 200 gamma gt small system pack 2x22ml / 2x6.8ml , em 200 glucose ( god – pod) system pack 10x44ml , em 200 hdl cholesterol with calibrator 4x30ml / 4x10ml , em 200 ldh – p small system pack 5x11ml / 5x4ml , em 200 ldl cholesterol with calibrator 2x30ml / 2x10ml , em 200 micro albumin control 1x1ml , em 200 micro albumin with cal 1x5ml / 2x25ml , em 200 micro protein with cal small system pack 5x 6 ml , em 200 phosphorus small system pack 5x6ml , em 200 sgot – el system pack 6x44ml / 3x22ml , em 200 sgpt – el system pack 6x44ml / 3x22ml , em 200 urea system pack 5x44ml / 5x11ml , em 200 total protein small system pack 5x6ml , em 200 triglycerides system pack 5x44ml / 5x11ml , em 200 xl autowash ac/al kit 5x44ml / 5x44ml , em 200 creatinine –enzymatic system pack 5x30 ml / 5x10 ml , em 200 erba auto wash system pack , em 200 xl multical 4x3ml , em 200 uric acid 5x44ml / 5x11ml , em 200 quanitative crp tulbilatex calibrator 2x22/ 1x11 ml , cartridge for bar code printer type wax 333plus size 55mm x 75mm , sterile urine container 20 50ml , paediatric vaccutainer sterile , paediatric vaccutainer edta , lyphochek assayed bio chemistry control level 1(siemens/roche/biorad) , lyphochek assayed bio chemistry control level 2(siemens/roche/biorad) , biorad lyphochek assayeddiabetes control (level 1&2) 06 x 0.5ml , medica easylyte plus na/k/cl solutions pack (ref 2121) with probe wipers (800 ml) , medica easylyte na/k/cl (500ml) urine diluent(ref 2111) , medica easylyte na/k/cl (90ml x 0.50g) daily rinse/cleaning solution kit (ref 2118) , urinalysisreagentstrips2para(protein& glucose) bott of 100 strips , urinalysisreagentstrips2para(ketone& glucose) bott of 100 strips , urinalysis reagent strips 10 para (multistix 10sg) bott of 100 strips for siemens urine analyser , sterilized disposable petri dish (size 90mm) , cytochrome stain kit (modified leishman’s) with stock buffer (2x)500 ml stain+500ml buffer , ck mb kit 2x8 / 2x2 ml(semi automatic) => limited...

Department of Higher Education - Madhya Pradesh

32137481 bids are invited for electronic digital balance 0.01mg , soxhlet extraction unit , uv transiluminator , compound microscope , dissecting microscope , autoclave portable , heating mental with regulator cap 1 ltrs , incubator stainless steel , digital colony counter , heating mental with regulator cap 500 ml , autoclave vertical cap 50ltrs , magnetic strirrer with hot plate , laminar air flow horizontal , binocular microscope , water bath double wall 6 holes stainless steel , hot air oven stainless steel , ph meter , water and soil testing analysis kit , vortex shaker , colorimeter , image projection system , slide readar , thin layer chromatography apparatus , laminar air flow vertical , kjeldahl digestion unit 6 test , gel electrophorasis horizontal tank with digital , deonizer with digital meter , d o meter digital , melting point apparatus digital , rotary microtome with accessories , water soil testing kit digital , spectrophotometer 340 900 nm , water bath 12 holes , double beam uv vis spectrometer without pc 200 1100nm , micro certifuge 10 1000 rpm , cork boring machine , humidity chamber , heating mentle 7 ltrs , ph meter digital , paper chromatography testing kit , chemical balance , thin layer chromatography kit , bod incubator , chromatrographic chamber , chromatrographic oven chamber , cod digestion apparatus , digital balance accuracy 0.001 200grm , digital thermostate , electronic digital balance , flame photometer , microprocessor flame photometer , polarimeter half shade , thin layer chromatography kit , oven , flame photometer , bod incubator , centrifuge machine 3000 14000 rpm , research microscope , water bath double wall , rotatory microtome with 12 holes stainless steel accessories , hot air oven stainless , magnetic strirrer with hot , water and soil testing , spectrophotometer 340 900nm range , apparatus to study charging and discharging of a capacitor , e m by milikans oil drop , zener diode characteristics apparatus with built in power supply , weight box , compound pendulum bar pendulum , jaegers apparatus to determine the surface tension , spectrometer 6 7 inches , transformer the surface tension , spectrometer 6 7 inches , transformer of mercury lamp , transformer for sodium vapor lamp , transistorized push pull amplifier , power amplifier , study of schmitt trigger circuit , study of hall effect compl1ete setup , ionization potential of lithium complete setup , fiber optics trainer , 8086 microprocessor with smps , complete apparatuses to determine e by milikons method , mosfet characteristic apparatus , lees apparatus to determine the hear conductivity of bad conductors of different geometry , complete apparatus to determine elm using thomsons method , dielectric constant apparatus , photo diode characteristic apparatus , inertia table , travelling microscope , vernier callipers , stop watch digital , newtons rings apparatus complete complete with travelling microscope power supply and sodium lamp , transistorized differential amplifier , study of amplitude modulation and demodulation trainer , apparatus to study response curve for lcr circuits and to determine the resonance frequency , battery charger 2 to 12 volt , potentiometer , single stage and double stage r.c. coupled amplifier feed back amplifier , solar cell characteristic apparatus , transistor characteristics apparatus with built in power supply and meters , physical balance , thermister characteristic apparatus , voltmeter dc ac required range , zener regulated power supply , transistorized regulated power supply , rheostate various length , diac and triac characteristic apparatus , sodium vapor lamp , fet characteristic apparatus , apparatus to study specific resistance and energy gap of a semiconductor , apparatus to determine the value of planks constant complete with photocell light source set of filter and power supply , hartley and colpitts oscillator...