Directorate Of Medical Education - Madhya Pradesh

34429793 tender for supply of chemical and reagent for mdru department third call , mdru kits and reagents , ammonium chloride 500gm , potassium bi carbonate 500gm , sodium chloride 500gm , tris hcl 500gm , sds 500gm , saturated phenol 500ml , chloroform 500ml , sodium acetate 250gm , isoamyl alcohol 500ml / 1ltr , glacial acetic acid 500ml / 1ltr , molecular biology grade agarose powder 250gm , bromophenol blue dye 2ml*5=1pack , ethidium bromide 10ml , molecular weight ( dna ladder ) 100bp & 1kb 1 vial , molecular weight ( dna ladder ) 50bp 1 vial , molecular weight ( dna ladder ) 25bp 1 vial , taq polymerase 500units / vial , amplitaq gold dna polymerase master mix 500units / vial , mgcl2 5ml , dntp mix 1ml , dnase 1000 unit , rnase 1000 unit , proteinase k 1000 unit , tris edta 500 gm , edta 250gm / 500gm , boric acid 250gm / 500gm , teepol5 liter , xylene cynol 10 gm , dmso 50 ml , tips i. 0.2 20 ?l tips , tips ii. 20 200 ?l tips , tips iii. 200 1000 ?l tips , superscript ii rnase reverse transcriptase / episcript™ rnase h reverse transcriptase ( episcript rt ) 400 / 500 reaction pack. , power sybrgreen pcr master mix 5 ml , power sybrgreen rt pcr reagent kit 5 ml , oligo ( dt ) 12 18 primer25ug ( 0.5ug / ul ) , absolute ethanol 500ml , pcr plates ( light cycler 480 compatible ) pack of 50 / pack of 100 , sealing foil ( rt pcr / qpcr grade ) ( light cycler 480 compatible ) pack of 50 / pack of 100 , filter tips each pack contains 1000 psc. , i. 0.2 20 ?l filter barrier tips , ii. 20 200 ?l filter barrier tips , iii. 200 1000 ?l filter barrier tips , mct variable tubes each pack contains 1000 psc. , i. 20 200?l tubes , ii. 200 600 ?l tubes , iii. 500 2000 ?l tubes , nitrile autodextorous gloves each pack contains 1000 psc. , mctstands for variable tubes sizes each pack contains 10 psc. , i. 20 200?l tubes stand , ii. 200 600 ?l tubes stand , iii. 500 2000 ?l tubes stand , filter tip boxes each pack contains 10 psc. , i. 0.2 20 ?l filter barrier tip box , ii. 20 200 ?l filter barrier tip box , iii. 200 1000 ?l filter barrier tip box , rt pcr grade water pack size of 20ml ( 20 ml * 5 ) , tip discard box ( 1 2 liter capacity ) each , graduated measuring cylinders 50, 100, 500, 1000 ml each , graduated beakers 50, 100, 500, 1000 ml each , flat bottom tube 5ml ( with screw cap ) pack size of 500 psc. , tube stand ( 15ml falcon, 5ml, 2ml, 0.5ml, 0.2ml mct ) pack size of 10 psc. , graduated conical flask 50, 100, 500, 1000ml pack size of 5 psc. , edta blood collection tube 5ml each pack contains 100 psc. , plain vial ( for clot activator ) each pack contains 100 psc. , fluoride vial each pack contains 100 psc. , test tube 5, 10 ml each pack contains 100 psc. , slide+cover slips ( 25mm*75mm ) each pack contains 100 psc. , tissue paper roll pack size of 12 psc. , fine tissue cloth roll pack size of 12 psc. , cotton pack size of 10 psc. , wash bottle / dropping bottle, 200ml, 500ml, 1ltr each , funnels variable range each , plastic bottle, 200, 500, 1000ml each , syringe + needle 2 ml, 5 ml pack size of 100 psc. each , nitrile gloves; medium and large size box pack size of 1000 psc. , dna isolation kit { blood } per kit , rna isolation kit per kit , phenol 500 ml , hno3 ( nitric acid ) 500 ml , propionaldehyde pure ( 97% ) 500 ml , phthalic anhydride 500 ml , glacialacetic acid ar 500 ml , hydrochloric acid ar 500 ml , sulfuric acid ar 500 ml , 2 amino ethanol 500 ml , pyridine ar 500 ml , ammonia solution ar 500 ml , ammonia chloride ar 500 ml , acetyl salicylic acid 500 ml , acetone ar 500 ml , anthranilic acid ar 500 ml , activated charcoal 500 ml , silica gel g 500 ml , benzoicacid ar 500 ml , sds 500 gm , colin ( cleaning detergent solution ) 500 ml , sterilium ( hand sanitizer ) 100 ml * 5 , dettol / lifeboy alcohol based hand sanitizer 100 ml * 5 , hypo 4% 5 l , floor cleaner phenyl 1 l * 5 , serum separator vial 3.5 ml ( vacutainer tube, 3.5ml, 13 x 75mm, plastic, additive: clot activator / polymer gel, gold hemogard closure, paper label ) pack size of 100 psc. each , labolene 1 l / 5 l , cleaning mop per psc , broom per psc , microwave gloves per pair , brown paper for autoclaving per roll , liquid nitrogen 10 / 25 ltr. , phosphate buffer saline ( 10x; ph 7.4; rnase free ) 500 ml , formalin ( formaldehyde aqueous solution; lab grade ) 500 ml , paraffin wax ( 58 600c for histology ) 500 gm , xylene ( molecular lab grade ) 500 ml , glycerol500 ml , ammonia ( nh4oh; extra pure ) 250 ml / 500 ml , methanol ( methyl alcohol, ch3oh ) 500 ml , acrylamide / bis ar 500 ml , 10x tbe buffer 500 ml , urea ( ultra pure; mol bio grade ) 500 gm / 1kg , ammonium persulfate 100 gm , temed ( ultra pure; mol bio grade ) 100 ml / 250 ml , 4’, 6 diamidino 2 phenylindole 50 ml , diethyl pyrocarbonate 5 gm / 25 gm , tae buffer , sybr gold 100ul , restriction enzyme – mnl i250 / 300 / 500 units , restriction enzyme – bcli1000 / 1500 / 2500 / 3000 units , restriction enzyme – hpych4v100 / 500 units , restriction enzyme – hpych4iii200 / 250 / 1000 / 1250 units , restriction enzyme – sau96i 1000 units , restriction enzyme – sfci200 / 1000 units , restriction enzyme – bcci1000 units , restriction enzyme – scrfi500 / 1000 / 2500 units , restriction enzyme – afliii250 / 1250 units , restriction enzyme – scai500 / 1000 / 1250 units , restriction enzyme – avai1000 / 2000 units , restriction enzyme – bsmi200 / 500 / 1000 / 2500 units , restriction enzyme – tspri ( also share cleavage site withtscai ) 1000 units , restriction enzyme – mboii250 / 300 / 1250 / 1500 units , restriction enzyme – bsh1236i500 / 1000 / 2500 units , restriction enzyme – banii1000 / 1500 / 2000 units , restriction enzyme – mph1103i1000 / 5000 units , restriction enzyme – dde i200 / 500 / 1000 / 2500 units , restriction enzyme – bsmb i ( also share cleavage site withesp3i ) 200 / 400 / 1000 units , restriction enzyme – afa i ( also share cleavage site withrsa i ) 1000 / 5000 units , restriction enzyme – bal i ( also share cleavage site withmlu ni ) 50 / 100 / 200 / 250 units , restriction enzyme – fspi ( also share cleavage site withnsbi ) 400 / 500 / 1000 / 2500 units , restriction enzyme – hpa ii ( also share cleavage site withmspi ) 1000 / 2000 / 4000 / 5000 / 10000 units , restriction enzyme hinf i , restriction enzyme hpych4 , restriction enzyme mboii , restriction enzyme bstui , restriction enzyme mvai , primers , fmr1 set 1 –f5 tcaggcgctcagctccgtttcggtttca 3 r5 5 aagcgccattggagccccgcacttcc 3 , mecp2 exon 1 set 1 f5 gttatgtctttagtctttgg–3´ r5 tgtgtttatcttcaaaatgt–3´ , exon 2set 1 f5 cctgcctctgctcacttgtt–3´ r5 ggggtcatcatacatgggtc–3´ , exon 2set 2 f5 agcccgtgcagccatcagcc–3´ r5 gttccccccgaccccaccct–3´ , exon 3 set 1 –f5 tttgtcagagcgttgtcacc–3´ r5 cttcccaggacttttctcca–3´ , exon 3 set 2 f5 aaccacctaagaagcccaaa–3´ r5 ctgcacagatcggatagaagac–3´ , exon 3 set 3 f5 ggcaggaagcgaaaagctgag–3´, r5 tgagtggtggtgatggtggtgg–3´ , exon 3 set 4 – f5 5´–tggtgaagcccctgctggt–3´ r5 ctccctcccctcggtgtttg–3´ , exon 3 set 5 f5ggagaagatgcccagaggag–3´ r5 cggtaagaaaaacatccccaa–3´ , exon3 ( l100v ) f5 aaccacctaagaagcccaaa 3 r5 gcttaagcttccgtgtccagccttcaggta 3 , putative promoter and exon 1. f5 gggtgcaatgaaacgctta 3 r5 tttaccacagccctctctcc 3 , mc4r rs17782313 f 5 aagttctacctaccatgttcttgg 3 r 5 ttccccctgaagcttttcttgtcattttgat 3 fto rs9939609 f 5 aactggctcttgaatgaaataggattcaga 3 r5 agagtaacagagactatccaagtgcagtac 3 , adipoqrs2241766 – f5 tgtgtgtgtggggtctgtct 3 r 5 tgtgatgaaagaggccagaa 3 , rs1501299 f5 ctacactgatataaactatatggag 3 r5 ccccaaatcacttcaggttg 3 , pcsk1 rs155971 – f5’tatatgcagccaccaatcca 3’ r5’aaaatgaagggagaagcacaaa3’ , pomcrs6232 f5 ttgtgcccttcatctgaaca 3 r5 tgtagcaactttggcatgga 3 , rs155971 f5tatatgcagccaccaatcca 3 r5 aaaatgaagggagaagcacaaa 3 , ppar g ( pro12ala ) f5gcc aat tcaagc cca gtc 3r5gat atgttt gca gac agt gta tca gtg aaggaa tcg ctttcc g 3 , kcnj11 ( rs5219 ) f5 gactctgcagtgaggcccta 3’ r5 acgttgcagttgcctttctt 3’ , capn10 ( rs3792267 ) f5 cacgcttgctgtgaagtaatgc 3’r5 tgattcc catggtctgtagcac 3’pik3ca set 1 forward 5’ ggagtatttcatgaaacaaatgaatgatgcg 3’ reverse 5’ gagctttcattttctcagttatctt 3’ , bat 25 set 1 f 5’ tcgcctccaagaatgtaagt 3’r 5’ tctgcattttaactatggctc 3’bat 26 set 1 f5’ tgactacttttgacttcagcc 3’r5’ aaccattcaacatttttaaccc 3’ , d2s123 set 1 f5’ aaacaggatgcctgccttta 3’ r5’ ggactttccacctatgggac 3’ , d5s346 set 1 f 5’ actcactctagtgataaatcggg 3’ r5 agcagataagacagtattactagtt 3 , d17s250 – set 1 f5’ ggaagaatcaaatagacaat 3’ r5’ gctggccatatatatatttaaacc 3’ , impdh2 set 1 f5 gtttctgcggtatcccaatc 3 r5 cgagcaagtccagcctat 3 bmp6 rs73719353 f5’ gctcctttgcacttcgctgt 3’ , r5’ aggctctgctg agctcctac 3’ , bmp6 rs73719341 f 5’tgaacttcccattcccctct 3’ r5’ataaaattagcattgatcca 3’ , bmp6 rs73719318 f5’caggtgctgtgcaacttctt 3’ r 5’agagggcaccatggttgcct 3’ , bmp6 rs73381662 f 5’ ctgagattcaattaggccca 3’ r 5’taaagaacagcaaaagtctg 3’ , bmp6 rs73381650 f 5’cacataaagattgctgcatt 3’ r 5’tagtaatcctaaaaatggga 3’ , anxa2 rs7170178 f 5’ ttcacagcagttcaaaatac 3’ r 5’ ctgggtttccagagatggaa 3’ , anxa2 rs73435133 f 5’ gagtgcaaggtgctgaggat 3’ r 5’ gatttcagacagcccttgca 3’ , anxa2 rs73418020 f 5’ tctgagagtgaaaggtgcac 3’ r 5’ tcccatcccctgaatccctg 3’ , anxa2 rs72746635 f 5’ cctgactcattgtcacatca 3’ r 5’ aagtggctttccactgccc 3’ , anxa2 rs73418025 f 5’ cttctcatcttactttt 3’ r 5’ agggaaggatacagaggaga 3’ , hsp 70 primer sequence5 agcgt aacac cacca ttcc 3 ( forward ) 5 tggct cccac cctat ctc 3 ( reverse ) , the gapdh sequence forward primer 5 agc cac atc gct gag aca c 3, reverse primer 5 gcc caa tac gaccaa atcc 3. , mthfr f:5 tgtggtctcttcatccctcgc 3;r: 5 ccttttggtgatgcttgttggc 3. , dpyd f:5 actcaatatctttactctttcatcaggac 3. r: 5 acattcaccaacttatgccaattct 3. , tyms f:5’ ggtacaatccgcatccaactatta 3’ r:5’ ctgataggtcacggacagattt 3’ , imp3 forward:5’atgactcctccctacccg3’ reverse:5’gaaagctgcttgatgtgc3’ , cxcl1forward: 5’ccagacccgcctgctg 3’and reverse:5’cctcctcccttctggtcagtt 3’ , cox 2 forward: 5 cagccatacagcaaatcc 3; reverse: 5 tcgcacttatactggtcaa 3 , hmlh1f 5 ttt tga tgt aga tgt ttt att agg gtt gt 3r 5 acc acc tcatcataa cta ccc aca 3 , ppar g ( pro12ala ) , f5gcc aat tcaagc cca gtc 3 , r5gat atgttt gca gac agt gta tca gtg aaggaa tcg ctt tcc g 3 , methylated ( hmlh1 ) f 5 acg tagacg ttt tat tag ggt cgc 3 r 5 cct catcgtaac tac ccg cg 3 , hmsh2 f 5 ggt tgt tgt ggt tgg atg ttg ttt 3 r 5 caa cta caa cat ctc ctt caa cta cac ca 3 , methylated ( hmsh2 ) f 5 tcg tgg tcg gac gtc gtt c 3 r 5 caa cgt ctc ctt cga cta cac cg 3 , ? actin: forward: 5’ ctacgtcgccctggacttcgagc 3’ ß actin: reverse: 5’ gatggagccgccgatccacacgg 3’ , kras forward: 5 gactgaatataaacttgtggtagttggacct 3.reverse: 5 ctattgttggatcatattcgtcc 3. , braf forward: 5 tcataatgcttgctgatagga 3. reverse: 5 ggccaaaaatttaatcagtgga 3. , mthfr ( c677t ) ‘‘5 gcacttgaaggagaaggtgtc 3” and reverse primer ‘‘5 aggacggtgcggtgagagtg 3” , mthfr ( a1298c ) forward ‘‘5 ctt tgg gga gct gaa gga cta cta c 3” and reverse ‘‘5 cac ttt gtg acc att ccg gtt tg 3” primers. , total rna isolation mini kit ( from human skin tissue ) / rneasy fibrous tissue mini kit ( for rna extraction from human skin tissue ) ( qiagen ) per kit ( each kit pack is for 50 reactions ) , purospin™ fibrous tissue rna purification kit ( luna nanotech ) ( for rna extraction from human skin tissue ) per kit ( each kit pack is for 250 reactions ) , aurum™ total rna fatty and fibrous tissue kit ( biorad ) / mp biomedicals fastrna pro green kitper kit ( each kit pack is for 50 reactions ) , human leptin elisa kit per kit ( each kit pack is for 96 reactions ) , human adiponectin elisa kit per kit ( each kit pack is for 96 reactions ) , human adipsin elisa kit per kit ( each kit pack is for 96 reactions ) , human resistin elisa kit per kit ( each kit pack is for 96 reactions ) , human iron elisa kit ( serum iron ) per kit ( each kit pack is for 96 reactions ) , human ferritin elisa kit ( serum / ferritin ) per kit ( each kit pack is for 96 reactions ) , gdf15 human elisa kit per kit ( each kit pack is for 96 reactions ) , spexin human elisa kit per kit ( each kit pack is for 96 reactions ) , human pai 1 elisa kit per kit ( each kit pack is for 96 reactions ) , thyroid estimation kit per kit ( each kit pack is for 96 reactions ) , ice maker machine for laboratory purpose 1 unit , microwave gloves each packet contains one pair of gloves. , pcr mini cooler / coolcube microplate and pcr tube cooler each , pipette 0.5 10ul, 02 20ul, 10 100ul, 20 200ul and 100 1000ul. each , horizontal gel apparatus: 18 – 20 cm ( length ) x 25 – 30 ( breadth ) x 5 7.5 cm ( height ) , 40 60 samples, multichannel pipette compatible combs and gel caste each , mini horizontal gel apparatus: 9 cm w x 11 cm l with grooves ( 8.7 cm l x 1.2 cm h ) on the side for gripping the gel tray. it should have two comb slots on the same tray area. buffer capacity should be 600 ml for the buffer tanks and optimum gel runs with a fill line indicator for buffer levels along the unit side each , multi size forceps lab set each packet containsmulti size forceps lab set , liquid nitrogen sample storage tanks each , liquid nitrogen sample handling gloves each packet contains one pair of gloves. , slide tray / rack each , l mold each , tissue cassette steel each , electric tissue float bath ( thermostate ) each , coupling jar each pack contains 2 psc. , staining rack each , whatman filter paper grade 1 & 2 each packet contains 50 psc.. , harri’s hematoxylin powder 25 / 50 / 100 / 250 / 500 gm , yellow eosin powder 25 / 50 / 100 / 250 / 500 gm , coverslip 18x18 ( microscopic ) each packet contains 100 psc.. , dpx mount 100 ml / 250 ml , hot plate each , mx35 premier microtome blade ( 34 / 80mm ) 50 blades each box contains 50 psc.. , diamond point marker pen ( histopathology use ) each , embedding mold and embedding ring each , qiamp dna ffpe tissue kit ( 50 rxns ) , genomic dna purification kit ( promega ) , rna extraction kit from tissue , cdna synthesis kit , superscript ii rnase reverse transcriptase , sybr green pcr master mix , sodium bisulphite , page loading dye , formamide , n’n’ methylene bisacrylamide , ammonium persulfate , temed , polyacrylamide , wizard dna clean up system ( promega ) , 2 mercaptoethanol , silver stain , hydroquinone , urea , blotting paper , dna ladder 10 bp , pas stain , histopathology plastic cassettes , poly – l – lysine coated slides , deep well mortar and pestle homogenizers ( medium size ) , deep well mortar and pestle ( small size ) , rneasy minielute cleanup kit , phase – lock gel heavy5 prime phase – lock gel heavy5 prime , qiazol lysis reagent , rneasy minielute cleanup kit , cryo vial 1 pkt contains 50 psc. , deep well mortar and pestle ( small size ) ...

Directorate Of Medical Education - Madhya Pradesh

34145016 supply of medicine / surgical / iv fluid / surgical suture / surgical stapler / chemical kits aceborophylline 100 mg amantadine 100mg capsule apripitant capsule 125mg & 80mg calcitrol 0.25 mg cap calcitrol 0.5mg capsule calcitrol calcium carbonate and zinc capsule chloramphenicol 250mg capsule chloramphenicol 500mg capsule crizotinib 250mg capsule cyclosporine 100 mg cyclosporine 50 mg deferiprone 500 mg cap. imatinib mesylate 100 mg oseltamivir ( 45mg ) , capsule palbociclib 100 mg cap palbociclib 75 mg cap sildenafil 20mg tetracycline capsules 250 mg tetracycline capsules 500 mg ulipristal acetate capsules 5mg acyclovir 3% ear drop beclomethasone ( 0.025% ) + clotrimazole 1% +neomycin sulphate 0.5% 5 ml ear drop fluromethanol eye drop gentamycin eye drop homatropine hydrobromide eye drop ip 5ml sterile lignocaine hcl 4% eye drop natamycin eye drop polyethelene glycol 400 & propylene glycol ophthalmic solution 10ml polyvinyl alcohol 1.4% 5 ml prednisolone eye / drop. proparacaine hydrochloride 0.5% eye drops 5ml sodium chloride opthalmic solution 5% eye drop acyclovir 3% eye oint.5 gm tube atropine eye oint. 3gm tube chloramphenicol eye ointment 5 gm tube ciprofloxacin eye ointment 5 gm tube hydroxypropylmethylcellulose 2% w / v ophthalmic solution ocular lubricant 5gm ointment tobramycin eye oint.3gm tube benzocain gel chlorhexadine gel choline salicyclic gel triamadone accetate gel sterile collogen granules nephro steril ( alanine 6.3 gm+l arginine 4.9 gm+l histidine 4.3 gm+l isoleucine 5.1 mg+l leucine 10.3 mg+l lysine 10.01 gm+l phenylalanine 3.8 gm+l threonine 4.8 gm+l valine 6.2 gm+methionine 2.8 gm+n acetylcarnosine 0.5 gm+proline 4.3 gm+serine 4.5 gm+tryptophan 1.9 gm ) 250ml infusion normal saline 1.6% 500 ml bottle parenteral nutrition two chamber bags without lipid ornidazole iv infusion 100ml bottle ringer lactate i / v 0.24 % v / v of lactic acid ( eq. to0.32% w / v of sodium lactate ) , 0.6 % w / v sodium chloride, 0.04 %w / v potassium chloride and 0.027 % w / v calcium chloride 500 ml ffs bottle ringer lactate i / v 0.24 % v / v of lactic acid ( eq. to0.32% w / v of sodium lactate ) , 0.6 % w / v sodium chloride, 0.04 %w / v potassium chloride and 0.027 % w / v calcium chloride 500 ml glass bottle sodium chloride hyper tonic n / 2 ( 0.45% ) 500 ml ffs bottle sodium chloride ( 1 / 2 n ) + dextrose 0.45% + 5% 500 ml ffs bottle desflurane 240ml bottle solution usp inhalation anaesthetic adalimumab 20mg / 0.4ml inj adalimumab 40mg / 0.8ml inj adenosine 3 mg / ml 2 ml amp ado trastuzumab emtansine 100 mg inj alteplase 50mg inj amidotrizoate meglumine; sodium amidotrizoate ( 76% ) dye 50 ml bottle aminophylline 25 mg / ml 10 ml vial ampicillin+sulbactum 1.5 mg inj anti d. immunoglobulin ( monoclonal ) ( 150mcg / vial ) human anti d, anti d. immunoglobulin ( monoclonal ) ( 300mcg / vial ) , human anti d anti human thymocyte immunoglobulin 25 mg anti scorpion venom inj <120mg total protein and >150 ld50 [ mouse ] neutralizing units / vial benfothiamine + folic acid + mecobalamin + pregabalin + vit b6 inj benzathine penicilline 12 lac iu / vial betamethasone sodium phosphate 4 mg / ml 1 ml amp biphasic insulin aspart ip penfill 100 iu inj 3 ml cartridge bortezomib 3 .5 mg / vial botalinin 100iu inj botalinin 200iu inj botulinum toxin type a injection buprenorphine hydrochloride 0.3mg base / ml 1ml amp inj butorphanol 1mg / ml 1ml amp carboprost tromethamin 250 mcg / ml 1ml amp cefuroxime 1.5gm inj cefuroxime 500mg inj cetuximab 100mg 2mg / ml vial cetuximab 200mg 2mg / ml vial cetuximab 50mg 2mg / ml vial chloramphenicol 500mg inj chlorpromazine ip 25mg vial cholecalciferol 600000 iu / ml injection cis atracurium 2mg / ml vail cladribine 10 mg / 10ml inj clonidine hydrochloride 100 mcg / ml 10 ml vial contrast urograffin inj cytarabine 1000 mg iv cytarabine 100mg injection cytarabine 1gm inj daunorubicin 50 mg / vial dexamethasone sodium phosphate ( 8mg / 2ml ( 2ml vial ) dextron 40 inj diatrizoate meglumine & diatrizoate sodium ( 37% ) vial diatrizoic acid 60% amp diatrizoic acid 65% amp diatrizoic acid 76% ( urographin dye ) injection diazepam 5 mg / ml 2 ml amp dicyclomine 10mg / ml 2 ml vial digoxin i.p. 0.5mg / 2 ml amp diltiazem 25mg / 5ml vial diphtheria antitoxin 1000 iu vial doxorubicin 500mg injection doxycyclin 100 mg injection edaravone 60 mg inj enalapril maleate inj 1.25 mg per ml 2ml vial ephedrine 30mg / ml 1ml inj esmolol / 40mg / ml 5 ml vial etanercept 25mg inj etanercept 50mg inj etomidate 2 mg / ml emulsion with mct 10ml vial fentanyl 100 microgran 2 ml amp fentanyl 50 microgran 2 ml amp fluorescein 20% 5 ml amp flupentixol 20 mg inj flupentixol 25 mg inj fluphenazine 25 mg / ml 1 ml amp ganciclovir 500 mg vial gas gangrene antitoxin 10, 000 iu / ml 40000 iu 4ml amp gatifloxacin vial gentamycin 80mg / 2ml amp glutathion 600mg inj granulocyte colony stimulating factor ( gcsf ) inj haemocoagulase 1 iu inj haemophilus influenzae type b vaccine hepatitis b vaccine / 1ml hyaluronidase 1500 iu / 2ml amp ifosfamide + mesna 1gm inj infliximab 100mg inj insulin glargine injection iohexol ( non ionic contrast medium in sterile aqueous solution ) 300 mg iodine / ml 100 ml bottle isobaric levobupivacaine 0.5% inj isoprenalin inj 1ml amp isoxsuprine hcl 5mg / ml 2ml amp ketamine hydrochloride 50 mg / ml 10 ml ketoprolac tromethamine 30 mg inj l aspiraginase 10000iu inj leuprolide 6.25mg inj levobupivacaine hyperbaric 0.5% lidocaine 4%, 5 ml vial lignocaine ( preservative free ) 2% 50 ml vial lignocaine 10% injection lignocaine 4% 30 ml vial lignocaine for spinal anaesthesia lignocaine 5% + destrose 7.5% 2 ml amp heavy lorazepam 2 mg / ml, 1 ml vial low molecular weight dextran 40000 vial mannicoccal acwy 0.5 ml inj meningococcal polysaccharide vaccine groupe a, c, y and w 135 combined vial mephentermine 30 mg / ml 10 ml mesna 200mg injection methacarbamol 100 mg. / 10ml vial methotrexate 500mg injection metoprolol 5mg / ml 5ml vial micafungin 100 mg micronised progesterone 50mg / ml 2ml amp micronized progesterone 100mg / ml 2ml amp milrinone 1mg / ml solution for injection / infusion mitomycin c 40mg inj mitoxantrone 15 mg inj morphine sulphate 10mg / ml 1ml amp naloxone 0.4 mg / ml, 1 ml nikethamide amp nimodipine 10mg / 50ml injection nitrofurantoin injection olanzapine 10 mg inj olanzapine depot inj panitumumab 100mg / 5ml inj pembrolizumab 100mg / 4ml ( 25mg / ml ) penicillin v 125 mg inj pentoxiphylline 20 mg / ml pertuzumab 30mg / ml ( 420mg / 14ml ) phenobarbitone 100mg / ml 1ml amp. phenobarbitone 200mg / ml 1ml amp. pilocarpine 0.5 % / 1ml amp piperacillin 2 gm+tazobactam 250 mg placenta extract 2 ml injection pneumococcal vaccine 10 ml vial pregabalin inj progesterone b.p.100mg vial promethazine 2 ml / 2.5% vial protamine sulphate 1%, 10mg / 5ml amp quinine sulphate 300 mg / ml, 2 ml amp romiplostim 250 mg injection romiplostim 500 mg injection ropivacaine 0.5% 20 ml vial ropivacaine 0.75% 4ml amp ropivacaine 10mg / ml 2.5ml vial ropivacaine hydrochloride 0.2% 40mg / 20ml vial ( 2mg / ml ) ropivacaine hydrochloride 0.75% 150 mg / 20 ml vial ( 7.5mg / ml ) sargramostim 500 mg inj soluble insulin penfill 3 ml injection surfactant ( porcine lung surfectant extract 80mg / ml ) terbutaline 0.5mg / ml aml amp teriparatide 600mcg 3 ml amp tetanus immunoglobulin usp 500 iu / vial thiamine 400mg inj thiamine hydrochloride inj.100mg / ml 2ml vial multiple dose ( vit.b1 ) thiopentone sodium 0.5gm powder / vial, 20 ml vial tobramycine 80 mg vial tocilizumab 400 mg inj torsemide inj 2ml amp trypan blue opthalmic solution 0.06% pre filled syringe ulinastatin 100000iu injection urokinase 500000 iu vial vasopressine 40 iu / ml amp verapamil hydrochloride 2.5 mg / ml 2ml amp vinblastine 10 mg / 10 ml amp vinorolbine 50mg inj vit d3 injection vit. cynocobalamin 500mcg +folic acid 15mg+niacinamide 200 mg + ascorbic acid inj vit. cynocobalamin 500mcg +folic acid 15mg+niacinamide 200 mg inj vit. methylcobalamin 1500 mcg +folic acid 0.7mg+ niacinamide 12 mg inj water for injection 10 ml amp zuclopenthixol acuphase 50 mg inj zuclopenthixol decanoate 200 mg inj acetic acid solution 3% 100ml acetone detection kit ada kit ae 1 / ae 3 aluminium ammonium sulphate powder 500gm amacr ana test kit anti a lactin 05ml anti ab sera 10ml anti d igg+ igm 10ml anti d igm 10ml anti h lactin 05ml anti her / erbb2 monoclonal anti human globulin ( ahg ) 05ml anti a sera 10 ml anti b sera 10 ml banded use in blood bank barium chloride 10 % 500 ml bcl 2 benedict reagent 5 lit cane bismark brown stain 100 gm blood culture media aerobic for adult ( bac t / alert pf plus blood culture media anaerobic for pediatric ( bac t / alert pf plus ) blotting paper 50 / pkt bovine albumin 22% 05ml buffer solution for hiv 50ml ca 125 calcium chloride 05ml / vail capillary tube cd34 combined spinal epidural ( cse ) kit couplin jar cover slips size 18x18mm cover slips size 22x22mm cox 2 csf protein kit cyclin d 1 cyto fix spray desmin disposable microtome blade ( 50 blades in one ) dpx mount 250ml ehlrich aldehyde reagent 125 ema estrogen receptor epi monoclonal filter paper 12.5 cm 0.1 micron ( 50 per pkt ) fouchet reagent 250ml glacial acetic acid 100 ml glial fibrillary acidic protein ( gfap ) h2so4 25 % 500 ml bottle haematoxylene 5gm haemoglobin strip hbv elisa test kit 4th generation 96 test hbv rapid test kit hpr polymerr kit with dab chromogen hydro chloride acid about 36.46% i.d. microtyping abd card i.d. microtyping gel card ahg immersion oil iso propyl alcohol ki67 / mib 1 06 ml antibody kit leishman stain 500 ml leucoreductionfilter ( bed side ) light green stain 100 gm liquid ammonia 500 ml liss diluent for gel card malaria parasite elisa test kit massons trichrome stain mercuri oxide 25gm methanol 2.5lit mgg 480ml multi parameter urine strips ( 100 in 1 box ) myogenin n / 10 hcl 500ml nfp nitric acid 500 ml nkx 3 1 p 53 pandys reagent 125ml pap pen papanicalou ea 125ml pea 030 papanicalou og 6 125ml pea 010 paraffin wax 58 60c pas stain pasture pipette poly l ltsin solution p8920 polythene gloves pricking lancet progestron receptor monoclonal retic stain 125ml s 100 sharp collection containers disposable 5 ltrs sharp collection containers disposable 1.5 ltrs single donor platelet kit make haemonotics / terumo penpol ( close system ) slide tray sma sodium chloride for analysis steel cassets for tissue processing sulpgar powder 500 gm sulpho salicylic acid 500ml synaptophysin tips for auto pippets ( 2 to 100 micron yellow 1000 / pkt ) tips for auto pippets ( 200 to 1000 micron blue 500 / pkt ) tissue paper roll titriplexiii pure ( edta ) tris buffer gr tween 20 for synthesis vdrl elisa test kit vimentin wafers cutting blade for tube welders xylene chlorhexidine mouthwash 0.2% 50 ml sterile haemocoagulase solution topical solution 0.2 cu nasal drop saline nasal gel 15 gm tube budesonide nasal spray 32mcg / spray methylcobalamin nasal spray 250 mcg saline nasal wash 3gm kit sodium chloride nasal wash betamethasone 0.5mg, gentamicin 1mg betamethasone valerate cream 0.05% 15gm betamethasone valerate ointment 0.1%, 15 gm tube centella asiatica extract based skin moisturization and antiscar gel 30gm clindamycin ointment 10gm fluconazole ointment 20 gm tube fusidic acid 2%, 15 gm heparin 20gm oint human placental extract ointment ketoconazole cream lidocaine zinc oxide ointment luliconazole cream la magnesium sulphate, sulphacetamide, urea, proflavin ( in glycerine base ) ointment75 gm neomycin sulphate 5 mg + bacitracin zinc 500 iu / gm, 15 gm papain urea and silk protein based debriding ointment and cream 100 gm papain urea and silk protein based debriding ointment and cream 25 gm papain urea and silk protein based debriding ointment and cream 50 gm papain urea 15 gm tube povidone iodine ointment 7.5%, 500 gm salicylic acid 2%, 30 gm silk protein based antimicrobial wound healing ointment loaded with asiaticoside and silver 100 gm silk protein based antimicrobial wound healing ointment loaded with asiaticoside and silver 25 gm silk protein based antimicrobial wound healing ointment loaded with asiaticoside and silver 250 gm silk protein based antimicrobial wound healing ointment loaded with asiaticoside and silver 50 gm silver sulphadiazine cream usp 1% w / w 250gm clotrimazole+beclomethasone oral paint triamcinolone oromucosal paste bp 0.1% ketocanazole oral paste triamcinolone acetonide dental paste usp 0.1% barium sulphate powder 250 gm clotrimazole powder neomycin sulphate+polymycin b powder polyethylene glycol + electrolyte powder protein powder silk protein and antimicrobial nano silver based surgical particle wound dressing 5ml vial n acetylcysteine solution for inhalation respules tiotropium ( 18 mcg ) + formoterol ( 12 mcg ) fostomycin sachet 3gm orodispersible probiotic sachet acyclovir lotion beclomethasone lotion citric acid 500 ml bottle compound benzointincture, benzoin, aloe, storax, tolu balsam and enough alcohol to make a tincture ( 74 80% alcohol ) , 100 ml feracrylum solution 1% 100 ml gention violet l / a glycerine 15% and sodium chloride 15% enema 20ml sodium hypochloride solution 5% 5 ltr topical heparin solution 5ml vial benzocaine +cetramide spray lignocaine spray 10% absorbable 2 0 endo suture cartridge 48 length advance rf energy hand instrument of 5 mm shaft diameter for laproscopic procedures with shaft length 35 cm and should be both hand and foot activated. compatible with ultrasonic vessel sealing dissector system installed in myh advance rf energy hand instrument of 5 mm shaft diameter for open procedures with shaft length 14 cm and should be both hand and foot activated. compatible with ultrasonic vessel sealing dissector system installed in myh circular stapler for end to end anastomosis with 31 mm diameter having varied staple height of 3.5 4 4.5mm circular stapler for end to end anastomosis with 31 mm diameter having varied staple height of 4 4.5 5mm circular stapler for end to end anastomosis with 33 mm diameter having varied staple height of 3.5 4 4.5mm circular stapler for end to end anastomosis with 33 mm diameter having varied staple height of 4 4.5 5mm disposable circular stapler 31mm diameter disposable circular stapler – 32mm diameter disposable circular stapler 33mm diameter disposable circular stapler iii rows disposable circular stapler 25 / 26mm diameter disposable circular stapler 28 / 29mm diameter disposable clip applier medium 10mm with 20 clips disposable clip applier medium 5mm with 16 clips disposable curved cutter stapler disposable hemorrhoidal stapler iiirows disposable hemorrhoidal stapler with detachable anvil. disposable linear stapler with fixed staple height 75mm 90mm size disposable linear stapler with fixed staple height 55mm 60mm size disposable trocar 05mm disposable trocar 10mm disposable trocar 12mm disposable trocar 15mm distal tip closure titanium ligation clip large size distal tip closure titanium ligation clip medium size distal tip closure titanium ligation clip small size endoscopic cutter & stapler 60mm long length endoscopic cutter & stapler 60mm regular length endosuturing device 10mm with toggle lever handpiece ( blue ) compatible with ultrasonic vessel sealing dissector system installed in myh handpiece ( transducer ) compatible with ultrasonic vessel sealing dissector installed in myh hemorrhoid stapler 33.5 mm diameter with detachable anvil, bridged anoscope, housing of 20 cc locking clip cartridge medium / large mesh fixation device with non absorbable titatinum tacks 20 multifire clip applier long size 15 clip multifire clip applier small size 20 clip non absorbable 2 0 endo suture cartridge 48 length open clip applicator 100 20cm length open clip applicator 200 20cm length open clip applicator 300 open clip applicator 400 open disposable clip applier for medium clip size 9.75 having 20 clips open linear cutter reload with 3 rows of staple line having varied satple height of 3.5 4 4.5 mm in reload having 60mm length open linear cutter reload with 3 rows of staple line having varied satple height of 4 4.5 5 mm in reload having 60mm length open linear cutter stapler compatible with 3 rows of staple line having varied satple height of 3.5 4 4.5 mm in reload having 60mm length open linear cutter stapler compatible with 3 rows of staple line having varied satple height of 4 4.5 5 mm in reload having 60mm length plastic locking clip applicator medium / large polycearbonte bladeless trocar with reducer seal 10mm polycearbonte bladeless trocar with reducer seal 12mm polycearbonte bladeless trocar with reducer seal 5mm polyproplene with polyglecaprone 25 partially absorbable mesh 7.6cm x 15cm polyproplene with polyglecaprone 25 partially absorbable mesh 10cm x 15cm reload 55 60mm for medium thick tissue blue compatible with linear cutter. reload 55 60mm for thin / vascular tissue white compatible with linear cutter. reload 75 80mm for medium thick tissue blue compatible with linear cutter. reload 75 80mm for thick tissue green compatible with linear cutter. reload compatible with curved cutter reload endoscopic cutter & stapler 45mm purple reload endoscopic cutter & stapler 60mm purple reload endoscopic cutter & staplter 45mm blue reload endoscopic cutter & staplter 45mm green reload endoscopic cutter & staplter 60mm / black reload endoscopic cutter & staplter 60mm blue reload endoscopic cutter & staplter 60mm gold reload endoscopic cutter & staplter 60mm green reload endoscopic cutter & staplter 60mm white reload for linear stapler with fixed staple height 35mm 45mm size blue reload for linear stapler with fixed staple height 35mm 45mm size green reload for linear stapler with fixed staple height 55mm 60mm size blue reload for linear stapler with fixed staple height 55mm 60mm size green reusable laparoscopic clip applicator for large titanium clips with 15cm 20cm length reusable laparoscopic clip applicator for large titanium clips with non detachable jaw assembly reusable laparoscopic clip applicator for large titanium clips. reusable laparoscopic clip applicator for medium large titanium clips with 28cm 30 cm length reusable laparoscopic clip applicator for medium large titanium clips with non detachable jaw assembly reusable linear cutter 55 60mm with 200 firing reusable linear cutter 75 80mm with 200 firing single use clip applier with 16 clips, 5mm diameter having display counter instrument u shaped clip suture locking autolock titanium clip 100 titanium clip 400 universal reload cartridge for 55 mm / 75mm new linear cutter for tissue thickness ranging from 1 mm to 2 mm with 6 rows of staples 3 on either side of cut line, 440 grade stainless steel knife integrated in the cartridge , 88 titanium staples / 118 titanium staples. universal stapler 55mm / 75mm new linear cutter along with staple height selector and 3d staple technology with ambidextrous firing with 6 rows of stapler height range of 1.5 mm to 2.00 m. paracetamol suppository abdominal drain no 8 abdominal drain bag accessory spikes amorphous hydrogel with colloidal silver antimicrobial , liquid parafin based silver sulphate antiseptic tulle 10cmx12cm antimicrobial incise drape 3 meter antimicrobial, liquid paraffin based chlorhexidien antiseptic tulle 10cmx12cm arterial pressure bag 1000ml arterial pressure bag 500ml ash brace m size barium sulphate liquid 1 liter bionet connector biopsy forceps type with / without spike / hot biopsy, length : 110cm / 160 cm / 210 cm, sterile for single use only, diameter – 1.8 mm / 2.5 mm as ordered bipolar forceps cable bis monitor electrode black monofilament 2 / 0 rc loop black thread ( stitching ) big bleaching powder gr ii 25 kg bag blood bag double 350 ml cpd solu blood bag double 350 ml with sagam blood bag quadruple 350 ml top bottom with cpd sagam solu blood bag quadruple 450 ml top bottom with cpd sagam solu blood bag single 350 ml blood bag transfer 350 ml blood bag triple 350 ml blood bag triple 350 ml sagam blood culture bottles bone marrow aspiration needles ( 14 ) bone marrow aspiration needles ( 15 ) bone marrow aspiration needles ( 16 ) bone marrow aspiration needles 13 g bone marrow biopsy needle bp cuff adult & pediatric carbolic acid 500 ml cardiovascular angiographic catheter 100cm, 4fr ( 1.35mm ) catheter single lumen 6.6 no catheter single lumen 7.7 no cautery patient plate disposable central venous line 4f cerebral catheter reservoir 12mm dia chamber cerebral catheter reservoir 18mm dia chamber cervical soft collar chlorhexidine gluconate dressing material chlorinated lime with boric acid solution 400ml cling drape 15x500cm closed suction trachostomy suction tube with pro s collegen patch collogen sheet 10x10 collogen sheet 15x15 colostomy kit condom catheter small, meadium, large conjugated drain craniotomy cutter blade cresol with soap solution 5ltr jar cvp manometer cylinder connection nut dermatome blade disposable haemorrhoidal circular stapler with dual safety with transparent housing size 34 dj stent 6 / 26 double monitoring pressure transducer dry collagen patch , non adhesive absorbalbe porus lyophilized fish origin collogen 10x10cm. dry collagen patch , non adhesive absorbalbe porus lyophilized fish origin collogen 30x30cm. dura guide for neuro surgery ecg paper 80mmx20 mtr roll ecg paper computerized triple channel 20m elastomeric pump for post operative analgesia endo stich lap suturing device 10 mm endotracheal tube with secondary lumen for surfactant therapy, size 2, 2.5, 3, 3.5, 4, 4.5 exchange transfusion catheter with four way adaptor size 4cm, l 40 cm extra ventricular drain ( evd ) fibrin & tissue glue fluorescein strips pkt foam sclerotherapy fibre fogartis catheter 4 fr gasket for vaccume jar 1000 ml gasket for vaccume jar 600 ml gasket for humidifier bottel guide wire m 0.89mm, 150cm halogen bulb holder ( heavy duty ) hemodialysis fluid for bicarb made ( part a 10 ltr + part b 500gm ) hip u drape humbys knife disposable blade hydrocephalus shunt medium pressur ( vp shunt ) hydrogen peroxide 21% w / w, paracetic acid 4% w / w, acetic acid 10% w / w ( cold st disinfectant for dialysis ) icd bag implantable pain port with epidural catheter for long term pain management impregnated antimicrobial latex two way foleys catheter with silicon should be impregnated with silver nano particles to prevent catheter associated uti and catheter blockage should have strong drainage funnel, double fixed non return valve for free inflation and deflation. size 14 balloon capacity between 1ml to 30ml, 50ml impregnated antimicrobial latex two way foleys catheter with silicon should be impregnated with silver nano particles to prevent catheter associated uti and catheter blockage should have strong drainage funnel, double fixed non return valve for free inflation and deflation. size 16 balloon capacity between 1ml to 30ml, 50ml impregnated antimicrobial latex two way foleys catheter with silicon should be impregnated with silver nano particles to prevent catheter associated uti and catheter blockage should have strong drainage funnel, double fixed non return valve for free inflation and deflation. size 18 balloon capacity between 1ml to 30ml, 50ml impregnated antimicrobial latex two way foleys catheter with silicon should be impregnated with silver nano particles to prevent catheter associated uti and catheter blockage should have strong drainage funnel, double fixed non return valve for free inflation and deflation. size 20 balloon capacity between 1ml to 30ml, 50ml impregnated antimicrobial latex two way foleys catheter with silicon should be impregnated with silver nano particles to prevent catheter associated uti and catheter blockage should have strong drainage funnel, double fixed non return valve for free inflation and deflation. size 22 balloon capacity between 1ml to 30ml, 50ml impregnated antimicrobial latex two way foleys catheter with silicon should be impregnated with silver nano particles to prevent catheter associated uti and catheter blockage should have strong drainage funnel, double fixed non return valve for free inflation and deflation. size 24 balloon capacity between 1ml to 30ml, 50ml impregnated antimicrobial latex two way foleys catheter with silicon should be impregnated with silver nano particles to prevent catheter associated uti and catheter blockage should have strong drainage funnel, double fixed non return valve for free inflation and deflation. size 26 balloon capacity between 1ml to 30ml, 50ml intraocular lens 14 30d dioptre intravenous drip set pediatric size introducer sheath 0.97mm 6fr, ( 2.0mm ) , 11 cm introducer sheath 0.97mm, 7 fr, ( 2.3mm ) , 11cm j r c bag 1 ltr j r c bag 1.5 ltr j r c bag 1 / 2 ltr 500ml kehr t tube laser radial fibre 600 micron and 400 micron liga clip 200mm, 300mm, 400mm liver biopsy gun long length quincke spinal needle for pain management, size – g 22, length – 120mm & 150mm mackintosh double colour water proof roll ( 20 meter per roll ) malecot rubber catheter no 12 malecot rubber catheter no 16 malecot rubber catheter no 20 malecot rubber catheter no 22 malecot rubber catheter no 24 medical dry imaging film 10x12 medical dry imaging film 14x17 medical dry imaging film 8x10 methacrylate based oxygen permeable non adherent 3 dimensional transforming powder dressing size 4 x 4 microlaryngeal surgery tube no 5 monopolar cautry wire disposable neonatal urine collection and measurement bag 100 ml omaya reservoir large size oxygen adaptor 5 type oxygen catheter oxygen connection with flow meter for central line oxygen connection with flow meter for cylinder oxygen high pressure hose pipe oxygen penal regulator for oxygen liquied tank ( 1 25 kg ) oxygen regulator for control penal board ( oxygen pipe line ) oxygen tailpipe ( flexible metalic ) pacing leads 6 fr paediatric double lumen polyurethan cvc line, 3 fr, l 10cm, 15cm, paraffin gauze dressing material 10x10cm pediatric diapers peritonial dialysis catheter 200mm pediatric peritonial dialysis catheter 280mm adult peritonial dialysis fluid 1ltr. pigtail catheter 6 fr ( 150 cm ) pigtail catheter with needle 6 fr ( 30 cm ) plaster of paris powder ip 1 kg pkt plastic nozel cap post exposure prophylaxis kits ( pep kits ) pressure regulated v p shunt for peadtric probe for oxygen radiopaque polyurethane catheter with fixation wings and integral extension tube 2f, 5f ( leader flex ) rectified sprit 4.5 ltr. scrotals support short pencil point spinal needle g 25 / 22, l 38mm. sics kit ( small incision cataract surgery ) silicon / double nasal prong with universal connector. all sizes silicon cautery plate silicon folyes catheter 14 fr silicon folyes catheter no 12 silicon tubing set for endoflaton silk protein and antimicrobial nano silver based sterile surgical wound dressing sheet 10 cmx 25 cm silk protein and antimicrobial nano silver based sterile surgical wound dressing sheet 20 cmx 25 cm silk protein and antimicrobial nano silver based sterile surgical wound dressing sheet 20 cmx 40 cm silk protein and antimicrobial nano silver based sterile surgical mesh wound dressing 10 cmx 25 cm silk protein and antimicrobial nano silver based sterile surgical mesh wound dressing 20 cmx 25 cm silk protein and antimicrobial nano silver based sterile surgical mesh wound dressing 20 cmx 40 cm silk protein based sterile surgical wound dressing sheet 20 cmx 40 cm silk protein based sterile surgical pu foam dressing 20cmx20cm silkolatex nasopharyngeal airway, with adjustable flange and widen end. sterilized sizes 20, 22, 24, 26, 28, 30, 32, 34, 36 fr soda lime for anesthesia workstation 5kg spatula for papsmear sterilant cold disinfectant for dialysis containing peraetic acid hydrogen peroxide acetic acid 5 ltr. sterile post‐operative surgical dressing surgical kit drape gown t.piece circuit with oxygen tubing set ( complete set ) tear test strip ( 100 strips in box ) terrimo guide wire thomas splint tmt graph paper tommy syringe tounge depresser wooden tracheostomy filter transducer set for invasive b.p. triway folyes catheter no 22 turp set ureteric catheter urine collecting bag with urometer 1 ltr. vaccum adaptor 5 type vaccum pump belt vaccum pump oil vaccum regulator ventilator circuit ( heated wire ) ventilator mask water bed wipes wound protector extra small incision size 2 4 cm wound protector large incision size 9 14 cm wound protector large incision size 9 14 cm with retraction ring wound protector medium incision size 5 9 cm wound protector small incision size 2.5 6 cm x ray casset 12x15 x ray casset 10x12 x ray casset 8x10 x ray developer 22.5 lit. x ray films size 10x12 50film per pkt blue sensitive x ray films size 12x15 50film per pkt blue sensitive x ray films size 8x10 50film per pkt blue sensitive x ray fixer 22.5 lit x ray hangers ( clip type ) 10x12 x ray hangers ( clip type ) 12x15 x ray hangers ( clip type ) 8x10 x ray screen high speed 12x15 x ray screen high speed 8x10 x rayscreen high speed 10x12 180 absorbable polyglyconate knotless wound closure device with unidirectional 0 30cm , green 37mm 1 / 2 circle taper point 180 absorbable polyglyconate knotless wound closure device with unidirectional 2 0 30cm , green 37mm 1 / 2 circle taper point 3 dimentional polyester mesh with micro porosity, x stich macro porosicty and multidirectional elasticity with optimesed atello collagen 1 absorbable anti adhesive barrier 12cm 3 dimentional polyester mesh with micro porosity, x stich macro porosicty and multidirectional elasticity with optimesed atello collagen 1 absorbable anti adhesive barrier 15cm 3 dimentional polyester mesh with micro porosity, x stich macro porosicty and multidirectional elasticity with optimesed atello collagen 1 absorbable anti adhesive barrier 20cm 5 mm helical shaped non absorbable titanium tacker for laproscopic mesh fixation device with 30 tacks 5 mm screw shaped polyglycolic lactic acid absorbable tacker for laproscopic mesh fixation fevice with min 30 tacks absorbable gelatin based topical absorbable flowable hemostat with 6cc syringe pre filled with hemostatic matrix. with 14.3 cm white applicator tip & 14.6 cm blue flexible applicator tip absorbable intraperitoneal umbilical patch of polyester mesh with collagen barrier and having absorbable pgla expanders with size 6 cm circle fda approved absorbable intraperitoneal umbilical patch of polyester mesh with collagen barrier and having absorbable pgla expanders with size 8 cm circle, fda approved absorbable unidirectional barbed device polydioxanone size 1, 40 mm 1 / 2 circle taper point needle 45 cm absorbable unidirectional barbed device symmetric anchoring pattern, triclosan coated polydioxanone size 1, 40 mm 1 / 2 circle taper point needle 45 cm absorbable unidirectional barbed device, symmetric anchoring pattern, triclosan coated polydioxanone, size 1, 36mm 1 / 2 circle taper point needle, 45 cm black braided silk 2 0 rb 5333 suture 17mm 1 / 2c taper black braided silk 3 0 rb suture 17mm 1 / 2c taper black braided silk 5 0 rb suture 17mm 1 / 2c taper black braided silk eyeless needled suture usp, size 8 0 suture length 76cm, needlelength & description 3 / 8 circle round bodied 30mm blackbraided silk eyeless needled suture usp, size 6 0 suturelength 76cm, needlelength & description 1 / 2 circle round bodied 30mm bovine collagen and glycosaminoglycan ( chondroitin 6 sulfate ) and silicone layer ( bilayer ) dermal regeneration template 2 in x 2 in bovine collagen and glycosaminoglycan ( chondroitin 6 sulfate ) and silicone layer ( bilayer ) dermal regeneration template 4 in x 10 in bovine collagen and glycosaminoglycan ( chondroitin 6 sulfate ) and silicone layer ( bilayer ) dermal regeneration template 4 in x 5 in bovine collagen and glycosaminoglycan ( chondroitin 6 sulfate ) and silicone layer ( bilayer mashed ) mashed dermal regeneration template 2 in x 2 in bovine collagen and glycosaminoglycan ( chondroitin 6 sulfate ) and silicone layer ( bilayer mashed ) mashed dermal regeneration template 4 in x 10 in bovine collagen and glycosaminoglycan ( chondroitin 6 sulfate ) and silicone layer ( bilayer mashed ) mashed dermal regeneration template 4 in x 5 in braided synthetic absorbable eyeless needled suture usp code 2423, size 1 0 suture ( os ) copolymer of glycolied and e caprolactone, 1 0 ct 1 needle and 45cm suture length unidirectional spiral. copolymer of glycolied and e caprolactone, 2 0 ct 1 needle and 45cm suture length unidirectional spiral. copolymer of glycolied and e caprolactone, 3 0 rb 1 needle and 20cm suture length unidirectional spiral. copolymer of glycolied and e caprolactone, 3 0 rb 1 needle and 45cm suture length unidirectional spiral. knotless wound closure device with unidirectional 2 0 45cm , undyed 24mm 3 / 8 circle reverse cutting knotless wound closure device with unidirectional 3 0 58cm , undyed 24mm 3 / 8 circle reverse cutting macro porus partially absorbable mesh made up of approximately equal parts of polypropylene monofilament fiber ( 6 0 ) and poliglecaprone 25 monofilament fiber ( 5 0 ) with pore size 2.7 mm having a weight of 39 g / m2 and containing blue orientation stripes of polypropylene. 15cmx15cm monofilament glycomer 0, 90cm , violet 40mm 1 / 2 circle taper point monofilament glycomer 1 , 90cm , violet 40mm 1 / 2 circle taper point monofilament glycomer 2 0 , 75cm , violet 27mm 1 / 2 circle taper point monofilament glycomer 3 0 75cm , undyed 24mm 3 / 8 circle reverse cutting monofilament glycomer 3 0 75cm , violet 22mm 1 / 2 circle taper point patient return electrode with current limiting nature & hence eliminate patient pad site burns based on capacitive coupling principle & made of akton polymer can be used for all patient’s weight >350 grams, radiolucent & latex free, no adhesive related irritation to patient skin.can be used any side up for easy handling in or and us fda approved compatible to any electrosurgical generator, size: 36” l x 20”w x 1 / 8”thickness. perforator 14mm pistol grip curved coagulating shears with ergonomic handle in the following shaft length 36cm. can seal blood vessel up to and including 5mm in diameter compatible with ultrasonic vessel sealing dissector system polydioxanone 122cm , no 1 size loop sgle with 65 mm needle and 1 / 2 circle tp needle. polydioxanone barbed suture 1 0 polydioxanone suture voilet monofilament 17mm 1 / 2c taper no 4 0 90cm polydioxanone suture voilet monofilament 40mm 1 / 2c blunt point 1 240cm polydioxanone suture voilet monofilament double armed trocar point 2 0 70cm polydioxanone suture clear monofilament 36mm 1 / 2c taper 3 0 70cm polydioxanone suture voilet monofilament 17mm 1 / 2c 5 0 70cm polyglactin 4 0suture undyed braided 1 / 2c reverse cutting polyglactin 910 with triclosan no. 0 x 90 36mm hc rb polyglactin 910 with triclosan no. 1 x 100 55mm hc rb polyglactin 910 with triclosan no. 1 x 90 36mm hc tc progrip self fixating mesh 12*08cm progrip self fixating mesh 14*9cm progrip self fixating mesh 15*15cm progrip self fixating mesh 20*15cm progrip self fixating mesh 30*15cm protective disk with chg hydrophilic polyurethane absorptive foam with 92 g chlorhexidine gluconate ( chg ) 1 disk ( 2.5 cm ) 7mm center hole with radial slit usfda approved protective disk with chg hydrophilic polyurethane absorptive foam with 92 g chlorhexidine gluconate ( chg ) 1 disk ( 2.5 cm ) 4.0 mm center hole with radial slit usfda approved scissor grip curved coagulating shears with curved tapered tip for precise dissection and with 240 degree activation triggers that support multiple hand position in the following shaft length 17cm. can seal blood vessels up to & including 5mm in diameter with ultrasonic vessel sealing dissector . self gripping polyester / polypropylene monofilament mesh pre cut with pla grips with size 14 x 09 cm for left side , fda approved self gripping polyester / polypropylene monofilament mesh pre cut with pla grips with size 14 x 09 cm for right side, fda approved self gripping polyester / polypropylene monofilament mesh pre cut with pla grips with size 12 x 08 cm for left side, fda approved self gripping polyester / polypropylene monofilament mesh pre cut with pla grips with size 12 x 08 cm for right side, fda approved sterilised surgical needled suture 8mm 1 / 4 spatulated micropoint double 5 0 sterlized monofilament polyamide eyeless needled suture uspsize 6 0 suture length in cm 70cm needle length & description 3 / 8 circle reverse cutting cutting 12mm sterlized surgical chromic gutsutue eyeless needied usp, code 4268, size5 / 0, suture length in cm 76cm, needle length & description 3 / 8 circle reverse cutting 12mm. suture dyed polyester poly ( p dioxxanone ) 1 0, 24x4cm, 1 / 2 circle 36mm rb 20 anchors / inch bidirctional. synthetic absorbable surgical suture triclosan coated violet monofilament polydioxanone suture with 70 cm size 2 0 with 1 / 2 circle taper point sh, 25mm to 26 mm needle usfda approved synthetic absorbable surgical suture triclosan coated monofilament poliglecaprone 25 suture, length 70 cm, size 2 0 with 3 / 8 circle oval round body visi black jb needle 26 mm synthetic absorbable surgical suture triclosan coated violet monofilament polydioxanone suture with 90 cm size 1 with 1 / 2 circle taper point ct 1 40 mm needle usfda approved transducer with unlimited counts compatible with ultrasonic vessel sealing dissector system v shape clip applicators large v shape clip applicators medium v shape clip applicators small v shape ligation clip large v shape ligation clip medium v shape ligation clip small aciclovir 200mg / 5ml oral suspension 100ml bottle albendazole suspension 200 mg / 5ml bottle baclofen oral solution ip 1mg / ml syp calcium phosphate, 2:1 ratio, 100 ml bottle carbamazepine oral suspension usp 100ml syp chloramphenicol palmitate oral suspension ip 125mg / ml 100ml syp chloroquine phosphate , 160 mg / 10 ml ( 50 mg / 5 ml base ) , 60 ml bottle ciprofloxacin 125mg / 5ml syp 60 ml bottle co trimoxazole 30 ml cyanocobalamin 7.5 mcg+ferrous ammonium citrate 160 mg+folic acid 0.5 mg / 10ml cyclosporine oral solution usp 100mg / ml 50ml syrup cyproheptadine + lycine and vitamins 200ml syp cyproheptadine hcl 2 mg + tricholine citrate 275 mg, 200 ml bottle domperidon suspension 1mg / ml 30 ml bottle etiophylline + theophylline pediatric syp. ( 46.5+14mg / 5ml ) 60 ml bottle ibuprofen oral suspension bp 100mg / 5ml 100ml syp iron+zinc syp metronidazole 200mg / 5ml suspension 60ml bottle nitazoxanide 100mg / 5ml 30 ml bottle norfloxacine suspension ( 30 ml bottle ) oxetacaine 10mg + aluminium hydroxide 291mg + milk of magnesia 98 mg per 5ml 200 ml bottle paracetamol oral solution 150mg / ml 15 ml bottle with dropper paracetamol syrup / suspension 125 mg / 5ml ( 60ml bottle ) phenobarbitone syp 30ml. 20mg / 5ml. phenytoin sodium suspension 30mg / 5ml 100 ml bottle prednisolone sodium phosphate solution 5mg / 5ml 60ml syp salbutamol sulphate , 2 mg / 5 ml , 60 ml bottle sodium valporate oral solution 100ml syp sorbitol 7.15 gm+tricholine citrate 0.55 gm sulfamethoxazole and trimethoprim suspension ( 200mg+ 40mg / 5ml ) 100 ml bottle trypsin bromelain & rutoside trihydrate tablets 6 mercaptopurine , 50mg acarbose 25 mg aceclofenac 100mg+paracetamol 500mg , tablet aceclofenac+thiocolchicoside 100mg+4mg tablet aceclofenace 100mg+serratiopeptidase 15mg tab acenocoumarol 2 mg tab acenocoumarol 1mg acyclovir 200mg tab ademetionine 100mg tab afatinib 40 mg agomelantine 025 mg tab alpha lipoic acid 100 mg+folic acid 1.5 mg+mecobalamin 1.5 mg+vitamin b6 3 mg ambroxol hydrochloride 30mg tab amitriptyline 10 mg amlodipine ( 5 mg ) + metoprolol ( 50 mg ) artemether 80mg tab artesunate 50 mg+sulphadoxine 500 mg+pyrimethamine 25 mg tab aspirin 75 mg aspirin 150 mg aspirin 75 mg+clopidogrel 75 mg+rosuvastatin 10 mg aspirin 75 mg+prasugrel 10 mg atorvastatin 10 mg+aspirin 75 mg. baclofen 5mg tab benfothiamin 150mg betahistine 4mg tab betamethasone 0.5 mg bisoprolol 2.5 mg+hydrochlorothiazide 6.25 mg bisoprolol 5 mg+amlodipine 5 mg bosentan 62.5 mg tab brivaracetam 50mg tab bromocriptine 2.5mg tab buprinorphine 4mg buprinorphine 8 mg bupropion 300 cabargolin 0.25 mg cefadroxil 500 mg chlorthalidon 50 mg tab cilostazole 50mg tab cilostazole100mg tab cinnarizine 20 mg and dimenhydrinate 40 mg citicoline 500mg tab clopidogrel 75 mg+aspirin 75 mg clopidogrel 75 mg+atorvastatin 20 mg clotrimazole 400mg tab co trimoxazole tab cyclophosphamide 50 mg tab cyclosporine 300mg tab cynocobalmin + folic acid tab dapagliflozin 5mg tab dapsone 100 mg tab deferasirox dispersible 500mg tab deflazacort 6mg tab desmopressin 0.5mg tab dexamethasone 4 mg tab diphenylhydramine 50 mg domperidone+ranitidine 150mg tab drotaverine 40 mg tab drotaverine 80mg duloxetine 40mg dydrogesterone 10mg eltrombopag olamine 150mg tab empagliflozin 25mg tablet entecavir 0.5mg tab entecavir 1mg tab eplerenone 25mg erlotinib tablets ip 100mg escitalopram 10 mg tab esomeprazole 40mg ethambutol hydrochloride 400mg tab ethambutol hydrochloride 800mg tab etizolam+propranolol 20mg tab etophylline 77 mg+ theophyllin 23 mg etoposide 50 mg etoricoxib 90mg farmalin 1gm tab ( 100 tab per box ) fenofibrate 160mg tab ferrous sulphate tab. 200mg ( equivalent to 60mg elemental iron ) fludrocortisone 0.1mg tab folic acid 800 mcg fungal diastase 100 mg+papain 60 mg gabapentin 400 mg+nortriptyline 10 mg ganciclovir 1000mg tab glibenclamide 2.5mg tab gliclazide 60mg glimepiride 2 mg + metformin 500 mg + pioglitazone 15 mg glimepiride 2 mg+metformin 500 glipizide 5 mg+metformin 500 mg glucagon 0.1mg tablet glyceryl trinitrate 0.5 mg sublingual tab hydrocortisone 10 mg hydrocortisone 20mg tab hydroxyzine 10 mg tab hyoscine butylbromide tab 10mg ibuprofen 400 mg indapamide hemihydrate 1.5mg isoniazid 200 mg tab isosorbide 5 mononitrate 20 mg isosorbide mononitrate 30 mg itopride 150mg itopride hydrochloride 25 mg tab itopride hydrochloride 50 mg tab l carnosine 200mg tablet lactobacillus 120 lamotrigine 25mg tab lansoprazole 15mg tab lapatinib 250 mg levetiracetam 750mg tab levodopa + carbidopa 100+25mg levofloxacin 750mg tab loperamide 8 mg tab lorcaserine 10 mg tab losartan ( 50 mg ) + chlorthalidone ( 12.5 mg ) lurasidone 20 magnesium oxide 200 mg magnesium valproate 400 mg mebendazole 100 mg tab meclizine hydrochloride 25 mg mefenamic acid 250mg+dicyclomine 10mg tab megestrol acetate 40mg melatonin 3mg melatonin 6mg mercaptopurine 50mg tab mesalamine ( 5 aminosalicylic acid ) 400 mg tab metaclopramide 10 mg tab metformin ( 1000 mg ) + vildagliptin ( 50 mg ) metformin 500 mg+voglibose 0.3 mg methimazole 10 mg tab methocarbamol 500 mg. methotrexate 10 mg methotrexate 5 mg tab methylcobalamin +folic acid tab methylcobalamin 1500mg tab methyldopa 250 mg tab methylphenidate 10 mg methylphenidate 20 mg methylphenidate 5 mg metoclopramide 05 mg metoprolol 12.5 mg metoprolol 50 mg+ramipril 5 mg misoprostol 200 mg modafinil 200mg tab morphine sulphate 10mg tablet moxonidine 0.3 mg multivitamin tab nfi formula sugar coated vit a 2500 iu, vit b12 , vit b 6, 0.5 mg, vit c 50mg vit d3 200iu, niacinamide 25mg folic acid 0.2mg ( with approximateoverages ) mycophenolate mofetil, 500 mg n acetylcysteine 300mg tab naproxen 250 mg tab naproxen 500mg + domperidone 10mg tab naproxen 500mg tab nebivolol 5mg nicorandil 5 mg tab nicotinamide 250mg tab nicoumalone 1 mg nimesulide 100 mg nimodipine 30mg tablet nitazoxanide 200 mg nitazoxanide 500mg tab nitrocontin 2.6 nitroglycerin 2.5 mg ofloxacin 200mg +tinidazole 600mg tab ofloxacin 400mg tab olmesartan 10 mg olmesartan 20mg olmesartan medoxomil 20 mg+amlodipine 5 mg+hydrochlorothiazide 12.5 mg olmesartan medoxomil 40 mg+amlodipine 5 mg oxcarbazepine 150 mg tab oxcarbazepine 300 mg tab oxybutynin 2.5mg tab pancreatic enzyme 1000mg tab pancreatic enzyme 2000mg tab pancreatic enzyme 500mg tab pantoprazole 40 mg+domperidone 30 mg paracetamol, chlorpheniramine maleate, phenylephrine hydrochloride & caffeine tablets pazopanib 200mg / 400mg penicillin v 250 mg tab ( phenoxymethyl penicillin potassium ) pentoxifylline 400mg perampanel 4mg phenobarbitone 30 mg. pramipexol 0.26 sr pramipexol 0.50mg prazosin 10mg tab propranolol hydrochloride 40mg+flunarizine 10mg tab propylthiouracil 50mg prucalopride 2mg tab quetiapine 50mg tab racecadotril 100mg ranolazine sustained release 500mg tab rifaximin 550 mg tablet rivaroxaban 10mg tab rivaroxaban 15mg tab rivaroxaban 5mg tab rosuvastatin 20 mg sacubitril 24 mg+valsartan 26 mg secnidazole 500 mg tab sevelamer carbonate 400mg tab sevelamer carbonate 800mg tab sildenafil 25 mg silodosin 8mg tab sitagliptin 50 mg+metformin 500 mg sodamint tab solifenacin 5mg tab sulfamethoxazole and trimethoprim ( 100mg+ 20mg ) tab sulfasalazine 500mg tab sunitinib 50 mg tapentadol 50mg tab telmisartan 40 mg+amlodipine 5 mg telmisartan 80 mg+amlodipine 5 mg telmisartan 80 mg+hydrochlorothiazide 12.5 mg teneligliptin 20 mg tenofovir disoproxil 300mg tab terbutaline sulphate 2.5mg tab tetrabenazine 12.5mg tab tetrabenazine 20 mg tab tetrabenazine 25mg tab thiamine 200mg tab thiamine 75mg thyroxine sodium 137 mcg thyroxine sodium 62.5 mcg thyroxine sodium 12.5 mcg thyroxine sodium 150 mcg thyroxine sodium 125 mcg thyroxine sodium 88mcg tablet tianeptine 12.5 mg tolperisone hydrochloride 150 mg tab tolvaptan 15 mg topotecan 1 mg torsemide 10 mg+spironolactone 50 mg tramadol 37.5mg and acetaminophen 325mg tablet valganciclovir 450mg tab valganciclovir 500mg tab valganciclovir 900mg tab valsartan 40 mg venlafaxine 75 verapamil 120mg tab vidagliptin 100mg tab vidagliptin 80mg vilazodon 20mg vilazodon 40mg voriconazole 100mg tab voriconazole 150mg tab voriconazole 200 mg voriconazole 50mg tab vortioxetine 20mg vortioxetine 10mg vortioxetine 5 mg warfarin sodium 5 mg tab zonisamide 100 mg tab zonisamide 50 mg tab...

Directorate Of Medical Education - Madhya Pradesh

33336734 tender for supply of chemical and reagents for mdru department of sgm hospital rewa , mdru chemical and reagents , ammonium chloride 250gm , potassium bi carbonate 250gm , sodium chloride 250gm , tris hcl 250gm , sds 250gm , saturated phenol 500ml , chloroform 500ml , sodium acetate 250gm , isoamyle alcohol 500ml , glacial acetic acid 500ml , molecular biology grade agarose powder 250gm , bromophenol blue dye 2ml , ethidium bromide 5ml , molecular weight ( dna ladder ) 100bp & 1kb 50ug , molecular weight ( dna ladder ) 50bp 50ug , molecular weight ( dna ladder ) 25bp 50ug , taq polymerase 5000unit , amplitaq gold dna polymerase master mix 500 unit , mgcl2 100 ul , dntp mix 100 ul , dnase 100 unit , rnase 100 unit , proteinase k 100 unit , triss 250gm , edta 250gm , boric acid 250gm , teepol 5 liter , xylene cynol 5 ml , dmso 500 ml , tips i. 0.2 20 ?l tips 2 pack ( pack size of 1000 psc. each ) , tips ii. 20 200 ?l tips 2 pack ( pack size of 1000 psc. each ) , tips iii. 200 1000 ?l tips 2 pack ( pack size of 1000 psc. each ) , superscript ii rnase reverse transcriptase 10000 u ( 200u / ul ) , power sybrgreen pcr master mix 2.5 ml , power sybrgreen rt pcr reagent kit 5 ml , oligo ( dt ) 12 18 primer25 ?g , absolute ethanol 500 ml , pcr plates pack of 50 , sealing foil ( rt pcr / qpcr grade ) pack of 50 , filter tips i. 0.2 20 ?l filter barrier tips 2 pack ( pack size of 1000 psc. each ) , filter tips ii. 20 200 ?l filter barrier tips 2 pack ( pack size of 1000 psc. each ) , filter tips iii. 200 1000 ?l filter barrier tips 2 pack ( pack size of 1000 psc. each ) , mct variable tubes i. 20 200?l tubes 2 pack ( pack size of 1000 psc. each ) , mct variable tubes ii. 200 600 ?l tubes 2 pack ( pack size of 1000 psc. each ) , mct variable tubes iii. 500 2000 ?l tubes 2 pack ( pack size of 1000 psc. each ) , nitrile autodextorous gloves 2 pack ( pack size of 1000 psc. ) , mctstands for variable tubes sizes i. 20 200?l tubes stand pack size of 1000 psc. each , mctstands for variable tubes sizes ii. 200 600 ?l tubes stand pack size of 1000 psc. each , mctstands for variable tubes sizes iii. 500 2000 ?l tubes stand pack size of 1000 psc. each , filter tip boxes i. 0.2 20 ?l filter barrier tip box 2 pack ( pack size of 1000 psc. each ) , filter tip boxes ii. 20 200 ?l filter barrier tip box 2 pack ( pack size of 1000 psc. each ) , filter tip boxes iii. 200 1000 ?l filter barrier tip box 2 pack ( pack size of 1000 psc. each ) , rt pcr grade water 20 ml , tip discard box ( 1 2 liter capacity ) 10 each , graduated measuring cylinders 50, 100, 500, 1000 ml 05each , graduated beakers 50, 100, 500, 1000 ml 05 each , flat bottom tube 5ml ( with screw cap ) 500 psc. , tube stand ( 15ml falcon, 5ml, 2ml, 0.5ml, 0.2ml mct ) pack size of 500 psc. , graduated conical flask 50, 100, 500, 1000ml pack size of 5 psc. each , edta blood collection tube 5ml 100 psc. , plain vial ( for clot activator ) 100psc. , fluoride vial 100 psc. , test tube 5, 10ml 100 psc. , slide+cover slips 50 psc. , tissue paper roll 10 psc. , fine tissue cloth roll 10 psc. , cotton 10 psc. , wash bottle / dropping bottle, 200ml, 500ml, 1ltr 5 psc. , funnels variable range 5 psc. , plastic bottle, 200, 500, 1000ml 5 psc. , syringe + needle 2ml, 5ml pack size of 100 psc. each , nitrile gloves; medium and large size pack size of 1000 psc. , dna isolation kit pack size for 100 reaction , rna isolation kit pack size for 100 reaction , phenol 500 ml , hno3 ( nitric acid ) 500 ml , propionaldehyde pure ( 97% ) 500 ml , phthalic anhydride 500 ml , glacialacetic acid ar 500ml , hydrochloric acid ar 500 ml , sulfuric acid ar 500 ml , 2 amino ethanol 500 ml , pyridine ar 500 ml , ammonia solution ar 500 ml , ammonia chloride ar 500 ml , acetyl salicylic acid 500 ml , acetone ar 500 ml , anthranilic acid ar 500 ml , activated charcoal 500 ml , silica gel g 500ml , benzoicacid ar 500ml , sds 250 gm , colin ( cleaning detergent solution ) 500 ml , sterilium ( hand sanitizer ) 500 ml , dettol / lifeboy alcohol based hand sanitizer 500 ml , hypo 4% 1000ml , floor cleaner phenyl 500 ml , serum separator vial 3 ml 100 psc. , labolene 1000 ml , cleaning mop 5 psc. , broom 5 psc. , microwave gloves 2 pkt. , brown paper for autoclaving 10 rolls , liquid nitrogen 5ltrpkt. , phosphate buffer saline 500 ml , formalin 500 ml , paraffin wax ( 58 60c ) 250 gm , xylene , glycerol 250 ml , ammonia 100 ml , methanol 250 ml , acrylamide / bis ar 250 ml. , 10x tbe buffer 500 gm , urea 100 ml , ammonium persulfate 100 ml , temed 100 ml , 4’, 6 diamidino 2 phenylindole 100 ml , diethyl pyrocorbonate 100ug , pbs 500ml , mnl i 500 unit , bcli 1500 unit , hpych4v 100 unit , hpych4iii 250 unit , sau96i 500 unit , sfci 200 unit , bcci 500 unit , scrfi 500 unit , afliii 250 unit , scai 500 unit , avai 500 unit , bsmi 250 unit , tspri 500 unit , mboii 300 unit , bsh1236i 500 unit , banii 1000 unit , mph1103i 500 unit , dde i 500 unit , bsmb i 200 unit , afa i 500 unit , bal i 250 unit , fspi 500 unit , primers 5 od , fmr1 set 1 – f5 tcaggcgctcagctccgtttcggtttca 3 r5 5 aagcgccattggagccccgcacttcc 3 5 od , mecp2 exon 1 set 1 f5 gttatgtctttagtctttgg–3´ r5 tgtgtttatcttcaaaatgt–3´ 5 od , exon 2set 1 f5 cctgcctctgctcacttgtt–3´ r5 ggggtcatcatacatgggtc–3´ 5 od , exon 2set 2 f5 agcccgtgcagccatcagcc–3´ r5 gttccccccgaccccaccct–3´ 5 od , exon 3 set 1 – f5 tttgtcagagcgttgtcacc–3´ r5 cttcccaggacttttctcca–3´ 5 od , exon 3 set 2 f5 aaccacctaagaagcccaaa–3´ r5 ctgcacagatcggatagaagac–3´ 5 od , exon 3 set 3 f5 ggcaggaagcgaaaagctgag–3´, r5 tgagtggtggtgatggtggtgg–3´ 5 od , exon 3 set 4 – f5 5´–tggtgaagcccctgctggt–3´ r5 ctccctcccctcggtgtttg–3´ 5 od , exon 3 set 5 f5ggagaagatgcccagaggag–3´ r5 cggtaagaaaaacatccccaa–3´ 5 od , exon3 ( l100v ) f5 aaccacctaagaagcccaaa 3 r5 gcttaagcttccgtgtccagccttcaggta 3 5 od , putative promoter and exon 1. f5 gggtgcaatgaaacgctta 3 r5 tttaccacagccctctctcc 3 5 od , mc4r rs17782313 f 5 aagttctacctaccatgttcttgg 3 r 5 ttccccctgaagcttttcttgtcattttgat 3 5 od , fto rs9939609 f 5 aactggctcttgaatgaaataggattcaga 3 r5 agagtaacagagactatccaagtgcagtac 3 5 od , adipoqrs2241766 – f5 tgtgtgtgtggggtctgtct 3 r 5 tgtgatgaaagaggccagaa 3 5 od , rs1501299 f5 ctacactgatataaactatatggag 3 r5 ccccaaatcacttcaggttg 3 5 od , pomcrs6232 f5 ttgtgcccttcatctgaaca 3 r5 tgtagcaactttggcatgga 3 rs155971 f5tatatgcagccaccaatcca 3 r5 aaaatgaagggagaagcacaaa 3 5 od , ppar g ( pro12ala ) f5gcc aat tcaagc cca gtc 3 r5gat atgttt gca gac agt gta tca gtg aaggaa tcg ctt tcc g 3 5 od , kcnj11 ( rs5219 ) f5 gactctgcagtgaggcccta 3’ r5 acgttgcagttgcctttctt 3’ 5 od , capn10 ( rs3792267 ) f5 cacgcttgctgtgaagtaatgc 3’ r5 tgattcc catggtctgtagcac 3’ 5 od , pik3ca set 1 forward 5’ ggagtatttcatgaaacaaatgaatgatgcg 3’ 5 od , pik3ca set 1 reverse 5’ gagctttcattttctcagttatctt 3’ 5 od , bat 25 set 1 f 5’ tcgcctccaagaatgtaagt 3’ r 5’ tctgcattttaactatggctc 3’ 5 od , bat 26 set 1 f5’ tgactacttttgacttcagcc 3’ r5’ aaccattcaacatttttaaccc 3’ 5 od , d2s123 set 1 f5’ aaacaggatgcctgcctttta 3’ r5’ gtttggactttccacctatgggac 3’ 5 od , d5s346 set 1 f 5’ actcactctagtgataaatcg 3 r5 agcagataagacagtattactagtt 3 5 od , d17s250 – set 1 f5’ ggaagaatcaaatagacaat 3’ r5’ gctggccatatatatatttaaacc 3’ 5 od , impdh2 set 1 f5 gtttctgcggtatcccaatc 3 r5 cgagcaagtccagcctat 3 5 od , bmp6 rs73719353 f5’ gctcctttgcacttcgctgt 3’ r5’ aggctctgctg agctcctac 3’ 5 od , bmp6 rs73719341 f 5’tgaacttcccattcccctct 3’ r5’ataaaattagcattgatcca 3’ 5 od , bmp6 rs73719318 f5’caggtgctgtgcaacttctt 3’ r 5’agagggcaccatggttgcct 3’ 5 od , bmp6 rs73381662f 5’ ctgagattcaattaggccca 3’r 5’taaagaacagcaaaagtctg 3’ 5 od , bmp6 rs73381650 f 5’cacataaagattgctgcatt 3’ r 5’tagtaatcctaaaaatggga 3’ 5 od , anxa2 rs7170178 f 5’ ttcacagcagttcaaaatac 3’ r 5’ ctgggtttccagagatggaa 3’ 5 od , anxa2 rs73435133 f 5’ gagtgcaaggtgctgaggat 3’ r 5’ gatttcagacagcccttgca 3’ 5 od , anxa2 rs73418020 f 5’ tctgagagtgaaaggtgcac 3’ r 5’ tcccatcccctgaatccctg 3’ 5 od , anxa2 rs72746635 f 5’ cctgactcattgtcacatca 3’ r 5’ aagtggctttccactgccc 3’ 5 od , anxa2 rs73418025 f 5’ cttctcatcttactttt 3’ r 5’ agggaaggatacagaggaga 3’ 5 od , hsp 70 primer sequence 5 agcgt aacac cacca ttcc 3 ( forward ) 5 tggct cccac cctat ctc 3 ( reverse ) 5 od , the gapdh sequence forward primer 5 agc cac atc gct gag aca c 3, reverse primer 5 gcc caa tac gaccaa atcc 3. 5 od , total rna mini kit ( from human skin tissue ) 2 pack ( pack size for 100 reaction ) , human leptin elisa kit pack size for 96 reaction , human adiponectin elisa kit pack size for 96 reaction , human adipsin elisa kit pack size for 96 reaction , human resistin elisa kit pack size for 96 reaction , human iron elisa kit ( serum iron ) pack size for 96 reaction , human ferritin elisa kit ( serum / ferritin ) pack size for 96 reaction , thyroid estimation kit pack size for 96 reaction , ice maker machine for laboratory purpose 1 psc. , microwave gloves 2 pkt. , pcr mini cooler 03 psc. , pipette 0.5 10ul, 02 20ul, 10 100ul, 20 200ul and 100 1000ul. 1 psc. each , horizontal gel apparatus: 18 – 20 cm ( length ) x 25 – 30 ( breadth ) x 5 7.5 cm ( height ) , 40 60 samples, multichannel pipette compatible combs and gel caste 1 psc. each , mini horizontal gel apparatus: 9 cm w x 11 cm l with grooves ( 8.7 cm l x 1.2 cm h ) on the side for gripping the gel tray. it should have two comb slots on the same tray area. 1 psc. each , buffer capacity should be 600 ml for the buffer tanks and optimum gel runs with a fill line indicator for buffer levels along the unit side , multi size forceps lab set 01 pkt. , liquid nitrogen sample storage tanks 5 tanks ( 3, 5, 10, 20, 25 ltrs ) , liquid nitrogen sample handling gloves 5 sets of gloves , slide tray / rack pack of 3psc. , l mold pack of 2 psc. , tissue cassette steel pack of 2 psc. , electric tissue float bath ( thermostate ) 1 psc. , coupling jar pack of 2 psc. , staining rack pack of 3 psc. , whatman filter paper grade 1 & 2 2 pack ( pack size of 50 psc. ) , harri’s hematoxylin powder 2 pack of 50 gm , yellow eosin powder 2 pack of 50 gm , coverslip 18x18 ( microscopic ) 2pack ( pack size of 100 psc ) . , dpx mount 50 ml , thymol crystals 250 gm , plastic boxes 5 boxes , steel / aluminium boxes 3 boxes , hot plate 1 psc. , mx35 premier microtome blade ( 34 / 80mm ) 50 blades 1 box , diamond pen ( histopathology use ) 1 pen , embedding mold and embedding ring 5 psc. , human pai 1 elisa kit pack size of 96 reactions , mortar and pestle homogenizers 1 psc....

Central Council For Research In Ayurvedic Sciences - Madhya Pradesh

32670762 bids are invited for alanine amino transferase , aspartate amino transferase , alkaline phosphatase , albumin , blood urea nitrogen , calcium , chloride , creatinine , glucose , gamma glutamyl transferase , phosphorus , potassium , sodium , total plasma protein , total cholesterol , triglycerides , total bilirubin , rodent thyroid stimulating hormone , rodent thyroxin , rodent triiodothyronine , dekaphan laura urine strips , prothrombin time , activated partial thromboplastin time , micro pipette tips , glass slides , cover slips , btct capillary tubes , nitrile gloves small , nitrile gloves medium , nitrile gloves large , micro centrifuge tubes 0.5 , microcentrifuge tubes 1.5 , micro centrifuge tubes 2 , oralgavage set , magnetic stirrer beads small , magnetic stirrerbeads medium , microtome blades slee , blotting papers ,bottle corks , diethyl ether , potassium iodide , isoflurane ,propanol , ethanol , xylene , hematoxylin stain solution ,eosin stain solution , paraffin wax , formaldehyde ,propylene glycol , sodium chloride , sodium dihydrogenphosphate , dihydrogen sodium phosphate , gum acacia ,giemsa stain solution , cell clean cl 50 , disodium edta total quantity : 53051...

Directorate Of Medical Education - Madhya Pradesh

32061822 tender for purchase of chemical and reagent for mdru dep tender for purchase of chemical and reagent for mdru dep , supply of chemicals and reagents for mdru , ammonium chloride 250gm , potassium bi carbonate 250gm , sodium chloride 250gm , tris hcl 250gm , sds 250gm , saturated phenol 500ml , chloroform 500ml , sodium acetate 250gm , isoamyle alcohol 500ml , glacial acetic acid 500ml , molecular biology grade agarose powder 250gm , bromophenol blue dye 2ml , ethidium bromide 5ml , molecular weight ( dna ladder ) 100bp & 1kb 50ug , molecular weight ( dna ladder ) 50bp 50ug , molecular weight ( dna ladder ) 25bp 50ug , taq polymerase 5000unit , amplitaq gold dna polymerase master mix 500 unit , mgcl2 100 ul , dntp mix 100 ul , dnase 100 unit , rnase 100 unit , proteinase k 100 unit , triss 250gm , edta 250gm , boric acid 250gm , teepol 5 liter , xylene cynol 5 ml , dmso 500 ml , mnl i 500 unit , bcli 1500 unit , hpych4v 100 unit , hpych4iii 250 unit , sau96i 500 unit , sfci 200 unit , bcci 500 unit , scrfi 500 unit , afliii 250 unit , scai 500 unit , avai 500 unit , bsmi 250 unit , tspri 500 unit , mboii 300 unit , bsh1236i 500 unit , banii 1000 unit , mph1103i 500 unit , dde i 500 unit , bsmb i 200 unit , afa i 500 unit , bal i 250 unit , fspi 500 unit , primers 5 od , fmr1 set 1 – f5 tcaggcgctcagctccgtttcggtttca 3 5 od , r5 5 aagcgccattggagccccgcacttcc 3 5 od , mecp2 exon 1 set 1 f5 gttatgtctttagtctttgg–3´ r5 tgtgtttatcttcaaaatgt–3´ 5 od , exon 2set 1 f5 cctgcctctgctcacttgtt–3´ r5 ggggtcatcatacatgggtc–3´ 5 od , exon 2set 2 f5 agcccgtgcagccatcagcc–3´ r5 gttccccccgaccccaccct–3´ 5 od , exon 3 set 1 – f5 tttgtcagagcgttgtcacc–3´ r5 cttcccaggacttttctcca–3´ 5 od , exon 3 set 2 f5 aaccacctaagaagcccaaa–3´ r5 ctgcacagatcggatagaagac–3´ 5 od , exon 3 set 3 f5 ggcaggaagcgaaaagctgag–3´, r5 tgagtggtggtgatggtggtgg–3´ 5 od , exon 3 set 4 – f5 5´–tggtgaagcccctgctggt–3´ r5 ctccctcccctcggtgtttg–3´ 5 od , exon 3 set 5 f5ggagaagatgcccagaggag–3´ r5 cggtaagaaaaacatccccaa–3´ 5 od , exon3 ( l100v ) f5 aaccacctaagaagcccaaa 3 r5 gcttaagcttccgtgtccagccttcaggta 3 5 od , putative promoter and exon 1. f5 gggtgcaatgaaacgctta 3 r5 tttaccacagccctctctcc 3 5 od , mc4r rs17782313 f 5 aagttctacctaccatgttcttgg 3 r 5 ttccccctgaagcttttcttgtcattttgat 3 5 od , fto rs9939609 f 5 aactggctcttgaatgaaataggattcaga 3 r5agagtaacagagactatccaagtgcagtac 3 5 od , adipoqrs2241766 – f5 tgtgtgtgtggggtctgtct 3 r 5 tgtgatgaaagaggccagaa 3 5 od , rs1501299 f5 ctacactgatataaactatatggag 3 r5 ccccaaatcacttcaggttg 3 5 od , pomcrs6232 f5 ttgtgcccttcatctgaaca 3 r5 tgtagcaactttggcatgga 3 5 od , rs155971 f5tatatgcagccaccaatcca 3 r5 aaaatgaagggagaagcacaaa 3 5 od , ppar g ( pro12ala ) f5gcc aat tcaagc cca gtc 3 r5gat atgttt gca gac agt gta tca gtg aaggaa tcg ctt tcc g 3 5 od , kcnj11 ( rs5219 ) f5 gactctgcagtgaggcccta 3’ r5 acgttgcagttgcctttctt 3’ 5 od , capn10 ( rs3792267 ) f5 cacgcttgctgtgaagtaatgc 3’ r5 tgattcc catggtctgtagcac 3’ 5 od , pik3ca set 1 forward 5’ ggagtatttcatgaaacaaatgaatgatgcg 3’ reverse 5’ gagctttcattttctcagttatctt 3’ 5 od , bat 25 set 1 f 5’ tcgcctccaagaatgtaagt 3’ r 5’ tctgcattttaactatggctc 3’ 5 od , bat 26 set 1 f5’ tgactacttttgacttcagcc 3’ r5’ aaccattcaacatttttaaccc 3’ 5 od , d2s123 set 1 f5’ aaacaggatgcctgcctttta 3’ r5’ gtttggactttccacctatgggac 3’ 5 od , d5s346 set 1 f 5’ actcactctagtgataaatcg 3 r5 agcagataagacagtattactagtt 3 5 od , d17s250 – set 1 f5’ ggaagaatcaaatagacaat 3’ r5’ gctggccatatatatatttaaacc 3’ 5 od , impdh2 set 1 f5 gtttctgcggtatcccaatc 3 r5 cgagcaagtccagcctat 3 5 od , bmp6 rs73719353 f5’ gctcctttgcacttcgctgt 3’ r5’ aggctctgctg agctcctac 3’ 5 od , bmp6 rs73719341 f 5’tgaacttcccattcccctct 3’ r5’ataaaattagcattgatcca 3’ 5 od , bmp6 rs73719318 f5’caggtgctgtgcaacttctt 3’ r 5’agagggcaccatggttgcct 3’ 5 od , bmp6 rs73381662 f 5’ ctgagattcaattaggccca 3’ r 5’taaagaacagcaaaagtctg 3’ 5 od , bmp6 rs73381650 f 5’cacataaagattgctgcatt 3’ r 5’tagtaatcctaaaaatggga 3’ 5 od , anxa2 rs7170178 f 5’ ttcacagcagttcaaaatac 3’ r 5’ ctgggtttccagagatggaa 3’ 5 od , anxa2 rs73435133 f 5’ gagtgcaaggtgctgaggat 3’ r 5’ gatttcagacagcccttgca 3’ 5 od , anxa2 rs73418020 f 5’ tctgagagtgaaaggtgcac 3’ r 5’ tcccatcccctgaatccctg 3’ anxa2 rs72746635 f 5’ cctgactcattgtcacatca 3’ r 5’ aagtggctttccactgccc 3’ 5 od , anxa2 rs73418025 f 5’ cttctcatcttactttt 3’ r 5’ agggaaggatacagaggaga 3’ 5 od , hsp 70 primer sequence 5 agcgt aacac cacca ttcc 3 ( forward ) 5 tggct cccac cctat ctc 3 ( reverse ) 5 od , the gapdh sequence forward primer 5 agc cac atc gct gag aca c 3, reverse primer 5 gcc caa tac gaccaa atcc 3. 5 od , tips i. 0.2 20 ?l tips pack size of 1000 each , tips ii. 20 200 ?l tips pack size of 1000 each , tips iii. 200 1000 ?l tips pack size of 1000 each , superscript ii rnase reverse transcriptase 10000 u ( 200u / ul ) , power sybrgreen pcr master mix 2.5 ml , power sybrgreen rt pcr reagent kit 5 ml , oligo ( dt ) 12 18 primer25 ?g , absolute ethanol 500 ml , pcr plates pack of 50 , sealing foil ( rt pcr / qpcr grade ) pack of 50 , filter tips pack size of 1000 psc. each , i. 0.2 20 ?l filter barrier tips , filter tips pack size of 1000 psc. each , ii. 20 200 ?l filter barrier tips , filter tips pack size of 1000 psc. each , iii. 200 1000 ?l filter barrier tips , mct variable tubes , i. 20 200?l tubes pack size of 1000 psc. , ii. 200 600 ?l tubes each , iii. 500 2000 ?l tubes , nitrile autodextorous gloves pack size of 1000 psc. , mctstands for variable tubes sizes pack size of 1000 psc. each , i. 20 200?l tubes stand , mctstands for variable tubes sizes pack size of 1000 psc. each , ii. 200 600 ?l tubes stand , mctstands for variable tubes sizes pack size of 1000 psc. each , iii. 500 2000 ?l tubes stand , filter tip boxes pack size of 1000 psc. each , i. 0.2 20 ?l filter barrier tip box , filter tip boxes pack size of 1000 psc. each , ii. 20 200 ?l filter barrier tip box , filter tip boxes pack size of 1000 psc. each , iii. 200 1000 ?l filter barrier tip box , rt pcr grade water 20 ml , tip discard box ( 1 2 liter capacity ) 10 each , graduated measuring cylinders 50, 100, 500, 1000ml 05each , graduated beakers50, 100, 500, 1000ml 05 each , flat bottom tube 5ml ( with screw cap ) 500 psc. , tube stand ( 15ml falcon, 5ml, 2ml, 0.5ml, 0.2ml mct ) pack size of 500 psc. , graduated conical flask 50, 100, 500, 1000ml pack size of 5 psc. each , edta blood collection tube 5ml 100 psc. , plain vial ( for clot activator ) 100psc. , fluoride vial 100 psc. , test tube 5, 10ml 100 psc. , slide+cover slips 50 psc. , tissue paper roll 10 psc. , fine tissue cloth roll 10 psc. , cotton 10 psc. , wash bottle / dropping bottle, 200ml, 500ml, 1ltr 5 psc. , funnels variable range 5 psc. , plastic bottle, 200, 500, 1000ml 5 psc. , syringe + needle 2ml, 5ml pack size of 100 psc. each , nitrile gloves; medium and large size pack size of 1000 psc. , dna isolation kit pack size for 100 reaction , rna isolation kit pack size for 100 reaction , total rna mini kit ( human skin tissue ) pack size for 100 reaction , human leptin elisa kit pack size for 96 reaction , human adiponectin elisa kit pack size for 96 reaction , human adipsin elisa kit pack size for 96 reaction , human resistin elisa kit pack size for 96 reaction , human iron elisa kit ( serum iron ) pack size for 96 reaction , human ferritin elisa kit ( serum / ferritin ) pack size for 96 reaction , thyroid estimation kit pack size for 96 reaction , chloroform 500 ml , phenol 500 ml , isoamyl alcohol 500 ml , hno3 500 ml , propionaldehyde pure ( 97% ) 500 ml , phthalic anhydride 500 ml , glacialacetic acid ar 500ml , hydrochloric acid ar 500 ml , sulfuric acid ar 500 ml , 2 amino ethanol 500 ml , pyridine ar 500 ml , ammonia solution ar 500 ml , ammonia chloride ar 500 ml , acetyl salicylic acid 500 ml , acetone ar 500 ml , anthranilic acid ar 500 ml , activated charcoal 500 ml , silica gel g 500ml , benzoicacid ar 500ml , sds 250 gm , cholin cleaner 500 ml , sterilium 500 ml , hand sanitizer 500 ml , hypo 4% 1000ml , floor cleaner phenyl 500 ml , serum separator vial 3 ml 100 psc. , labolene 1000 ml , cleaning mop 5 psc. , broom 5 psc. , ice maker machine for laboratory purpose 1 psc. , microwave gloves 2 pkt. , pcr mini cooler 03 psc. , brown paper for autoclaving 10 rolls , pipette 0.5 10ul, 02 20ul, 10 100ul, 20 200ul and 100 1000ul. 1 psc. each , horizontal gel apparatus: 18 – 20 cm ( length ) x 25 – 30 ( breadth ) x 5 7.5 cm ( height ) , 40 60 samples, multichannel pipette compatible combs and gel caste 1 psc. each , mini horizontal gel apparatus: 9 cm w x 11 cm l with grooves ( 8.7 cm l x 1.2 cm h ) on the side for gripping the gel tray. it should have two comb slots on the same tray area. buffer capacity should be 600 ml for the buffer tanks and optimum gel runs with a fill line indicator for buffer levels along the unit side 1 psc. each , multi size forceps lab set 01 pkt. , liquid nitrogen sample storage tanks 5 tanks ( 3, 5, 10, 20, 25 ltrs ) , liquid nitrogen 5ltrpkt. , liquid nitrogen sample handling gloves 5 sets of gloves , phosphate buffer saline 500 ml , formalin 500 ml , slide tray / rack pack of 2 psc. , paraffin wax ( 58 60c ) 250 gm , l mold pack of 2 psc. , tissue cassette steel pack of 2 psc. , electric tissue float bath ( thermostate ) 1 psc. , coupling jar pack of 2 psc. , staining rack pack of 2 psc. , whatman filter paper grade 1 & 2 pack size of 50 psc. , harri’s hematoxylin powder 50 gm , yellow eosin powder 50 gm , coverslip 18x18 ( microscopic ) 100 psc. , dpx mount 50 ml , xylene 250 ml , glycerol 100 ml , thymol crystals 250 gm , plastic boxes 5 boxes , steel / aluminium boxes 3 boxes , ammonia 250 ml , hot plate 1 psc. , methanol 250 ml. , mx35 premier microtome blade ( 34 / 80mm ) 50 blades 1 box , diamond pen ( histopathology use ) 1 pen , embedding mold and embedding ring 5 psc. , acrylamide / bis ar 500 gm , 10x tbe buffer 100 ml , urea 100 ml , ammonium persulfate 100 ml , temed 100 ml , 4’, 6 diamidino 2 phenylindole 100ug , human pai 1 elisa kit pack size of 96 reactions , diethyl pyrocorbonate 5 ml , pbs 500ml , mortar and pestle homogenizers...

Indian Army - Madhya Pradesh

31849554 purchase of medical stores and drugs as per rfp , medicines : , prothrombin time ( 12x5 ml ) , ana ( 1x5 tests ) , sterile swab stick with polypropylene tube ( 1x100 tubes ) , troponine –i ( 1x25 tests ) , appendrof tube 1ml ( 1x1000 ) , biorad level 1 chemistry control ( 12x5 ml ) , biorad level 2 chemistry control ( 12x5 ml ) , diabetes control biorad level 1 & 2 , tri control for sysmex kx 21 , slide microscope size 75x25 mmwith inter link paper ( blue star ) , reticulocyte stain ( 100 ml ) , zn stain ready to use , indian ink stain ( 50 ml ) , lacto phenol cotton blue stain , cled agar ( 500 gm ) , urochrome agar ( 500 gm ) , muller hinton agar ( 500 gm ) , blood agar base ( 500 gm ) , saburoid dextose agar ( 500 gm ) , cover slip 22x30cm , cover slip 22x40cm , cover slip 22x50cm , glycerin , paraffin wax 500 gm pack , haemotoxyllin ehrlich ( ready to use ) , haematoxillin stain harris ( ready to use ) 500 ml bottle , ethanol , methanol ( alcohol methyl ) , chloroform , microtome blade s 35 high profile type ( 50 blades pack ) feather / lica microtome , salmonella, shigella agar ( 500 gm ) , microscope bulbs , glass marking pen ( diamond marker ) , cuvette for stago start 4 , milk adulterants test kit , tourniquet , petridish disposable , pap stain , grocott stain , plastic tissue embedding ring , plastic tissue cassette => limited...

Indian Army - Madhya Pradesh

31599724 purchase of medical stores as per rfp , medicines : , prothrombin time (12x5 ml) , ana (1x5 tests) , sterile swab stick with polypropylene tube(1x100 tubes) , troponine –i (1x25 tests) , appendrof tube 1ml (1x1000) , biorad level 1 chemistry control (12x5 ml) , biorad level 2 chemistry control (12x5 ml) , diabetes control biorad level 1 & 2 , tri control for sysmex kx 21 , slide microscope size 75x25 mmwith inter link paper (blue star) , reticulocyte stain (100 ml) , zn stain ready to use , indian ink stain (50 ml) , lacto phenol cotton blue stain , cled agar (500 gm) , urochrome agar (500 gm) , muller hinton agar (500 gm) , blood agar base (500 gm) , saburoid dextose agar (500 gm) , cover slip 22x30cm , cover slip 22x40cm , cover slip 22x50cm , glycerin , paraffin wax 500 gm pack , haemotoxyllin ehrlich (ready to use) , haematoxillin stain harris ( ready to use) 500 ml bottle , ethanol , methanol (alcohol methyl) , chloroform , microtome blade s 35 high profile type (50 blades pack) feather/lica microtome , salmonella, shigella agar (500 gm) , microscope bulbs , glass marking pen (diamond marker) , cuvette for stago start 4 , milk adulterants test kit , tourniquet , petridish disposable , pap stain , grocott stain , plastic tissue embedding ring , plastic tissue cassette => limited...

Indian Army - Madhya Pradesh

31341499 purchase of medical stores as per rfp , medicines : , prothrombin time (12x5 ml) , ana (1x5 tests) , sterile swab stick with polypropylene tube(1x100 tubes) , troponine –i (1x25 tests) , appendrof tube 1ml (1x1000) , biorad level 1 chemistry control (12x5 ml) , biorad level 2 chemistry control (12x5 ml) , diabetes control biorad level 1 & 2 , tri control for sysmex kx 21 , slide microscope size 75x25 mmwith inter link paper (blue star) , reticulocyte stain (100 ml) , zn stain ready to use , indian ink stain (50 ml) , lacto phenol cotton blue stain , cled agar (500 gm) , urochrome agar (500 gm) , muller hinton agar (500 gm) , blood agar base (500 gm) , saburoid dextose agar (500 gm) , cover slip 22x30cm , cover slip 22x40cm , cover slip 22x50cm , glycerin , paraffin wax 500 gm pack , haemotoxyllin ehrlich (ready to use) , haematoxillin stain harris ( ready to use) 500 ml bottle , ethanol , methanol (alcohol methyl) , chloroform , microtome blade s 35 high profile type (50 blades pack) feather/lica microtome , salmonella, shigella agar (500 gm) , microscope bulbs , glass marking pen (diamond marker) , cuvette for stago start 4 , milk adulterants test kit , tourniquet , petridish disposable , pap stain , grocott stain , plastic tissue embedding ring , plastic tissue cassette => limited...

Medical Education Department - Madhya Pradesh

30851406 bids are invited for amyloidosis liver slide , infarction kidney slide , skin lepromatous leprosy slide , skin tuberculosis slide , actinomycosis slide , liver cvc slide , kidney renal cell carcinoma slide , adenocarcinoma colon slide , stomach chronic peptic ulcer slide , liver cirrhosis slide , seminoma testis slide , osteogenic slide , skin melanoma , rhinosporiodiosis slide , hydatid cyst slide , carcinoma lung slide , basel cell carcinoma slide , leomyosarcoma uterus slide , chronic osteomyelitis slide , fibrosarcoma slide , ameloblastoma slide , teratoma testis slide , wilms tomour slide , pleomorphic adenoma slide , gastric carcinoma slide , osteoclastoma bone slide , pinworm in appendix slide , atherosclerosis slide , carbencillin , cephalexin , cephotaxime , ciprofloxacin , cloxacillin , co trimoxazole , gentamicin , oxacillin , furazolidine , oxytertracyline , steptomycin , linezolid , ceftazidine clavulanic acid , cefefime , aztreonom , meropenam , cefotaxime , cefixime , ofloxacin , tigecycline , netimicin , fosfomycin , glusose phosphate broth ( mr vp medium ) , kovac reagent , tryptophan broth , oxidase disc , straightwire with handle , mannual blood culture bottle ( bh1 bottle ) , 40% urea , triple sugar agar , hydrogen peroxide , kohreagent , lugols iodine , peptone water , mc cartney bottle, widal antigen , aso , typhiod igg / igm , test tube stand , spirit lamp stainless steel , nichrome loop with handle , tissue paper roll , concavity slide , amber colour dropper , crystal violet powder , gram iodine bottle , cary blairtransport medium , loffler serum sloop base with horseserum medium , albert stain kits , eosin , acrylic sheet ( 1375 mm * 915 mm ) , acrylic cutter , silk thread , phpaper , benzedine powder , microtome blade ( hp 35 inch *75 mm ) , barium chloride ( bacl2 ) , disposable dropper small , paps stain kit ( rapid ) , sodium metabisulfite , albumino meter , g6 pd ( semi quantatiive ) , urin analysertrips para , ehrich reagent , hemoglobino meter ( sahils ) , slide box ( 75 mm*25 mm ) , cover slip box ( 22*22 mm ) 1 / 53 total quantity : 3793...

Indian Army - Madhya Pradesh

30832614 purchase of lab reagents and consumables as per rfp , medicines : , prothrombin time ( 12x5 ml ) , ana ( 1x5 tests ) , sterile swab stick with polypropylene tube ( 1x100 tubes ) , troponine –i ( 1x25 tests ) , appendrof tube 1ml ( 1x1000 ) , biorad level 1 chemistry control ( 12x5 ml ) , biorad level 2 chemistry control ( 12x5 ml ) , diabetes control biorad level 1 & 2 , tri control for sysmex kx 21 , slide microscope size 75x25 mmwith inter link paper ( blue star ) , reticulocyte stain ( 100 ml ) , zn stain ready to use , indian ink stain ( 50 ml ) , lacto phenol cotton blue stain , cled agar ( 500 gm ) , urochrome agar ( 500 gm ) , muller hinton agar ( 500 gm ) , blood agar base ( 500 gm ) , saburoid dextose agar ( 500 gm ) , cover slip 22x30cm , cover slip 22x40cm , cover slip 22x50cm , glycerin , paraffin wax 500 gm pack , haemotoxyllin ehrlich ( ready to use ) , haematoxillin stain harris ( ready to use ) 500 ml bottle , ethanol , methanol ( alcohol methyl ) , chloroform , microtome blade s 35 high profile type ( 50 blades pack ) feather / lica microtome , salmonella, shigella agar ( 500 gm ) , microscope bulbs , glass marking pen ( diamond marker ) , cuvette for stago start 4 , milk adulterants test kit , tourniquet , petridish disposable , pap stain , grocott stain , plastic tissue embedding ring , plastic tissue cassette => limited...

Indian Army - Madhya Pradesh

30788294 invitation of online bids for purchase of invitation of online bids for purchase of expendable medical stores out of dglp echs fund , kit ck mb erba semi autho , kit prothrombin time 1x5 ml ( tulip ) , ethyl alcohol ( std ) , kit dengue ns1ag comb card test ) ( tulip ) , cell pack pack of 20 ltr ( sysmex ) , stromatolyser 500 ml bott ( sysmex ) , cell clean 1x50 ml bott ( sysmex ) , sterile urine container10 ml , glass slides pkt of 100 ( 5 star ) , blood agar plate , mha agar plate , kit uristick ( protein & sugar ) , urine multi strip siemens bott of 100 strip , hi media zn stain ( readymade ) , hi media gram stain ( readymade ) , hi media methylene blue for retic stain , sample cup pack of 100 cup em 200 , upt ( hcg ) 2x50 test kit , kit hiv rapid 4th gen cardtest ( sd, j mitra ) , kit vdrl card test ( tulip ) , kit salmonella typhi card test ( tulip ) , kit aso titer 1x2 ml ( kit of 35 test ) ( tulip ) , print roll , anti sera a bott of 10 ml antigen igm ( tulip ) , anti sera b bott of 10 ml antigen igm ( tulip ) , anti sera ab bott of 10 ml antigen igm ( tulip ) , anti sera d bott of 10 ml antigen igm ( tulip ) , ketostick , hi media sugar set ( biochemical reaction ) , rapid covid 19 antigen test , viral transport medium 3 ml ( vtm ) , kit d dimer 1x7 ml , feder hish profile microtome blades ( 1x50 ) , edta vaccutainer ( bd ) , sodium citrate ( bd ) , gel vaccutainer sterile tube of 5 ml ( bd ) , sterilevaccutainer sterile ( bd ) , sodium flouride => limited...

Government Medical College - Madhya Pradesh

30268661 supply of medicine supply of medicine , injection, tablet, capsul, cream, oint, eye drop, syp, solution, ointment, iv fluid, power, gel, spary, inhaler, etc , 5 fluro uracil 250mg 10 ml amp , 5 fluro uracil 500mg 10 ml amp , actinomycin 0.5 mg inj , acycloir 250 mg inj , acycloir 500 mg inj , acycloir 750 mg inj , adenosine 3 mg / ml 2 ml amp , ado trastuzumab emtansine 100 mg inj , adrenalin inj 1mg / ml 1ml amp , alamine 8.2gm+l glutanic acid 13.46gm 100 ml bottle i / v , alteplase 50mg inj , amidotrizoate meglumine; sodium amidotrizoate ( 76% ) dye 50 ml , amikacin250mg / 2 ml 2 ml vial , amikacin500mg / 2 ml 2 ml vial , aminophylline 25 mg / ml , amiodarone 50 mg / ml 3 ml amp , amoxicillinmg + clavulanic acid mg 1.2 gm vial , amoxicillin 500 mg + clavulanic acid100mg, inj , amphotericine ( liposomal ) 50 mg inj , amphotericine b 50 mg inj , ampicillin500 mg vial , anti d. immunoglobulin ( monoclonal ) ( 150mcg / vial ) human anti d, , anti d. immunoglobulin ( monoclonal ) ( 300mcg / vial ) , human anti d , anti hemophillic factor viii 250 iu ( vial ) , vial , anti hemophillic factor viii 500 iu ( vial ) , vial , anti human thymocyte immunoglobulin 25 mg , anti rabies vaccine inj , anti scorpion venominj <120mg total protein and >150 ld50 , anti snake venom ( liquid form ) 10ml ( polyvalent ) , artesunate 60 mg / vial , ascorbic acid 500mg / ml 50ml vial ( vitamin c ) inj , atracurium25mg / ml 2.5ml amp , atropine sulphate 0.6mg / ml amp , azithromycin 100mg / 5ml inj , azithromycin 200mg / 5ml inj , bendamustin 100 mg vial , benfothiamine + folic acid + mecobalamin + pregabalin + vit b6 inj , benzathine penicilline 12 lac iu / vial vial , betamethasone sodium phosphate 4 mg / ml 1 ml amp , bevacizumab 100 iu vial , bleomycin 15 unit vial , bortezomib 2 .5 mg vial , bortezomib 2 mg / vial , bupivacaine hcl0.5% 20 ml vial , bupivacaine hcl for spinal anaesthesia , buprenorphine hydrochloride0.3mg base / ml 1ml amp inj , busulphan 60mg vial , butorphanol 1mg / ml 1ml amp , caffeine citrate 20 mg / ml 3 ml vial , calcium carbonate 10%10ml amp , calcium chloride 10% 100mg / ml 10ml vial , calcium gluconate 10% 10 ml vial , calcium leucovorin ( folinic acid ) 50 mg / vial 5 ml vial , carboplatin 150 mg inj vial , carboplatin 450 mg injvial , carboprost promithamin 250 mcg / ml 1ml amp , carmustin 100 mg inj vial , carmustine ( bcnu ) 100 mg vial , cefaparazone with salbactum , cefazoline 500 mg vial , cefepime 500 mgvial , cefepime 500mg +tazobactum 625 mg vial , cefoperazone + sulbactam 1000 mg +1000 mg vial , cefoperazone 1gmvial , cefotaxime + sulbactam 1000 mg + 500 mg vial , cefotaxime sodium 1 gm / vial , cefotaxime sodium 500mg vial , ceftazidime 1gm vial , ceftazidime 250 mg inj vial , ceftazidime 500mg vial , ceftriaxone + sulbactum 1.5gm vial , ceftriaxone + tazobactum inj 1.125gm vial , ceftriaxone 1 gm / vial , ceftriaxone 500 mg / vial , cetuximab 100mg vial , cetuximab 200mg / 100ml vial , cetuximab 50mg vial , chloroquine phosphate 40mg / ml 5ml amp , chlorpheniramine maleatevial , chlorpromazine ip 25mg vial , cisplatin 10 mg vial , cisplatin 50 mg vial , clindamycin 150 mg / ml 2 ml vial , clindamycin 600mg / 4ml solution for injection , clopixol acuphase 50 mg inj , clopixol deconate 200 mg inj , collistimate sod. 1iuvial , collistimate sod. 2iuvial , crystalline insulin 40 iu / 10ml regular insulin 10 ml amp , cyclophosphamide 200 mg / vial , cyclophosphamide 500 mg / vial , cyclophosphamide ip 1 gm vial , cytrabine 100 mg inj , dacarbazine 200 mg inj , dacarbazine 500 mg inj , dacarbazine 500 mginj , daunorubicin 20 mg / vial , daunorubicin 50 mg / vial , decitabine 50mg inj , dexamethasone 4mg vial , dexamethasone 4mg / 1mlinj , dexmedetomidine100 mg / ml amp ( 1 ml amp ) , diatrizoate meglumine & diatrizoate sodium ( 37% ) vial , diatrizoic acid 60% amp , diatrizoic acid 65% amp , diazepam5 mg / ml 2 ml amp , diazepam 2 ml amp , diclofenac sodium 25 mg / ml 3 ml amp , diclofenac sodium inj for intravenous use surfactant free 1 amp , dicyclomine 10mg / ml 2 ml vial , digoxin i.p. 0.5mg / 2 ml amp , diltiazem 25mg / 5ml vial , diphtheria antitoxin1000 iu vial , dobutamine 50 mg / ml 5 ml amp , docetaxel 120mg inj , dopamine hydrochloride 40 mg / ml 5 ml amp , doxorubicin ( lypholozed ) 10 mg / vial , doxorubicin 50 mg / vial , drotaverin 40mg / 2ml amp , edavarane60 mg inj , enalapril maleate inj 1.25 mg per ml 2ml vial , enoxaparin 40mg inj amp , enoxaparin 60mg inj amp , ephedrine 30mg / ml inj , epirubicin 100mg inj , epirubicin 50mg inj , erythropoetin 4 k inj , erythropoietin 10000iu inj 1ml pfs , erythropoietin 40000iu inj 1ml pfs , esmolol / 40mg / ml 5 ml vial , ethamsylate 125 mg inj , ethamsylate 2ml / 125mg / amp , etiophylline + theophylline inj 220mg / 2ml amp , etomidate 2 mg / ml emulsion with mct 10ml vial , etoposide 100 mg inj , fat emulsion 20% 250 ml bottle , fentanyl 100 microgran2 ml amp , fentanyl 50 microgran 2 ml amp , filgrastim 300 mcg 1ml pfs , fluanxol depot 25 mg inj , fludarabin 50 mg vial , fluorescein 20% 5 ml amp , flupenthioxl 20 mg inj , fluphenazine 25 mg / ml 1 ml amp , frusemide 10mg / 2ml amp , g.c.s.f. 300 unit inj , ganciclovir 500 mg vial , gas gangrene antitoxin 10, 000 iu / ml 40000 iu 4ml amp , gatifloxacin vial , gemcitabine 1 gm vial , gemcitabine 1.4 gm vial , gentamycin 80mg / 2ml amp , glargine 100iu / 3ml amp , glycopyrrolate 0.2 mg / ml 1 ml amp , glycopyrrolate 0.5mg + neostigmine 2.5mg 5ml amp , haemocoagulase 1 iu ( reptilase ) botropose inj , haloperidol 5 mg / iv / im inj , haloperidol 50 mg / ml 1 ml inj , heparin5000 iu ( 1000 iu / ml5 ml vial ) , heparin 25000 iu ( 5000 iu / ml5ml vial ) , hepatitis b vaccine / 1ml , hepatitis immunoglobulin 100iu vial , human albumin 20 % / 100ml bottle , hyaluronidase 1500 iu / 2ml amp , hydrocortisone dry powder 100 mg / vial ( hydrocortisone sodium , hydroxy progesterone caproate 250mg / ml vial , hydroxypropylmethylcellulose 2% inj pre filled syringe , hyoscine butyl bromide / 20mg / 2ml amp , ifosfamide1 gm vial , ifosfamide2 gm vial , ifosphamide + mesna 1gminj , imipenem 1g vial , imipenem 1gm+cilastatin sodium 500 mg vial , iohexol 350 mg i / ml ( non ionic contrast medium in sterile , irinotecan 100mg inj , irinotecan 40mg inj , iron sucrose , isoprenalin inj 1ml amp , isoxsuprine hcl5mg / ml 2ml amp , iv human immunoglobulin 5% iv ig ( 5gm / 100ml bottle, injection , ketamine hydrochloride 50 mg / ml 10 ml , labetalol 20 mg ( 5mg / 1 ml 4 ml amp ) , l asparaginase 5000iu inj , levetiracetam 100mg / ml 5ml amp , levosulpride inj amp , lignocaine ( preservative free ) 2% 50 ml vial , lignocaine for spinal anaesthesia , lignocaine hydrochloride + adrenaline , lignocaine hydrochloride 2% 21.3 mg / ml 30 ml vial , lignocaine / lidocaine 4%, 30 ml vial , liposomal doxorubicine 2mg / ml inj , lmwh low molecular weight heparin 40mg vial , lmwh low molecular weight heparin 60mg vial , lorazepam 2 mg / ml, 1 ml vial , lorazepam 2 mg / ml, 2 ml vial , l ornithine l aspartats10ml inj , low molecular weightdextran 40000 vial , magnesium sulphate inj50% w / v 10ml amp , meningococcal polysaccharide vaccine groupe a, c, y and w 135 , mephentermine 30 mg / ml 10 ml , meropenem 1 gm / vial , meropenem 500 mg / vial , metaclopromide 5mg / ml 2ml amp , methacarbamol 100 mg. / 10ml vial , methotrexate 15 ( preservative free ) inj , methotrexate 50 mg / 2 ml, 2 ml vial , methyl ergometrine maleate 0.2 mg / ml, 1 ml amp , methylcobalamine ( vitamin b12 ) 500 mcg / ml, 3 ml amp , methylene blue 1% 10ml inj , methylprednisolone125mg vial , methylprednisolone 1 gm vial , methylprednisolone 40 mg / vial , methylprednisolone sodium succinate 500 mg / vial , metoprolol 5mg / ml 5ml vial , micronised progesterone 50mg / ml 2mlamp , micronized progesterone 200 ml vial , midazolam 1mg / ml, 1 ml amp , midazolam 1mg / ml 5ml vial , milrinone 1mg / ml solution for injection / infusion , mitomycin c 10mg / 40mg inj , mitoxantrone 15 mg inj , mixed.25 / 75 ( 25% insulin lispro+75% lispro insulin protamin ) , mixed.30 / 70 insullin biphasic isophane40 iu / ml 10 ml vial , morphine supaphate 10mg / ml 1ml amp , multivitamin 10 ml amp , nabpaclitaxel 100mg / vial , n acetyl cysteine inj 200mg / ml 10 ml amp , naloxone 0.4 mg / ml, 1 ml , nekethamide amp , neostigmine 0.5 mg / ml, 1ml amp , nitroglycerine ( glyceryl tri nitrate ) 25 mg / 5 ml 5 ml amp , noradrenaline bitartrate2 mg base / 2 ml amp , octreotide 100microgram / ml solution for injection 1 ml amp , octreotide 50 microgram / ml solution for injection 1 ml amp , olanzapine10 mg inj , olenzapine depot inj , ondansetron 2 mg / ml 2 ml amp , ondansetron 2 mg / ml 4 ml amp , oxaliplatin 100mg inj , oxaliplatin 50mg inj , oxytocin 5 iu / ml, 1 ml amp , paclitaxel 100mg inj , paclitaxel 260mg inj , panitumumab 100mg / 5ml inj , pantoprazole 40 mg / vial , paracetamol 150mg / ml 2ml amp , paracetamol 2ml amp for i / v use , peg gcsf 6 mcg , pembrolizumab 100mg / 4ml ( 25mg / ml ) , pemetraxed 100 mg inj , pemetraxed 500 mg inj , penicillin v 125 mg inj , pentazocin lactate 30mg / ml 1ml amp. , pentoxiphylline 20 mg / ml , perinorm 2ml , pertuzumab 30mg / ml ( 420mg / 14ml ) , pheniramine maleate ip 22.75 mg, 2 ml amp , phenobarbitone100mg / ml 1ml amp. , phenobarbitone200mg / ml 1ml amp. , phenytoin sodium50mg / ml 2ml / amp , pilocarpine 0.5 % / 1ml amp , piperacillin 4 gm + tazobactum 500 mg, vial , piperacillin tazobactum 1.125 gm vial , pneumococcal vaccine 10 ml vial , potassium chloride inj. 150mg / 10ml amp , pralidoxime20 ml vial , pregabalin inj , progesterone b.p.100mg vial , prolution depot 250mg inj 1ml amp , promethazine 2 ml / 2.5% vial , propofol sodium with mct / lct 1% w / v 10 mg / ml, 20 ml vial , protamine sulphate 1%, 10mg / 5ml amp , quinine sulphate 300 mg / ml, 2 ml amp , rabeprazole 20 mg vial , ranitidine 50mg / 2ml amp , remdesivir inj 100mg / 20ml vial , rituximab 100mg inj , rituximab 500mg inj , ropivacaine hydrochloride0.2% 40mg / 20ml vial ( 2mg / ml ) , ropivacaine hydrochloride0.75% 150 mg / 20 ml vial ( 7.5mg / ml ) , ropivacaine 10mg / ml 2.5ml vial , ropivacaine 0.5% 20 ml vial , ropivacaine 0.75% 4ml amp , sargramostin 500 mg inj , soda bicarbonate 10ml, 7.5% inj , sodium thiopentone inj 0.5gm powder / vial 20ml vial , sodium valproate 100 mg / ml, 5 ml , streptokinase 150000iu ( 15 lac ) amp , streptomycin 0.75 mg vial , succinyl choline 50 mg / ml, 10 ml vial , surfactant bovine ( 135 mg phopholipid per 5 ml / 5ml vial ) , vial , tecoplanin 400mg vial , terbutalime 0.5mg / ml aml amp , teriparatide 600mcg 3 ml amp , terlipressin 1 mg / 10 ml amp , tetanus immunoglobulin usp 500 iu / vial , tetanus toxide 0.5ml ampoule , thiamine hydrochloride inj.100mg / ml 2ml vial multiple dose , thiopentone sodium 0.5gm powder / vial, 20 ml vial , thiopentone sodium 1 gm / vial , tigecycline, 50 mg, vial , tobramycine 80 mg vial , tocilizumab 400 mg inj , torsemide inj 2ml amp , tramadol 50 mg / ml, 2 ml amp , tramadol 50 mg inj , tranexamic acid 100mg inj , tranexamic acid 500 mg / 5 ml, 5 ml amp , trastuzumab 440mg inj , triamcinolone acetate 40 mg / ml 1 ml amp , trypan blue opthalmic solution 0.06% pre filled syringe , urokinase 500000 iu vial , vancomycin hydrochloride 1000 mg / vial , vancomycin hydrochloride 500 mg / vial , vasopressine40 iu / ml amp , vasopressine 20unit amp , vecuronium bromide 2 mg / ml, 2 ml amp , verapamil hydrochloride 2.5 mg / ml amp , vinblastine 10 mg / 10 ml, 10 ml , vincristine 1 mg / ml, 1 ml vial , vinorelbin 10 mg inj , vinorolbine 50mg inj , vit. cynocobalamin 500mcg +folic acid 15mg+niacinamide 200 mg , vit. cynocobalamin 500mcg +folic acid 15mg+niacinamide 200 mg , vit. methylcobalamin 1500 mcg +folic acid 0.7mg+niacinamide 12 , vitamin b complex inj , vitamin k 1ml, 10mg / ml , voriconazole 10 mg / ml, 200 mg / vial , water for injection 10 ml amp , zoledronic acid 4 mg / 100 ml vial , amino acid infusion 5 %100 ml , amino acids 10% w / vin glass bottle 500ml, , aminoacid ( essential ) 10% 100 ml ffs bottle , balanced crystalloid solution 500 ml bottle , ciprofloxacin100 mg / 50 ml 100 ml ffs bottle , dextrose 40% 100 ml bottle , dextrose 5 % with normal saline 0.45% , dextrose saline ( dns ) , dextrose, 25% 100 ml ffs bottle , dextrose, d 10 10% 500 ml ffs bottle , dextrose, d 5, 5% 500 ml ffs bottle , dextrose, d 50 50% 100 ml ffs bottle , electrolyte m ( multi electrolyte with 5% dextrose iv injection , electrolyte p ( multiple electrolytes & dextrose injection type i ip ) , fat emulsion 20% 0.2 ( 250 ) ml , fluconazole 100ml bottle. 2mg / ml. , glutamine dipeptide 100ml bottle , glycine irrigation solution ip 3000 ml bottle , hydroxyethylstarch 6% solution with sodium chloride 0.9% iv , levofloxacin 500 mg / 100 ml 100 ml ffs bottle , linezolid 200 mg / 100ml 300 ml bottle , mannitol20%100 ml ffs bottle , mannitol 20% 350ml , metronidazole 500 mg / 100 ml 100 ml ffs bottle , normal saline 0.9% 100 ml ffs bottle , normal saline 0.9% 3 ltrs bottle , normal saline 0.9% 500 ml ffs bottle , normal saline 1.6% 500 ml bottle , normal saline 3% 100 ml ffs bottle , normal saline glass bottle 100ml , normal saline glass bottle 500ml , ofloxacin 100 ml / 200mg bottle , omega 3 fatty acid 100 ml bottle , paracetamol1000 mg 100 ml ffs bottle , ringer lactatei / v 0.24 % v / v of lactic acid ( eq. to0.32% w / v of , ringer lactatei / v 0.24 % v / v of lactic acid ( eq. to0.32% w / v of , sodium chloride hyper tonicn / 2 ( 0.45% ) 500 ml ffs bottle , sodium chloride ( 1 / 2 n ) + dextrose , total parenteral nutrition 1000 ml with 763 kcal , tpn ( total parenteral nutrition ) including carbohydrate + proteins , budesonide respules 0.5mg , desflurane 240ml bottle , formeterol + budesonide 120 mdi respules , ipratropium bromide 250 mcg / ml amp , ipratropium bromide 40 mcg + levosalbutamol200 mcg respules , isofluran 250 ml bottle , salbutamol nebuliser solution bp sabutamol sulphate eq. to , salmeterol 25 mcg + fluticasone 250 mcg 120 mdi , sevoflorane 250ml. , 6 mercaptopurine , 50mg , acamprosate, 333 mg , aceclofenac 100mg tablet , aceclofenac 100mg+paracetamol 325mg , tablet , aceclofenac 100mg+paracetamol 325mg + chlorzoxazone 250mg , aceclofenac 100mg+paracetamol 325mg + serratiopeptidase 10mg , aceclofenac 100mg+paracetamol 500mg , tablet , acenocoumaro / nicoumalone 2 mg tab , acetazolamide 250 mg tab ( dimox ) , acyclovir400 mg , acyclovir800 mg , afatinib 40 mg , agomelantine 025 mg tab , albendazole 400 mg , albendazole 400 mg + ivermectin 6 mg tab , alendronate 70 mg , alfuzocin hcl 10mg , alfuzosin 10mg+dutasteride 0.5 mg , allopurinol 100 mg , alprazolam 0.25 mg , amiodarone 200 mg , amisulpride 100 mg , amisulpride 200 mg , amisulpride 50 mg , amitriptyline 25 mg , amitriptyline 50 mg , amitriptyline 75 mg , amlodipine 2.5 mg , amlodipine 5 mg , amlodipne 10 mg tab , amolodipine 5mg +atenolol 50mg , anastrozole1mg , aripiprazole 10 mg , aripiprazole 15 mg , aripiprazole 30 mg , artesunate 50 mg+sulphadoxine 500 mg+pyrimethamine 25 mg , aspirin 150 mg , aspirin 75 mg , atenolol 25 mg tab , atenolol 50 mg , atiomoxetin 10 mg tab , atiomoxetin 25 mg tab , atorvastatin 10 mg , atorvastatin 20 mg , atorvastatin 40 mg , axitinib 5mg , azathioprine 50 mg tab , azithromycin500 mg , azithromycin 250 mg tab , azithromycin+fluconazole+secnidazole ( 1gm+150mg+1gm ) tab , baclofen 10 mg , baclofen od 20 mg , baclofen od 30 mg , baclofen od 40 mg , betahistine 16 mg tab , betahistine 8 mg tab , betamethasone 0.5 mg , bicalutamide 50 mg , bisacodyl5 mg , blonameserire 2 mg , blonameserire 4 mg , buprinoprhin 4mg , buprinoprhin 8 mg , bupropion150 mg , buspirone 10 mg , buspirone 5 mg , cabargolin 0.25 mg , calcium acetate 667 mg tab , calcium carbonate tab , calcium d3 / 500mg , calithromycin 250 mg , capecitabine 500mg , carbamazepine200 mg , carbamazepine sr100 mg , carbamazepine sr200 mg , carbamazepine sr400 mg , carbimazole 5mg , carvedilol6.5 mg. , carvedilol 3.125 mg tab , cefixim 200 mg + clavulanic acid 125 mg , cefixime 100 mg , cefixime 200 mg , cefodoxime 200mg tab , cefpodoxime50 mg , cefuroxime 500 mg , cetirizine10 mg , chlordizepoxide 10mg , chlordizepoxide 25mg , chloroquine phosphatetab. 250 mg , chlorpheniramine maleate tab 4 mg , chlorpromazine50mg , chlorpromazine 100 mg , chlorthalidon 50 mg tab , chymotrypsin & trypsin tab , cinnarizine 25 mg tab , cinnarizine tab. 5mg , ciprofloxacin500 mg , clindamycin 600mg , clobazam 10 mg , clobazam 5 mg , cloimipramine 50mg , clonazepam 0.25 mg tab , clonazepam 0.5 mg tab , clonazepam 1 mg , clonazepam 2 mg , clonidine100 mcg , clonidine 100 mg tab , clopidogrel75 mg , clopidogrel aspirin , clotrimazole vaginal 500mg tab , clozapine 100 mg , clozapine 25 mg , clozapine 50 mg , crizotinib 250mg , cyclophosphamide 50 mg tab , deferasirox dispersible 500 mg tab , dexamethasone 4 mg tab , diazepam10 mg , diazepam5 mg , diclofenac 50mg + paracetamol 325mg + serratuioeotudase 10mg , diclofenac 50mg + paracitamole 500mg , diclofenac 50mg + serrtiopeptidase , diclofenac sodium 50 mg , dicyclomine tab 10 mg. , digoxin 0.25 mg , diltiazem 30mg , diphenylhydramine 50 mg , disulfiram 250 mg , divalproex sodium 250 mg , domperidone 10 mg tab , domperidone+ranitidine 150mg tab , donepezil10 mg , donepezil 5 mg , dosatinib 100mg / 50 mg , doxophylline400 mg , dudrogesterone 10mg , duloxetine 20 mg tab , duloxetine 30 mg tab , enalapril maleate 2.5 mg , enalapril maleate 5 mg , erlotinib 100mg , erlotinib 150mg , escitalopram 10 mg , escitalopram 20 mg , escitalopram 5 mg , ethamsylate 500 mg , etizolam 0.5mg , etophylline 77 mg+ theophyllin 23 mg , etoposide 50 mg , everolimus 2.5mg / 5mg / 10mg , famutaz 40 mg , ferrous ascorbate 100 mg tab ( elemental iron +folic acid 1.5 mg , ferrous sulphate tab. 200mg ( equivalent to 60mg elemental iron ) , flavoxate hcl 200mg , flebuxostat 40mg , fluconazole 150 mg , fludrocortisone 0.1mg tab , flunarizine 10 mg , flunarizine 5 mg , fluoxetine 40 mg , fluvoxamine 50 mg , folic acid 5 mg , frusemide40 mg , gabapentin 300 mg. , gabapentine 100 mg , gefitinib 250mg , glibenclamide 2.5mg tab , glibenclamide 5mg tab , gliclazide 80 mg , glimeperide2 mg , glimeperide 1 mg , glimipride 1mg+metformine 500mg , glyceryl trinitrate 0.5 mg sublingual tab , haloperidol 1.5 mg , haloperidol 10 mg , haloperidol 5 mg , hydrochlorothiazide 12.5 mg , hydrochlorothiazide 25 mg , hydrocortisone 10 mg , hydroxychloroquine sulphate 400 mg , hydroxychloroquine ( 200 mg ) , tablet , hyoscine butylbromide tab 10mg , ibuprofen400 mg , ibuprofen 400 mg + paracetamol 325 mg , imatinib 100mg , imatinib 400 mg , imipramine hcl 25 mg , imipramine hcl 75 mg , iron folic acid tab ferous sulphate dessicated ip 333 335mg , iso sorbitrate dinitrate sublingual5mg , isosorbide 5 mononitrate20 mg , ivermectin 12 mg , labetalol 100mg , lacosamide 50 mg tab , lactobacillus tab 60 million spores , lamotrigine 100 mg , lamotrigine dt 50 mg tab , lapatinib 250 mg , lenalidomide 10 mg , lenalidomide 10mg / 25mg , letrozole 2.5mg , levetiracetam 250 mg , levetiracetam 500 mg , levocetirizine 5mg tab , levocetirizine 5mg+ monteleukast 10 mg tab , levodopa + carbidopa 100+10mg , levofloxacin tab 500mg , linezolid600mg , lithium carbonate 300 mg , lithium carbonate 400 mg , lorazepam1 mg , lorazepam 2mg tab , lorcaserine 10 mg tab , losartan 50 mg tab , losartan 50 mg+hydroclorothiazide 12.5 mg tab , mag. oxide 200 mg , mebendazole 100 mg tab , mefenamic acid + dicyclomine tab ( 250 mg + 10 mg ) , tablet , mefenamic acid + drotaverine hcl tab ( 250 mg + 80 mg ) , tablet , megestrol acetate 40mg , memantine 10 mg , mesalamine ( 5 aminosalicylic acid ) 400 mg tab , metformin 500 mg , metformine 500 mg + glimipride 2 mg tab , metformine 500 mg+ gliclazide 80 mg tab , metformine 500 mg+glibenclamide 5 mg tab , methimazole 10 mcg tab , methocarbamol500 mg. , methotrexate10 mg , methotrexate2.5 mg , methotrexate7.5 mg , methyephendate 10 mg , methyephendate 20 mg , methyephendate 5 mg , methyl prednisolone16 mg , methyl prednisolone 4 mg tab , methyl prednisolone 8 mg tab , methylcobalamin500 mcg , methylcobalamin 1500 mcg+alpha lipoic acid 100 mg+folic acid1.5 , methyldopa 250 mg tab , metoclopramide05 mg , metoclopramide 10 mg , metolazone 5 mg , metoprolol tab 50 mg , metronidazol 400mg , mifepristone 200mg ( 1 tab ) +misoprostol 200mcg ( 4 , mirtazapine15 mg , mirtazapine30 mg , mirtazapine7.5 mg , misoprostol 200 mg , modafinil 100 mg tab , morphine 10 , multivitamin tab nfi formula sugar coated vita 2500 iu, vit b12 , , mycophenolate mofetil, 500 mg , n acetylcysteline 600 mg , naltrexone, 50 mg , nicorandil 5 mg tab , nifedepine 10mg , nifedepine r 20mg , nilotinib 200mg , nitazoxnide 200 mg , nitrofurantoin ip , 100 mg , norfloxacin400 mg , norfloxacine 400 mg + tinidazole 600 mg , ofloxacin 200mg +tinidazole 600mg tab , olanzapine 5 mg , olanzapine10 mg , olanzapine2.5 mg , olanzapine20 mg , olanzapine7.5 mg , olmesartan40mg , ondansetron 4 mg , ondansetron 8mg , orlistate 120 mg tab , orlistate 60 mg tab , ornidazole500 mg , oxcarbazapine 300mg tab , oxcarbazapine 600mg tab , oxcarbazepine 150 mg , pacitane 2mg tab , palbociclib 100 mg , palbociclib 125 mg , palbociclib 75 mg , paliperidone 1.5 mg , paliperidone 3 mg , pantoprazole 40 mg , pantoprazole 40 mg+ domperidon 10 mg , paracetamol 500 mg , paracetamol 650mg tab , paroxetine cr 12.5 mg , pazopanib 200mg / 400mg , penicillin v 250 mg tab ( phenoxymethyl penicillin potassium ) , pentoxifylline 400mg , phenobarbitone 30 mg. , phenobarbitone 60 mg. , phenytoin sodium100 mg , piogliatazone 15 mg tab , piogliatazone 30 mg tab , piracetam 400 mg , piracetam 800 mg , prazosin 5 mg , prednisolone 10 mg , prednisolone 5 mg , pregabalin 75 mg tab , primaquine7.5 mg , primaquine 15 mg tab , procyclidine 5 mg , promethazine 2 5 mg , propranolol la 40 mg , propranolol10 mg , propranolol20 mg , propylthiouracil , pyridoxine 40 mg tab , quetiapine 100 mg , quetiapine 200 mg , quetiapine 50 mg , quinine sulphate 300 mg , rabeprazole 20 mg tab , racecadotril 100mg , ramipril 2.5 mg tab , ramipril 5 mg tab , ranitidine 150 mg tab , resperidon 0.5mg , resperidon 2 mg , resperidon 4 mg , rivaroxaban 20 mg tab , rosuvastatin. 10 mg , sacubtril plus valsartan , secnidazole 500 mg tab , sertraline 100 mg , sertraline 50 mg , sildenafil 50 mg tab , sitagliptin 100 mg tab , sitagliptin 50 mg tab , sodium valporate 300 mg , sodium valproate200 mg , sodium valproate 500 mg , sorafinib 200mg , spironolactone 100 mg tab , spironolactone 25 mg , spironolactone+frusemide 20mg +50mg , sulfamethoxazole and trimethoprim ( 100mg+ 20mg ) tab , sulfamethoxazole and trimethoprim ( 800mg+ 160mg ) tab , sunitinib 50 mg , tadalafil 10 mg , tamoxifen 10 mg , tamoxifen 20mg , tamsulosin 0.4mg , tamsulosin$dutasteride 0.4mg+0.5mg , telmisartan40 mg. , telmisartan hydrochlorthiazide 40mg+12.5mg tab , terbutaline sulphate 2.5mg tab , tetrabenazine 20 mg tab , thiamine 100mg , thiamine 75mg , thyroxine sodium 100mg , thyroxine sodium 25 mg , thyroxine sodium 50mg , thyroxine sodium 75 mcg , tianeptine 12.5 mg , topiramate 100 mg tab , topiramate 25 mg , topiramate 50 mg , topotecan 1 mg , torasemide10 mg , tramadol – 100 mg tab , tramadol – 50 mg , tranexamic acid500 mg , trifluoperazine5 mg , trihexyphenidyl 2 mg , ursodeoxycolic acid300 mg , venlafaxine sr 150 mg , venlafaxine sr 75 mg , verapamil40 mg , vildagliptin 50 mg +metformin 500 mg tab , vildagliptin 50 mg tab , vit b complex tab. nfi ( prophylactic ) b1 2mg, b2 2mg, b6 0.5mg, , vit d3 60000 k tab , vitamin c 500 mg ( ascorbic acid ) , voglibose 0.3 mg tab , voriconazole 200 mg , warfarin 5 mg tab , zinc sulphate ( dispersible ) 20 mg , zolpidem 10 mg tab , zonisamide 100 mg tab , zonisamide 50 mg tab , zyloric acid 100 mg , aceborophylline 100 mg , amoxicillin 250 mg cap , amoxycilline – 500 mg , amoxycilline + clavulanic acid 625 mg cap. , ampicillin 250mg+ cloxacillin250mg , ampicilline – 500 mg , cyclosporine 100 mg , cyclosporine 50 mg , doxycycline 100 mg , fluoxetine bp 20 mg , hydroxy urea 500 mg cap. , imatinib mesylate 100 mg , itraconazole 100 mg , ivabradin 5mg , omeprazole 20 mg , oseltamivir ( 45mg ) , capsule , oseltamivir ( 75mg ) , capsule , pregabalin 75 mg + methylcobalamin 750 mcg , rifaximine 400 mg , temozolamide 100 mg , temozolamide 250 mg , sildenafil 20mg , vit. e400 mg , acyclovir 3% , atropine sulphate 1% 5 ml vial , carboxymethylcellulose solu. eye drop 1% , carboxymethylcellulose solu. eye drop 0.5% , ciprofloxacin eye drop 0.3% , fluromethanol eye drop , gentamycin eye drop , homotropine drop 2% eye drop , hypersol s ( 5% ) , lignocaine hcl 4% eye drop , loteprednol eye drop , natamycin eye drop , nepafenac ophthalmic solution , methyl cellulose / visco elastic , moxifloxacin 0.5% eye drop , moxifloxacin +prednisolone eye drope , ofloxacin 0.3% 5 ml vial , polyethelene glycol 400 & propylene glycol ophthalmic solution , pilocarpine eye drops 2% , polyvinyle alcohol 1.4% 5 ml , prednisolon eye / drop. , proparacaine , sodium chloride 5% eye drop ( nacl 5% ) , timolol maleate 0.5% 5 ml vial , tobramycin 0.3% 5ml eye drop , tropicamide 1% 5 ml vial , topicamide +phenylephrine eye drop , olopatidine hydrochloride ophthalmic solution 0.1% , benzocaine 2.7 w / v + chlorbutol 5% w / v +paradichlorobenzene 2% w / v+ , tobramycin eye oint.3gm tube , acyclovir 3% eye oint.5 gm tube , atropine eye oint. 3gm tube , chloramphenicol eye ointment 5 gm tube , ciprofloxacin eye ointment 5 gm tube , hydroxypropylmethylcellulose 2% w / v ophthalmic solution ocular , diclofenac gel 1% 30 gm , ecg gel 250ml bottle , lignocain jelly 2% , oxetacaine 10mg + aluminium hydroxide 291mg + milk of , prostaglandin e2 , ultra sonograph gel 250ml bottle , white petroleum jelly kg , acyclovir5%, 5 gm , beclomethasone+ clotrimazole +neomycin sulphate cream , betamethasone valerate ointment 0.1%, 15 gm tube , betamethosome valerate cream 0.05% 15gm , clobetasol propionate 0.05%, 15 gm tube , clotrimazole 2%w / w 15 gm , fusidic acid 2%, 15 gm , human placental extract , mupirocin 2%, 15 gm , magnesium sulphate, sulphacetamide, urea, proflavin ( in glycerine , neomycin sulphate 5 mg + bacitracin zinc 500 iu / gm, 15 gm , papin urea 15 gm tube , povidone iodine 5 % w / w + metronidazole 1 % w / w, 15 gm tube , povidone iodine 5%, 250 gm , povidone iodine 7.5%, 500 gm , salicylic acid 2%, 30 gm , silver sulphadiazine cream usp 1% w / w 250gm , mct oil 100ml bottle , lactobacillus, 150 million spores, , arginine sachet 10gm , hmf lactocex plus sachet , orodispersible probiotic sachet , ors who powder glucose anhydrous 13.5g / l, sodium chloride , formula milk for infants 500gm , potassium permegnet powder 400 gm pkt , neomycin sulphate powder 5gm , povidone iodine powder 5% , framycetin sulphate 1% w / w 30 gm tube , permethrin5% w / v 30gm , permethrin 5% 60 ml lotion , calamini lotion 50 ml bottle , alcoholic handrub with triple action:50%2 , antiseptic hospital concentrate contdaining 20% chlorohexidine , citric acid 500 ml bottle , compound benzointincture, benzoin, aloe, storax, tolu balsam , formaldehyde ( formalin ) 37% acq. 450 ml bottle , glutaral dehyde solution 2% w / v stabilized 5 ltr cans , glycerine 500ml bottle , glycerine enima , hand wash.sol . ( sol.isoprapanol, propanol, mecetronium, skin care , hydrogen peroxide soln 20% 500 ml bottle , hypo solution 5% 5 ltr , liquid paraffin ip 500ml bottle , povidone iodine ( surgical scrub ) , 7.5%, 500 ml bottle , povidone iodine, 5 %, 500 ml bottle , surface & environmental disinfectant , aluminium hydro gel syp ( antacid ) 100ml bottle , ambroxol 15mg + terbutaline 1.25mg+ guaiphenesin 50mg, , amoxicillin 125mg / 5ml 30ml bottle syp , amoxicillin and clavulanic acid 200+28.5mg suspension 30 ml , azithromycin 200mg / 5ml suspension 15 ml bottle , bromhexine hydrochloride syp. 4 mg / 5ml ( bottle ) , calcium carbonate with vitamin d3 and minerals like phosphorus, , calcium phosphate, 2:1 ratio, 100 ml bottle , cefixime , 100 mg / 5 ml, 30 ml bottle , cetirizine, 5 mg / 5 ml , 60 ml bottle , chloroquine phosphate , 160 mg / 10 ml ( 50 mg / 5 ml base ) , 60 ml , ciprofloxacin 125mg / 5ml syp 60 ml bottle , co trimoxazole 30 ml , cyclosporine 50 ml syp , cyproheptadine hcl 2 mg + tricholine citrate 275 mg, 200 ml , dextromethorphan 100 mg ( bottle ) , diphenhydramine 14.08mg+ammonium chloride 138mg +sodium , di sodium hydrogen citrate 200ml bottle , domperidon suspension 1mg / ml 30 ml bottle , etiophylline + theophylline pediatric syp. ( 46.5+14mg / 5ml ) 60 ml , glycerol 100ml , ibuprofen+paracetamol 60ml , iron200ml , lactulose , 3.35 gm / 5 ml , 100 ml bottle , levetiracetam 100 ml bottle , metronidazole 200mg / 5ml suspension 60ml bottle , milk of megnasia + liquid paraffine 100 ml , nitazoxanide 100mg / 5ml 30 ml bottle , norfloxacine suspension ( 30 ml bottle ) , ofloxacin suspension 50mg / 5ml 60ml , ondenstrone 30ml. 2mg / 5ml. , paracetamol oral solution 150mg / ml 15 ml bottle with dropper , phenobarbitone syp 30ml. 20mg / 5ml. , phenytoin sodium suspension 30mg / 5ml , potassium chloride syp 100 ml bottle , salbutamol sulphate , 2 mg / 5 ml , 60 ml bottle , sodium valproate , 200 mg / 5 ml , 100 ml bottle , sucralfate100 ml , sulfamethoxazole and trimethoprim suspension ( 200mg+ , vitamin a syp 100000 unit / ml ( 100 ml bottle ) , vitamin b complex, nfi formula, 100 ml bottle , zinc 20mg / 5ml 30 ml bottle , multivitamin multimineral with antioxidant syp200 ml , budesonide nasal spray , fluticasone nasal spray , lignocaine spray 10% , xylometazolin 0.1% nasal drop 10 ml vial , nasoclear nasal mist spray 20 ml spray , nasoclear nasal gel 15 gm tube , nasoclear nasal wash 3gm kit , chlorhexidine mouth wash 50 ml bottle , mouth wash 0.2% 50 ml , mouth paint clotrimazole 1%15 ml , absorable cotton roll, net 500gm , abdominal binder no 34 , abdominal drain set 28 no. , abdominal drain set 32 no , absorbable gelatine spangstron ip 80mmx50mmx10mm , accessory spikes , adhesive plaster 7.5 cm x 10 mtrs , ag ion impregnated central venous double lumen , ag ion impregnated central venous triple lumen , ag ion impregnated triple lumen catheter for haemodialysis, fr 12, , air bed matterses with complete set , airway size 3, 4, 5, 5.5 , airway size 6, 7.5 , alcohal based hand sanitizer 500ml bottle with dispenser ) , ambu bag adult , ambu bag pediatric , antimicrobial incise drape 3 m , artery catheter , av blood lines with av pressure transducer ( acceptable for fitting , barium sulphate powder susp 95% w / v powder ( hd ) 95% 400gm , bionet connector , biopsy forceps , biopsy gun , bipap mask , biploar forceps cable , bipolar cable , bis monitor electrode , black thread ( stitching ) big , bleaching powder gr ii 25 kg bag , blood administration ( transfussion ) set , blood bag double 350 ml , blood bag double 350 ml cpd solu , blood bag double 350 ml with sagam , blood bag quadruple 350 ml top bottom with cpd sagam solu , blood bag quadruple 450 ml top bottom with cpd sagam solu , blood bag single 350 ml , blood bag transfer 350 ml , blood bag triple 350 ml , blood bag triple 350 ml sagam , blood collection tube clot activator with rubber cap , blood culture bottles , blood transfusion set , bone marrow aspiration needles ( 14 ) ( medevolution ltd ) , bone marrow aspiration needles ( 15 ) ( medevolution ltd ) , bone marrow aspiration needles ( 16 ) ( medevolution ltd ) , bone marrow aspiration needles13 g ( medevolution ltd ) , bone marrow biopsy needle , bone wax , bp cuff adult & pead. , camera cover , cannula fixer set , carbolic acid 500 ml , c arm cover , catheter mount adult size , catheter mount peadiatric size , cautery pencil , cautery plate ( reusable ) , central line double luman 16g , central line singal luman , cerebral catheter reservoir 12mm dia chamber , cerebral catheter reservoir 18mm dia chamber , chest drainage catheter size: fg20 to fg40 , chest drainage catheter size: fg20 to fg40 with trocar , chlorhexidine gauze dresssing b.p antiseptic tulle gas dressing , collagen patch 30x30 , colostomy kit , computer radiography x ray film ( fuji ) 10x12 pkt , computer radiography x ray film ( fuji ) 14x17 pkt , computer radiography x ray film ( fuji ) 8x10 pkt , condom catheter , card clamp , craniotomy cutter blade , craniotomy drape ( 1.6 x 3.2 mtrs ) , crape bandage 2 , crape bandage 4 , crape bandage 6 , cvc line double lumen polyurethane catheter ( flexon , cvc line triple lumen polyurethane catheter ( flexon material ) with , cvp manometer , cylinder connection nut , cylinder key , cylinder spanner , d.j.stent 5 fr, 6 fr , 3fr, 4fr , dengue card test 100 test kit , dialyser 1.5 / 1.6 dialyzers multiple use made of polysulphone or , disp paper gloves , dispo cap , dispo face mask triple layer ( standard ) , dispo hivfull protecatin kit , dispo. n95 mask , disposable needle 18g ( single use ) , disposable needle 20g ( single use ) , disposable needle 22g ( single use ) , disposable needle 23g ( single use ) , disposable needle 24g ( single use ) , disposable needle no 26gx1 / 2 , disposable spinal needle 18 , disposable spinal needle 22 , disposable spinal needle 23 , disposable spinal needle 24 , disposable spinal needle 25 , disposable sterile gown , disposable suction catheter all size , distilled water 5 lit. , double lumen peripherally inserted central venous silicon , double lumen peripherally inserted central venous silicon , drap sheeth 120cm x 210cm sterile , ear buds , ecg disposabile electrode , ecg paper ( wax coated ) 50mmx30 mtr roll , ecg paper computerized triple channel 20m , edta tube , elastic adhesive bandage 10cm x 4 , elastic adhesive bandage 10cm x 6 , elastomeric pump for post operative analgesia , endotracheal tube cuffed 3.0 , endotracheal tube cuffed 3.5 , endotracheal tube cuffed4 , endotracheal tube cuffed5 , endotracheal tube cuffed 5.5 , endotracheal tube cuffed6 , endotracheal tube cuffed6.5 , endotracheal tube cuffed7 , endotracheal tube cuffedsize7.5 , endotracheal tube cuffed size 8 , endotracheal tube cuffed size8.5 , endotracheal tube cuffed size 9 , endotracheal tube cuffedsize 9.5 , endotracheal tubes plain without cuff size 2, , endotracheal tubes plain without cuff size2.5, , endotracheal tubes plain without cuff size3 , endotracheal tubes plain without cuff size3.5, , endotracheal tubes plain without cuff size 4 , endotracheal tubes plain without cuff size 4.5 , endotracheal tube with secondary lumen for , epidural kit ( needle & catheter 16g, ) , epidural kit ( needle & catheter 18g ) , epidural kit ( needle & catheter 19g, ) , epidural needle , examination glovesmedium pair , examination glovessmall pair , examination gloves large pair , exchange transfusion catheter with four way adaptor size 4cm, l , extention line 10cm , extention line 50cm , extention line 100cm , extention line 150cm , extention line 200 cm , extra ventricular drain ( evd ) , feeding tube size 3, 4, 5, , feeding tube size 6, 7, 8, 9, 10 , flexo metallic tube no 6, 6.5, 7, 7.5, 8, 8.5 , fluroscein strips pkt , fogharty cathetor 5fr , foley balloon catheter three way ( a ) fg 16, 18, 20, 22 , foley catheter size 12 2 way , foley catheter size 14 two way , foley catheter size 16 two way , foley catheter size 18 two way , foley triway no 20 two way , foley urinary catheter size 8 10 pediatrics , gigli saw wire , glass slide , glass tube 125x150 , glucometer strips , gudel airway all size soft and smooth , guide wire 0.35 no , guide wire 0.38 no , guide wire 150cm staight tip , guide wire 80cm. , halogen bulb holder ( heavy duty ) , hemodialysis fluid for bicarb made ( part a 10 ltr + part b , hernia flat mesh size: 10x15 , hernia flat mesh size: 15x15 , hernia flat mesh size: 15x20 , hernia flat mesh size: 3x5 , hernia flat mesh size: 6x6 , hickman catheter double lumen7.7 no , hickman catheter single lumen4.7 no , hickman catheter single lumen6.6 no , hickman catheter single lumen7.7 no , hme filter , humbeysknife disposable blade , hydrocephalus shunt medium pressur ( vp shunt ) , icd bag , implantable pain port with epidural catheter for long term pain , insulin syringe , intravenous drip set adult size , intravenous drip set pediatric size , iv .regulator set ( control drop set ) , iv cannula size 16 g , iv cannula size18g , iv cannula size20g , iv cannula size22g , iv cannula size24g , iv cannula size26g , j r c bag 1.5 ltr , 1 ltr , j r c bag 1 / 2 ltr 500ml , juglarcatheter 12 fr ( adult ) , juglar catheter 8fr ( pediatric ) , k 90 catheter , kallis pad disposable , liga clip 200, 300, 400 , long length quincke spinal needle for pain management, size – g , lung excersizer , lysol ( cresol with soap solution ) 5ltr jar , mackintosh double colour water proof , malecot rubber catheter no 12 , malecot rubber catheter no 16 , malecot rubber catheter no 20 , malecot rubber catheter no 22 , malecot rubber catheter no 24 , mesure volume set soft chamber, with bulb latex 110ml , micro drip set with bulb latex , micropore 6” , monopolar coutry wire , mucous extractor with connector for bronchoscope capacity 70 ml , mucus extractor , nebulazation mask ( set ) adult & pediatric , neonatal urine collection and measurement bag , niv mask venti cpap ( large & medium ) , non sterile surgical rubber gloves 6.5 no. ( pair ) made of natural , non sterile surgical rubber gloves 7 no. ( pair ) made of natural , non sterile surgical rubber gloves 7.5 no. ( pair ) made of natural , o maya large / small , oxygen catheter , oxygen connection for central line , oxygen connection for cylinder , oxygen high pressure hose pipe , oxygen mask adult & pediatric , paediatric double lumen polyurethan cvc line, 3 fr, l , paediatric double lumen polyurethane cvp catheter, 4.5 fr, g , paediatric triple lumen polyurethan cvc line with nitinol j guide , paper adhesive plaster microporous surgical tape 2inch x 10mt , paper adhesive plaster microporous surgical tape 3inch x 10mt , paper adhesive plaster microporous surgical tape 4inch x 10mt , pediatric diapers , pediatric ventilator circuit complete set , peripheral inserted central catheter 4 fr , peripheral inserted central catheter 5 fr , peritonial dialysis catheter 200mm peadiatric , peritonial dialysis catheter 280mm adult , peritonial dialysis fluid 1ltr. , pigtail catheter no 10 , pigtail catheter no 14 , plain vial with screw cap12x75 , plaster of paris bandage 3 , plaster of paris bandage 4 , plaster of paris bandage 6 , plaster of paris powder ip 1 kg pkt , plastic apron , plastic nozel cap , plastic test tube 3 , post exposure prophylaxis kits ( pep kits ) , probe for oxygen , pt vial / tube ( prothrombin vial / tube ) , radial a catheter , rectified sprit 4.5 ltr. , ryles tube size 10, 12, 14, 16, 18 , schirmer strips , short catheter with straight / j tip guide wire ( l 20, fr 2, g 22 ) , short pencil point spinal needle g 25 / 22, l 38mm. , sics kit ( small incision cataract surgery ) , silicon / double nasal prong with universal connector. all sizes. , silicon cautery plate , silicon mask size 0, 1, 2, 3, 4 & 5 , soda lime for anesthesia workstation 5kg , soft roll 15cm x 3 meter , spatula for papsmear , sterilant cold disinfectant for dialysis containing peraetic acid , sterile adhesive iodine drape large , sterile alcohol swabs , sterile disposable syringe 1ml , sterile gauze swab / pad packets , sterile hypodermic syringe with needle 03 ml , sterile hypodermic syringe with needle 10ml , sterile hypodermic syringe with needle 20ml , sterile hypodermic syringe with needle 2ml , sterile hypodermic syringe with needle 50ml / 60ml , sterile hypodermic syringe with needle 5ml , sterile luerlock syringe 10 ml , sterile luerlock syringe 5 ml , sterile leurlock syringe 20ml , sterile leurlock syringe 50ml , sterlie gloves isi 6.5 made of natural latex, micro rough finish , sterlie gloves isi size7.5 made of natural latex, micro rough , sterlie gloves isi size8 made of natural latex, micro rough , sterlie gloves isi size 7 made of natural latex, micro rough , sterlie powder free glovessize6.5 made of natural latex, micro , sterlie powder free glovessize7 made of natural latex, micro , sterlie powder free glovessize7.5 made of natural latex, micro , sterlie powder free glovessize8 made of natural latex, micro , surgical blade size 11 , surgical blade size 15 , surgical blade size 22 , surgical blade size 24 , t.piece circuit with oxygen tubing set ( complete set ) , tegaderm ( cvl dressing ) 10 cm*12 cm , tegaderm ( cvl dressing ) 7 cm* 8.5 cm , tegaderm ( samll ) i / v , thermometer , thomas splint , transducer set for invasive b.p. , three way stop cock , tmt paper , tounge depresser , tracheostomy tube cuffed plastic 5, 5.5, 6, 6.5, 7, 7.5, 8, 8.5 , triway with extention 10, 50, 100, 150, , turp set , twin nasal cannula adult , twin nasal cannula paed. , urine collecting bag , urine collecting bag with urometer , urine sugar diagnostic stick , vaccum jar 1000 ml , vaccum jar 2000 ml , vaccum pump belt , vaccum pump oil , vaccum regulator , vaporizer , ventilator catheter mount , ventilator circuit , ventilator circuit ( heated wire ) , ventilator circuit ( neonatal ) , ventilator circuit full kit ( tubing+hmf+filter+catheter , ventilator mask , ventilator nebulization kit with t piece , ventilator single tubing circuit ( adult ) , water bed , wipes , wound suctionset no 11 / 12 / 14 / 16 / 18 , x ray casset12x15 , x ray casset 10x12 , x ray casset 8x10 , x ray developer 22.5 lit. , x ray films size 10x12 50film per pkt , x ray films size 12x15 50film per pkt , x ray films size 8x10 50film per pkt , x ray fixer 22.5 lit , x ray hangers ( clip type ) 10x12 , x ray hangers ( clip type ) 12x15 , x ray hangers ( clip type ) 8x10 , x ray screen high speed 12x15 , x ray screen high speed 8x10 , x rayscreen highspeed 10x12 , yankar suction catheter ( complit set ) , pacing leads 6 fr , introducer sheath 6fr , pigtail catheter 6 fr ( 150 cm ) , j tip 0.035 mm guidewire , black braided silk eyeless needled suture usp, code 5036 size 2 , black braided silk eyeless needled suture usp, code 5082 size 4 , black braided silk eyeless needled suture usp, code 5333 size 2 , blackbraided silk eyeless needled suture usp, size 5 0 , blackbraided silk eyeless needled suture usp, size 6 0 , blackbraided silk eyeless needled suture usp, code 5049 size 4 0 , blackbraided silk eyeless needled suture usp, code 5070 size 3 0 , blackbraided silk eyeless needled suture usp, code 5087 size 3 0 , blackbraided silk eyeless needled suture usp, code 5334 size 1 0 , braided synthetic absorbable eyeless needled suture usp code , braided synthetic absorbable eyeless needled suture uspbraided , braided synthetic absorbable polyglactin 910 eyeless needled , braided synthetic absorbable polyglactin 910 eyeless needled , braided synthetic absorbable polyglactin 910 eyeless needled , braided synthetic absorbable polyglactin 910 eyeless needled , braided synthetic absorbable polyglactin 910 eyeless needled , oxidized regenerated cellulose ( absorbable hemostat fibrillar ) 1 in , oxidized regenerated cellulose based topical absorbable hemostar , oxldlzed regenerated cellulose; rayon fiber with 18% to 21% w / w , oxldlzed regenerated cellulose; rayon fiber with 18% to 21% w / w , polyamide black size 10 / 0 3 / 8 circle spachula needle 6mm , polyamide black size 8 / 0 3 / 8 circle revers cutting needl 6mm , sterlizedabsorbable eyeless needled suture usp, code , sterlizedabsorbable eyeless needled suture usp, code , sterlizedabsorbableeyeless needled suture usp, code , sterlizedabsorbableeyeless needled suture usp, code , sterlizedabsorbableeyeless needled suture usp, code , sterlizedabsorbableeyeless needled suture usp, code , sterlizedabsorbable polyglycolic acid eyeless needled suture , sterlizedabsorbable polyglycolic acid eyeless needled suture , sterlized monofilament polyamide eyeless needled suture , sterlized monofilament polyamide eyeless needled suture , sterlized monofilament polyamide eyeless needled suture , sterlized monofilament polyamide eyeless needled suture , sterlized monofilament polyamide eyeless needled suture , sterlized monofilament polyamide eyeless needled suture , sterlized monofilament polyamide eyeless needled suture , sterlized monofilament polypropyleneeyeless needled suture , sterlized monofilament polypropyleneeyeless needled suture , sterlized monofilament polypropyleneeyeless needled suture , sterlized monofilament polypropylene eyeless needled suture , sterlized monofilament polypropylene eyeless needled suture , sterlized monofilament polypropylene eyeless needled suture , sterlized monofilament polypropylene eyeless needled suture , sterlized monofilament polypropylene eyeless needled suture , sterlized monofilament polypropylene eyeless needled suture , sterlized surgical chromic gutsutue eyeless needied usp, code , sterlized surgical chromic gutsutue eyeless needied usp, code , sterlized surgical chromic gutsutue eyeless needied usp, code , sterlized surgical chromic gutsutue eyeless needied usp, code , sterlized surgical chromic gutsutue eyeless needied usp, code , sterlized surgical chromic gutsutue eyeless needied usp, code , sterlized surgical chromic gutsutue eyeless needied usp, code , sterlized surgical chromic gutsutue eyeless needied usp, code , surgical silk braded ( sutupack ) sterile foilover wrappack code 213 , surgical silk braded ( sutupack ) sterile foilover wrappack code 214 , surgical silk braded ( sutupack ) sterile foilover wrappack code 215 , vicryl 2.0 round body needle , 20g round body cutting needle 1 / 2 circle , copolymer of glycolied and e caprolactone, 1 0 ct 1 needle and , copolymer of glycolied and e caprolactone, 3 0 rb 1 needle and , monofilament glycomer 631* 3 0 75cm, undyed24mm3 / 8 , monofilament glycomer 631* 3 0 75cm, violet22mm1 / 2 , monofilament glycomer 631* 1 , 90cm, violet40mm1 / 2 circle , monofilament glycomer 631* 2 0 , 75cm, violet27mm1 / 2 , monofilament glycomer 631* 0, 90cm, violet40mm1 / 2 circle , ( coated braided polyglctin 910 with triclosan coating sut. ) with 1 / 2 , ( coated braided polyglctin 910 with triclosan coating sut. ) with 1 / 2 , ( coated braided polyglctin 910 with triclosan coating sut. ) with 1 / 2 , ( coated braided polyglctin 910 with triclosan coating sut. ) with 1 / 2 , ( coated braided polyglctin 910 with triclosan coating sut. ) with 1 / 2 , poliglecaprone 25 undyed with irgcare mp3 0, 3 / 8 circle reverse , polydioxanone lrgacare mp coated 150cm usp1 0 rb ctx, 1 / 2 , suture dyed polyester poly ( p dioxxanone ) 1 0, 24x4cm, 1 / 2 circle , 180 absorbablepolyglyconate knotless wound closure device with , 180 absorbablepolyglyconate knotless wound closure device with , 90 glycomer 631knotless wound closure device with , 90 glycomer 631knotless wound closure device with , copolymer of glycolied and e caprolactone, 2 0 ct 1 needle and , copolymer of glycolied and e caprolactone, 3 0 rb 1 needle and , synthetic absorbable surgical suture , polyglactin 910 with irgacare , synthetic absorbable surgical suture irgacare coated monofilament , absorbable unidirectional barbed device symmetric anchoring , absorbable adhesion barrier in the form of off white knitted fabric , polyster braided polybutylatecodated 1 / 2 circle tapercut double , triclosan antibacterial coated polyglactin 910 with 23 mm needle , protective disk with chg hydrophilic polyurethane absorptive foam , protective disk with chg hydrophilic polyurethane absorptive foam , self gripping polyester monofilament mesh pre cut with pla grips , self grippingpolyester monofilament mesh pre cut with pla grips , self grippingpolyester monofilament mesh pre cut with pla grips , self grippingpolyester monofilament mesh pre cut with pla grips , absorbable intraperitoneal umbilical patch of polyester mesh with , absorbable intraperitoneal umbilical patch of polyester mesh with , ada kit , aluminium ammonium sulphate powder 500gm , ana 96 well , anti a lactin 05ml , anti ab sera 10ml , anti d igg+ igm 10ml , anti d igm 10ml , anti hlactin 05ml , anti human globulin ( ahg ) 05ml , anti a sera , anti ab sera , anti a lactin , anti b sera , banded use in blood bank , benedict reagent5 lit cane , blotting paper sheet , blue tip 2ml , bovine albumin 22%05ml , buffer solution for hiv 50ml , ca 125 , calcium chloride 05ml / vail , capillary tube , couplin jar , cover slips size 18x18mm , cover slips size 22x22mm , cyto fix spray , diagnostic strip for urine ( sugar and albumin ) , diamond pencil , dpx mount 250ml ( urgent ) , ehlrich aldehyde reagent 125 , fouchet reagent 250ml , glass slide iso mark no 12mm , haematoxylene 5gm ( urgent ) , hbsag elisa test kit 4th generation 96 test , hbsag rapid test kit50 test , hbv elisa test kit 4th generation96 test , hbv rapid test kit , hcv elisa test kit 4th generation 96 test , hcv rapid test kit , hiv elisa test kit 4th generation 96 test , hiv rapid test kit , i.d. microtyping abd card , i.d. microtyping gel card ahg , immersion oil , iso propyl alcohol , leucoreductionfilter ( bed side ) , liss diluent for gel card , m .p elisa , mercuri oxide 25gm , methanol 2.5lit , mgg 480ml , mp antigen test kit rapid , n / 10 hcl 500ml , nitrile gloves size small / medium / large , p t tubes 3.8% sodium citrate , pandys reagent 125ml , papanicalou ea 125ml pea 030 , papanicalou og 6 125ml pea 010 , paraffin wax 58 60c , pasture pipette , polythene gloves , retic stain 125ml , slide tray , steel cassets for tissue processing , sulpho salicylic acid 500ml , tissue paper roll , vdrl elisa test kit , vdrl rapid test strip , vdrl rpr test kit , wafers cutting blade for tube welders , xylene , yellow gel tube vaccum blood collection tube , yellow tip plastic , massons trichrome stain , acetone detection kit , acetic acid solution 3%100ml , barium chloride 10 %500 ml , glacial acetic acid 100 ml , glucose kit god / pod , h2so4 25 % 500 ml bottle , leishman stain 500 ml , sharp collection containers disposable 1.5 ltrs , sharp collection containers disposable5 ltrs , total protein kits 100 ml , field stain a 500 ml , field stain b 500 ml , multi parameter urine strips ( 100 in 1 box ) , bismark brown stain 100 gm , light green stain 100 gm , disposable microtome blade ( 50 blades in one ) , csf protein kit , filter paper 12.5 cm 0.1 micron ( 50 per pkt ) , tips for auto pippets ( 2 to 100 micron yellow 1000 / pkt ) , tips for auto pippets ( 200 to 1000 micron blue 500 / pkt ) , surgical blade 22 no carbon steel , sugar albumin uristics ( bi parameter ) , sulpgar powder 500 gm , liquid ammonia 500 ml , nitric acid 500 ml , blotting paper 50 / pkt , pas stain , blood culture media aerobic for pediatric ( bac t / alert pf , blood culture media anaerobic for pediatric ( bac t / alert , ki67 / mib 106 ml antibody kit , glial fibrillary acidic protein ( gfap ) , s 100 , ae 1 / ae 3 , ema , nfp , synaptophysin , estrogen receptor epi monoclonal , progestron receptor monoclonal , anti her / erbb2 monoclonal , myogenin , sma , cd34 , bcl 2 , cyclin d 1 , cox 2 , p 53 , nkx 3 1 , amacr , vimentin , desmin , tris buffer gr , titriplexiii pure ( edta ) , sodium chloride for analysis , tween 20 for synthesis , hydro chloride acid about 36.46% , poly l ltsin solution p8920 , pap pen , hpr polymerr kit with dab chromogen , pricking lancet , leucoreductionfilter ( lab side ) , haemoglobin strip , single donor platelet kit make haemonotics / terumo penpol ( close , disposable circular stapler 26mm diameter , disposable circular stapler 29mm diameter , disposable circular stapler 31mm diameter , disposable circular stapler – 32mm diameter , disposable circular stapler33mm diameter , disposable circular stapleriii rows , disposable linear stapler with fixed staple height 55mm 60mm , disposable linear stapler with fixed staple height 75mm , reload 55 60mm for thin / vascular tissue white compatible , reload 55 60mm for medium thick tissue blue compatible , reload 75 80mm for medium thick tissue blue compatible , reload 75 80mm for thick tissue green compatible with , disposable hemorrhoidal stapler , disposable hemorrhoidal stapler iiirows , disposble skin stapler with pins , disposable hemorrhoidal stapler with detachable anvil. , reload for linear stapler with fixed staple height 35mm 45mm , reload for linear stapler with fixed staple height 35mm 45mm , reload for linear stapler with fixed staple height 55mm 60mm , reload for linear stapler with fixed staple height 55mm 60mm , disposable curved cutter stapler , polycearbonte bladeless frocar with reducer seal 5mm , polycearbonte bladeless frocar with reducer seal 10mm , polycearbonte bladeless frocar with reducer seal 12mm , reload for linear cutter 55mm 60mm size blue , reload forlinear cutter 55mm 60mm size green , reload forlinear cutter 75mm 80mm size blue , reload forlinear cutter 75mm 80mm size green , reload for linear cutter 90mm 100 mm size blue , reload forlinear cutter 90mm 100 mm size green , reusable laparoscopic clip applicator for medium large titanium , reusable laparoscopic clip applicator for large titanium clips with , mesh fixation device with non absorbable titatinum tacks , mesh fixation device with non absorbable titatinum tacks 15 , mesh fixation device with non absorbable titatinum tacks 20 , mesh fixation device with non absorbable titatinum tacks 30 , mesh fixation device with 30 poly ( lactide co glycolide ) , mesh fixation device with 15 poly ( lactide co glycolide ) , partially absorbable mesh with absorable & semi , partially absorbable mesh with absorable & semi absorbable , polyprplene with polyglecaprone 25 partially absorbable mesh , polyprplene with polyglecaprone 25 partially absorbable mesh , skin staple remover with plastic handle , distal tip closure titanium ligation clip small size , distal tip closure titanium ligation clip medium size , distal tip closure titanium ligation clip medium large size , distal tip closure titanium ligation clip large size , reusable laparoscopic clip applicator for large titanium , reusable laparoscopic clip applicator for medium large , reusable laparoscopic clip applicator for large titanium , dispoable trocar 05mm , dispoable trocar 10mm , dispoable trocar 12mm , dispoable trocar 15mm , disposable curved cutter stapler , reload compatible with curved cutter , endoscopic cutter & staplter60mmlong , endoscopic cutter & staplter60mm , reload endoscopic cutter & staplter60mm white / , reload endoscopic cutter & staplter60mm gold , reload endoscopic cutter & staplter60mm green , reload endoscopic cutter & staplter60mm blue , reload endoscopic cutter & staplter60mm / black , reload endoscopic cutter & staplter45mm green , reload endoscopic cutter & staplter45mm blue , endosuturing device 10mm with toggle lever , absorbable 2 0 endo suture cartridge 48 length , non absorbable 2 0 endo suture cartridge 48 length , disposable clip applier medium 5mm with 16 clips , disposable clipapplier medium 10mm with 20 clips , multifire clip applier small size 20 clip , multifire cliip applier long size 15 clips , reusable linear cutter 55 60mm with 200 firing , reusable linear cutter 75 80mm with 200 firing , suture locking , plastic locking clip applicator medium / large , locking clip cartridge medium / large , open clip appkicator 100 lt / 200 lt / 300 lt / 400 lt , titanium clip 100 lt / 200 lt / 300 lt / 400 , instrument tray 8×6 inch , instrument tray 9×6 inch , instrument tray 10×8 inch , instrument tray 11×7 inch , instrument tray 12×10 inch , instrument tray 14×10inch , instrument tray 15×12 inch , instrument tray 18×12 inch , instrument / dressing drum 9×5 inch , instrument / dressing drum 9×9 inch , instrument / dressing drum 10×8 inch , instrument / dressing drum 11×9 inch , instrument / dressing drum 14×9 inch , instrument / dressing drum 15×12 inch , formalin chamber 20 inch ( 20x8x8 ) 3 tray , formalin chamber 14inch 3 tray , formalin chamber 10 inch 2 tray , kidney tray set ( 150mmx200mmx250mmx300 mm ) , stainless steel cidex box with lid 10 lits ( 27x6x5 “ ) , ulv fogging machine , sanishieldsolution , ot slipper orthopedic soft , s.s sterilization autoclave , square box 20cmx20cm , s.s sterilization autoclave , square box 20cmx10cm , ent surgical micromotor drill system , micro ear burr tungsten carbide cutting 70mm , micro ear burr tungsten carbide cutting 0.5 mm , micro ear burr tungsten carbide cutting 0.60mm , micro ear burr tungsten carbide cutting 1 mm , micro ear burr tungsten carbide cutting 1.50 mm , micro ear burr tungsten carbide cutting 2.00 mm , micro ear burr tungsten carbide cutting 2.50 mm , micro ear burr tungsten carbide cutting 3.00 mm , micro ear burr tungsten carbide cutting 3.50 mm , micro ear burr tungsten carbide cutting 4.00 mm , micro ear burr tungsten carbide cutting 4.50 mm , micro ear burr tungsten carbide cutting 5.00 mm , micro ear burr tungsten carbide cutting 5.50 mm , micro ear burr tungsten carbide cutting 6.00 mm , micro ear burr tungsten carbide cutting 6.50 mm , micro ear burr tungsten carbide cutting 7.00 mm , micro ear burr tungsten carbide diamond / polishing 70mm length 0.50 mm , micro ear burr tungsten carbide diamond / polishing 70mm length 0.60 mm , micro ear burr tungsten carbide diamond / polishing 70mm length 1 mm , micro ear burr tungsten carbide diamond / polishing 70mm length1.50 mm , micro ear burr tungsten carbide diamond / polishing 70mm length 2.00mm , micro ear burr tungsten carbide diamond / polishing 70mm length2.50 mm , micro ear burr tungsten carbide diamond / polishing 70mm length3.00 mm , micro ear burr tungsten carbide diamond / polishing 70mm length 3.50 mm , micro ear burr tungsten carbide diamond / polishing 70mm length 4.00 mm , micro ear burr tungsten carbide diamond / polishing 70mm length 4.50 mm , micro ear burr tungsten carbide diamond / polishing 70mm length 5.00mm , micro ear burr tungsten carbide diamond / polishing 70mm length 5.50 mm , micro ear burr tungsten carbide diamond / polishing 70mm length 6.00 mm , micro ear burr tungsten carbide diamond / polishing 70mm length 6.50 mm , micro ear burr tungsten carbide diamond / polishing 70mm length 7.00 mm , bulls lampstand &100watt bulbs , head mirror , otoscope ( heine fibro optic ) , thudicum nasal speculum , lac’s tongue depressor ( metalic reuseable ) , in direct laryngoscopy mirrors , st clairs tompsons posterior rhinoscopy mirrors , hartmann aural speculum , shea aural speculum , tumarkin aural speculum , verhoeven micro ear suction tip , ear microsuction tip adapter , nasal suction tip , suction apparatus , siegles speculum , tuning fork ( 256hz, 512hz, 1024hz ) , bayonet forceps , jobson horne probe , steilizer ( boiler ) , bp apparatus , stethoscope , tilleys nasal dressing forcep , hartman nasal packing forcep , loop vectix wire , instrument tray 10inch x 15 inch , ent opd led head light , metalic washerless aural syringe ( simpson’s ) , tilley lichwitz s trocar&canula , tongue tie release butterfly forcep all size , sprit lamp , barany noise box , ear vectis with cerumen spud , hartmann aural forceps , trocltsch aural forceps , lucas curved aural forceps , eustachian tube catheter , mac ewen cell seeker and curette , alligator forceps , nasal foreign body hook , higginson syringe , tilleys antral harpoon , myle nasoantral perforator , st clair thompson quinys forceps , cidex box 45 cm and 35 cm and 24 cm , formalinchamber ( 35 cm & 45 cm ) , cheatle sterilizerforceps , cheatle forceps jar , bandage cutting scissors , x ray view box , opd sterlizing fogger machine , ultrasonic instrument cleaner , curved scissor 6 inch , formalin chamber 24 cm , savalon solution , bowl , romposon suction tube , nasal suction tip , tilleys forcep , lidocaine 4% solution 30 ml , gauze cloth 91 cm / 20 m , macintos 20×1 mtr , surgical mopping pad , adk drain 24 no , adk drain 28 no , chest tube with trocar 20 no , chest bag under waterseal 26 no , romovac suction drain 16 no , romovac suction drain 14 no , romsons corrugated drain , harnia mesh kit 3×6 inch , intraoclar lens ( 15 no to 27 no ) , viscoelastic substance , balanced salt solution , formalin solution , acetone solution , inj. hylase ( hyluronidase ) , lignocaine 2%+ adrenaline , inj.gentamicin , inj. phenylephrine 10 mg / 1 ml , cuticell10*10 cm , cuticell 10*30 cm , hand wash soln 500 ml , microgen d 125 , iv ns3 % 100 ml , iso p 500 ml , iv ns 0.45% 500 ml , guedal airway size 000, , guedal airway size 00, , silicon mask adult size 00 with connection tube, reservoir bag and valve, high concentration, ( bains circuit ) , ansthesia work station disposable circuit ( adult ) , laryngoscope ( paedeatric ) a machintosh size 00, , laryngoscope ( paedeatric ) b miller blade size , 0, , laryngoscope ( paedeatric ) a machintosh size , 1, , laryngoscope ( paedeatric ) b miller blade size size , 1, , laryngoscope ( paedeatric ) b miller blade size , 2 , laryngoscope ( adult ) with bladesize , 3, , laryngoscope ( adult ) with bladesize , 4 , maccoy laryngoscope with bladesize 3, , maccoy laryngoscope with bladesize , 4 , maccoy laryngoscope with bladesize 5 , lma ( proseal ) size 1, , lma ( proseal ) size , 1.5, , lma ( proseal ) size , 2, , lma ( proseal ) size , 2.5 , lma ( proseal ) size , 3, , lma ( proseal ) size , 4, , lma ( proseal ) size , 5 , lma ( i gel ) size 1 , lma ( i gel ) size 1.5 , lma ( i gel ) size 2 , lma ( i gel ) size 2.5 , lma ( i gel ) size 3 , lma ( i gel ) size 4 , lma ( i gel ) size 5 , intubating lma ( i lma ) fastrac 6 , intubating lma ( i lma ) fastrac 6.5 , intubating lma ( i lma ) fastrac 7 , intubating lma ( i lma ) fastrac 7.5 , intubating lma ( i lma ) fastrac 8 , intubating bougie , ventilating bougie , ansathesia face mask silicone transparentsize 00 , ambu bag ( padeatric ) 150 ml , micropore 0.5inch , micropore 1 inch , magill forcep ( adult ) , magill forcep ( padeatric ) , video laryngoscope with blade 2 ( c mac ) , video laryngoscope with blade 3 ( c mac ) , video laryngoscope with blade 4 ( c mac ) , centralvenous catheterkit ( paedeatric ) , pressure bag 1000 ml , pressure bag 500 ml , nebulizer machine , head ring ( peadia ) , head ring ( adult ) , hot air warmer , 3 way extension 25 cm , needle cutter , 3 way extension 100 cm , electric surgical instrument boiler ( 24*8*8 ) inch , electric surgical instrument boiler ( 20*8*7.5 ) inch , tee oxygenator ( t piece ) , tub big50 litr , detergent powder 500 gm , rubber sheet macintos20m roll , capmask / cloth based , towels ( small ) , towels ( large ) ) , shoe cover / cloth based , disposablesurgical gown , combined epidural spinal set ( 18g ) , hernia mes ( polypropylene ) 3*6 inch , north & southpole indotracheal tube ( rate tube ) size 3.5, ( ring adair elwiny ) , north & southpole indotracheal tube ( rate tube ) size 04 ( ring adair elwiny ) , north & southpole indotracheal tube ( rate tube ) size 4.5, ( ring adair elwiny ) , north & southpole indotracheal tube ( rate tube ) size 05, ( ring adair elwiny ) , north & southpole indotracheal tube ( rate tube ) size 5.5, ( ring adair elwiny ) , north & southpole indotracheal tube ( rate tube ) size 06, ( ring adair elwiny ) , north & southpole indotracheal tube ( rate tube ) size 6.5, ( ring adair elwiny ) , north & southpole indotracheal tube ( rate tube ) size 07, ( ring adair elwiny ) , north & southpole indotracheal tube ( rate tube ) size 7.5, ( ring adair elwiny ) , north & southpole indotracheal tube ( rate tube ) size 08 ( ring adair elwiny ) , betadine scrub ( 500 ml ) , betadine solution ( 500 ml ) , nylon 2.0 ( cutting needle ) suture , ethilone 2.0 , condom , g bone , mirena 50 , bupevacine inj ( 20 ml ) , pregnancy kit , infrared thermometer gun , nebuliser mask ( paedia ) , needle cutter electrical , steam disinfectant system, ( fumigation machine ) , surgical poly wrap , tripple lumen central line adult , uroflometer , pulse oxymeter , nasopharyngealairway size 5.5 , nasopharyngealairway size 6 , nasopharyngealairway size 7 , nasopharyngealairway size6.5 , nasopharyngealairway size7.5 , steel scissor 10 no , steel tray ( small ) , steel tray ( large ) , steel tray ( medium ) , bb splint , disposable catheter mount , tooke corneal knife ( num ) , inj. adenosine 6 mg / 2 ml , inj. adrenaline 1 mg / ml , inj. adrenaline 1 mg , inj. alamine 200 ml , inj. albumin iv 20% 100 ml , inj. amikacin500 mg , inj. amikacin ( 250mg / 2ml ) , inj. amiodarone 150 mg , inj. amoxycillin + clav. acid1.2 g , inj. amoxycillin + clavulanic acid 1.2 gm , inj. amoxycillin 500 + clavulanic acid 100 mg , inj. amphotericin b 50 mg , inj. anti rabis immunoglobulin ( inj. arv ) , inj. antisnake venom 10 ml , inj. artemether 80 mg , inj. artesunate 60 mg , inj. artesunate 60mg , inj. arv / antirabies vaccine , inj. atracurium50 mg ( 5 ml ) , inj. atracurium 10 mg ( 2.5ml ) , inj. atropin 1 ml / 0.6 mg , inj. atropine 0.6 mg , inj. bupivacaine 0.5 % 20 ml , inj. bupivacaine 0.5 % 4 ml ( heavy ) spinal , inj. bupivacaine hydrochloride 0.25% 20 ml , inj. calcium gluconate 10% ( 10 mg ) , inj. calcium gluconate 10% 10ml , inj. carboprost 250 mg , inj. cefazolin1 gm , inj. cefoperazone 1000mg + sulbactam 1000mg , inj. cefotaxime sodium500 mg , inj. cefotaxime sodium500 mg / vial , inj. cefotaxime sodium 1 gm , inj. ceftriaxone500mg vial , inj. ceftriaxone ( 250mg vial ) , injection , inj. ceftriaxone+ sulbactam , inj. chlorpheniramine 25 mg , inj. ciprofloxacin 200 mg , inj. clindamycin 600 mg , inj. clindamycin 300 mg , inj. clindamycin 900 mg , inj. colistin3 miu , inj. colistin4.5miu , inj. colistin 2miu , inj. colistin 9miu , inj. deriphyline , inj. dexamethasone 8 mg , inj. dexmeditomidine 100 mcg / 1 ml , inj. diazepam 10mg , inj. diazepam 5mg , inj. diclofenac 25 mg , inj. dicyclomin 10 mg , inj. dicyclomine 10 mg , inj. digoxin 0.5 mg / 2 ml , inj. dilitiazemiv 25 mg , inj. dobutamine 250 mg , inj. dobutamine 250 mg ( 5ml ) , inj. dopamine 40 mg , inj. dopamine 5ml , inj. enoxaparine 40 mg , inj. enoxaparine 60 mg , inj. ephedrine30 mg / 1 ml , inj. esmolol 100 mg , inj. ethamsylate250mg , inj. etomidate 10 ml ( 2 mg / ml ) , inj. fentanyl 2 ml ( 50 mg / ml ) , inj. flumazenil 0.5 mg , inj. fortwin ( pentazocin ) 30mg , inj. frusemide 10 mg , inj. furosemide 40 mg , inj. gentamicin 80 mg , inj. gentamicin40 mg / ml , inj. gentamicin 40 mg , inj. gentamycin 80 mg / 2 ml , inj. glargin insulin 100 iu / ml , inj. glucagon 1 mg , inj. glycopyrrolate 1 ml / 0.2 mg , inj. haloperidol 2mg / ml , inj. hydralazine 10 mg , inj. hydrocortisone 100 mg , inj. hyoscine 20 mg / ml , inj. hyoscine butyl bromide 20 mg , inj. hyydrocortisone 100mg , inj. insulin nph , inj. insulin regular , inj. iron sucrose 100 mg iv 5 ml , inj. iron sucrose 50 mg / ml iv , inj. kcl 10 ml / 150 mg , inj. ketamine10 ml ( 50 mg / ml ) , inj. labetalol20 mg , inj. levetiracetam 500 mg , inj. levofloxcillin100 ml , inj. lignocaine 2 % ( 21.3 mg / ml 30 ml vial , inj. lignocaine 2%iv ( 30 ml ) , inj. linezolid 600 mg , inj. linezolid 600 mg 300 ml , inj. l orithine l asportate 5 gm , inj. loxicard 2% 20 ml iv , inj. mannitol 100 ml , inj. mannitol 100 ml , inj. mephentermine 30 mg / 1 ml , inj. meropenam + sulbactam1 gm , inj. methargine 0.5 mg , inj. methotrexate 100mg / ml , inj. methylcobalamin 500 mcg / 3ml , inj. methylprednisdone 500 mg , inj. methylprednisolone 1 gm , inj. metoclopramidehcl 5 mg / ml , inj. metoclopramide 5 mg / ml , inj. metoprolol 1 mg / ml ( 5 ml ) , inj. metoprolol 1mg / 5mliv , inj. metrogyl 100 ml , inj. mgso4 1 gm / ml ( 50% ) , inj. midazolam 1 mg / ml ( 5ml ) , inj. midazolam 1mg / 5ml , inj. mixtard insulin 100 iu / 10 ml , inj. morphine 1 ml / 10 mg , inj. moxiflox 400 mg iv , inj. multivitamin iv , inj. nalaxone 400 mg , inj. nefenamic acid 500 mg , inj. neostigmine +glycopyrrolate ( 2.5mg + 0.5mg ) 5 ml , inj. neostigmine 1 ml / 0.5 mg , inj. nitroglycerin25 mg / 5 ml , inj. noradrenaline 1ml , inj. noradrenaline 2 mg , inj. ondansetron2 mg / ml , inj. ondensetrone 8 mg / 2 ml , inj. oxytocine 10 iu , inj. pantaprazole 40 mg , inj. paracetamol 150 mg , inj. pheniramine 75mg ( 2ml ) , inj. phenylephrine 10 mg / 1 ml , inj. phenytoin 50mg , inj. phenytoin 50mg / ml , inj. pilocarpine nitrate ip 0.5 % w / v ( 1 ml ) , inj. piperacillin +tazobactam4.5 gm , inj. potassium chlorideiv 150 mg / 10 ml , inj. promethazine25 mg / 7.84 ml , inj. promethazine 25mg , inj. propofol 20 ml ( 10 mg / ml ) , inj. protamine sulfate 10 mg , inj. quinine 600 mg , inj. regular insulin 100 iu , inj. ropivacaine 0.7 % / 20 ml , inj. sodabicarbonate 10 ml , inj. streptokinase 1.2 mu , inj. succynyl choline 10 ml ( 50 mg / ml ) , inj. tecoplanin 200 mg , inj. tecoplanin 400 mg , inj. terlipressiniv 1 mg / 10 ml , inj. tetanns toxcid 5 ml , inj. thiopentanil sodium 500 mg , inj. tramadol 50 mg , inj. tranexamic acid 500 mg , inj. tranexamic acid injection bp / ip ( 100mg / ml ( 5ml amp ) ) , inj. triamcinolone acetate 40mg / ml , inj. triamcinolone acetate 40mg / ml , inj. valethamate 10 mg , inj. vancomycin 1 gm , inj. vecuronium 10 mg , inj.botropase ( ( haemocoagulase 1cu ) 1ml ) , inj. verapamil 5 mg , inj. vit d33 l , inj. vit d3 6l , inj. vitamin k 10 mg , inj. xylocaine 2% intravenous , inj.adrenaline 1 ml , inj.dmpa 150 mg , tabmethyl prednisolone 16 mg , tab deriphylline ( etophylino 77mg + theophyline 23mg ) , tab fluconazole150 mg , tab fluconazole 100 mg , tab fluconazole 200 mg , tab fluconazole 300 mg , tab fluconazole400 mg , tab fluconazole 50 mg , tab hydroxyzine25mg , tab hydroxyzine 10 mg , tab.acebrophyllin + n acetyl cystine , tab.aceclofanc + paracetamol , tab.aceclofenac 100 mg , tab.amlodipine2.5 mg , tab.amlodipine5 mg , tab.amoxycillin + clavulanic acid625 mg , tab.amoxycillin 500mg , tab.aspirin 75 mg , tab.atorvastatin20 mg , tab.azithromycin 500 mg , tab.azithromycin 500mg , tab.buscopan 10 mg , tab.carvedilol 3.125 mg , tab.cefixime 200mg , tab.cepodoxime 200mg , tab.cepodoxime+clavulanic acid 325 mg , tab.cinnarizine + dimehydrate , tab.cinnarizine 25 mg , tab.clopidogrel 75 mg , tab.diclofanac+ paracetamol , tab.diclofenac 50 mg , tab.digoxin0.25 mg , tab.ethamsylate 250 mg , tab.fluconazole 150 mg , tab.furazolidone100mg , tab.glimeperide2mg , tab.glimeperide 1mg , tab.iron folic acid 400 mg , tab.lefulonamide10mg , tab.lefulonamide20 mg , tab.levocetrizine + montelukast , tab.levofloxacin 500 mg , tab.metformin 500 mg , tab.metoprolol 50 mg , tab.metronidazole 400mg , tab.nifedipine 10 mg , tab.nitrofurantoin 100 mg , tab.ofloxacine + ornidazole , tab.ofloxacine 200mg , tab.paracetamol 500mg , tab.paracetamol 650mg , tab.pheniramine maleate4 mg , tab.rabeprazole 20 mg , tab.telmisartan 40 mg , tab.thyroxine 25mg , tab.thyroxine 50mg , tab.thyroxine 75mg , tab.vildagliptin 50 mg , tab. acebrophyllin 100 , tab. acetazolamide 250mg , tab. acetylcysteine ( mucinac ) 600 mg , tab. acyclovir 800mg , tab. alprazolam0.5mg , tab. alprazolam 0.25 mg , tab. alprzolam 0.25mg , tab. amiodarone 100 mg , tab. amitriptyline 10 mg , tab. amitriptyline 25 mg , tab. amlodipin 5 mg , tab. amoxycillin + clavulanic acid625 mg , tab. arltemrthev+ lumefantrine , tab. ascorbic acid ( vitamin c ) 500mg , tab. asprin 150 mg , tab. asprin 75 mg , tab. atorvastatin 40mg , tab. azathioprine 100 mg , tab. azithromycin 500mg , tab. betahistine 8mg , tab. cabergoline 0.5 mg , tab. calcium + vit d3 500 mg , tab. carbamazepine 400mg , tab. carbimazole 10 , tab. cefelexin 500 mg , tab. cefixime 200 mg , tab. cefpodoxime200 mg , tab. cetrizine5mg , tab. cetrizine 10 mg , tab. chlordiazepoxide 10 mg , tab. chloroquine 500 mg , tab. cinnarizine ( 25 mg ) , tab. ciprofloxacin500 mg , tab. ciprofloxacin 250 mg , tab. clonazepam 0.5 mg , tab. clonazepam 0.25 mg , tab. cyclophosphamide 50 mg , tab. dapsone 100 mg , tab. dexamethasone 2 mg , tab. dexamethasone 4 mg , tab. dexamethasone 8 mg , tab. diclofenac + serratiopeptidase 10 mg , tab. dicyclomine 10 mg , tab. dicylomine 20 mg , tab. diltiazem 30 mg , tab. divalprox sodium 250 , tab. domperidone 10 mg , tab. drotaverine 40 mg , tab. escitalopram 10 mg , tab. etiophyllin + theophyllin 50 mg , tab. etizolam0.5mg , tab. etizolam 0.25 mg , tab. fexofenadine 120 mg , tab. fexofenadine 180 mg , tab. fluconazole 150mg , tab. furosemide 10 mg , tab. haloperidol 0.5mg , tab. hydrocortisone 100 mg , tab. hyoscine butyl bromide 10 mg , tab. ibuprofen 400 mg , tab. iron folic acid ( 100 mg +5 mg ) , tab. ivabradin 5mg , tab. labetalol 100 mg , tab. labetalol 200 mg , tab. levetriacetam 500 , tab. levocetrizine 10 mg , tab. levocetrizine 5 mg , tab. levocetrizine 5mg , tab. levofloxacin 250 mg , tab. levofloxacin 500 mg , tab. linezolid 600 mg , tab. mala n , tab. metformin 500mg , tab. methargine 0.2mg , tab. methotrexate 10mg , tab. methotrexate5mg , tab. methotrexate7.5 mg , tab. methotrexate 2.5 mg , tab. methyl prednisolone 32mg , tab. methylcobalamin / mecobalamin 500 mcg , tab. metoclopramide 10 mg , tab. metoprolol 25 mg , tab. metoprolol 50 mg , tab. metorolol 25mg , tab. metronidazole 200 mg , tab. misoprostol200 mg , tab. misoprostol 25 mg , tab. mv / b complex , tab. nefenamic acid&diclocylomine ( 500mg+ 20 mg ) , tab. nifidipin10 mg , tab. nintedanib 100 mg , tab. nintedanib 150 mg , tab. nitrofurantion 100 mg , tab. norethisterone 5mg , tab. norfloxacin 400 mg , tab. ofloxacin 200 mg , tab. olanzapine10 mg , tab. olanzapine 10mg , tab. olanzapine 5 mg , tab. ondensetron 4 mg , tab. oremeloxifene ( chhaya ) 30 mg , tab. oseltamivir 30mg , tab. oseltamivir75mg , tab. oseltamivir 45 mg , tab. pantaprazole+ domperidone , tab. pantaprazole 40 mg , tab. pheniramine 25mg , tab. phenytoin 100 mg , tab. pirfenidone200 mg , tab. pirfenidone400 mg , tab. prednisolone20 mg , tab. prednisolone 10mg , tab. prednisolone 10 mg , tab. prednisolone 5 mg , tab. prednisolone 5mg , tab. pregabatin + methylcobalamin 75 / 1500 , tab. pregasterone susline 200 mg , tab. propanolol 40 mg , tab. pyoridoxine sr 100 mg , tab. pyroxicame 10 / 20 mg , tab. pyroxicame 20 mg , tab. ramipril 2.5 mg , tab. ramipril 5 mg , tab. ranitidine 150 mg , tab. roflumilast 250 mg , tab. roflumilast 500 mg , tab. sodium valproate 500 , tab. thyrox12.5mg , tab. thyrox 100 mg , tab. thyrox 25 mg , tab. thyrox 75mg , l arginine + proanthocinidin ( argipreg ) sachet granules , tab. tramadol 100 mg , tab. toclizumab5 mg , tab. torsemide 10 mg , tab. tramadol50mg , tab. trypsin / chymotrypsine colloidal / sessatiopeptidase 100000 au , tab. ursodeoxycholic acid 300 mg , tab. verapamil 40 mg , tab. vitd3 60 k , tab. vitamin. b complex ( nfi ( prophylactic ) ) , tab. zinc oxide 20 mg , tab.doxyllamine+pyridoxine , tab.dydrogesterone 10 mg , tab.misoprostol 600 mcg , tab.ofloxacin+ornidazole , tab.thyrox 50mg , betadine pessary 200mg , tab. mtp kit ( mifepristone 200 mg+misoprostol 200 mg ) , tab.trenexa+ethamsylate , ors sachet , chlorhexidine gluconate mouthwash 0.2% w / v solution ( 50ml bottle ) , glucose powder , hiv kit / hbs ag ( surgical ppe kit ) , ketopatch , diclofenac patch , cholecalciferol granules 60000 iu , cap. ampicillin ( 250 mg ) , cap. b complex minerals with zinc , cap. doxycycllin 100 mg , cap. itraconazole200 mg , cap. methylcobalamin + alpha lipoic acid ( 1500 mcg + 100 mg , cap. itraconazole 100 mg , cap. vit e 200 , cap. vit e 400 , cap. vitamin a 1 lakh iu , creamliquidparaffin , cream clotrimazole 1% 30 gm tube , cream soframycin , creambeclomethasone 30 gm tube , creambetamethasone20 gm tube , creamfusidic acid 15 gm tube , creamketoconazole 15 gm tube , cream clobetasol propionate0.5 % , cream acyclovir 5% ( 5gm ) , cream estriol 1% ( 1.5 gm ) , diclofenacgel 30 gm tube , dinoprostron gel 0.5 mg , neomycin sulphate+bacitracin zinc5mg+500 iu / gm ointment15gm tube , neomycin sulphate+bacitracin zinc ( 5mg+500 iu / gm ointment 15gm tube , oint. choline salicylate + benzalkonium chloride9% + 0.02% ( 10 gm ) , oint acyclovir. 5g , oint soframycin 10 gm , oint. chloramphenicol +dexamethasone ( 1%+0.1% ) , oint. choline salicylate + lidocaine , oint. clobectasol + salycylic acid 3 % , oint. mupirocin 2% , oint. neosporin5 gm tube , oint. povidone15 gm tube , oint. silver nitrate 15g , oint.mupirocin ( 2% w / w ( 5 gm tube ) , oint. mupirocin ( 2% w / w ( 5 gm tube ) , oint. lignocaine hydrochloride ( 2% w / v ( 30 gm tube ) , ointment betadine 2% 5gm , placenta extract gel 20g , eye ointment ciprofloxacin0.3% ( 3gm tube ) , oint. clindamycin gel 5 gm , oint. gentamycin sulphate 0.1% ( 15gm tube ) , , ointment metrogyll p 2% , xylocaine spray 10 % , eye drop cyclopentolate 1% w / v ( 5 ml ) , , eye drop dexamethasone + gentamycin 0.1%+0.3% , eye drop carboxymethylcellulose sodium 0.5% ( 10ml ) , eye drop sodium chloride ( ophthalmic ) 5% ( 10 ml ) , eye drop timolol maleate0.5 %w / v ( 5 ml vial ) , eye drop gatifloxacin 0.3% 5ml , eye drop. phenylepherine hcl & tropicamide 5% + 1% 5 ml , eye drop tobramycin ( 0.3% 5ml ) , eye drop proparacaine 0.50% 5 ml / vial , eye drop. carboxymethylcellulose ip 1% w / v 10ml vial , hydroxypropyl methylcellulose ophthalmic solution 2% , hydroxypropyle methyle cellulose opthalmic solution ( 2% 2ml pfs ) , eye drop , eye drop olopotadine antiallergic ( 0.1% w / v ( 5 ml vial ) ) , , eye drop providone iodine 1% ( 5 ml ) , eye drop fluconazole 3 mg ( 10 ml vial ) , eye drops pilocarpine 4% , eye drops pilocarpine hydrochloridebp 2% , eye drop ciprofloxacin+ dexamethosone ( 0.3%+0.1% ) , eye drop ofloxacin 0.3% w / v ( 5 ml vial ) , eye drop. lignocaine hydrochloride ( 4% ( 5 ml vial ) , eye dropmoxifloxacin + prednisolone 5 mg + 3 mg / 5 ml , eye dropmoxifloxacin 0.5% w / v ( 5 ml ) , , ear wax cerumenolyticeach 10 ml , nasal drop xylometazoline ( 0.1%w / v 10 ml vial , nasal spray calcitonin30 mcg , bss solution for opthalmic use ( 500ml ) , solution , eye drop atropine sulphate 1% ( 5 ml vial , ear drops gentamycin + hydrocortisone 0.3% + 1% , eye drophomatropine 2 % ( 5 ml ) , , eye drop ciprofloxacin 0.3% ( 5ml vial ) , ciprofloxacin eye ointment 0.3% ( 3gm tube ) , syp.b complex 100 ml , syp. alkacitral ( disodium hydrogen citrate ) 1.4g / ml , syp. cyproheptadine 100 ml , syp. dextrometharphin 100 ml , syp. lactulose 150 ml , syp. liv 52250 ml , syp. prednisolone 10 mg , syp. prednisolone 20 mg , syp. prednisolone 5 mg , syp. vitamin a ( 10000o iu ) 100 ml , syrp. paracetamol 125 mg ( 60ml bottle ) , syringe 50 ml , syrp. alkalizer100 ml , syrp. anti oxidant lycopen 200 ml , syrp. dextromethorphan + chlorpheniramine , syrp. dextromethorphan 10mg / 5ml ( 100ml bottle , syrp. lactulose 60 ml , syrp. potassium chloride 100mg / ml , syrp. potassium chloride 200 ml , syrp. sucralfate + oxetacaine , syrp. ambroxol hcl 15mg+terbutaline sulphate 1.25mg+guaiphenesin 50mg 5ml 100ml , syrp. amoxicillin and clavulanic acid i.p. ( 200+28.5mg ( 30 ml bottle ) , syrup antacid , clotrimazole pessary 100 mg , clotrimazole pessary 500 mg , budecort inhaler200 mcg , budesonide inhaler ( foracort ) 0.5 mg , budesonide respules 0.5 mg , buprenorphine patch , tiotropium 18ugmdi / dpi , tiotropium 9ugmdi / dpi , xylocaine viscoussolution 4% , total parentral nutrition ( tpn ) 1 litr. , total parentral nutrition ( tpn ) 500mlperiferal , sporolac sachet ( 5 millions lactobacillus ) , soda lime granule5 kg , sodium phosphateenema 100 ml , hydrogen peroxide 3% ( 500 ml ) , surgical spirit500 ml , sevoflurane inhalation , salbutamol respules 5ml ( asthalin ) , sanitizer 500 ml , savlon solution500 ml , povidonelotion10 % 500 ml , povidonelotion5 %500 ml , povidonelotion7.5% 500 ml , peglec sachet , nebul.levosalbutamol+ipratopium bromide , liquid paraffin500 ml, bottle ) , solution , lignocaine 2% + adrenaline 5 mcg / ml ( 30 ml ) , vial , lignocaine 2% jelly , iv d10% 500 ml , iv d25% 100 ml , iv ns3 % 100 ml , iv ns 0.45% 500 ml , iv. fluiddns 500ml , iv. fluidringer lactate500ml , iv fluid normal saline 500 ml , iv infusion volulyte 6 % ( hestarch ) 500 ml , iv. normal saline 0.9 % 100 ml , iv isolyte m 500 ml , iv isolyte p 500 ml , iv intralipid 20 % 100 ml , iv. intraocular irrigating solution sodium chloride 0.49 % w / v, potassium chloride 0.075 % w / v, calcium chloride 0.048 %, magnesium chloride 0.03 % w / v, sodium acetate 0.39 % w / v, sodium citrate 0.17 % w / v. 500 ml ffs , isoflurane refiller 250 ml , insulin syring 40 iu 1 ml , hydrogen peroxide soln 100 ml , iv. hexa starch / voluvin 500 ml , hand sanitizer 1 ltr. , glutraldehyde 2.45 % , iv glycerine ip ( 100ml bottle ) , iv. glycerine / acriflaxin 100 ml , formetrol6 mcg + budesonide400 mcgmdi / dpi , formetrol6 mcg + budesonide 200 mcgmdi / dpi , formalin soln37 to 41 % ( 5 litr ) , enterogermina , disposable syringe 10 ml , disposable syringe 20 ml , disposable syringe 5 ml , disposablesyringe2 ml , disposable syringe50 ml , disposable needles26g , disposable needles24g , disposable needles22g , disposable needles20g , disposable needles18g , disposable needles16g , double arm nylon monofilament with 8 0 ( 3 / 8circle taper point needle ) , , disposable surgicalgloves6 no , disposable surgicalgloves6.5 no , disposable surgicalgloves 7no , disposable surgicalgloves 7.5no , disposable surgicalgloves 8no , latex examination gloves large , latex examination gloves medium , dynaplast 2 inch adhesive bandage , dynaplast 3 inchadhesive bandage , dynaplast bandage 10 cm * 4 m , disposable surgical mask , dustbin big 60 litr ( red / blue / black ) , dustbin small 30 litr ( red / blue / black ) , cotton cloth guaze than , cotton crape bandage 10cm x 4m , cotton crape bandage 15cm x 4m , cotton khadi curtain, 1.75 mt, , cotton khadi matress, 3x6 feet, 10.0kg, , cotton roll 500 gm , chadar check rangeen 84 inch x 48 inch , chadar rangeen 60 inch x 90 inch , blanket jammu woolen plane, 54x90 inch, , endotracheal cuff pressure manometer , endotracheal tube introducer ( stylet ) adult , endotrachial tube ( protex ) size 6, ( cuffed ) , endotrachial tube ( protex ) size 6, ( uncuffed ) , endotrachial tube ( protex ) adult size , 7 ( cuffed ) , endotrachial tube ( protex ) adult size , 6.5 ( cuffed ) , endotrachial tube ( protex ) adult size 7.5 ( cuffed ) , endotrachial tube ( protex ) adult size 8, ( cuffed ) , endotrachial tube ( protex ) adult size 8.5 ( cuffed ) , endotrachial tube ( protex ) padeatric size 5.5 ( cuffed ) , endotrachial tube ( protex ) padeatric size , 3 ( uncuffed ) , endotrachial tube ( protex ) padeatric size 2.5, ( uncuffed ) , endotrachial tube ( protex ) padeatric size 5 ( uncuffed ) , endotrachial tube ( protex ) padeatricsize 3.5 ( uncuffed ) , endotrachial tube ( protex ) padeatricsize 4, ( uncuffed ) , endotrachial tube ( protex ) padeatricsize 4.5 ( uncuffed ) , endotrachial tube ( protex ) padeatricsize 5, ( cuffed ) , epidural needle with catheter ( mini pack ) size 18 g , et tube ( cuffed ) 7no , et tube ( cuffed ) 6.5 no , et tube ( cuffed ) 7.5 no , et tube ( cuffed ) 8no , et tube ( cuffed ) 8.5 no , et tube 6 no. uncuffed , et tube 7 no. uncuffed , ethibond ( polyster suture ) 1 0 round body 1 / 2 circle 75 cm , ethibond ( polyster suture ) 2 0 round body 1 / 2 circle 75 cm , ethibond ( polyster suture ) 3 0 round body 1 / 2 circle 75 cm , ethibond ( polyster suture ) 5 0 round body 1 / 2 circle 75 cm , nylon clear monofilament 1 024 mm reverse cutting 75 cm , nylon clear monofilament 2 0 24 mm reverse cutting 75 cm , nylon clear monofilament 3 0 24 mm reverse cutting 75 cm , nylon suture, macrofilment spatulated, micropoint double armed size 10 0 ( 12 foils / pkt ) , poly propylene monofilament 0, 30mm 1 / 2 circle75 cm , poly propylene monofilament 1, 30mm 1 / 2 circle75 cm , polyamide size 8 / 0, 12 foils / pkt ( 3 / 8 cir micro point spatulated 6 mm, length 38 cm ) , polyglactin 0, 31mm 1 / 2 circle 70 cmreverse cutting , polyglactin 1 0, 31mm 1 / 2 circle 70 cm round bodied , polyglactin 2 0, 31mm1 / 2 circle 90 cm round bodied , polyglactin 2 0, 31mm 1 / 2 circle 70 cm reverse cutting , polyglactin 3 0, 31mm 1 / 2 circle 70 cm round bodied , polyglactin 4 0, 31mm 1 / 2 circle 70 cm round bodied , polyglecaprone with curved 5 / 0 reverse cutting needle ( 16 mm ) , catgut 1 0 round bodied 1 / 2 circle 76 cm , catgut 2 0 round bodied 1 / 2 circle 76 cm , polypropylene monofilament sterile precut cd reverse ( cutting needle 6 0 ) , b.b silk with 1 / 2 cir rb needle size:4 / 0 20 mm length 75 cm, 12 foils per packet , b.b. silk 6 reels x 25 mts length 25 braided silk without needle in reels non absorbable surgical suture , synthetic absorbable suture 4 / 0 with 1 / 2 cir rb needle size:4 / 0 20mm length 70cm poly glycolic acid ( pga ) ( 12 foils / pkt ) , silk suture 1 01 / 2 round circle black braided 24 mm 76 cm , silk suture 2 01 / 2 round circle black braided 24 mm 76 cm , silk suture 3 01 / 2 round circle black braided 24 mm 76 cm , absorbable ( 6 0 ) braided coated polyglactin aw violet 8mm 1 / 2 circle spatulated micro point doublw arm ( 45 , silk suture 4 01 / 2 round circle black braided 24 mm 76 cm , roll bandage 05 cm x 05 m , roll bandage 10 cm x 05 m , roll bandage 15 cm x 05 m , roll bandage 7.5 cm x 05 m , ryles tube10 no. , ryles tube 12 no. , ryles tube size 14 , ryles tube size 16 , ryles tube size 18 , schantz pin 4 mm , schantz pin 4.5 mm , schantz pin 5mm , romo vac set 14 , romo vac set 16 , rubber sheet ( small ) , rubber sheet ( large ) , silicon mask adult size 0 with connection tube, reservoir bag and valve, high concentration ( bains circuit ) , silicon mask adult size 01 with connection tube, reservoir bag and valve, high concentration ( bains circuit ) , silicon mask adult size 02 with connection tube, reservoir bag and valve, high concentration, ( bains circuit ) , silicon mask adult size 03with connection tube, reservoir bag and valve, high concentration, ( bains circuit ) , silicon mask adult size 04with connection tube, reservoir bag and valve, high concentration, ( bains circuit ) , silicon mask adult size 05 with connection tube, reservoir bag and valve, high concentration, ( bains circuit ) , silicon mask paediatric size 00 with connection tube, reservoir bag and valve, high concentration, ( bains circuit ) , silicon mask size 0 paediatric with connection tube, reservoir bag and valvepaediatric ( jackson rees circuit ) , silicon mask size 1 paediatric with connection tube, reservoir bag and valve, paediatric ( jackson rees circuit ) , , oxygen mask adult , non rebreathing mask , sics blade cresent ( 15 degree ) , simcoe i / a cannula, direct , skeletal traction kit , skin grafting blade ( downys blade ) , skin traction kit , spinal needle size 25 g , spinal needle size 26 g , spinal needle size 27 g , ss wire20g , ss wire 18 g , ss wire 22g , st pin 4 mm , st pin5 mm , st pin 4.5 mm , suction catheter 10 no , suction catheter 12 no , suction catheter 14 no , suction catheter 16 no , suction catheter 18 , suction tube10no , suction tube12no , suction tube14no , suction tube 8no , surgical steel drum 11*9inch , surgical steel drum 12*10inch , surgical steel drum 15*12 inch , surgical steel drum 6*6inch , surgical steel drum 6*9inch , surgical steel drum 9*9inch , surgical bladesize 15 , surgical blade , size 22 , surgical bladesize 23 , surgical blade , size 24 , surgical blade, size 11 , surgical cap disposable , ultrasoundjelly 250 gm , ecg jelly 250 gm , echo cardiography250 gm , view box size 14x17 , view box size 8x17 , weighingmachine mechenical , white ( sharp container ) 10 litr , whole sheet 35 inch x 35 inch , wound suction catheter ( no 18 ) , each , laryngoscope ( adult ) with bladesize , 3, , laryngoscope ( adult ) with bladesize , 4 , laryngoscope ( adult ) with bladesize 2, , laryngoscope ( paedeatric ) a machintoshb miller blade size , 1, , laryngoscope ( paedeatric ) a machintoshb miller blade size , 0, , laryngoscope ( paedeatric ) a machintoshb miller blade size , 2 , laryngoscope ( paedeatric ) a machintoshb miller blade size 00, , laryngoscope ( paedeatric ) a machintosh blade size 0, , laryngoscope ( paedeatric ) a machintosh blade size , 1, , lma ( i gel ) size 1.5 , lma ( i gel ) size 2.5 , lma ( i gel ) size 3 , lma ( i gel ) size 4 , lma ( i gel ) size 5 , lma ( i gel ) size 1 , lma ( i gel ) size 2 , lma ( proseal ) size , 1.5, , lma ( proseal ) size , 2, , lma ( proseal ) size , 2.5 , lma ( proseal ) size , 3, , lma ( proseal ) size 1, , lma ( proseal ) size , 4, , lma ( proseal ) size , 5 , maccoy laryngoscope with bladesize 3, , maccoy laryngoscope with bladesize , 4 , ( c mac ) video laryngoscope with complete blade set , maccoy laryngoscope with bladesize 5 , magill forcep ( adult ) , magill forcep ( padeatric ) , iv cannula ( two way ) size 24 , iv cannula 16 no. , iv cannula 18 no. , iv cannula 20 no. , iv cannula 22 no. , k wire1.6mm , k wire2mm , k wire2.5 mm , k wire 1 mm , k wire 3mm , kit 1 , kit 2 , kit 6 , intubating lma ( i lma ) fastrac 6 , intubating lma ( i lma ) fastrac 7 , intubating lma ( i lma ) fastrac 7.5 , intubating lma ( i lma ) fastrac 8 , intubating lma ( i lma ) fastrac 6.5 , intubating bougie , hernia mesh 15x15 , hernia mesh 3x6 , head ring ( adult ) , head ring ( peadia ) , guedalsairway size , 0, , guedalsairway size , 2, , guedalsairway size , 5 , guedalsairway size 00, , guedalsairway size 000, , guedalsairway size 1, , guedals airway size , 4, , guedals airway size 3, , glucometer , glucometer strips , hmef, filter, heat and moisture exchanger with viral filter ( hmef ) , formalin chamberthree tray ( 24*8*8 ) inch , formalin chamber three tray ( 20*8*8 ) inch. , formalin chamber two tray ( 16*8*8 ) inch. , foley catheter 20 no. 3 way , foley catheter 22 no. 3 way , foley’s catheter 16 no. , foley’s catheter12 no. , foley’s catheter14 no. , foleys catheter size10 , foleys catheter size18 , foldable iol sterile lens + 19.5d , foldable iol sterile lens + 19d , foldable iol sterile lens + 20.5d , foldable iol sterile lens + 20d , flexometallictube ( armored tube ) , 6.5 , flexometallictube ( armored tube ) , 7 , flexometallictube ( armored tube ) , 7.5 , flexometallictube ( armored tube ) , 8 , flexometallictube ( armored tube ) 6, , flexometallictube ( armored tube ) 8.5 , electric surgical instrument boiler ( 20*8*7.5 ) inch , electric surgical instrument boiler ( 24*8*8 ) inch , ecg paper a4 size , echo cardiography rollpaper , 3 way cannula ( triway ) , 3 way extension 100 cm , 3 way extension 25 cm , abdominaldrain adk drain no. 28 , abdominaldrain adk drain no. 30 , ansathesia face mask silicone transparentsize , 4 , ansathesia face mask silicone transparentsize , 5 , ansathesia face mask silicone transparentsize 0 , ansathesia face mask silicone transparentsize 00 , ansathesia face mask silicone transparentsize 1 , ansathesia face mask silicone transparentsize 2 , ansathesia face mask silicone transparentsize 3 , ansthesia work station disposable circuit ( adult ) , ansthesia work station disposable circuit ( paedeatric ) , centralvenous catheterkit ( adult ) , centralvenous catheterkit ( paedeatric ) , ambu bag ( padeatric ) 150 ml , ambu bag ( padeatric ) 250 ml , stethograph , analytical digital balance , perimeter ( priestley smith ) s / lp.984 b & t , long knee brace , knee cap , finger splint , wrist hand stabillizer , cock up splint , thumb spica splint , arm pouch , universal shoulder immobillzer , clavicular brace , neck collar soft , nack collar hard , l s belt , forearm brace , anklet , crepe bandage 4 inch , crepe bandage 6inch , dynaplast , stockinette / soft roll , walker , sodium borate 1 kg , sodium citrate 1 kg , pipracelline+tezobactum inj ( 4.5 gm ) , inj. tranexamic acid 500 mg , inj. lebetalol 5 ml , inj. magnesium sulfate , kelleys pad , povidone solution 5% 500 ml , inj methergine 0.2 mg , inj mgso4 50% , catgut 1 no suture , vicryl 1 no ( round bodied needle ) suture , inj epidosin , inj drotaverine , urine for albumin strip , cerviprime gel 0.5 mg , inj anti d ( 300 microgram ) , edta vial , b.p. instumanet with all size cuf , anterior vaginal wall retractor , ovum forceps ( medium size 05 ) ( small size 05 ) , blakes uterine curette , karmans cannula set ( 05 no ) , karmans cannula set ( 06 no ) , karmans cannula set ( 08 no ) , karmans cannula set ( 12 no ) , hegars cervical dilator set , mva syringe along with cannula , uterine sound , vullselum , tab. tranexa , tab. misopristol , cotton guaze pad , nylon suture 3 0 , nylon suture 4 0 , suction catheter 06 no , suction catheter 07 no , suction catheter 08 no , iv metronidazole 100 ml , iv ringer lactate 500 ml , iv normal saline 100 ml , mackintosh sheet , laryngo scope neonate blade size 0 / 1 , cidex solution 5 ltr , surgical drum 12×15 , surgical drum 11×13 , surgical drum 9×11 , surgical tray medium , surgical tray large , povidone onitment 250 gm , digital fuji x ray film 8*10 ( 1×150 ) , posterior chamber intra ocular lens ( pciol ) ( pmma, single piece, size 6mm optics total 13mm ) 10 d , pciol / / 12 d , pciol / / 14 d , pciol / / 16 d , pciol / / 17 d , pciol / / 17.5 d , pciol / / 18 d , pciol / / 18.5 d , pciol / / 19 d , pciol / / 19.5 d , pciol / / 20 d , pciol / / 20.5 d , pciol / / 21 d , pciol / / 21.5 d , pciol / / 22 d , pciol / / 22.5 d , pciol / / 23 d , pciol / / 23.5 d , pciol / / 24 d , pciol / / 25 d , pciol / / 26 d , pciol / / 27 d , pciol / / 28 d , pciol / / 29 d , pciol / / 30 d , anterior chamber intra ocular lens ( aciol ) , kelman multiflex model ( pmma, single piece, size 6mm optics total 13mm ) 16 d , aciol / / 17 d , aciol / / 18 d , aciol / / 19 d , aciol / / 20 d , viscoelastic substance ( pre filled syringe ) , trypan blue dye , hylase injection , lignocaine 4% drops , pilocarpine injection , epitrate injection , virgin silk suture6 0 , monofillanent nylon suture ( double ended ) , surgical blade 15 number , vicryl suture 6 0 , keratome blade , crescent blade , side port , tab. diamox , spirit lamp , r.o. machine for washing and scrubings , formiline chamber , white and green cloth , uv sterilizer , color vision chart – original ishihara , near vision chart with different languages , torch with yellow light , maddoxrod , maddox wing , diplopia goggles , bipolar wetfield cautry , placido disc , prism bar , cryo unit , non contact tonometer , multi media projector with screen , hess screen chart , usg –a scan , corneal loupe , indirect ophthalmoscope with +20 and +30 volk lenses , direct ophthalmoscope , snellen’s chart / snellen drum with or without remote control , trial set with trial frame ( adult and children ) , streak retinoscope , keratometer , synaptophore , chalazion set , autoclave , drum ( large, medium, small ) , kidney tray ( large , medium , small ) , bowl , infrared thermometer , chittle forceps , boiler ( small and large ) , stainless steel traywith cover ( small and large ) , schiotz tonometer , intraocular lens 15 no to 27 no , intraocular lens 27 no , methylene blue dye , balancde salt solution , dextrose 5 % , dextrose 10 % , inj. epitate , inj.derriphyline , inj.botroclot , xylocaine jelly , inj.mitomycin c , thread ( 100 no ) , ethilon suture ( 4 0 ) , ethilon suture ( 6 0 ) , i / v set , needle ( 26.5 ) , syringes ( 5 ml ) , syringes ( 10 ml ) , syringes ( 20 ml ) , syringes ( 5 ml ) , n 95 mask , disposable eye drape , eye towel , intracatheter , inj mannitol , inj avil , chlorine solution 500 ml , betadene solution , ppe kit , betadene scrub , hydrogen peroxide solution , inj. betamethasone 4 mg , inj oxytocin 10 iu , drotaverine 40 mg / 2ml , inj. vit k , inj. dizepam , inj iron sucrose , tab. misoprostol 200 mg ( 4 tab. pack ) , baby tag , tab. tranexamic acid 500 mg , umblical cord clamp large size , rubber catheter plain , yankurs suction tube , weight machine neonatal , weight machine adult , dressing steel tray 12×15 , dressing steel tray medium , dressing steel tray small , dressing drum 12×15 , dressing drum 13×11 , electric sterlizer 20×8×6 , dettol shop 20 gm , polyglycolic acid absorbable surgical suture ( 12 foils / pkt ) ( 1 / 2 cir rb needle 40 mm length 90 cm size 1 ) vicryl , prolene 1 rb 1 / 2 circle 30 mm l 70 cm ( 12 foils / pkt ) needle , ethicon 2 0 black clear monofilament rc 45 mm 75 cm needle ( 12 foils / pkt ) , ethicon 3 0 black clear monofilament rc 45 mm 75 cm needle ( 12 foils / pkt ) , b.b silk ( 12 foils / pkt ) ( 1 / 2 rcut needle 45 mm length 76 cm size 2 / 0 ) , stylet ( adult ) , stylet ( paedia ) , enema port , phosphate enema , methanol ( 50 ltr. per container packing ) , glycerin ( 50 ltr. per container packing ) , phenol , thymol crystals , 1 % eosin , winter green perfume ( oil of winter green ) , gasket , microbiological filter , printer paper , heater , hepa filter , printer ink ribbon , bowie & dick test strip , biological indicator , documentation label ( 1 roll of 750 ) , packaging indicator , cleaning indicator , ink roll labelling gun , chemical indicator ltsf , biological indicator ltsf , sterilization reel 50×200 mtrs ltsf , sterilization reel 75×200 mtrs ltsf , sterilization reel 100×200 mtrs ltsf , sterilization reel 200×200 mtrs ltsf , sterilization reel 250×200 mtrs ltsf , sterilization reel 300×200 mtrs ltsf , cartridge filter , antiscalant chemical ( cane of 40 ltr ) , calcitonin nasal spray 30 mcg , tab. lefulonamide 10 / 20 mg , tab. pyroxicame 10 / 20 mg , tab.toclizumab 5 mg , k wire 1 mm , k wire 1 .5 mm , k wire 1 .5 mm , k wire 2 mm , k wire 2.5 mm , k wire 3 mm , st pin 4 mm , st pin 4.5 mm , st pin 5 mm , ss wire 18 g , ss wire 20 g , ss wire22 g , stirrup , vicryl 2.0 rc , vicryl 3.0 rc , vicryl os 8 , vicryl os 6 , ethibond 2 no , ethibond 5 no , ethilone 1.0 , ethilone 2.0 , ethilone 3.0 , nylon 1.0 , nylon 2.0 , nasal prong , infant feeding tube 5 , infant feeding tube 6 , infant feeding tube 7 , infant feeding tube 8 , infant feeding tube 9 , diaper , identification band , disposable sheets , umblical catheter , centralline 3 fr , centralline 4 fr , centralline 5 fr , peadia set , alcohol based hand rub , formalin ( 50 ml bottel ) , phenyl ( 500ml ) , liquid handwash ( 500ml ) , disposable mark , disposable cap , sleeper , oxygen connecting tube , steel spoon , steel bowl , inj. normal saline ( 500 ml ) , inj. normal saline ( 200 ml ) , inj. isolyte p ( 500 ml ) , inj. ringer lactate ( 500 ml ) , inj. adreraline , inj. sodium valproate , inj. levepril ( levetirautam ) , inj. cefotaxim ( 250 mg ) , inj. cefepine , inj. pantop , inj. aciloc , ivig , inj. methyprednisolone , inj. mepropencm ( 235 mg ) , inj. sodabicarb ( 10ml ) , inj. capnea , inj. metronidazol ( 100 ml ) , inj. fluconzole , inj.botropose , inj. ampicilin , inj. teicoplanin , inj. 3% normal saline , inj. aminoveir , levosalbutamol respule , budecort respule , inj. amphotericin , syp paracitamol ( 5ml=125 mg ) , syp. ibuprofen , syp. dextromethorphen , syp. bromohexine , syp. calcium , drop multivitamin , syp. phenobarbitone , syp. cefixim ( 5ml=50 mg ) , drop domperidone , drop paracetamol , saline nasal drops , tobramnycin eye drop , hmf sachet ( lactodex ) , tab paracetamol , tab. amoxyclav , syp. amoxycalv , syp cetrizine , syrup zinc ( 20 mg ) , syrup phenytoin , syrup multivitamin , formalin ( 5 ltr packing ) , formalin ( 1 ltr packing ) , formalin ( 50 ltr per container packing ) , color vision chart —original ishihara , near vision chart with different languages , torchwith yellow light , maddox wing , diplopia goggles , placido disc , corneal loupe , snellens chart / snellen drum with or without remote control , trial set with trial frame ( adult and children ) , chalazion set , stainless steel tray with cover ( small and large ) , schiotztonometer , cotton absorbent ( 1 / 2 kg ) , blood group antisera ( abd ) , potassium nitrate , potassium acetate , sodium acetate , inj. acyclovir , inj. surfactant ( serventa ) ...

Netaji Subhash Chandra Bose Medical College - Madhya Pradesh

29527347 supply of reagent, chemical glass ware, stationary and general items 2 manual kits 3 acid phosphates kit ( 100test ) 4 albuminkit ( 100 gms ) 5 alkaline phosphates kit ( 500 gms ) 6 amylase ( 500 ml ) 7 aptt ( 500 ml ) 8 aso titre test ( 96 tes ) 9 billirubin direct ( 100 tset ) 10 billirubin total ( 100 test ) 11 mercuric sulphate ( 500 gms ) 12 sodium nitroprusside ( 500 gms ) 13 chicken gunia rapid kit igm ( 100 test ) 14 cholesterol kit ( 100 test ) 15 ck mb ( 100 test ) 16 cpk mb ( 100 test ) 17 c reactive protein ( 100 test ) 18 sodium n+ ( 100 test ) 19 crp kit ( 100 test ) 20 csf protein ( 100 test ) 21 dengue rapid kit for igg & igm ( 100 test ) 22 robertson cooked media ( 500 gms ) 23 drinking water testing ( 12 parameters ) 24 potasium k+ ( 100 test ) 25 g6pd kit ( 100 test ) 26 glucose kit god method ( 100 test ) 27 glycosylate hb% ( 100 test ) 28 hbsag card test ( each ) 29 mountax test 5 tu / ppd ( 100 test ) 30 pragnancy test hcg card test ( 100 test ) 31 pregnancy test, latex agglutination inhibition test ( 100 test ) 32 prothombin time kit ( 100 test ) 33 ra factor test ( 100 test ) 34 rapid test kit for anti hcv ab ( 100 test ) 35 s.acid phosphtac ( 100 test ) 36 s.alkaline phosphate ( 100 test ) 37 s.analyese ( 100 test ) 38 s.cholestrol kit ( 100 test ) 39 s.glucose kit ( 100 test ) 40 s.h.d.l. ( 100 test ) 41 s.triglyceride ( 100 test ) 42 s.uric kit ( 100 test ) 43 serum bilirubin kit ( 100 test ) 44 serum calcium kit ( 100 test ) 45 serum creatinine kit ( 100 test ) 46 serum protein kit ( 100 test ) 47 serum uric acid kit ( 100 test ) 48 sgot ( 100 test ) 49 sgpt ( 100 test ) 50 t3 elisa test kit ( 100 test ) 51 t4 elisa test kit ( 100 test ) 52 total protein ( 100 test ) 53 triglyceride kit ( 100 test ) 54 tsh elisa test kit ( 100 test ) 55 urea enzymatic ( 100 test ) 56 sabourauds dextrose agar with chloramphenicol medium ( 500gms ) 57 sabourauds dextrose agar with brain heart infusion agar ( 500gms ) 58 lactophenol cotton blue ( 10gms ) 59 glycerol ( laboratory grade ) ( 500 ml ) 60 mccartney bottle ( 500 gms ) 61 edta disodium salt ( 500 gms ) 62 barium chloride powder ( 500 gms ) 63 urea kit ( 100 test ) 64 vdrl card test tpha ( 100 test ) 65 vdrl latex test / rpr ( 100 test ) 66 widal kit ( 100 test ) 67 widal test ( 100 test ) 68 isoamyl alchohol ( 500 ml ) 69 hcl ( 500 ml ) 70 phenol red powder ( 500 gms ) 71 bakout ( 20 ltr ) 72 finit ( 10 ltr ) 73 k.telurite blood agar ( himedia ) ( 100 gms ) 74 hi.viral tranport medium ( himedia ) ( 100 tubes ) 75 cetrimide agar ( himedia ) ( 100 gms ) 76 caryblair transport medium ( himedia ) ( 100 gms ) 77 wilson blair agar ( himedia ) ( 100gms ) 78 agar powder ( himedia ) ( 500 gms ) 79 sabouraud dextrose agar ( himedia ) ( 500gms ) 80 urea agar base ( himedia ) ( 500 gms ) 81 tsi agar ( himedia ) ( 500 gms ) 82 muller hinton medium powder ( himedia ) ( 100gms ) 83 ma conkey agar powder veg ( himedia ) ( 500 gms ) 84 nutrient agar powder veg. ( himedia ) ( 500 gms ) 85 t.c.b.s.agar powder veg ( himedia ) ( 500 gms ) 86 geletin agar ( himedia ) ( 500 gms ) 87 deoxycholate citrate agar ( himedia ) ( 500 gms ) 88 simmons citrate agar ( himedia ) ( 500 gms ) 89 bordet gengoue media ( himedia ) ( 500 gms ) 90 xld agar ( himedia ) ( 500 gms ) 91 hektoen enteric agar ( himedia ) ( 500 gms ) 92 lj media slants ( himedia ) ( 500 gms ) 93 lj media with first line antitubercrular drugs ( himedia ) ( 500 gms ) 94 cled medium ( himedia ) ( 500 gms ) 95 triptycase tellurite agar ( himedia ) ( 500 gms ) 96 brin heart infusion broth ( himedia ) ( 500 gms ) 97 brain heart infusion agar ( himedia ) ( 500 gms ) 98 columbia blood agar base ( himedia ) ( 500 gms ) 99 thioglycolate broth ( himedia ) ( 500 gms ) 100 lofflers medium base ( himedia ) ( 100 gms ) 101 moellers decarboxylase broth with arginine ( himedia ) ( 100 gms ) 102 moellers decarboxylase broth with lysine ( himedia ) ( 100 gms ) 103 moellers decarboxylase broth with ornithine ( himedia ) ( 100 gms ) 104 corn meal agar ( himedia ) ( 100 gms ) 105 tretrazolium reduction media ( himedia ) ( 100 gms ) 106 hichrome candida differential media ( himedia ) ( 100 gms ) 107 bile esculin agar ( himedia ) ( 100 gms ) 108 pvr broth ( himedia ) ( 100 gms ) 109 pvr reagent ( himedia ) ( 100 gms ) 110 kits, chemicals, strains & antibiotic sensitivity discs 111 iso propyl alchohol ( 1 liters ) ( merck / qualigen / fisher ) 112 benzene ( 1 liters ) ( merck / qualigen / fisher ) 113 formaline ( 1 liters ) ( merck / qualigen / fisher ) 114 hematoxyline powder ( fisher / loba ) ( 500 ml ) 115 dpx ( 500ml ) ( merck / qualigen / fisher ) 116 microtome blade ( leica / chile ) ( 500 ml ) 117 alluminium potassium sulphate ( 1kg ) ( merck / qualigen / fisher ) 118 mercuric oxide ( 100 gm ) ( merck / qualigen / fisher ) 119 carbolic soap ( 500 ml ) 120 ammonium potassium sulphate ( 500 gm ) 121 nitric acid ( 500 ml ) 122 hiv kit elisa ( 96 test ) 123 hiv kit rapid ( 96 test ) 124 hcv kit elisa ( 96 test ) 125 hcv kit rapid ( 96 test ) 126 hbsag kit elisa ( 96 test ) 127 hbsag kit rapid ( 96 test ) 128 rpr ( vdrl ) kit ( 500 test ) 129 rpr kit strip ( 100 test ) 130 rapid malaria antigen detection test card for pv& pf antigen ( pack ) ( 30 test ) 131 neomycin ( 500 discs ) 132 norfloxacin ( 500 discs ) 133 ofloxacin ( 500 discs ) 134 pencillin ( 500 discs ) 135 pipracillin + tazobactum ( 500 discs ) 136 tobramycin ( 500 discs ) 137 sterptomycin ( 500 discs ) 138 ticarcillin ( 500 discs ) 139 optochin ( 100 discs ) 140 bacitracin ( 500 discs ) 141 cefoperazone sulbactum ( 500 discs ) 142 clindamycin ( 500 discs ) 143 doxcyline ( 500 discs ) 144 erythromycin ( 500 discs ) 145 cefuroxime sodium 30mcg ( 500 discs ) 146 pipracillin ( 500 discs ) 147 netillin ( 500 discs ) 148 gentmycin ( 500 discs ) 149 levofloxacin ( 500 discs ) 150 cloxacillin ( 500 discs ) 151 imipenem10mcg ( 500 discs ) 152 ertapenem10mcg ( 500 discs ) 153 meropenem10mcg ( 500 discs ) 154 doripenem10mcg ( 500 discs ) 155 ceftazidime / clavulanic acid caz / ca 30 / 10mcg ( 500 discs ) 156 cefotaxime / clavulanic acid ctx / ca 30 / 10mcg ( 500 discs ) 157 aztreonam30mcg ( 500 discs ) 158 ceftazidime30mcg ( 500 discs ) 159 cefotaxime30mcg ( 500 discs ) 160 ceftriaxone 30mcg ( 500 discs ) 161 cefoxitin 30mcg ( 500 discs ) 162 cefepime30mcg ( 500 discs ) 163 sparfloxacin 5mcg ( 500 discs ) 164 novobiocin30mcg ( 200 discs ) 165 amoxycillin clavulanic acid 20 / 10mcg ( 500 discs ) 166 cephotoxime ( 500 discs ) 167 clarithromycin 15mcg ( 500 discs ) 168 co trimoxazole1.25 / 23.75mcg ( 500 discs ) 169 piperacillin100mcg ( 500 discs ) 170 vancomycin30mcg ( 500 discs ) 171 netilmicin30mcg ( 500 discs ) 172 kanamycin 30mcg ( 500 discs ) 173 ampicillin 10mcg ( 500 discs ) 174 azithromycin 15mcg ( 500 discs ) 175 carbenicillin100mcg ( 500 discs ) 176 ceacals30mcg ( 500 discs ) 177 cefoperazone 75mcg ( 500 discs ) 178 ceftizoxime30mcg ( 500 discs ) 179 nalidixic acid 30mcg ( 500 discs ) 180 ceftazidime avibactam 30 / 20mcg ( 500 discs ) 181 ceftolozane tazobactam 30 / 10mcg ( 500 discs ) 182 ceftaroline 30mcg ( 500 discs ) 183 amikacin30mcg ( 500 discs ) 184 fosfomycin 200mcg ( 500 discs ) 185 nitrofurantoin 30mcg ( 500 discs ) 186 sulfisoxazole 250mcg / 300mcg ( 500 discs ) 187 linezolid 30mcg ( 500 discs ) 188 caspofungin 5mcg ( 500 discs ) 189 fluconazole 25mcg ( 500 discs ) 190 voriconazole 1 mcg ( 500 discs ) 191 ltraconzaole 10mcg ( 500 discs ) 192 amphotericin b 100mcg ( 500 discs ) 193 ketoconazole 50mcg ( 500 discs ) 194 nystatin i00iu ( 500 discs ) 195 anti abd monoclonal ( igm ) 10ml 196 staphylococcus aureusatcc 25923 ( himedia ) 197 escherichia coli atcc 25922 ( himedai ) 198 psuedomonas aeruginosa atcc 27853 ( himeda ) 199 enterococcus faecalisatcc 29212 ( susceptlble ) , atcc51299 ( reslstant ) 200 salmonela shigella agar ( 500 gms ) 201 bear extract powder ( 500 gms ) 202 petri dish ( 100 mm glass ) 203 petridish big size ( glass ) ( 150 mm* 20 mm ) 204 petridish medium size ( glass ) ( 100 mm* 17 mm ) 205 toluidine blue ( 100 gm ) 206 ethyl alcogol ( 500 ml ) 207 glycerol ( reagent grade ) ( 500 ml ) 208 magnesium citrate ( 500 gm ) 209 asparagine ( 100 gm ) 210 boric acid ( 500 ml ) 211 amyl alcohol ( 500 ml ) 212 mono potassium phosphate ( 500 gm ) 213 disodium phosphate ( 500 gm ) 214 xylose ( 100 gm ) 215 iodine ( 100 gm ) 216 potassium tellurite ( 100 gm ) 217 potassium chloride ( 500 gm ) 218 india ink ( 100 ml ) 219 l.j. ( lowenstein jensen ) media ( ready to use ) ( 50 bottles ) 220 lacto phenol cotton blue stain ( ready to use ) ( 100 ml ) 221 dermatophyte test media ( 500 gm ) 222 bird seed agar / niger seed agar ( 500 gm ) 223 potato dextrose agar ( 500 gm ) 224 hichrome agar for candida ( 500 gm ) 225 cornmeal agar ( 500 gm ) 226 tetrazolium reduction medium ( 500 gm ) 227 vdrl glass slide ( 10 pieces ) 228 teasing / dissecting needles10 pieces 229 anti d blend, monoclonal ( igm + igg ) anti sera 230 anti a1 lectin 231 anti ab monoclanal 232 anti h 233 activated papain enzyme stablized solution 234 anti c 235 anti e 236 anti e 237 coombs anti sera 238 id gel cross match card ( ahg ) ( cooms ) test card 239 gel diluent liss 240 blood bag double 350ml ( hll / jmitra ) ( each ) 241 blood bag double 450 ml ( hll / jmitra ) ( each ) 242 blood bag triple 350ml ( hll / jmitra ) ( each ) 243 single donor platelet / plasma kit, with acd a bag 500ml ( for apheresis ) 244 usg jelly ( 500 ml ) 245 mannitol ( 100 gms ) 246 absolute alcohol ( 500 ml ) 247 acetone ( 500 ml ) 248 albumin flakes ( 500 gms ) 249 alpha naphthol ( 100 gms ) 250 alpha naphthylamine ( 25gms ) 251 ammonium di hydrogen phosphate ( 500 gms ) 252 ammonium molybdat ( 500 gms ) 253 ammonium oxalate ( 100gms ) 254 ammonium sulphate ( 500 gms ) 255 barium chroride 256 basic fuschin ( 100 gms ) 257 benzidine powder ( 500 gms ) 258 betadin solution ( 500 gms ) 259 bile salt agar ( 500 gms ) 260 bismuth ammonium citrate ( 100 gms ) 261 bleaching powder ( 1 kg ) 262 blood group anti sera abd set monoclonal ( igm & igg ) ( 10 ml ) ( tulip ) 263 blood group anti sera a set monoclonal ( igm ) ( 10 ml ) ( tulip ) 264 blood group anti sera b set monoclonal ( igm ) ( 10 ml ) ( tulip ) 265 blood group anti sera d set monoclonal ( igm ) ( 10 ml ) ( tulip ) 266 bole billiverdin ( 500 ml ) 267 bromine liquid ( 25 ml ) 268 bromothymol blue ( 5 gms ) 269 calcium pure ( 500 gms ) 270 casein ( 500 gms ) 271 conc. h2so4 ( 500 ml ) 272 conc. hno3 ( 500 ml ) 273 concentrated hcl ( 500 ml ) 274 copper acetate ( 500 gms ) 275 cotton roll ( each roll ) 276 creatinine powder ( 500 gms ) 277 crystal voilet ( 500gms ) 278 cuso4 crystal ( 500 gms ) 279 d.p.x. mount 280 dextrose ( 500 gms ) 281 di methyl amino benzaldehyde ( 100 gms ) 282 di pot. hydrogen phosphate ( 100 gms ) 283 di sodium ortho phosphate ( 500 gms ) 284 dibasic sod. phosphate ( 100 gms ) 285 disodium hydrogen phosphate ( 100 gms ) 286 distill water 5 ltr 287 e.d.t.a. powder 288 ecg jelly 250 gm 289 eosin ( cdh / merck ) ( 100 gms ) 290 eosin stain ( for histology staining ) 291 ferric chloride ( fecl3 ) 292 field stain a&b 293 l moulds ( each ) 294 fontana stain ( 100 gms ) 295 formaldehyde ( formalin ) 37% 296 eosin spirit soluble ( himedia / qualigens / loba ) ( 1 gms ) 297 tissue capsule with cover ( 20*20*10 ) ( each ) 298 formaldehyde 40% 200 kg pack 299 formaldehyde 40% 500 ml pack 300 fructose ( 500 gms ) 301 gelatin ( 500 gms ) 302 giemsa powder ( 500 gms ) 303 giemsa stain ( 500 gms ) 304 glacial acetic acid ( 1000ml ) 305 glucose ( 500 gms ) 306 glycerine ( 500 gms ) 307 gms stain ( each kit ) 308 cefezolin ( 500 discs ) 309 hand lotion 250ml antiseptic washing 310 hand sanitizers 311 hydrogen peroxide ( 500gms ) 312 cefaparazone ( 500 discs ) 313 hydrogen peroxide soln 20% 314 india ink ( 5 ml ) 315 ciproflaxcin ( 500 discs ) 316 kovacs indole reagent ( 100 ml ) 317 l.asparagine ( 100 gms ) 318 lactic acid ( 1 ltr ) 319 lactophenol cotton blue 320 lactose ( 500 gms ) 321 lead acetate strips ( 500 gms ) 322 leishman stain solution 323 lens cleaner 2000ml 324 liquid paraffin heavy ( 500 gms ) 325 liquid praffin ( 500ml ) 326 liquid ammonia ( 500 ml ) 327 lysozyme ( 1 gms ) 328 malachite green ( 25gms ) 329 maltose ( 500 gms ) 330 naladixix acid ( 500 discs ) 331 methanol 332 methyl red ( ph indicator ) ( 25gms ) 333 methyl violet ( 100 gms ) 334 methylene blue ( 100 gms ) 335 na natroprusside 336 nalc powder ( 25 gms ) 337 neutral red indicator ( 25 gms ) 338 paraffin wax ( 500 gms ) 339 paraffin wax roll for test tube sealing 340 peptone ( 500 gms ) 341 ph strips ( ph 1 10 ) ( 25 packets ) 342 phenol crystal ( 500 gms ) 343 phenolphthalein ( 100 gms ) 344 phenyl hydrazine hydrochloride ( 100 gms ) 345 phosphate pure 346 picric acid ( 500 gms ) 347 pot. dichromate ( 500 gms ) 348 pot. hydroxide ( 500 gms ) 349 potasium alum 350 potassium iodide ( 100gms ) 351 rectified spirit 352 ressorcinol ( 500 gms ) 353 saffranine ( 100 gms ) 354 salphate pure 355 silver nitrate ( 500 gms ) 356 sodium acetate ( 500 gms ) 357 sodium carbonate ( 100 gms ) 358 sodium chloride ( 1 kg pack ) 359 sodium dihydrogen phosphate ( 100 gms ) 360 sodium hydroxide ( 5 ltr ) 361 sodium hydroxide ( flakes ) 362 sodium hydroxide pellets ( 500gms ) 363 sodium hypochloride ( 500 gms ) 364 sodium sulphate ( 500 gms ) 365 sodium taurocholate ( bile salt ) ( 500 gms ) 366 spirit ( 400 ltr ) 367 starch ( 500 gms ) 368 sterile container ( each ) 369 sucrose ( 500 gms ) 370 sulphur powder ( 500 gms ) 371 sulphuric acid ( 500 ml ) 372 tetra methylparaphenyl diaminodihydro chloride ( oxidase reagent ) ( 25gms ) 373 thallus acetate ( 1 gms ) 374 thymol crystals ( 1 gms ) 375 tincture benzoin co 376 tri sodium citrate ( 100 gms ) 377 trichloro acetic acid ( 1000 ml ) 378 urea ( 100 gms ) 379 urea powder 380 whatmas filter paper no. ( standard size ) 381 xyline ( 1liters ) ( merck / qualigen / fisher ) 382 yeast extract powder ( 100 gms ) 383 molecular water ( nucleous free / rnsa dnsa free ) ( 500 ml pack ) 384 kh2po4 ( 500 gms ) 385 beaf exract powder ( 500 gms ) 386 magnisium sulphate ( 500 gm ) 387 glass ware 388 amplifire for neurograph 389 anaerobic gas pack for 3.5 lit capacity, disposable oxygen absorbing, carbon dioxide generating agent used in anaerobic system no need to use catalysts or pressure gauge 390 anaerobic indicator tables for anaerobic system ( for anaerobic system ) 391 anaerobic system rubber rings ( for anaerobic system ) 392 arnold sterilizer 393 needle disposal 22 gauge 1 ( each ) 394 b.p. blade 24 no. 395 beaker ( 1000cc ) 396 beaker ( 100cc ) 397 beaker ( 500cc ) 398 beaker ( 50cc ) 399 beaker 100ml 400 beaker 200ml 401 blood bag tube stripper mannual 402 bone marrow aspiration needle ( 16, 18, 20 no. ) 403 bone marrow trephine biopsy needle 404 bottle with clear transparent glass 50ml 405 capillary tube 1 mm ( long ) 406 capillary tube 1mm or all size 407 centrifuge tube 15ml 408 centrifuge tube 2ml ( p.p ) 409 seftazidime avibactum ( 500 discs ) 410 charging droppers 411 collection vail 2ml 412 collection vail 5ml 413 colony counter digital for bacteriology, digital display to cout 9999 414 colorimeter cuvetts 415 conical flask flat bottom ( 1000cc ) 416 conical flask flat bottom ( 250cc ) 417 conical flask flat bottom ( 500cc ) 418 conical flask flat bottom ( 50cc ) 419 coplins jar50ml 420 coppling jars ( horizontal ) 421 demonstration stethoscope with multiple earpiece 422 distilled water plant ( all glass ) 423 dropping bottel 424 dropping bottles for stains ( plastic ) 425 durhams tube 426 e.s.r. tube 427 ecg roll 428 eeg electrodes for neurograph 429 esr tube ( wwstergren ) 430 flask bottom flask 2 ltr capaciy 431 flat bottom flask 5 liter capacity 432 flat bottom ph electrode for ph determination for use on soft moist surface like agar gel plate and both on solid and semisolid surface 433 funnel 434 glass pipetts each of each size 435 glass slide ( sunbeam / bluestar ) 436 glass slide ( size 76x26 mm ) thickness 1.35mm 437 glass slide ( size 76x22mm ) thickness :1.45mm ) 438 glass trough pneumatic 439 seftaroline ( 500 discs ) 440 haemocytometer ( each ) 441 haemoglobinometer ( sahils ) 442 hammer ( reflex ) ( each ) 443 hb tube ( each ) 444 ink well for neurograph 445 jar glass ( 2ltr ) 446 lovibond comparators 447 lp bone marrow needle 448 lp needle ( top spinal ) 22x89mm 449 mackartaneys bottle 450 maker pen for digital colony counter 451 measuring cylinder 1000ml 452 measuring cylinder 100ml 453 measuring cylinder 500ml 454 micro coverslips ( 18mmx18mm ) square 455 micro coverslips ( 19mmx19mm ) square 456 micro coverslips ( 22mmx22mm ) square 457 micro coverslips ( 22mmx25mm ) rectangular 458 micro coverslips ( 22mmx30mm ) rectangular 459 micro coverslips ( 22mmx40mm ) rectangular 460 micro coverslips ( 22mmx500mm ) rectangular ( special ) 461 micro coverslips ( 22mmx50mm ) rectangular 462 micro coverslips ( 22mmx60mm ) rectangular ( special ) 463 micro coverslips ( 24mmx24mm ) square ( special ) 464 micro coverslips ( 24mmx40mm ) rectangular ( special ) 465 micro coverslips ( 24mmx60mm ) rectangular ( special ) 466 micro coverslips ( 25mmx50mm ) rectangular ( special ) 467 micro coverslips ( 25mmx60mm ) rectangular ( special ) 468 micro coverslips 18mm circular 469 micro coverslips 19mm circular 470 micro coverslips 22 mm circular 471 micro coverslips 24mm circular 472 micro pippete 10 ul 473 micro pippete 20 ul 474 micro pippette 1000 ul 475 micro pippette 100ul 476 micro pippette 200 ul 477 micro pippette 50 ul 478 micro pippette 500ul 479 micro pippette tips ( 200 1000ul ) 480 micro pippette tips ( 2 200ul ) 481 micro tips yellow size small 482 micrometer stage 483 micropipate ( 00 to 210 micro litter ) 484 micropipate ( 00 to 1500 microlitter ) 485 micropipette tips 0 200 μl 486 micropipette tips 1000 μl 487 micropipette tips 200 μl 488 microscope oil immersion moveable stage abbe condenser etc 489 multichannel micropipette 10μl ( fixed volume, 8 channel with built in tip ejector 490 multichannel micropipette 100μl ( fixed volume, 8 channel with built in tip ejector 491 multichannel micropipette 200μl ( fixed volume, 8 channel with built in tip ejector 492 multichannel micropipette 50μl ( fixed volume, 8 channel with built in tip ejector 493 museum jar ( rectangular with lid ) 494 anti sera e coli ( 5 amplues ) 495 anti sera shigella ( 5 amplues ) 496 anti sera vibrio ( 5 amplues ) 497 anti sera salmonella ( 5 amplues ) 498 patri dish 9cm glass 499 shigella ( lyophilized culture ( 173204 ) ( pack 2 stick ) 500 vibrio ( lyophilized culture ( 173204 ) ( pack 2 stick ) 501 klebsella ( lyophilized culture ( 173204 ) ( pack 2 stick ) 502 proteus ( lyophilized culture ( 173204 ) ( pack 2 stick ) 503 salmonella ( lyophilized culture ( 173204 ) ( pack 2 stick ) 504 alkaline bile salt agar ( himeda ) ( 500 gms ) 505 monsurs gelatin tourochalate ( himedia ) ( 100 gms ) 506 pcv tube ( wintrobe ) 507 petri plate carrier for 10 paltes anerobic system 508 ph meter digital 509 pippete 1ml 510 pippete 5ml 511 plastic container for collection of stool, pus, sputum, with sepcimens 20ml capacity, sterile 512 plastic container for collection of stool, pus, sputum, with sepcimens 50ml capacity, sterile 513 platinum wire loop 514 postmortem glvoes size 8 ½ 515 pricking needles 516 priestley smith perimeter 517 rack for patridish 518 reagent bottle ( 1000cc ) 519 reagent bottle ( 100cc ) 520 reagent bottle ( 2000cc ) 521 reagent bottle ( 250cc ) 522 reagent bottle ( 500cc ) 523 reagent bottle ( 50cc ) 524 reagent bottle 100ml 525 reagent bottle 50ml 526 regent bottle 250ml 527 rubber bulb for pipettes big 528 rubber bulb for pipettes small 529 rubber teats varium volume 530 scissors big size 531 single channel fixed volume micropipette 10μl 532 single channel fixed volume micropipette 100μl 533 single channel fixed volume micropipette 25μl 534 single channel fixed volume micropipette 50μl 535 single channel micropipette variable volume 100 1000μl 536 slide 76mmx25mm 537 spatula 538 spirit lamp 539 staining trough 540 stature needles ( half dozen stainless stell ) cat no. round bodied half circle size 1 541 surgical gloves 7 542 surgical glvoes 6 ½ 543 test tube borocilicated ( 100x12mm ) 544 test tube borocilicated ( 150x18mm ) 545 test tube borocilicated ( 75x12mm ) 546 test tube basket 547 test tube glass 5ml 548 test tube holder 549 test tube plastic with cap 5ml 550 test tube stand ( big ) 551 test tube washing brush 552 test tube with rim 05 cm 553 test tube with rim 10cm 554 thermometer 555 urinometer 556 vdrl shaker 557 water both ( serological ) 56c 558 writing pen for neurograph 559 stationary 560 attendance register student ( custom print ) 561 attendance register staff ( custom print ) 562 calculator ( basic large display ) 563 carbon paper ( 8x13 blue ) 564 chalk color ( 1x100 per pkt, non dust type ) 565 chalk white ( 1x100 per pkt, non dust type ) 566 correcting pen ( white fluid ) 567 cotton tag ( 6 long ) 100 pcs per bunch ) 568 dak book 2qr 569 envelope ( 11x5, laminated 100gsm ) 570 envelope ( 11x5, white 57gsm ) 571 envelope ( 12x16, brown paper100gsm ) 572 envelope ( 8x10, laminated100gsm ) 573 examination copy24 pages ( size 32x20cm ) 60 gsm with numbering neolith paper 574 examination supplementary copy12 pages ( size 32x20cm ) 60 gsm with numbering neolith paper 575 favicol 50 gms 576 file cover ( number j 55 ) ( each ) 577 index file ( each ) 578 file folder ( each ) 579 file lace ( 18 cloth green / white 924 ) ( 100 pcs ) 580 file pad ( each ) 581 glue stick ( 18gms ) 582 glue stick ( 8gms ) 583 gum bottle ( 150ml ) 584 gum bottle ( 700ml ) 585 ink pad ( medium size ) ( each ) 586 paper clip ( 15mm ) 587 paper clip ( 41mm ) 588 paper pin 400gm 589 paper punching machine big size ( each ) 590 paper weight 591 photocopy pape a3 size ( 75gsm 500sheets ) 592 photocopy pape a4 size ( 75gsm 500sheets ) 593 photocopy pape fssize ( 75gsm 500sheets ) 594 pin cushion ( magnet type, standard size plastic body ) 595 sealing wax ( per kg ) 596 stamp pad ( big size ) ( 7cm x 14cm metal case ) 597 stamp pad ( small size ) 598 stamp pad ( small size ) ( 5cmx9cm ) metal case 599 stapler big size no. 24 / 6 600 stapler hp 45 601 stapler pin no.10 602 stapler pin no.24 / 6 603 tag ( big green ) 604 a4 size printing single side 605 a4 size printing double side 606 a5 size printing single side 607 a5 size printing double side 608 a3 size printing single side 609 a3 size printing double side 610 a4 size book printing with binding ( 100 pages ) ( multiple color pages ) 611 register 100 page 612 register200 page 613 register 300 page 614 register 400 page 615 register600 page 616 register 800 page 617 stock register ( 100 page ) ( custom print ) 618 stock register ( 200 page ) ( custom print ) 619 stock register ( 300 page ) ( custom print ) 620 marker pen ( each ) 621 highlighter ( each ) 622 dak book ( custom print ) 623 led bulb ( 09 watt ) 624 led bulb ( 12 watt ) 625 led bulb ( 15 watt ) 626 tag 6’’ 627 flag ( 76mm×15mm×5 ) 628 locker 629 basta cloth 630 led tube light complete set 631 punching machine big size 632 pin cushion plastic box 633 duster 634 paper pin ( steel ) 635 pad ink 636 scissor ( big size ) 637 sealing wax 638 dusting cloth 639 pen ( red, blue & black ) 640 poker 641 detergent powder ( 1 kg ) 642 soap 643 phenyl 644 acid cleaner 645 naphthaline balls 646 dustbin small 647 dustbin big ( 50 ltr ) 648 dustbin big ( 10 ltr ) 649 plastic bucket ( 20 ltr ) 650 toilet brush 651 wiper with handel ( big size ) 652 bomboo stick ( 5 feet ) 653 bomboo stick ( 12 feet ) 654 bomboo basket 655 floor cleaning moper 656 plastic mugs 657 gala hardy 658 water pipe ( flexible ) ( per meter ) 659 date broom 660 coconut broom...

Indian Army - Madhya Pradesh

29346779 invitation for online bids for purchase of expendable medical stores items out of dglp echs fund invitation of online bids for purchase of expendable medical stores out of dglp echs fund , kit urea 5 x 44 / 5x11ml sys pack ( transasia ) , kit creatinine 5x30 / 5x10 ml sys pack ( transasia ) , kit uric acid 2 x 44 / 5x11mlsys pack ( transasia ) , kit bilirubin direct 6x44 / 3x22ml sys pack ( transasia ) , kit bilirubin total 6x44 / 3x22ml sys pack ( transasia ) , kit ggt 2 x 12 sys pack ( transasia ) , kit sgot 6x44 / 3x22 ml sys pack ( transasia ) , kit sgpt 6x44 / 3x22 ml sys pack ( transasia ) , kit ckn 2 x 12 ml sys pack ( transasia ) , kit cholesterol 10 x 44 ml sys pack ( transasia ) , kit hdl cholesterol 2x44 ml sys pack ( transasia ) , kit triglycerides 5 x 44 / 5x11 ml sys pack ( transasia ) , kit calcium 4x44 ml sys pack ( transasia ) , kit ldh 4x44 ml sys pack , kit sd malaria parachecktest card ( sd ) , kit widal test 4x5 ml ( tulip ) , kit aso titer 1x2 ml ( kit of 35 test ) ( tulip ) , kit crp 1x2ml ( kit of 35 test ) ( tulip ) , kit ra factor 1x2ml ( kit of 35 test ) ( tulip ) , kit hiv rapid 4th gen cardtest ( sd, j mitra ) , kit hcv rapid card test ( sd, j mitra ) , kit vdrl card test ( tulip ) , kit prothrombin time 1x5 ml ( tulip ) , oral glucose pkt of 500 gm , kit pttk 1x5 ml ( tulip ) , kit trop t cardtest ( roche ) , ethyl alcohol ( std ) , kit dengue ns1ag comb card test ) ( tulip ) , sterile urine container10 ml , cell pack pack of 20 ltr ( sysmex ) , stromatolyser 500 ml bott ( sysmex ) , cell clean 1x50 ml bott ( sysmex ) , anti sera a bott of 10 ml antigen igm ( tulip ) , anti sera b bott of 10 ml antigen igm ( tulip ) , anti sera ab bott of 10 ml antigen igm ( tulip ) , anti sera d bott of 10 ml antigen igm ( tulip ) , kit salmonella typhi card test ( tulip ) , cled agar plate , blood agar plate , mackoney agar plate , mha agar plate , kit hbsag rapid card test ( sd, j mitra ) , anti ah bott of 10 ml , blood culture media bott of 50 ml ( himedia ) , kit alkaline phosphate sys pack , kit glucose 10 x 44 ml sys pack ( transasia ) , kit amylase 5x11 ml sys pack ( transasia ) , glass slides pkt of 100 ( 5 star ) , kit lipase 1x44 ml / 1x11 ml sys pack , kit protein 10x44 ml sys pack , kit albumin 10x44 ml sys pack , kit micro protein sys pack , urine multi strip siemens bott of 100 strip , kit hba1cxl 2 x 15 / 2x5ml , kit uristick ( protein & sugar ) , kit d –dimer ( transasia ) , erba wash sys pack 10 x100 ml , kit multical sys pack , kit ck mb erba semi autho , protime ls ( pack of 10 vial ) , sample cup pack of 100 cup ( erba ecl 105 ) , kit occult blood , upt ( hcg ) 2x50 test kit , ketostick , cover slip 22 x 50 mm ( 5 star ) pkt of 10 gm , cover slip 22 x 40 mm ( 5 star ) pkt of 10 gm , vardhaman thermal printer size 57 mm x 18 mtr , tarsons microtips 2 200 ul , tarsons microtips 500 – 1 ml , plasma high performance microtome blade...

Directorate Of Medical Education - Madhya Pradesh

29207351 tender for medicine / surgical item / i.v. fluid / surgical suture / kits chemical and surgical stapler , medicine, surgical item, i.v. fluids, surgical suture, kits chemical and surgical stapler , 5 fluro uracil 250mg 10 ml amp , 5 fluro uracil 500mg 10 ml amp , acyclovir 250 mg inj , acyclovir 500 mg inj , acyclovir 750 mg inj , adalimumab 20mg inj , adalimumab 40mg inj , adenosine 3 mg / ml 2 ml amp , ado trastuzumab emtansine 100 mg inj , adrenalin inj 1mg / ml 1ml amp , alamine 8.2gm+l glutanic acid 13.46gm 100 ml bottle i / v , alteplase 50mg inj , amidotrizoate meglumine; sodium amidotrizoate ( 76% ) dye 50 ml bottle , amikacin250mg / 2 ml 2 ml vial , amikacin500mg / 2 ml 2 ml vial , aminophylline 25 mg / ml 10 ml vial , amiodarone 50 mg / ml 3 ml amp , amoxicillinmg + clavulanic acid mg 1.2 gm vial , amoxicillin 500 mg + clavulanic acid100mg, inj , amphotericine b ( liposomal ) 50 mg inj , amphotericine b 50 mg inj , ampicillin500 mg vial , anti d. immunoglobulin ( monoclonal ) ( 150mcg / vial ) human anti d, , anti d. immunoglobulin ( monoclonal ) ( 300mcg / vial ) , human anti d , anti hemophillic factor viii 250 iu ( vial ) , anti hemophillic factor viii 500 iu ( vial ) , anti human thymocyte immunoglobulin 25 mg , anti rabies vaccine inj , anti scorpion venominj <120mg total protein and >150 ld50 [ mouse ] neutralizing units / vial , anti snake venom ( liquid form ) 10ml ( polyvalent ) , artesunate 60 mg / vial , ascorbic acid 100mg / ml 5ml amp ( vitamin c ) inj , atracurium25mg / ml 2.5ml amp , atropine sulphate 0.6mg / ml2ml amp , azithromycin 100mg / 5ml inj , azithromycin 500mg / 5ml inj , bendamustine 100 mg vial , benfothiamine + folic acid + mecobalamin + pregabalin + vit b6 inj , benzathine penicilline 12 lac iu / vial , betamethasone sodium phosphate 4 mg / ml 1 ml amp , bevacizumab 100 iu vial , bleomycin 15 unit vial , bortezomib 2 .5 mg vial , bortezomib 2 mg / vial , bortezomib 3 .5 mg vial , bupivacaine hcl0.5% 20 ml vial , bupivacaine hcl for spinal anaesthesia 0.5% ( heavy ) amp 4 ml amp , buprenorphine hydrochloride0.3mg base / ml 1ml amp inj , busulfan 60mg vial , butorphanol 1mg / ml 1ml amp , caffeine citrate 20 mg / ml 3 ml vial , calcium carbonate 10% 10ml amp , calcium chloride 10% 100mg / ml 10ml vial , calcium gluconate 10% 10 ml vial , carboplatin 150 mg inj , carboplatin 450 mg inj , carboprost tromethamin 250 mcg / ml 1ml amp , carmustine 100 mg vial , cefaparazone with salbactum 1.5gm ( cefaparazone 1000 mg with salbactum 500 mg ) vial , cefazolin 500 mg vial , cefepime 500 mgvial , cefepime 500mg +tazobactum 625 mg vial , cefoperazone + sulbactam 1000 mg +500 mg vial , cefoperazone 1gmvial , cefotaxime + sulbactam 1000 mg + 500 mg vial , cefotaxime sodium 1 gm / vial , cefotaxime sodium 500mg vial , ceftazidime 1gm vial , ceftazidime 250 mg inj vial , ceftazidime 500mg vial , ceftriaxone + sulbactum 1.5gm vial , ceftriaxone + tazobactum inj 1.125gm vial , ceftriaxone 1 gm / vial , ceftriaxone 500 mg / vial , cetuximab 2mg / ml 100mg / 50ml vial , cetuximab 2mg / ml 200ml / 100 ml vial , cetuximab 50mg vial , chloroquine phosphate 40mg / ml 5ml amp , chlorpheniramine maleatevial , chlorpromazine ip 25mg vial , cisplatin 10 mg vial , cisplatin 50 mg vial , cladribine 10 mg inj , clindamycin 150 mg / ml 2 ml vial , clindamycin 600mg / 4ml solution for injection 150mg / ml 4ml amp , clonidine100 mcg / ml 10 ml vial , colistimathate sodium for injection 1 million iuvial , colistimathate sodium for injection 2 million iuvial , crystalline insulin 40 iu / 10ml regular insulin 10 ml amp , cyclophosphamide 200 mg / vial , cyclophosphamide 500 mg / vial , cyclophosphamide ip 1 gm vial , cytrabine 100 mg inj , dactinomycin 0.5 mg inj , dacarbazine 200 mg inj , dacarbazine 500 mg inj , daunorubicin 20 mg / vial , daunorubicin 50 mg / vial , decitabine 50mg inj , dexamethasone sodium phosphate 4mg / 2mlinj , dexamethasone sodium phosphate ( 8mg / 2ml ( 2ml vial ) , dexmedetomidine100 mg / ml ( 1 ml amp ) , diatrizoate meglumine & diatrizoate sodium ( 37% ) vial , diatrizoic acid 60% amp , diatrizoic acid 65% amp , diazepam5 mg / ml 2 ml amp , diclofenac sodium 25 mg / ml 3 ml amp , diclofenac sodium inj for intravenous use surfactant free 1 amp , dicyclomine 10mg / ml 2 ml vial , digoxin i.p. 0.5mg / 2 ml amp , diltiazem 25mg / 5ml vial , diphtheria antitoxin1000 iu vial , dobutamine 50 mg / ml 5 ml amp , docetaxel 120mg inj , dopamine hydrochloride 40 mg / ml 5 ml amp , doxorubicin ( lyophilized ) 10 mg / vial , doxorubicin 50 mg / vial , drotaverin 40mg / 2ml amp , edaravone60 mg inj , enalapril maleate inj 1.25 mg per ml 2ml vial , enoxaparin 40mg inj , enoxaparin 60mg inj , ephedrine 30mg / ml 1ml inj , epirubicin 100mg inj , epirubicin 50mg inj , erythropoetin 4000 iuinj pfs , erythropoietin 10000iu inj 1ml pfs , erythropoietin 2000 iu inj 1ml pfs , esmolol / 40mg / ml 5 ml vial , etanercept 25mg inj , etanercept 50mg inj , ethamsylate 2ml / 125mg / amp , etiophylline + theophylline inj 220mg / 2ml amp , etomidate 2 mg / ml emulsion with mct 10ml vial , etoposide 100 mg inj , fat emulsion 20% 250 ml bottle , fentanyl 100 microgran2 ml amp , fentanyl 50 microgran 2 ml amp , filgrastim 300 mcg 1ml pfs , fludarabine 50 mg vial , fluorescein 20% 5 ml amp , flupentixol 20 mg inj , flupentixol 25 mg inj , fluphenazine 25 mg / ml 1 ml amp , frusemide 10mg / 2ml amp , g.c.s.f. 300 unit inj , ganciclovir 500 mg vial , gas gangrene antitoxin 10, 000 iu / ml 40000 iu 4ml amp , gatifloxacin vial , gemcitabine 1 gm vial , gemcitabine 1.4 gm vial , gentamycin 80mg / 2ml amp , glargine 100iu / 3ml amp , glycopyrrolate 0.2 mg / ml 1 ml amp , glycopyrrolate 0.5mg + neostigmine 2.5mg 5ml amp , haemocoagulase 1 iu inj , haloperidol 5 mg / ml 1 ml amp , haloperidol 50 mg / ml 1 ml inj , heparin5000 iu ( 1000 iu / ml5 ml vial ) , heparin 25000 iu ( 5000 iu / ml5ml vial ) , hepatitis b vaccine / 1ml , hepatitis immunoglobulin 100iu vial , human albumin 20 % / 100ml bottle , hyaluronidase 1500 iu / 2ml amp , hydrocortisone dry powder 100 mg / vial ( hydrocortisone sodium succinate inj ) , hydroxyprogesterone caproate 250mg / ml 2ml inj , hydroxypropylmethylcellulose 2% inj pre filled syringe , hyoscine butyl bromide / 20mg / 2ml amp , ifosfamide1 gm vial , ifosfamide2 gm vial , ifosfamide + mesna 1gminj , imipenem 1g vial , imipenem 1gm+cilastatin sodium 500 mg vial , infliximab 100mginj , iohexol ( non ionic contrast medium in sterile aqueous solution ) 300 mg iodine / ml 100 ml bottle , irinotecan 100mg inj , irinotecan 40mg inj , iron sucrose 20 mg / ml 5 ml amp , isobaric levobupivacaine 0.5% inj , isoprenalin inj 1ml amp , isoxsuprine hcl5mg / ml 2ml amp , iv human immunoglobulin 5% iv ig ( 5gm / 100ml bottle, injection , ketamine hydrochloride 50 mg / ml 10 ml , labetalol 20 mg ( 5mg / 1 ml 4 ml amp ) , l asparaginase 5000iu inj , leucovorin calcium 50 mg / 5 ml vial , levetiracetam 100mg / ml 5ml amp , levosulpride inj amp , lignocaine ( preservative free ) 2% 50 ml vial , lignocaine for spinal anaesthesia lignocaine 5% +destrose 7.5% 2 ml amp heavy , lignocaine hydrochloride + adrenaline 2% + 0.005 mg / ml 30 ml vial , lignocaine hydrochloride 2% 21.3 mg / ml 30 ml vial , lignocaine / lidocaine 4%, 30 ml vial , liposomal doxorubicine 2mg / ml inj , lorazepam 2 mg / ml, 1 ml vial , lorazepam 2 mg / ml, 2 ml vial , l ornithine l aspartats10ml inj , low molecular weightdextran 40000 vial , magnesium sulphate inj50% w / v 10ml amp , meningococcal polysaccharide vaccine groupe a, c, y and w 135 combined vial , mephentermine 30 mg / ml 10 ml , meropenem 1 gm / vial , meropenem 500 mg / vial , methacarbamol 100 mg. / 10ml vial , methotrexate 15 mg / ml ( preservative free ) inj , methotrexate 50 mg / 2 ml, 2 ml vial , methyl ergometrine maleate 0.2 mg / ml, 1 ml amp , methylcobalamine ( vitamin b12 ) 500 mcg / ml, 3 ml amp , methylene blue 1% 10ml inj , methylprednisolone125mg10 ml vial , methylprednisolone 1 gm vial , methylprednisolone 40 mg / vial , methylprednisolone sodium succinate 500 mg / vial , metoclopramide 5mg / ml 2ml amp , metoprolol 5mg / ml 5ml vial , micronised progesterone 50mg / ml 2ml amp , micronized progesterone 100mg / ml2ml amp , midazolam 1mg / ml, 1 ml amp , midazolam 1mg / ml 5ml vial , milrinone 1mg / ml solution for injection / infusion , mitomycin c 40mg inj , mitoxantrone 15 mg inj , mixed.25 / 75 ( 25% insulin lispro+75% lispro insulin protamin ) 100iu / ml , mixed.30 / 70 insullin biphasic isophane40 iu / ml 10 ml vial , morphine sulphate 10mg / ml 1ml amp , multivitamin 10 ml amp , nab paclitaxel 100mg / vial , n acetyl cysteine inj 200mg / ml 10 ml amp , naloxone 0.4 mg / ml, 1 ml , neostigmine 0.5 mg / ml, 1ml amp , nikethamide amp , nitroglycerine ( glyceryl tri nitrate ) 25 mg / 5 mlamp , noradrenaline bitartrate2 mg base / 2 ml amp , octreotide 100microgram / ml solution for injection 1 ml amp , octreotide 50 microgram / ml solution for injection 1 ml amp , olanzapine10 mg inj , olanzapine depot inj , ondansetron 2 mg / ml 2 ml amp , ondansetron 2 mg / ml 4 ml amp , oxaliplatin 100mg inj , oxaliplatin 50mg inj , oxytocin 5 iu / ml, 1 ml amp , paclitaxel 100mg inj , paclitaxel 260mg inj , panitumumab 100mg / 5ml inj , pantoprazole 40 mg / vial , paracetamol 150mg / ml 2ml amp , paracetamol 2ml amp for i / v use , peg gcsf 6 mcg , pembrolizumab 100mg / 4ml ( 25mg / ml ) , pemetraxed 100 mg inj , pemetraxed 500 mg inj , penicillin v 125 mg inj , pentazocin lactate 30mg / ml 1ml amp. , pentoxiphylline 20 mg / ml , pertuzumab 30mg / ml ( 420mg / 14ml ) , pheniramine maleate ip 22.75 mg, 2 ml amp , phenobarbitone100mg / ml 1ml amp. , phenobarbitone200mg / ml 1ml amp. , phenytoin sodium50mg / ml 2ml / amp , pilocarpine 0.5 % / 1ml amp , piperacillin 4 gm + tazobactum 500 mg, vial , piperacillin tazobactum 1.125 gm vial , pneumococcal vaccine 10 ml vial , potassium chloride inj. 150mg / 10ml amp , pralidoxime20 ml vial , pregabalin inj , progesterone b.p.100mg vial , promethazine 2 ml / 2.5% vial , propofol sodium with mct / lct 1% w / v 10 mg / ml, 20 ml vial , protamine sulphate 1%, 10mg / 5ml amp , quinine sulphate 300 mg / ml, 2 ml amp , rabeprazole 20 mg vial , rabies immunoglobulin inj 300 iu / 2 ml , ranitidine 50mg / 2ml amp , remdesivir inj 100mg / vial , rituximab 100mg inj , rituximab 500mg inj , ropivacaine 0.5% 20 ml vial , ropivacaine 0.75% 4ml amp , ropivacaine 10mg / ml 2.5ml vial , ropivacaine hydrochloride0.2% 40mg / 20ml vial ( 2mg / ml ) , ropivacaine hydrochloride0.75% 150 mg / 20 ml vial ( 7.5mg / ml ) , sargramostim 500 mg inj , soda bicarbonate 10ml, 7.5% inj , sodium valproate 100 mg / ml, 5 ml , streptokinase 150000iu ( 15 lac ) amp , streptomycin 0.75 mg vial , succinyl choline 50 mg / ml, 10 ml vial , surfactant bovine ( 135 mg phopholipid per 5 ml / 5ml vial ) , tecoplanin 400mg vial , terbutaline 0.5mg / ml aml amp , teriparatide 600mcg 3 ml amp , terlipressin 1 mg / 10 ml amp , tetanus immunoglobulin usp 500 iu / vial , tetanus toxide 0.5ml ampoule , thiamine hydrochloride inj.100mg / ml 2ml vial multiple dose ( vit.b1 ) , thiopentone sodium 0.5gm powder / vial, 20 ml vial , thiopentone sodium 1 gm / vial , tigecycline, 50 mg, vial , tobramycine 80 mg vial , tocilizumab 400 mg inj , torsemide inj 2ml amp , tramadol 100 mg inj50 mg / ml, 2 ml amp , tramadol 50 mg inj , tranexamic acid 100mg inj , tranexamic acid 500 mg / 5 ml, 5 ml amp , trastuzumab 440mg inj , triamcinolone acetate 40 mg / ml 1 ml amp , trypan blue opthalmic solution 0.06% pre filled syringe , urokinase 500000 iu vial , vancomycin hydrochloride 1000 mg / vial , vancomycin hydrochloride 500 mg / vial , vasopressine40 iu / ml amp , vasopressine 20unit amp , vecuronium bromide 2 mg / ml, 2 ml amp , verapamil hydrochloride 2.5 mg / ml amp , vinblastine 10 mg / 10 ml amp , vincristine 1 mg / ml, 1 ml vial , vinorelbin 10 mg inj , vinorolbine 50mg inj , vit. cynocobalamin 500mcg +folic acid 15mg+niacinamide 200 mg + ascorbic acid inj , vit. cynocobalamin 500mcg +folic acid 15mg+niacinamide 200 mg inj , vit. methylcobalamin 1500 mcg +folic acid 0.7mg+ niacinamide12 mg inj , vitamin b complex inj , vitamin k 1ml, 10mg / ml , voriconazole 10 mg / ml, 200 mg / vial , water for injection 10 ml amp , zoledronic acid 4 mg / 100 ml vial , zuclopenthixol acuphase 50 mg inj , zuclopenthixol decanoate 200 mg inj , amino acid infusion 5 %100 ml , amino acids 10% w / vin glass bottle 500ml, , aminoacid ( essential ) 10% 100 ml ffs bottle , balanced crystalloid solution 500 ml bottle , ciprofloxacin200 mg / 100 ml ffs bottle , dextrose 40% 100 ml bottle , dextrose 5 % with normal saline 0.45% 500 ml glass bottel with rubber cork , dextrose saline ( dns ) 5% + 0.9% 500 ml ffs bottle , dextrose, 25% 100 ml ffs bottle , dextrose, d 10 10% 500 ml ffs bottle , dextrose, d 5, 5% 500 ml ffs bottle , dextrose, d 50 50% 100 ml ffs bottle , electrolyte m ( multi electrolyte with 5% dextrose iv injection type iii ip ) , type iii ip 500 ml ffs bottle , electrolyte p ( multiple electrolytes & dextrose injection type i ip ) type i ip 500 ml ffs bottle , fat emulsion 20% ( 250 ) ml , fluconazole 100ml bottle. 2mg / ml. , glutamine dipeptide 100ml bottle , glycine irrigation solution ip 3000 ml bottle , hydroxyethylstarch 6% solution with sodium chloride 0.9% iv infusion 500 ml ffs bottle , levofloxacin 500 mg / 100 mlffs bottle , linezolid 200 mg / 100ml 300 ml bottle , mannitol20%100 ml ffs bottle , mannitol 20% 350ml , metronidazole 500 mg / 100 mlffs bottle , normal saline 0.9% 100 ml ffs bottle , normal saline 0.9% 3 ltrs bottle , normal saline 0.9% 500 ml ffs bottle , normal saline 1.6% 500 ml bottle , normal saline 3% 100 ml ffs bottle , normal saline glass bottle 100ml , normal saline glass bottle 500ml , ofloxacin 200mg / 100 ml bottle , omega 3 fatty acid 100 ml bottle , paracetamol1000 mg 100 ml ffs bottle , ringer lactatei / v 0.24 % v / v of lactic acid ( eq. to0.32% w / v of sodium lactate ) , 0.6 % w / v sodium chloride, 0.04 %w / v potassium chloride and 0.027 % w / v calcium chloride 500 ml ffs bottle , ringer lactatei / v 0.24 % v / v of lactic acid ( eq. to0.32% w / v of sodium lactate ) , 0.6 % w / v sodium chloride, 0.04 %w / v potassium chloride and 0.027 % w / v calcium chloride 500 ml glass bottle , sodium chloride hyper tonicn / 2 ( 0.45% ) 500 ml ffs bottle , sodium chloride ( 1 / 2 n ) + dextrose 0.45% + 5% 500 ml ffs bottle , total parenteral nutrition 1000 ml with 763 kcal dextrose 15% w / v, amino acids 10% w / v with electrolytes & intravenous fat emultion triglycerides 20% w / v ) ( all in one inthree chamber bag ) , 1000ml , tpn ( total parenteral nutrition ) including carbohydrate + proteins + fats solution ) 15% dextrose 10% amino acids 2000 ml , budesonide respules 0.5mg , desflurane 240ml bottle , formeterol + budesonide 120 mdi respules , ipratropium bromide 250 mcg / ml amp , ipratropium bromide 40 mcg + levosalbutamol200 mcg respules , isofluran 250 ml bottle , salbutamol nebuliser solution bp sabutamol sulphate eq. to salbutamol 1mg per ml ( 2.5 ml amp ) , ampule , salmeterol 25 mcg + fluticasone 250 mcg 120 mdi , sevoflorane 250ml. , 6 mercaptopurine , 50mg , acamprosate, 333 mg , aceclofenac 100mg tablet , aceclofenac 100mg+paracetamol 325mg , tablet , aceclofenac 100mg+paracetamol 325mg + chlorzoxazone 250mg tab ( ) , tablet , aceclofenac 100mg+paracetamol 325mg + serratiopeptidase 10mg tab ( ) , tablet , aceclofenac 100mg+paracetamol 500mg , tablet , acenocoumarol2 mg tab , acetazolamide 250 mg tab , acyclovir400 mg , acyclovir800 mg , afatinib 40 mg , agomelantine 025 mg tab , albendazole 400 mg , albendazole 400 mg + ivermectin 6 mg tab , alendronate 70 mg , alfuzocin hcl 10mg , alfuzosin 10mg+dutasteride 0.5 mg , allopurinol 100 mg , alprazolam 0.25 mg , amiodarone 200 mg , amisulpride 100 mg , amisulpride 200 mg , amisulpride 50 mg , amitriptyline 25 mg , amitriptyline 50 mg , amitriptyline 75 mg , amlodipine 2.5 mg , amlodipine 5 mg , amlodipine 10 mg tab , amolodipine 5mg +atenolol 50mg , anastrozole1mg , aripiprazole 10 mg , aripiprazole 15 mg , aripiprazole 30 mg , artesunate 50 mg+sulphadoxine 500 mg+pyrimethamine 25 mg tab , aspirin 150 mg , aspirin 75 mg , atenolol 25 mg tab , atenolol 50 mg , atomoxetine 10 mg tab , atomoxetine 25 mg tab , atorvastatin 10 mg , atorvastatin 20 mg , atorvastatin 40 mg , axitinib 5mg , azathioprine 50 mg tab , azithromycin500 mg , azithromycin 250 mg tab , azithromycin+fluconazole+secnidazole ( 1gm+150mg+1gm ) tab , baclofen 10 mg , baclofen extanded release40 mg , baclofenextanded release 30 mg , baclofen extanded release 20 mg , benfothiamin 150mg , betahistine 16 mg tab , betahistine 8 mg tab , betamethasone 0.5 mg , bicalutamide 50 mg , bisacodyl5 mg , blonanserin 2 mg , blonanserin 4 mg , buprinorphine 4mg , buprinorphine 8 mg , bupropion150 mg , bupropion300 , buspirone 10 mg , buspirone 5 mg , cabargolin 0.25 mg , calcium acetate 667 mg tab , calcium carbonate 500 mg tab , calcium d3 / 500mg , capecitabine 500mg , carbamazepine200 mg , carbamazepine sr100 mg , carbamazepine sr200 mg , carbamazepine sr400 mg , carbimazole 5mg , carvedilol6.5 mg. , carvedilol 3.125 mg tab , cefixim 200 mg + clavulanic acid 125 mg , cefixime 100 mg , cefixime 200 mg , cefodoxime 200mg tab , cefpodoxime50 mg , cefuroxime 200 mg , cefuroxime 500 mg , cetirizine10 mg , chlordizepoxide 10mg , chlordizepoxide 25mg , chloroquine phosphatetab. 250 mg , chlorpheniramine maleate tab 4 mg , chlorpromazine50mg , chlorpromazine 100 mg , chlorthalidon 50 mg tab , chymotrypsin & trypsin tab , cinnarizine 25 mg tab , cinnarizine 5 mg tab. , ciprofloxacin500 mg , clarithromycin 250 mg , clindamycin 300mg , clindamycin 600mg , clobazam 10 mg , clobazam 5 mg , clomipramine 50mg , clonazepam 0.25 mg tab , clonazepam 0.5 mg tab , clonazepam 1 mg , clonazepam 2 mg , clonidine 100 mcg tab , clopidogrel75 mg , clopidogrel 150mg+ aspirin 75 mg , clotrimazole vaginal 500mg tab , clozapine 100 mg , clozapine 25 mg , clozapine 50 mg , coenzyme q , crizotinib 250mg , cyclophosphamide 50 mg tab , dasatinib 50 mg , deferasirox dispersible 250 mg tab , deferasirox dispersible 500 mg tab , deflazacort 30 mg tab , dexamethasone 4 mg tab , diazepam10 mg , diazepam5 mg , diclofenac 50mg + paracetamol 325mg + serratiopeptidase 10mg tab , diclofenac 50mg + paracetamole 500mg , diclofenac 50mg + serrtiopeptidase , diclofenac sodium 50 mg , dicyclomine tab 10 mg. , digoxin 0.25 mg , diltiazem 30mg , diphenylhydramine 50 mg , disulfiram 250 mg , divalproex sodium 250 mg , domperidone 10 mg tab , domperidone+ranitidine 150mg tab , donepezil10 mg , donepezil 5 mg , doxophylline400 mg , duloxetine 20 mg tab , duloxetine 30 mg tab , dydrogesterone 10mg , empagliflozin 25mg tablet , enalapril maleate 2.5 mg , enalapril maleate 5 mg , erlotinib 100mg , erlotinib 150mg , escitalopram 10 mg , escitalopram 20 mg , escitalopram 5 mg , ethamsylate 500 mg , etizolam 0.5mg , etophylline 77 mg+ theophyllin 23 mg , etoposide 50 mg , everolimus 2.5mg / 5mg / 10mg , farmalin 1gm tab ( 100 tab per box ) , febuxostat 40 mg , ferrous ascorbate 100 mg tab ( elemental iron +folic acid 1.5 mg tab , ferrous sulphate tab. 200mg ( equivalent to 60mg elemental iron ) , flavoxate hcl 200mg , fluconazole 150 mg , fludrocortisone 0.1mg tab , flunarizine 10 mg , flunarizine 5 mg , fluvoxamine 50 mg , folic acid 5 mg , frusemide40 mg , gabapentin 300 mg. , gabapentine 100 mg , gefitinib 250mg , glibenclamide 2.5mg tab , glibenclamide 5mg tab , gliclazide 80 mg , glimeperide2 mg , glimeperide 1 mg , glimipride 1mg+metformine 500mg , glucagon 0.1mg tablet , glyceryl trinitrate 0.5 mg sublingual tab , haloperidol 1.5 mg , haloperidol 10 mg , haloperidol 5 mg , hydrochlorothiazide 12.5 mg , hydrochlorothiazide 25 mg , hydrocortisone 10 mg , hydroxychloroquine sulphate 400 mg , hydroxychloroquine ( 200 mg ) , tablet , hyoscine butylbromide tab 10mg , ibuprofen400 mg , ibuprofen 400 mg + paracetamol 325 mg , imatinib 100mg , imatinib 400 mg , imipramine hcl 25 mg , imipramine hcl 75 mg , iron folic acid tab ferous sulphate dessicated ip 333 335mg equivalent to 100mg of elemental iron +folic acid ip 0.5mg tab ferrous sulphate of elemental iron +folic acid ip 0.5tab ferrous sulphate dessicated ip mg equivalent to 20mg , iso sorbitrate dinitrate sublingual5mg , isosorbide 5 mononitrate20 mg , ivermectin 12 mg , l carnosine , labetalol 100mg , lacosamide 50 mg tab , lactobacillus tab 60 million spores , lamotrigine 100 mg , lamotrigine dt 50 mg tab , lapatinib 250 mg , lenalidomide 10 mg , lenalidomide 25mg , letrozole 2.5mg , levetiracetam 250 mg , levetiracetam 500 mg , levocetirizine 5mg tab , levocetirizine 5mg+ monteleukast 10 mg tab , levodopa + carbidopa 100+25mg , levofloxacin tab 500mg , linezolid600mg , lithium carbonate 300 mg , lithium carbonate 400 mg , lorazepam1 mg , lorazepam 2mg tab , lorcaserine 10 mg tab , losartan 50 mg tab , losartan 50 mg+hydroclorothiazide 12.5 mg tab , lurasidone 20 , lurasidone 40 , magnesium oxide 200 mg , mebendazole 100 mg tab , mefenamic acid + dicyclomine tab ( 250 mg + 10 mg ) , tablet , mefenamic acid + drotaverine hcl tab ( 250 mg + 80 mg ) , tablet , megestrol acetate 40mg , melatonin 3mg , melatonin 6mg , memantine 10 mg , mesalamine ( 5 aminosalicylic acid ) 400 mg tab , metformin 500 mg , metformin sr 1gm tablet , metformine 500 mg + glimipride 2 mg tab , metformine 500 mg+ gliclazide 80 mg tab , metformine 500 mg+glibenclamide 5 mg tab , methimazole 10 mg tab , methocarbamol500 mg. , methotrexate10 mg , methotrexate2.5 mg , methotrexate7.5 mg , methyl prednisolone16 mg , methyl prednisolone 4 mg tab , methyl prednisolone 8 mg tab , methylcobalamin500 mcg , methyldopa 250 mg tab , methylphenidate 10 mg , methylphenidate 20 mg , methylphenidate 5 mg , metoclopramide05 mg , metoclopramide 10 mg , metolazone 5 mg , metoprolol tab 50 mg , metronidazol 400mg , mifepristone 200mg ( 1 tab ) +misoprostol 200mcg ( 4 tab ) ( combipack ) , tab. mtp kit , mirtazapine15 mg , mirtazapine30 mg , mirtazapine7.5 mg , misoprostol 200 mg , modafinil200 , modafinil 100 , morphine 10 , multivitamin tab nfi formula sugar coated vita 2500 iu, vit b12 , vit b 6, 0.5 mg, vit c 50mg vit d3 200iu, niacinamide 25mg folic acid 0.2mg ( with approximateoverages ) , mycophenolate mofetil, 500 mg , n acetyl cysteine 600 mg , naltrexone, 50 mg , nicorandil 5 mg tab , nicoumalone 2mg tab , nifedepine 10mg , nifedepine r 20mg , nilotinib 200mg , nitazoxanide 200 mg , nitrofurantoin ip , 100 mg , norfloxacin400 mg , norfloxacine 400 mg + tinidazole 600 mg , ofloxacin 200mg +tinidazole 600mg tab , olanzapine 5 mg , olanzapine10 mg , olanzapine2.5 mg , olanzapine20 mg , olanzapine7.5 mg , olmesartan40mg , ondansetron 4 mg , ondansetron 8mg , orlistate 120 mg tab , orlistate 60 mg tab , ornidazole500 mg , oxcarbazapine 300mg tab , oxcarbazapine 600mg tab , oxcarbazepine 150 mg , paliperidone 1.5 mg , paliperidone 3 mg , pantoprazole 40 mg , pantoprazole 40 mg+ domperidon 10 mg , paracetamol 500 mg , paracetamol 650mg tab , paroxetine cr 12.5 mg , pazopanib 200mg / 400mg , penicillin v 250 mg tab ( phenoxymethyl penicillin potassium ) , pentoxifylline 400mg , perampanel 4mg , phenobarbitone 30 mg. , phenobarbitone 60 mg. , phenytoin sodium100 mg , pioglitazone 15 mg tab , pioglitazone 30 mg tab , piracetam 400 mg , piracetam 800 mg , pramipexol 0.26 sr , pramipexol 0.50mg , prazosin 5 mg , prednisolone 10 mg , prednisolone 5 mg , pregabalin 75 mg tab , primaquine7.5 mg , primaquine 15 mg tab , procyclidine 5 mg , promethazine 2 5 mg , propranolol la 40 mg , propranolol10 mg , propranolol20 mg , propylthiouracil 50mg , pyridoxine 40 mg tab , quetiapine 100 mg , quetiapine 200 mg , quetiapine 50 mg , quinine sulphate 300 mg , rabeprazole 20 mg tab , racecadotril 100mg , ramipril 2.5 mg tab , ramipril 5 mg tab , ranitidine 150 mg tab , resperidon 0.5mg , resperidon 2 mg , resperidon 4 mg , rivaroxaban 20 mg tab , rosuvastatin. 10 mg , sacubitril plus valsartan 50mg , secnidazole 500 mg tab , sertraline 100 mg , sertraline 50 mg , sildenafil 50 mg tab , sitagliptin 100 mg tab , sitagliptin 50 mg tab , sodium valproate 300 mg , sodium valproate200 mg , sodium valproate 500 mg , sorafinib 200mg , spironolactone 100 mg tab , spironolactone 25 mg , spironolactone+frusemide 20mg +50mg , sulfamethoxazole and trimethoprim ( 100mg+ 20mg ) tab , sulfamethoxazole and trimethoprim ( 800mg+ 160mg ) tab , sunitinib 50 mg , tadalafil 10 mg , tadalafil 20 , tamoxifen 10 mg , tamoxifen 20mg , tamsulosin 0.4mg , tamsulosin+dutasteride 0.4mg+0.5mg , telmisartan40 mg. , telmisartan hydrochlorthiazide 40mg+12.5mg tab , terbutaline sulphate 2.5mg tab , tetrabenazine 20 mg tab , thiamine 100mg , thiamine 75mg , thyroxine 88mcg tablet , thyroxine sodium12.5 mcg , thyroxine sodium 137 mcg , thyroxine sodium150 mcg , thyroxine sodium 62.5 mcg , thyroxine sodium 100 mcg , thyroxine sodium 25 mcg , thyroxine sodium 50 mcg , thyroxine sodium 75 mcg , tianeptine 12.5 mg , topiramate 100 mg tab , topiramate 25 mg , topiramate 50 mg , topotecan 1 mg , torasemide10 mg , tramadol – 100 mg tab , tramadol – 50 mg , tranexamic acid500 mg , trifluoperazine5 mg , trihexyphenydyl hydrochloride 2mg , ursodeoxycolic acid300 mg , venlafaxine sr 150 mg , venlafaxine sr 75 mg , venlafaxine 37 , venlafaxine 75 , verapamil40 mg , vilazodon 20 , vilazodon 40 , vildagliptin 50 mg +metformin 500 mg tab , vildagliptin 50 mg tab , vit b complex tab. nfi ( prophylactic ) b1 2mg, b2 2mg, b6 0.5mg, niacinamide 25mg, calciuym pantothenate 1mg ( with appropriate overges ) , vit d3 60000 k tab , vitamin c 500 mg ( ascorbic acid ) , voglibose 0.2mg tablet , voglibose 0.3 mg tab , voriconazole 200 mg , vortioxetine 20mg , vortioxetine10mg , vortioxetine5 mg , warfarin 5 mg tab , zinc sulphate ( dispersible ) 20 mg , zolpidem 10 mg tab , zonisamide 100 mg tab , zonisamide 50 mg tab , zyloric acid 100 mg , aceborophylline 100 mg , amoxicillin 250 mg cap , amoxycilline – 500 mg , amoxycilline + clavulanic acid 375 mg cap. , amoxycilline + clavulanic acid 625 mg cap. , ampicillin 250mg+ cloxacillin250mg , ampicilline – 500 mg , cyclosporine 100 mg , cyclosporine 50 mg , deferiprone 500 mg cap. , doxycycline 100 mg , fluoxetine 40 mg , fluoxetine bp 20 mg , hydroxy urea 500 mg cap. , imatinib mesylate 100 mg , itraconazole 100 mg , ivabradin 5mg , methylcobalamin 1500 mcg+alpha lipoic acid 100 mg+folic acid1.5 mcg thiamine mononitrate 10 mg ( pyridoxine hcl 3 mg ) cap. , omeprazole 20 mg , oseltamivir ( 45mg ) , capsule , oseltamivir ( 75mg ) , capsule , palbociclib 100 mg cap , palbociclib 125 mg cap , palbociclib 75 mg cap , pregabalin 75 mg + methylcobalamin 750 mcg , rifaximine 400 mg , sildenafil 20mg , temozolamide 100 mg , temozolamide 250 mg , vitamine400 mg , acyclovir 3% , atropine sulphate 1% 5 ml vial , carboxymethylcellulose solu. eye drop 1% , carboxymethylcellulose solu. eye drop 0.5% , ciprofloxacin eye drop 0.3% 10 ml , fluromethanol eye drop , gentamycin eye drop , homotropine drop 2% eye drop , lignocaine hcl 4% eye drop , loteprednol eye drop , natamycin eye drop , nepafenac ophthalmic solution , methyl cellulose / visco elastic , moxifloxacin 0.5% eye drop , moxifloxacin +prednisolone eye drope , ofloxacin 0.3% 5 ml vial , polyethelene glycol 400 & propylene glycol ophthalmic solution 10ml , pilocarpine eye drops 2% , polyvinyl alcohol 1.4% 5 ml , prednisoloneeye / drop. , proparacaine , sodium chloride opthalmic solution 5% eye drop , timolol maleate 0.5% 5 ml vial , tobramycin 0.3% 5ml eye drop , tropicamide 1% 5 ml vial , topicamide +phenylephrine eye drop , olopatidine hydrochloride ophthalmic solution 0.1% , benzocaine 2.7 w / v + chlorbutol 5% w / v +paradichlorobenzene 2% w / v+ turpentine oil 15% w / v ear drop , beclomethasone ( 0.025% ) + clotrimazole 1% +neomycin sulphate 0.5%5 ml ear drop , tobramycin eye oint.3gm tube , acyclovir 3% eye oint.5 gm tube , atropine eye oint. 3gm tube , chloramphenicol eye ointment 5 gm tube , ciprofloxacin eye ointment 5 gm tube , hydroxypropylmethylcellulose 2% w / v ophthalmic solution ocular lubricant 5gm ointment , diclofenac gel 1% 30 gm , ecg gel 250ml bottle , lignocain jelly 2% , oxetacaine 10mg + aluminium hydroxide 291mg + milk of magnesia 98 mg per 5ml 200 ml bottle , prostaglandin e2 0.5 mg 3 gm pre filled syringe , ultra sonograph gel 250ml bottle , white petroleum jelly kg , acyclovir5%, 5 gm , beclomethasone+ clotrimazole +neomycin sulphate cream , betamethasone valerate ointment 0.1%, 15 gm tube , betamethasone valerate cream 0.05% 15gm , clobetasol propionate 0.05%, 15 gm tube , clotrimazole 2%w / w 15 gm , fusidic acid 2%, 15 gm , fluconazole ointment 20 gm tube , human placental extract , mupirocin 2%, 15 gm , magnesium sulphate, sulphacetamide, urea, proflavin ( in glycerine base ) ointment75 gm , neomycin sulphate 5 mg + bacitracin zinc 500 iu / gm, 15 gm , papin urea 15 gm tube , povidone iodine 5 % w / w + metronidazole 1 % w / w, 15 gm tube , povidone iodine 5%, 250 gm , povidone iodine 7.5%, 500 gm , salicylic acid 2%, 30 gm , silver sulphadiazine cream usp 1% w / w 250gm , silk protein based antimicrobial wound healing ointment loaded with asiaticoside and silver 250 gm , silk protein based antimicrobial wound healing ointment loaded with asiaticoside and silver 100 gm , silk protein based antimicrobial wound healing ointment loaded with asiaticoside and silver 50 gm , silk protein based antimicrobial wound healing ointment loaded with asiaticoside and silver 25 gm , papain urea and silk protein based debriding ointment and cream 100 gm , papain urea and silk protein based debriding ointment and cream 50 gm , papain urea and silk protein based debriding ointment and cream 25 gm , povidone iodine and silk protein based topical antiseptic and wound healing ointment 25gm , povidone iodine and silk protein based topical antiseptic and wound healing ointment 50 gm , povidone iodine and silk protein based topical antiseptic and wound healing ointment 100 gm , povidone iodine and silk protein based topical antiseptic and wound healing ointment 250gm , silver nitrate hydrogel wound dressing 25gm , centella asiatica extract based skin moisturization and antiscar gel 30gm , mct oil 100ml bottle , mct oil 100ml bottle , paracetamol suppository , lactobacillus, 150 million spores, , l arginine sachet 10gm , hmf1 gm sachet , orodispersible probiotic sachet , ors who powder glucose anhydrous 13.5g / l, sodium chloride 2.6g / l, potassium chloride 1.5g / l, trisodium citrate 2.9g / l , formula milk for infants 500gm , potassium permegnet powder 400 gm pkt , neomycin sulphate powder 5gm , povidone iodine powder 5% , silk protein andnano silver based microbicidal sterile wound dressing dusting powder 100 gm , silk protein andnano silver based microbicidal sterile wound dressing dusting powder 50 gm , silk protein and antimicrobial nano silver based surgical particle wound dressing 5ml vial , silk protein and antimicrobial nano silver based surgical particle wound dressing 10ml vial , framycetin sulphate 1% w / w 30 gm tube , permethrin5% w / v 30gm , permethrin 5% 60 ml lotion , calamini lotion 50 ml bottle , alcoholic handrub with triple action:50%2 propano+25%1.propanol+2.5% chx+0.5 triclosan.500 ml , antiseptic hospital concentrate contdaining 20% chlorohexidine soln ip 7.5% v / v cetrimide ip 15%w / v iso peopyl alchohol 6 8% 1000ml. , citric acid 500 ml bottle , compound benzointincture, benzoin, aloe, storax, tolu balsam and enough alcohol to make a tincture ( 74 80% alcohol ) , 100 ml , feracrylum solution 1% 100 ml , formaldehyde solution37% acq. 450 ml bottle , glutaral dehyde solution 2% w / v stabilized 5 ltr cans , glycerine 500ml bottle , glycerine enema , hand wash solution ( sol.isoprapanol, propanol , mecetronium, skin care additives ) 500 ml bottle , hydrogen peroxide solution 20% 500 ml bottle , sodium hypochloride solution 5% 5 ltr , liquid paraffin ip 500ml bottle , povidone iodine ( surgical scrub ) , 7.5%, 500 ml bottle , povidone iodine, 5 %, 500 ml bottle , surface & environmental disinfectant each 100 gm contains: 1.6 dihydroxy, 2 5 dioxahexane 11.2 g. glutaraldehyde 5.0 g. benzalkonium chloride ip 5.0 g.5 ltr , topical heparin solution 5ml vial , aluminium hydro gel syp 100ml bottle , albendazole suspension 200 mg / 5ml bottle , ambroxol 15mg + terbutaline 1.25mg+ guaiphenesin 50mg, 100ml bottle , amoxicillin 125mg / 5ml 30ml bottle syp , amoxicillin and clavulanic acid 200+28.5mg suspension 30 ml bottle syp , azithromycin 200mg / 5ml suspension 15 ml bottle , bromhexine hydrochloride syp. 4 mg / 5ml ( bottle ) , calcium carbonate with vitamin d3 and minerals like phosphorus, zinc, magnesium syp 100ml bottle , calcium phosphate, 2:1 ratio, 100 ml bottle , cefixime , 100 mg / 5 ml, 30 ml bottle , cetirizine, 5 mg / 5 ml , 60 ml bottle , chloroquine phosphate , 160 mg / 10 ml ( 50 mg / 5 ml base ) , 60 ml bottle , ciprofloxacin 125mg / 5ml syp 60 ml bottle , co trimoxazole 30 ml , cyclosporine 50 ml syp , cyproheptadine hcl 2 mg + tricholine citrate 275 mg, 200 mlbottle , dextromethorphan 100 mg ( bottle ) , diphenhydramine 14.08mg+ammonium chloride 138mg +sodium citrate 57.03mg / 5 ml , di sodium hydrogen citrate 200ml bottle , domperidon suspension 1mg / ml 30 ml bottle , etiophylline + theophylline pediatric syp. ( 46.5+14mg / 5ml ) 60 ml bottle , glycerol 100ml , ibuprofen+paracetamol 60ml , iron200ml , lactulose , 3.35 gm / 5 ml , 100 ml bottle , levetiracetam 100 ml bottle , metronidazole 200mg / 5ml suspension 60ml bottle , milk of megnasia + liquid paraffine 100 ml , nitazoxanide 100mg / 5ml 30 ml bottle , norfloxacine suspension ( 30 ml bottle ) , ofloxacin suspension 50mg / 5ml 60ml , ondansetrone 30ml. 2mg / 5ml. , paracetamol oral solution 150mg / ml 15 ml bottle with dropper , paracetamol syrup / suspension 125 mg / 5ml ( 60ml bottle ) , phenobarbitone syp 30ml. 20mg / 5ml. , phenytoin sodium suspension 30mg / 5ml 100 ml bottle , potassium chloride syp 100 ml bottle , salbutamol sulphate , 2 mg / 5 ml , 60 ml bottle , sodium valproate , 200 mg / 5 ml , 100 ml bottle , sucralfate100 ml , sulfamethoxazole and trimethoprim suspension ( 200mg+ 40mg / 5ml ) 100 ml bottle , vitamin a syp 100000 unit / ml ( 100 ml bottle ) , vitamin b complex, nfi formula, 100 ml bottle , zinc 20mg / 5ml 30 ml bottle , multivitamin multimineral with antioxidant syp200 ml , budesonide nasal spray , fluticasone nasal spray , lignocaine spray 10% , xylometazolin 0.1% nasal drop 10 ml vial , saline nasal spray 20 ml , methylcobalamin nasal spray 250 mcg , saline nasal gel 15 gm tube , saline nasal wash 3gm kit , h2o2 mouth gargle 3% , povidone iodine mouth gargle 2% w / v 100 ml , chlorhexidine mouth wash 50 ml bottle , mouth wash 0.2% 50 ml , kmno4 mouth wash , mouth paint clotrimazole 1%15 ml , abdominal binder no 34 , abdominal drain set 28 no. , abdominal drain set 32 no , absorable cotton roll, net 500gm , absorbable gelatine spongip 80mmx50mmx10mm , accessory spikes , adhesive plaster 7.5 cm x 10 mtrs , adult diaper size l & xl , ag ion impregnated central venous double lumen polyurethane catheter, 7.5 fr, g 16x18 length 16cm , ag ion impregnated central venous triple lumen polyurethane catheter, 7.5 fr, g 14x18x18 length 16cm , ag ion impregnated triple lumen catheter for haemodialysis, fr 12, l 15cm, with polyurethan extention tube, flow rate per lumen – 320ml / min , air bed mattress with complete set , alcohal based hand sanitizer 500ml bottle with dispenser ) , ambu bag adult , ambu bag pediatric , anesthesia kit spinal & epidural with balloon indicator lor syringe type 16g / 25g ( 80mm*113mm / 90mm*123mm ) , 18g / 27g ( 80mm*113mm / 90mm*123mm ) , antimicrobial , liquid parafin based silver sulphate / chlorhexidineantiseptic tulle10cmx12cm , antimicrobial double lumen polyurethane cvc catheter kit with rollerson syringe, fr 3 5, g 18x18, l 15 / 16cm. peadiatric , antimicrobial double lumen polyurethane cvc catheter kit with rollerson syringe, fr 5 7, g 18x18, l 15 / 16cm. , antimicrobial incise drape 3 meter , antimicrobial triple lumen polyurethane cvc catheter kit with rollerson syringe, fr 3 5, g 16*18x18, l 15 / 16cm. peadiatric , antimicrobial triple lumen polyurethane cvc catheter kit with rollerson syringe, fr 5 7, g 16*18x18, l 15 / 16cm. , armored cuffed tube made of 100% silicon, radio opaque, should have prefilled stylet mounted connector, piot balloon with universal port. size. fr 2, 2.5, 3, 3.5, 4, 4.5, 5, 5.5 6, 6.5, 7, 7.5, 8, 8.5, 9 should be fda / ce approved , artery catheter , av blood lines with av pressure transducer ( acceptable for fitting to all standard dialyzer ) with side tubing ( for heparinization and av pressure monitorig ) blood tubing set dialysis , barium sulphate powder susp 95% w / v powder ( hd ) 95% 400gm , bionet connector , biopsy forceps type with / without spike / hot biopsy, length : 110cm / 160 cm / 210 cm, sterile for single use only, diameter – 1.8 mm / 2.5 mm as ordered , biopsy gun 16 20 gauze , bipap mask size large , bipap mask size medium , bipap mask size small , bipolar cable , bipolar forceps cable , bis monitor electrode , black thread ( stitching ) big , bleaching powder gr ii 25 kg bag , blood administration ( transfussion ) set , blood bag double 350 ml , blood bag double 350 ml cpd solu , blood bag double 350 ml with sagam , blood bag quadruple 350 ml top bottom with cpd sagam solu , blood bag quadruple 450 ml top bottom with cpd sagam solu , blood bag single 350 ml , blood bag transfer 350 ml , blood bag triple 350 ml , blood bag triple 350 ml sagam , blood collection tube clot activator with rubber cap , blood culture bottles , blood transfusion set double moldedchamber without airway , blood transfusion set single molded chamber without airway , bone marrow aspiration needles ( 14 ) , bone marrow aspiration needles ( 15 ) , bone marrow aspiration needles ( 16 ) , bone marrow aspiration needles13 g , bone marrow biopsy needle , bone wax , bp cuff adult & pediatric , camera cover disposable , cannula fixer set , carbolic acid 500 ml , c arm cover disposable , catheter mount adult size , catheter mount pediatric size , catheter single lumen4.7 no , catheter single lumen6.6 no , catheter single lumen7.7 no , catheter double lumen7.7 no , cautery pencil disposable , cautery platedisposable , central line double lumen 16 fr , central line single lumen , cerebral catheter reservoir 12mm dia chamber , cerebral catheter reservoir 18mm dia chamber , chest drainage catheter size: fg20 to fg40 , chest drainage catheter size: fg20 to fg40 with trocar , colostomy kit , condom catheter , cord clamp , craniotomy cutter blade , craniotomy drape ( 1.6 x 3.2 mtrs ) , crepe bandage 2 , crepe bandage 4 , crepe bandage 6 , cresol with soap solution5ltr jar , cvc line double lumen polyurethane catheter ( flexon material ) with bls introducer and nitinol j guide wire, 7fr, g 16x16 length 15cm , cvc line triple lumen polyurethane catheter ( flexon material ) with bls introducer and nitinol j guide wire, 7.5 fr, g 14x18x18, length 15cm, 20cm ( anti microbial coated ) , cvl dressing10 cm*12 cm pad for central line , cvl dressing7 cm* 8.5 cm for central line , cvp manometer , cylinder connection nut , cylinder key , cylinder spanner , d.j.stent 5 fr, 6 fr , 3fr, 4fr , dialyser 1.5 / 1.6 dialyzers multiple use made of polysulphone or polyethersulfone low / middle flux, hi performance dialyser performance enhanced technology with hi biocompatibility housed in medical grade polycarbonate openable ends for easy cleaning caps ( for dialysate inlet utlet for safer storage openable caps ( red and blue ) hi quality sterilisation procedure using gamma radiation , disposable eye shield u / v light protector for infants & neonates. sterile single pack. , disposable face mask triple layer ( standard ) , disposable hivfull protection kit , disposable n95 mask , disposable needle 18g ( single use ) , disposable needle 18g 1 1 / 2 ( single use ) , disposable needle 20g ( single use ) , disposable needle 22g ( single use ) , disposable needle 23g ( single use ) , disposable needle 24g ( single use ) , disposable needle no 26gx 1 1 / 2 , disposable needle no 26gx1 / 2 , disposable paper gloves , disposable spinal needle 18 , disposable spinal needle 22 , disposable spinal needle 23 , disposable spinal needle 24 , disposable spinal needle 25 , disposable sterile gown , disposable suction catheter all size , disposable surgeon cap , distilled water 5 lit. , double lumen peripherally inserted central venous silicon catheter ( 3fr, 4fr, 4.5fr, 5fr ) length 60cm , double lumen peripherally inserted central venous silicon catheter ( 7fr, 9fr, 11fr, 14fr ) length 90cm, with subcutaneous cuff for long term venous access , drap sheeth 120cm x 210cm sterile , dry collagen patch , non adhesive absorbalbe porus lyophilized fish origin collogen 10x10cm. , dry collagen patch , non adhesive absorbalbe porus lyophilized fish origin collogen 30x30cm. , ear cotton swab , ecg disposable electrode , ecg paper 80mmx20 mtr roll , ecg paper computerized triple channel 20m , edta tube , elastic adhesive bandage 10cm x 4 , elastic adhesive bandage 10cm x 6 , elastomeric pump for post operative analgesia , endotracheal tube cuffed4 , endotracheal tube cuffed5 , 5.5 , endotracheal tube cuffed6 , endotracheal tube cuffed6.5 , endotracheal tube cuffed7 , endotracheal tube cuffedsize 9.5 , endotracheal tube cuffedsize7.5 , endotracheal tube cuffed 3.0 , endotracheal tube cuffed 3.5 , endotracheal tube cuffed size8.5 , endotracheal tube cuffed size 8 , endotracheal tube cuffed size 9 , endotracheal tube with secondary lumen for surfactant therapy, size 2, 2.5, 3, 3.5, 4, 4.5 , endotracheal tubes plain without cuff size 2, 2.5, 3, 3.5, 4, 4.5 , epidural kit ( needle & catheter 16g, ) , epidural kit ( needle & catheter 18g ) , epidural kit ( needle & catheter 19g, ) , epidural needle , examination gloves sizesmall ( 100 pcs / pkt ) , examination gloves size large ( 100 pcs / pkt ) , examination gloves size medium ( 100 pcs / pkt ) , exchange transfusion catheter with four way adaptor size 4cm, l 40 cm , extention line 100cm , extention line 10cm , extention line 150cm , extention line 200 cm , extention line 50cm , extra ventricular drain ( evd ) , feeding tube size 3, 4, 5, , feeding tube size 6, 7, 8, 9, 10, 12, 14 , flexo metallic tube no 6, 6.5, 7, 7.5, 8, 8.5 , fluorescein strips pkt , fogharty catheter 5fr , foley balloon catheter three way ( a ) fg 16, 18, 20, 22 , foley catheter size 12 2 way , foley catheter size 14 two way , foley catheter size 16 two way , foley catheter size 18 two way , foley catheter size 20 two way , foley urinary catheter size 8 10 pediatrics , gasket for humidifier bottel , gasket forvaccume jar 1000 ml , gasket forvaccume jar 600 ml , gigli saw wire , glass slide iso mark no 12mm , glass tube 125x150 , glucometer strips pkt ( 50 strip / pkt ) , guedel airway all size soft and smooth , guide wire 0.35 no , guide wire 0.38 no , guide wire 150cm staight tip , guide wire 80cm. , halogen bulb holder ( heavy duty ) , hemodialysis fluid for bicarb made ( part a 10 ltr + part b 500gm ) , hernia flat mesh size: 10x15 , hernia flat mesh size: 15x15 , hernia flat mesh size: 15x20 , hernia flat mesh size: 3x5 , hernia flat mesh size: 6x6 , hme filter , humbysknife disposable blade , hydrocephalus shunt medium pressur ( vp shunt ) , icd bag , implantable pain port with epidural catheter for long term pain management , incubating laryngeal mask airway 4, 5 , insulin syringe , intraocular lens 14 30d dioptre , intravenous drip set adult size , intravenous drip set pediatric size , introducer sheath 6fr , iv .regulator set ( control drop set ) , iv cannula size18g , iv cannula size20g , iv cannula size22g , iv cannula size24g , iv cannula size26g , iv cannula size 16 g , j r c bag 1.5 ltr , 1 ltr , j r c bag 1 / 2 ltr 500ml , j tip 0.035 mm guidewire , jugularcatheter 12 fr ( adult ) , jugular catheter 8fr ( pediatric ) , k 90 catheter , kellys pad disposable , laryngeal mask airway classic 1, 1.5, 2, 2.5, 3, 4, 5 , liga clip 200mm, 300mm, 400mm , lma reusable pro seal second generation with gastric drain tube and reinforcement airway tube. size 1, 1.5, 2, 2.5, 3, 4, 5. , long length quincke spinal needle for pain management, size – g 22, length – 120mm & 150mm , low adherent absorbent wound dressing with a polyester perforated wound contact layer size 50cm 7mtr roll , lung excersizer , mackintosh double colour water proof roll ( 20 meter per roll ) , malecot rubber catheter no 12 , malecot rubber catheter no 16 , malecot rubber catheter no 20 , malecot rubber catheter no 22 , malecot rubber catheter no 24 , medical dry imaging film 10x12 , medical dry imaging film 14x17 , medical dry imaging film 8x10 , mesure volume set soft chamber, with bulb latex 110ml , methacrylate based oxygen permeable non adherent 3 dimensional transforming powder dressing size 4 x 4 , micro drip set with bulb latex , microlaryngeal surgery tube no 5 , monopolar cautry wire disposable , mucous extractor with connector for bronchoscope capacity 70 ml , mucus extractor , multifunctional mask with the attachment of nebulizer mask, venture mask, oxygen mask, aerosol mask, with 7 oxygen and paediatric. , naso pharyngeal airway adult all size , naso pharyngeal airway paediatric all size , nebulization mask ( set ) adult & pediatric , neonatal urine collection and measurement bag 100 ml , nitrile gloves size small / medium / large , non rebreathing mask ( oxygen mask with reservoir bag , non sterile surgical rubber gloves 6.5 no. ( pair ) made of natural latex micro rough finish for better grip , non sterile surgical rubber gloves 7 no. ( pair ) made of natural latex micro rough finish for better grip , non sterile surgical rubber gloves 7.5 no. ( pair ) made of natural latex micro rough finish for better grip , oxygen adaptor 5 type , oxygen catheter , oxygen connection with flow meter for central line , oxygen connection with flow meter for cylinder , oxygen high pressure hose pipe , oxygen mask adult & pediatric , oxygen penal regulator for oxygen liquied tank ( 1 25 kg ) , oxygen regulator for control penal board ( oxygen pipe line ) , oxygen tailpipe ( flexible metalic ) , p t tubes 3.8% sodium citrate ( prothrombin tube ) , pacing leads 6 fr , paediatric double lumen polyurethan cvc line, 3 fr, l 10cm, 15cm, , paediatric double lumen polyurethane cvp catheter, 4.5 fr, g – 20x20 length – 6cm, 12.5cm , paediatric epidural set ( with 19g needle with matel stylet 22gcatheter 0.22 micron epidural catheter andsyringes , paediatric triple lumen polyurethan cvc line with nitinol j guide wire, 4.5 fr, g 20*23*23, l 6cm, 8cm, 10cm, 12.5cm , paper adhesive plaster microporous surgical tape 2inch x 10mt roll , paper adhesive plaster microporous surgical tape 3inch x 10mt roll , paper adhesive plaster microporous surgical tape 4inch x 10mt roll , paper adhesive plaster microporous surgical tape 6inch x 10mt roll , pec haemostatic patch for post renal dialysis size 5cm x 7cm , pediatric diapers , pediatric ventilator circuit complete set , peripheral inserted central catheter 4 fr , peripheral inserted central catheter 5 fr , peritonial dialysis catheter 200mm pediatric , peritonial dialysis catheter 280mm adult , peritonial dialysis fluid 1ltr. , pigtail catheter 6 fr ( 150 cm ) , pigtail catheter no 10 , pigtail catheter no 14 , plain vial with screw cap12x75 , plaster of paris bandage 3 , plaster of paris bandage 4 , plaster of paris bandage 6 , plaster of paris powder ip 1 kg pkt , plastic apron disposable , plastic nozel cap , plastic test tube 3 , post exposure prophylaxis kits ( pep kits ) , probe for oxygen , proseal lma ( plma ) 1, 1.5, 2, 2.5, 3, 4, 5 , radial a catheter , rectified sprit 4.5 ltr. , reinforced epidural wired polyurethane catheter kit with stainless steel needle. size catheter 19g, needle 17g. , ryles tube size 10, 12, 14, 16, 18 , self adhering silicon external catheter should be built in band, clear odorless single sterilized pack, 100% latex free. size 25 / 29 / 32 / 36 / 41mm. , semi automatic core biopsy instrument set with 2 throw length of 10 mm and 20 mm in a single device along with a throw length indicator window and a fire ready indicator mark compatible adjustable coaxial and a blunt tip stylet. should be usfda approved 18g*10cm, 18g*16cm & 18g*20cm, 20g*10cm, 20g*16cm , short catheter with straight / j tip guide wire ( l 20, fr 2, g 22 ) , short pencil point spinal needle g 25 / 22, l 38mm. , should have dual hook for zero migration post deployment should have the option of repositioning after deployment should have dustable twisted wire construction for durability. 20g*107mm , sics kit ( small incision cataract surgery ) , silicon / double nasal prong with universal connector. all sizes , silicon cautery plate , silicon mask size 0, 1, 2, 3, 4 & 5 , silk protein and antimicrobial nano silver based sterile surgicalwound dressing sheet 10 cmx 25 cm , silk protein and antimicrobial nano silver based sterile surgicalwound dressing sheet 20 cmx 25 cm , silk protein and antimicrobial nano silver based sterile surgicalwound dressing sheet 20 cmx 40 cm , silk protein and antimicrobial nano silver based sterile surgical mesh wound dressing 10 cmx 25 cm , silk protein and antimicrobial nano silver based sterile surgical mesh wound dressing 20 cmx 25 cm , silk protein and antimicrobial nano silver based sterile surgical mesh wound dressing 20 cmx 40 cm , silk protein and antimicrobial nano silver based sterile surgical pu foam dressing 10 cmx 10 cm , silk protein and antimicrobial nano silver based sterile surgical pu foam dressing 20cmx20cm , silk protein based sterile surgicalwound dressing sheet20 cmx 40 cm , silk protein based sterile surgical pu foam dressing 20cmx20cm , silkolatex nasopharyngeal airway, with adjustable flange and widen end. sterilizedsizes 20, 22, 24, 26, 28, 30, 32, 34, 36 fr , soda lime for anesthesia workstation 5kg , soft roll 15cm x 3 meter , spatula for papsmear , spring loaded automatic biopsy gun one handed cocking machanism with non roll handle design. angle sample notch for enhance needle action choice of two firing buttons.should be usfda approved 16g* 10cm, 16g* 16 cm, 18g* 10cm, 18g* 16cm, 18g* 20cm, 18g* 25cm , sterilant cold disinfectant for dialysis containing peraetic acid hydrogen peroxide acetic acid 5 ltr. , sterile adhesive iodine drape large , sterile alcohol swabs , sterile disposable syringe 1ml , sterile disposable syringe with needle 03 ml , sterile disposable syringe with needle 2ml , sterile disposable syringe with needle 5ml , sterile gauze swab / pad , sterile gloves isi 6.5 made of natural latex, micro rough finish for better grip , sterile gloves isi size7.5 made of natural latex, micro rough finish for better grip , sterile gloves isi size8 made of natural latex, micro rough finish for better grip , sterile gloves isi size 7 made of natural latex, micro rough finish for better grip , sterile hypodermic syringe with needle 10ml , sterile hypodermic syringe with needle 20ml , sterile hypodermic syringe with needle 50ml , sterile leur lock syringe 20ml , sterile leur lock syringe 50ml , sterile luer lock syringe 10 ml , sterile luer lock syringe 5 ml , sterile powder free glovessize6.5 made of natural latex, micro rough finish for better grip , sterile powder free glovessize7 made of natural latex, micro rough finish for better grip , sterile powder free glovessize7.5 made of natural latex, micro rough finish for better grip , sterile powder free glovessize8 made of natural latex, micro rough finish for better grip , supreme lma ( slma ) , surgical blade size 11 , surgical blade size 15 , surgical blade size 22 , surgical blade size 24 , t.piece circuit with oxygen tubing set ( complete set ) , tear test strip ( 100 strips in box ) , thermometer digital , thomas splint , three way stop cock , tmt graph paper , tounge depresser wooden , tracheostomy tube cuffed plastic 5, 5.5, 6, 6.5, 7, 7.5, 8, 8.5 , transducer set for invasive b.p. , triway with extention 10, 50, 100, 150, , turp set , twin nasal cannula adult , twin nasal cannula padiatric , urine collecting bag 2 ltr. , urine collecting bag with urometer 1 ltr. , urine sugar diagnostic stip , vaccum adaptor 5 type , vaccum jar 1000 ml with regulator , vaccum jar 2000 ml with regulator , vaccum pump belt , vaccum pump oil , vaccum regulator , vaporizer , ventilator catheter mount , ventilator circuit , ventilator circuit ( heated wire ) , ventilator circuit ( neonatal ) , ventilator circuit full kit ( tubing+hmf+filter+catheter mount+bacteria filter ) , ventilator mask , ventilator nebulization kit with t piece , ventilator single tubing circuit ( adult ) , water bed , wipes , wound suctionset no 11 / 12 / 14 / 16 / 18 , x ray casset12x15 , x ray casset 10x12 , x ray casset 8x10 , x ray developer 22.5 lit. , x ray films size 10x12 50film per pkt blue sensitive , x ray films size 12x15 50film per pkt blue sensitive , x ray films size 8x10 50film per pkt blue sensitive , x ray fixer 22.5 lit , x ray hangers ( clip type ) 10x12 , x ray hangers ( clip type ) 12x15 , x ray hangers ( clip type ) 8x10 , x ray screen high speed 12x15 , x ray screen high speed 8x10 , x rayscreen highspeed 10x12 , yankauer suction catheter ( complet set ) , 180 absorbablepolyglyconate knotless wound closure device with unidirectional 030cm , green37mm1 / 2 circletaper point , 180 absorbablepolyglyconate knotless wound closure device with unidirectional 2 0 30cm , green37mm1 / 2 circletaper point , 20g round body cutting needle 1 / 2 circle , absorbable adhesion barrier in the form of off white knitted fabric prepared by oxidized regenerated cellulose indicated for both open and laparoscopic procedures size , absorbable gelatin based topical absorbable flowable hemostat with 6cc syringe pre filled with hemostatic matrix. with 14.3 cm white applicator tip & 14.6 cm blue flexible applicator tip , absorbable intraperitoneal umbilical patch of polyester mesh with collagen barrier and having absorbable pgla expanders with size 6 cm circle fda approved , absorbable intraperitoneal umbilical patch of polyester mesh with collagen barrier and having absorbable pgla expanders with size 8 cm circle, fda approved , absorbable unidirectional barbed devicepolydioxanone size 1, 40 mm 1 / 2 circle taper point needle 45 cm , absorbable unidirectional barbed devicesymmetric anchoring pattern, triclosan coated polydioxanone size 1, 40 mm 1 / 2 circle taper point needle 45 cm , absorbable unidirectional barbed device, symmetric anchoring pattern, triclosan coated polydioxanone, size 1, 36mm 1 / 2 circle taper point needle, 45 cm , black braided silk eyeless needled suture usp, size 8 0 suture length76cm, needlelength & description 3 / 8 circle round bodied 30mm , black braided silk eyeless needled suture usp, code 5036 size 2 0 suture length in cm 76cm, needle length & description 3 / 8 circlereverse cutting 45mm , black braided silk eyeless needled suture usp, code 5082 size 4 0 suture length76cm, needlelength & description 3 / 8 circle round bodied 16mm , black braided silk eyeless needled suture usp, code 5333 size 2 0 suture length 76cm, needle length & description 1 / 2 circle round bodied 30mm , blackbraided silk eyeless needled suture usp, size 5 0 suturelength 76cm, needlelength & description 1 / 2 circle round bodied 30mm , blackbraided silk eyeless needled suture usp, size 6 0 suturelength 76cm, needlelength & description 1 / 2 circle round bodied 30mm , blackbraided silk eyeless needled suture usp, code 5049 size 4 0 suturelength 76cm, needlelength & description 1 / 2 circle round bodied 16mm , blackbraided silk eyeless needled suture usp, code 5070 size 3 0 suturelength 76cm, needlelength & description 1 / 2 circle round bodied 25mm , blackbraided silk eyeless needled suture usp, code 5087 size 3 0 suture length76cm, needle length & description 1 / 2 circle round bodied 20mm , blackbraided silk eyeless needled suture usp, code 5334 size 1 0 suturelength 76cm, needlelength & description 1 / 2 circle round bodied 30mm , bovine collagen and glycosaminoglycan ( chondroitin 6 sulfate ) and silicone layer ( bilayer ) dermal regeneration template 2 in x 2 in , bovine collagen and glycosaminoglycan ( chondroitin 6 sulfate ) and silicone layer ( bilayer ) dermal regeneration template 4 in x 10 in , bovine collagen and glycosaminoglycan ( chondroitin 6 sulfate ) and silicone layer ( bilayer ) dermal regeneration template 4 in x 5 in , bovine collagen and glycosaminoglycan ( chondroitin 6 sulfate ) and silicone layer ( bilayer mashed ) mashed dermal regeneration template 2 in x 2 in , bovine collagen and glycosaminoglycan ( chondroitin 6 sulfate ) and silicone layer ( bilayer mashed ) mashed dermal regeneration template 4 in x 10 in , bovine collagen and glycosaminoglycan ( chondroitin 6 sulfate ) and silicone layer ( bilayer mashed ) mashed dermal regeneration template 4 in x 5 in , braided synthetic absorbable eyeless needled suture usp code 2423, size 1 0 suture ( os ) , braided synthetic absorbable eyeless needled suture uspbraided ab. suture 6 0 rc 1 / 4 circle 45cm needle 8 mm , braided synthetic absorbable polyglactin 910 eyeless needled suture size6 0 round body needle , braided synthetic absorbable polyglactin 910 eyeless needled suture usp code 2341, size 2 0 suture length in 70cm 1 / 2 circle round bodied 30mm , braided synthetic absorbable polyglactin 910 eyeless needled suture usp code 2346, size 1 0 suture length in 90cm 1 / 2 circle40mm heave , braided synthetic absorbable polyglactin 910 eyeless needled suture usp code 2347, size 1 suture length in 90cm 1 / 2 circle40mm heave , braided synthetic absorbable polyglactin 910 eyeless needled suture usp code 2421, size 1 suture length in 90cm 1 / 2 circle rc 40mm os needle , braided synthetic absorbable polyglactin 910 eyeless needled suture usp code 2534, size 1 0 suture 90cms, 1 / 2 circle rc 36mm, os6 needle , coated braided polyglctin 910 with triclosan coating sut. ) with 1 / 2 cir rb needle 20mm length 75cm size 3 / 0. , coated braided polyglctin 910 with triclosan coating sut. ) with 1 / 2 cir rb needle 30mm length 100cm size 2 / 0. , coated braided polyglctin 910 with triclosan coating sut. ) with 1 / 2 cir rb needle 36mm length 90cm size 3 / 0 , coated braided polyglctin 910 with triclosan coating sut. ) with 1 / 2 cir rb needle 40mm length 100cm size 1 , coated braided polyglctin 910 with triclosan coating sut. ) with 1 / 2 cir rb needle 40mm length 100cm size 1 / 0 , complete absorbable mesh fixation device with minimum strap length 7.0 mm2 point fixation to hold the mesh and device with 25 tacks only. , copolymer of glycolied and e caprolactone, 1 0 ct 1 needle and 45cm suture length unidirectional spiral. , copolymer of glycolied and e caprolactone, 2 0 ct 1 needle and 45cm suture length unidirectional spiral. , copolymer of glycolied and e caprolactone, 3 0 rb 1 needle and 20cm suture length unidirectional spiral. , copolymer of glycolied and e caprolactone, 3 0 rb 1 needle and 45cm suture length unidirectional spiral. , knotless wound closure device with unidirectional 2 0 45cm , undyed24mm3 / 8 circlereverse cutting , knotless wound closure device with unidirectional 3 0 58cm, undyed24mm3 / 8 circlereverse cutting , macro porus partially absorbable mesh made up of approximately equal parts of polypropylene monofilament fiber ( 6 0 ) and poliglecaprone 25 monofilament fiber ( 5 0 ) with pore size 2.7 mm having a weight of 39 g / m2 and containing blue orientation stripes of polypropylene.15cmx15cm , monofilament glycomer0, 90cm, violet40mm1 / 2 circletaper point , monofilament glycomer1 , 90cm, violet40mm1 / 2 circletaper point , monofilament glycomer2 0 , 75cm, violet27mm1 / 2 circletaper point , monofilament glycomer3 0 75cm, undyed24mm3 / 8 circlereverse cutting , monofilament glycomer3 0 75cm, violet22mm1 / 2 circletaper point , non absorbable pre shaped polypropylene mesh large size , non absorbable pre shaped polypropylene mesh medium size , non absorbable pre shaped polypropylene mesh small size , oxidized regenerated cellulose ( absorbable hemostat fibrillar ) 1 in x 2 in ( 2.5cm x 5.1cm ) , oxidized regenerated cellulose based topical absorbable hemostar thicker weave 4x8 , oxidized regenerated cellulose based topical absorbable hemostat, fibrillar / layer form, with bactericidal property. fibril material ( 7layers ) for broad surface area coverage. size 2x4 inch , oxidized regenerated cellulose based topical absorbable hemostat, structured non wovenmaterial, with bactericidal property. ease of use in both open and minimally invasive procedures. size 2x4 inch , oxidized regenerated cellulose based topical absorbable hemostat, structured non wovenmaterial, with bactericidal property. ease of use in both open and minimally invasive procedures. size 4x4 inch , oxldlzed regenerated cellulose; rayon fiberas per us phrmcopela standards enforceable by us fda with bactericidal property 2x3 , oxldlzed regenerated cellulose; rayon fiber as per us phrmcopela standards enforceable by us fda with bactericidal property 3x4 , patient return electrode with current limiting nature & hence eliminate patient pad site burns based on capacitive coupling principle & made of akton polymer can be used for all patient’s weight >350 grams, radiolucent & latex free, no adhesive related irritation to patient skin.can be used any side up for easy handling in or andus fda approved compatible to any electrosurgical generator, size: 36” l x 20”w x 1 / 8”thickness. , pistol grip curved coagulating shears with ergonomic handle in the following shaft length 36cm. can seal blood vessel up to and including 5mm in diameter compatible with ultrasonic vessel sealing dissector system , poliglecaprone 25 undyed 3 0, 3 / 8 circle reverse cutting26mm 70cm. , polyamide black size 10 / 0 3 / 8 circle spachula needle 6mm , polyamide black size 8 / 0 3 / 8 circle revers cutting needl 6mm , polydioxanone122cm , no 1 size loop sgle with 65 mm needle and 1 / 2 circle tp needle. , polydioxanone150cm usp1 0 rb ctx, 1 / 2 circle, 48mm , polyester suture no. 2 x 100 45mm hc tc , polyester suture no. 5 x 75 55mm hc tc , polyglactin 910 1 x 100 45mm hc rb , polyglactin 910 fast und 0 x 110 40mm hc rb , polyglactin 910 fast und 2 0 x 100 36mm hc rb , polyglactin 910 with triclosan no. 0 x 90 36mm hc rb , polyglactin 910 with triclosan no. 0 x 90 40mm hc rb , polyglactin 910 with triclosan no. 1 x 100 55mm hc rb , polyglactin 910 with triclosan no. 1 x 90 36mm hc tc , polyglactin 910 with triclosan no. 1 x 90 40mm hc rb , polyglactin 910 with triclosan no. 1 x 90 40mm hc rc , polyglactin 910 with triclosan no. 2 x 90 40mm hc rb , polyglactin 910 with triclosan no. 2 x 90 40mm hc rc , polyglactin 910 with triclosan no. 2 0 x 90 30mm hc rb , polyglactin 910 with triclosan no. 2 0 x 90 40mm hc rb , polyglactin 910 with triclosan no. 3 0 x 90 20mm hc rb , polyglactin 910 with triclosan no. 3 0 x 90 36mm hc tc , polyglactin 910 with triclosan no. 4 0 x 70 20mm hc rb , polyglactin 910 with triclosan no. 5 0 x 45 16mm hc rb , polyglactin 910 with triclosan no.1 0x 90 36mm hc rc , polyglactin 910 with triclosan no.1 0x 90 40mm hc rb , polyglactin 910 with triclosan no.1 0x 90 40mm hc tc , polyglycolic acid no. 1 x 180 50 / 40mm cu rb hc tc dn , polypropylene 6 0x60 10mm hcrb dntp3 , polypropylene 7 0x60 09mm hcrb dntp3 , polyster braided1 / 2 circle tapercut double needle with 17 mm needle and suture lenght 90cm , protective disk with chg hydrophilic polyurethane absorptive foam with 92 g chlorhexidine gluconate ( chg ) 1 disk ( 2.5 cm ) 4.0 mm center hole with radial slit usfda approved , protective disk with chg hydrophilic polyurethane absorptive foam with 92 g chlorhexidine gluconate ( chg ) 1 disk ( 2.5 cm ) 7mm center hole with radial slit usfda approved , scissor grip curved coagulating shears with curved tapered tip for precise dissection and with 240 degree activation triggers that support multiple hand position in the following shaft length 17cm. can seal blood vessels up to & including 5mm in diameter with ultrasonic vessel sealing dissector . , self grippingpolyester / polypropylene monofilament mesh pre cut with pla grips with size 14 x 09 cm for left side , fda approved , self grippingpolyester / polypropylene monofilament mesh pre cut with pla grips with size 14 x 09 cm for right side, fda approved , self grippingpolyester / polypropylene monofilament mesh pre cut with pla grips with size 12 x 08 cm for left side, fda approved , self gripping polyester / polypropylene monofilament mesh pre cut with pla grips with size 12 x 08 cm for right side, fda approved , sterlizedabsorbable eyeless needled suture usp, code 2341, size 2 0 suture length in cm 70cm needle length & description 1 / 2 circle round bodied 30mm , sterlizedabsorbable eyeless needled suture usp, code 2345, size 2 0 suture length in cm 70cm needle length & description 1 / 2 circle round bodied 40mm , sterlizedabsorbableeyeless needled suture usp, code 2304, size 4 0 suture length in cm 70cm needle length & description 1 / 2 circle round bodied 20mm , sterlizedabsorbableeyeless needled suture usp, code 2317, size 2 0 suture length in cm 90cm needle length & description 1 / 2 circle round 30mm , sterlizedabsorbableeyeless needled suture usp, code 2437, size 3 0 suture length in cm 70cm needle length & description 1 / 2 circle round bodied 20mm , sterlizedabsorbable polyglycolic acid eyeless needled suture usp, code 2303, size 5 0 suture length in cm 45cm needle length & description 1 / 2 circle round bodied 16mm , sterlizedabsorbable polyglycolic acid eyeless needled suture usp, code 2442, size 5 0 suture length in cm 45cm needle length & description 3 / 8 circle cutting 16mm , sterlized monofilament polyamide eyeless needled suture usp, code 3317, size 5 0 suture length in cm 70cm needle length & description 3 / 8 circle reverse cutting cutting 12mm , sterlized monofilament polyamide eyeless needled suture usp, code 3318, size 4 0 suture length in cm 70cm needle length & description 3 / 8 circlecutting cutting 16mm , sterlized monofilament polyamide eyeless needled suture usp, code 3328, size 3 0 suture length in cm 70cm needle length & description 3 / 8 circlereverse cutting cutting 26mm , sterlized monofilament polyamide eyeless needled suture usp, code 3336, size 2 0 suture length in cm 70cm needle length & description 3 / 8 circlereverse cutting cutting 45mm , sterlized monofilament polyamide eyeless needled suture usp, code 3347, size 1 suture length in cm 100cm needle length & description 1 / 2 circleround bodied 40mm heavy , sterlized monofilament polyamide eyeless needled suture usp, code 7003, size 10 0 suture length in cm 30cm needle length & description 3 / 8 circledouble arm 6mm heavy , sterlized monofilament polyamide eyeless needled suture uspsize 6 0 suture length in cm 70cm needle length & description 3 / 8 circle reverse cutting cutting 12mm , sterlized monofilament polypropyleneeyeless needled suture usp, code 829, size 6 0 suture length in cm 70cm needle length & description 3 / 8 circle round bodied 13mm double armed. , sterlized monofilament polypropyleneeyeless needled suture usp, code 841, size 2 0 suture length in cm 70cm needle length & description 1 / 2 circle round bodied 30mm , sterlized monofilament polypropyleneeyeless needled suture usp, code 842, size 1 0 suture length in cm 70cm needle length & description 1 / 2 circle round bodied 30mm , sterlized monofilament polypropylene eyeless needled suture usp, code 823, size 6 0 suture length in cm 70cm needle length & description 3 / 8 circle slim blade cutting 15mm. , sterlized monofilament polypropylene eyeless needled suture usp, code 843, size 1 suture length in cm 70cm needle length & description 1 / 2 circle round bodied 40mm heavy , sterlized monofilament polypropylene eyeless needled suture usp, code 849, size 4 0 suture length in cm 70cm needle length & description 1 / 2 circle round bodied 16mm , sterlized monofilament polypropylene eyeless needled suture usp, code 870, size 4 0 suture length in cm 70cm needle length & description 3 / 8 circle cutting 16mm , sterlized monofilament polypropylene eyeless needled suture usp, code 881, size 5 0 suture length in cm 70cm needle length & description 3 / 8 circle round bodied 16mm. , sterlized monofilament polypropylene eyeless needled suture usp, code 882, size 5 0 suture length in cm 70cm needle length & description 3 / 8 circle round bodied 16mm.double 16mm armed , sterlized surgical chromic gutsutue eyeless needied usp, code 4201, size3 / 0, suture length in cm 76cm, needle length & description 3 / 8 circle cutting 22mm. , sterlized surgical chromic gutsutue eyeless needied usp, code 4216, size2 / 0, suture length in cm 76cm, needle length & description 3 / 8 circle round bodied 30mm. , sterlized surgical chromic gutsutue eyeless needied usp, code 4217, size1 / 0, suture length in cm 76cm, needle length & description 3 / 8 circle round bodied 30mm. , sterlized surgical chromic gutsutue eyeless needied usp, code 4221, size1 / 0, suture length in cm 76cm, needle length & description 3 / 8 circle round bodied 40mm. , sterlized surgical chromic gutsutue eyeless needied usp, code 4227, size 1, suture length in cm 100cm needle length & descriptio 1 / 2 circle round bodied 45mm heavy. , sterlized surgical chromic gutsutue eyeless needied usp, code 4237, size3 / 0, suture length in cm 76cm, needle length & description 1 / 2 circle round bodied 20mm. , sterlized surgical chromic gutsutue eyeless needied usp, code 4259, size1, suture length in cm 76cm, needle length & description 1 / 2 circle round bodied 40mm heavy. , sterlized surgical chromic gutsutue eyeless needied usp, code 4268, size5 / 0, suture length in cm 76cm, needle length & description 3 / 8 circle reverse cutting 12mm. , surgical silk bradedsterile foilover wrappack code 213 size 2 0 suture length in 2 x 75cm , surgical silk bradedsterile foilover wrappack code 214 size 1 0 suture length in 2 x 75cm , surgical silk bradedsterile foilover wrappack code 215 size 1 suture length in 2 x 75cm , suture dyed polyester poly ( p dioxxanone ) 1 0, 24x4cm, 1 / 2 circle 36mm rb 20 anchors / inch bidirctional. , synthetic absorbable surgical suturetriclosancoated violet monofilament polydioxanone suture with 70 cm size 2 0 with 1 / 2 circle taper point sh, 25mm to 26 mm needle usfda approved , synthetic absorbable surgical suture , polyglactin 910 with triclosancoated undyed 2 0, 1 / 2 circle round body taper point ct 1 36 mm , 90 cm undyed , synthetic absorbable surgical suture , polyglactin 910 with triclosancoated, undyed 3 0, 3 / 8 circle cutting ps1 prime, multi pass ethalloy, 24 mm, 70 cm undyed , synthetic absorbable surgical suture triclosancoated monofilament poliglecaprone 25 suture, length 70 cm, size 2 0 with 3 / 8 circle oval round body visi black jb needle 26 mm , synthetic absorbable surgical suture triclosancoated violet monofilament polydioxanone suture with 90 cm size 1 with 1 / 2 circle taper point ct 1 40 mm needle usfda approved , synthetic absorbable surgical suture, polyglactin 910 with triclosancoated undyed1, 1 / 2 circle round body taper point ct 1 36mm, 90cm undyed. , transducer with unlimited counts compatible with ultrasonic vessel sealing dissector system , triclosan antibacterial coated polyglactin with 23 mm needle suture length 70cm, reverse cutting portt heavy needle size 1 no. , v shape clip applicators large , v shape clip applicators medium , v shape clip applicators medium large , v shape clip applicators small , v shape ligation clip large , v shape ligation clip medium , v shape ligation clip medium large , v shape ligation clip small , ada kit , aluminium ammonium sulphate powder 500gm , ana test kit , anti a lactin 05ml , anti ab sera 10ml , anti d igg+ igm 10ml , anti d igm 10ml , anti hlactin 05ml , anti human globulin ( ahg ) 05ml , anti a sera 10 ml , anti b sera 10 ml , banded use in blood bank , benedict reagent5 lit cane , blotting paper sheet , blue tip 2ml , bovine albumin 22%05ml , buffer solution for hiv 50ml , ca 125 , calcium chloride 05ml / vail , capillary tube , couplin jar , cover slips size 18x18mm , cover slips size 22x22mm , cyto fix spray , dengue card test , dpx mount 250ml , ehlrich aldehyde reagent 125 , fouchet reagent 250ml , haematoxylene 5gm , hbsag elisa test kit 4th generation 96 test , hbsag rapid test kit50 test , hbv elisa test kit 4th generation96 test , hbv rapid test kit , hcv elisa test kit 4th generation 96 test , hcv rapid test kit , hiv elisa test kit 4th generation 96 test , hiv rapid test kit , i.d. microtyping abd card , i.d. microtyping gel card ahg , immersion oil , iso propyl alcohol , leucoreductionfilter ( bed side ) , liss diluent for gel card , malaria parasite elisa test kit , mercuri oxide 25gm , methanol 2.5lit , mgg 480ml , malaria parasite antigen test kit rapid , n / 10 hcl 500ml , pandys reagent 125ml , papanicalou ea 125ml pea 030 , papanicalou og 6 125ml pea 010 , paraffin wax 58 60c , pasture pipette , polythene gloves , retic stain 125ml , slide tray , steel cassets for tissue processing , sulpho salicylic acid 500ml , tissue paper roll , vdrl elisa test kit , vdrl rapid test kit , rpr test kit , wafers cutting blade for tube welders , xylene , yellow gel tube vaccum blood collection tube , yellow tip plastic , massons trichrome stain , acetone detection kit , acetic acid solution 3%100ml , barium chloride 10 %500 ml , glacial acetic acid 100 ml , glucose kit god / pod , h2so4 25 % 500 ml bottle , leishman stain 500 ml , sharp collection containers disposable 1.5 ltrs , sharp collection containers disposable5 ltrs , total protein kits 100 ml , field stain a 500 ml , field stain b 500 ml , multi parameter urine strips ( 100 in 1 box ) , bismark brown stain 100 gm , light green stain 100 gm , disposable microtome blade ( 50 blades in one ) , csf protein kit , filter paper 12.5 cm 0.1 micron ( 50 per pkt ) , tips for auto pippets ( 2 to 100 micron yellow 1000 / pkt ) , tips for auto pippets ( 200 to 1000 micron blue 500 / pkt ) , sugar albumin urin stics ( bi parameter ) , sulpgar powder 500 gm , liquid ammonia 500 ml , nitric acid 500 ml , blotting paper 50 / pkt , pas stain , blood culture media aerobic for adult ( bac t / alert pf plus , blood culture media anaerobic for pediatric ( bac t / alert pf plus ) , ki67 / mib 1 06 ml antibody kit , glial fibrillary acidic protein ( gfap ) , s 100 , ae 1 / ae 3 , ema , nfp , synaptophysin , estrogen receptor epi monoclonal , progestron receptor monoclonal , anti her / erbb2 monoclonal , myogenin , sma , cd34 , bcl 2 , cyclin d 1 , cox 2 , p 53 , nkx 3 1 , amacr , vimentin , desmin , tris buffer gr , titriplexiii pure ( edta ) , sodium chloride for analysis , tween 20 for synthesis , hydro chloride acid about 36.46% , poly l ltsin solution p8920 , pap pen , hpr polymerr kit with dab chromogen , pricking lancet , leucoreductionfilter ( lab side ) , haemoglobin strip , single donor platelet kit make haemonotics / terumo penpol ( close system ) , absorbable 2 0 endo suture cartridge 48 length , advance rf energy hand instrument of 5 mm shaft diameter for open procedures with shaft length 14 cm and should be both hand and foot activated. compatible with ultrasonic vessel sealing dissector system installed in myh , advance rf energy hand instrument of 5 mm shaft diameter for laproscopicprocedures with shaft length 35 cm and should be both hand and foot activated. compatible with ultrasonic vessel sealing dissector system installed in myh , disposable circular stapler 25 / 26mm diameter , disposable circular stapler 28 / 29mm diameter , disposable trocar 05mm , disposable trocar 10mm , disposable trocar 12mm , disposable trocar 15mm , disposable circular stapler 31mm diameter , disposable circular stapler – 32mm diameter , disposable circular stapler33mm diameter , disposable circular stapleriii rows , disposable clipapplier medium 10mm with 20 clips , disposable clip applier medium 5mm with 16 clips , disposable curved cutter stapler , disposable curved cutter stapler , disposable hemorrhoidal stapler , disposable hemorrhoidal stapler iiirows , disposable hemorrhoidal stapler with detachable anvil. , disposable linear stapler with fixed staple height 75mm 90mm size , disposable linear stapler with fixed staple height 55mm 60mm size , disposble skin stapler with pins , distal tip closure titanium ligation clip large size , distal tip closure titanium ligation clip medium size , distal tip closure titanium ligation clip small size , endoscopic cutter & stapler60mmregular length , endoscopic cutter & stapler60mmlonglength , endosuturing device 10mm with toggle lever , handpiece ( blue ) compatible with ultrasonic vessel sealing dissector system installed in myh , handpiece ( transducer ) compatible with ultrasonic vessel sealing dissectorinstalled in myh , locking clip cartridge medium / large , mesh fixation device with 15 poly ( lactide co glycolide ) absorbable tacks , mesh fixation device with 30 poly ( lactide co glycolide ) absorbable tacks , mesh fixation device with non absorbable titatinum tacks 15 , mesh fixation device with non absorbable titatinum tacks 20 , mesh fixation device with non absorbable titatinum tacks 30 , multifire clip applier long size 15 clip , multifire clip applier small size 20 clip , non absorbable 2 0 endo suture cartridge 48 length , open clip applicator 100 20cm length , open clip applicator 200 20cm length , open clip applicator 300 , open clip applicator 400 , partially absorbable mesh with absorable & semi absorbable sides 15cm x 15cm , partially absorbable mesh with absorable & semi absorbable sides 10cm x 15cm , plastic locking clip applicator medium / large , polycearbonte bladeless trocarwith reducer seal 10mm , polycearbonte bladeless trocarwith reducer seal 12mm , polycearbonte bladeless trocar with reducer seal 5mm , polyproplene with polyglecaprone 25 partially absorbable mesh 10cm x 15cm , polyproplene with polyglecaprone 25 partially absorbable mesh 7.6cm x 15cm , reload 55 60mm for medium thick tissue blue compatible with linear cutter. , reload 55 60mm for thin / vascular tissue white compatible with linear cutter. , reload 75 80mm for medium thick tissue blue compatible with linear cutter. , reload 75 80mm for thick tissue green compatible with linear cutter. , reload compatible with curved cutter , reload endoscopic cutter & stapler45mm purple , reload endoscopic cutter & stapler60mm purple , reload endoscopic cutter & staplter45mm blue , reload endoscopic cutter & staplter45mm green , reload endoscopic cutter & staplter60mm / black , reload endoscopic cutter & staplter60mm blue , reload endoscopic cutter & staplter60mm gold , reload endoscopic cutter & staplter60mm green , reload endoscopic cutter & staplter60mm white , reload forlinear cutter 55mm 60mm size green , reload forlinear cutter 75mm 80mm size blue , reload forlinear cutter 75mm 80mm size green , reload forlinear cutter 90mm 100 mm size green , reload for linear cutter 55mm 60mm size blue , reload for linear cutter 90mm 100 mm size blue , reload for linear stapler with fixed staple height 35mm 45mm size blue , reload for linear stapler with fixed staple height 35mm 45mm size green , reload for linear stapler with fixed staple height 55mm 60mm size blue , reload for linear stapler with fixed staple height 55mm 60mm size green , reusable laparoscopic clip applicator for large titanium clips with15cm 20cm length , reusable laparoscopic clip applicator for large titanium clips with non detachable jaw assembly , reusable laparoscopic clip applicator for large titanium clips. , reusable laparoscopic clip applicator for medium large titanium clips with28cm 30 cm length , reusable laparoscopic clip applicator for medium large titanium clips with non detachable jaw assembly , reusable linear cutter 55 60mm with 200 firing , reusable linear cutter 75 80mm with 200 firing , skin staple remover with plastic handle , suture locking autolock , titanium clip 100 , titanium clip 200 , titanium clip 300 , titanium clip 400 , universal reload cartridge for 55 mm / 75mm new linear cutter for tissue thickness ranging from 1 mm to 2 mm with 6 rows of staples 3 on either side of cut line, 440 grade stainless steel knife integrated in the cartridge , 88 titanium staples / 118 titanium staples. , universal stapler 55mm / 75mm new linear cutter along with staple height selector and 3d staple technology with ambidextrous firing with 6 rows of stapler height range of 1.5 mm to 2.00 m....

Directorate Of Medical Education - Madhya Pradesh

28057428 supply of injection, vi fluid, tablet, capsul, syp. solution, eye drop, ointment, cream, powder, gel, spray, inhaler 2 5 fluro uracil 250mg 10 ml amp 3 5 fluro uracil 500mg 10 ml amp 4 actinomycin 0.5 mg inj 5 acycloir 250 mg inj 6 acycloir 500 mg inj 7 acycloir 750 mg inj 8 adenosine 3 mg / ml 2 ml amp 9 ado trastuzumab emtansine 100 mg inj 10 adrenalin inj 1mg / ml 1ml amp 11 alamine 8.2gm+l glutanic acid 13.46gm 100 ml bottle i / v 12 alteplase 50mg inj 13 amidotrizoate meglumine; sodium amidotrizoate ( 76% ) dye 50 ml bottle 14 amikacin 250mg / 2 ml 2 ml vial 15 amikacin 500mg / 2 ml 2 ml vial 16 aminophylline 25 mg / ml 17 amiodarone 50 mg / ml 3 ml amp 18 amoxicillin mg + clavulanic acid mg 1.2 gm vial 19 amoxicillin 500 mg + clavulanic acid 100mg, inj 20 amphotericine ( liposomal ) 50 mg inj 21 amphotericine b 50 mg inj 22 ampicillin 500 mg vial 23 anti d. immunoglobulin ( monoclonal ) ( 150mcg / vial ) human anti d, 24 anti d. immunoglobulin ( monoclonal ) ( 300mcg / vial ) , human anti d 25 anti hemophillic factor viii 250 iu ( vial ) , vial 26 anti hemophillic factor viii 500 iu ( vial ) , vial 27 anti human thymocyte immunoglobulin 25 mg 28 anti rabies vaccine inj 29 anti scorpion venom inj <120mg total protein and >150 ld50 [ mouse ] neutralizing units / vial 30 anti snake venom ( liquid form ) 10ml ( polyvalent ) 31 artesunate 60 mg / vial 32 ascorbic acid 500mg / ml 50ml vial ( vitamin c ) inj 33 atracurium 25mg / ml 2.5ml amp 34 atropine sulphate 0.6mg / ml amp 35 azithromycin 100mg / 5ml inj 36 azithromycin 200mg / 5ml inj 37 bendamustin 100 mg vial 38 benfothiamine + folic acid + mecobalamin + pregabalin + vit b6 inj 39 benzathine penicilline 12 lac iu / vial vial 40 betamethasone sodium phosphate 4 mg / ml 1 ml amp 41 bevacizumab 100 iu vial 42 bleomycin 15 unit vial 43 bortezomib 2 .5 mg vial 44 bortezomib 2 mg / vial 45 bupivacaine hcl 0.5% 20 ml vial 46 bupivacaine hcl for spinal anaesthesia n0.5% ( heavy ) amp 4 ml amp n 47 buprenorphine hydrochloride 0.3mg base / ml 1ml amp inj 48 busulphan 60mg vial 49 butorphanol 1mg / ml 1ml amp 50 caffeine citrate 20 mg / ml 3 ml vial 51 calcium carbonate 10%10ml amp 52 calcium chloride 10% 100mg / ml 10ml vial 53 calcium gluconate 10% 10 ml vial 54 calcium leucovorin ( folinic acid ) 50 mg / vial 5 ml vial 55 carboplatin 150 mg inj vial 56 carboplatin 450 mg inj vial 57 carboprost promithamin 250 mcg / ml 1ml amp 58 carmustin 100 mg inj vial 59 carmustine ( bcnu ) 100 mg vial 60 cefaparazone with salbactum n1.5gm ( cefaparazone 1000 mg with salbactum 500 mg ) vial n 61 cefazoline 500 mg vial 62 cefepime 500 mg vial 63 cefepime 500mg +tazobactum 625 mg vial 64 cefoperazone + sulbactam 1000 mg +1000 mg vial 65 cefoperazone 1gm vial 66 cefotaxime + sulbactam 1000 mg + 500 mg vial 67 cefotaxime sodium 1 gm / vial 68 cefotaxime sodium 500mg vial 69 ceftazidime 1gm vial 70 ceftazidime 250 mg inj vial 71 ceftazidime 500mg vial 72 ceftriaxone + sulbactum 1.5gm vial 73 ceftriaxone + tazobactum inj 1.125gm vial 74 ceftriaxone 1 gm / vial 75 ceftriaxone 500 mg / vial 76 cetuximab 100mg vial 77 cetuximab 200mg / 100ml vial 78 cetuximab 50mg vial 79 chloroquine phosphate 40mg / ml 5ml amp 80 chlorpheniramine maleate vial 81 chlorpromazine ip 25mg vial 82 cisplatin 10 mg vial 83 cisplatin 50 mg vial 84 clindamycin 150 mg / ml 2 ml vial 85 clindamycin 600mg / 4ml solution for injection n150mg / ml 4ml amp n 86 clopixol acuphase 50 mg inj 87 clopixol deconate 200 mg inj 88 collistimate sod. 1iu vial 89 collistimate sod. 2iu vial 90 crystalline insulin 40 iu / 10ml regular insulin 10 ml amp 91 cyclophosphamide 200 mg / vial 92 cyclophosphamide 500 mg / vial 93 cyclophosphamide ip 1 gm vial 94 cytrabine 100 mg inj 95 dacarbazine 200 mg inj 96 dacarbazine 500 mg inj 97 dacarbazine 500 mg inj 98 daunorubicin 20 mg / vial 99 daunorubicin 50 mg / vial 100 decitabine 50mg inj 101 dexamethasone 4mg vial 102 dexamethasone 4mg / 1ml inj 103 dexmedetomidine100 mg / ml amp ( 1 ml amp ) 104 diatrizoate meglumine & diatrizoate sodium ( 37% ) vial 105 diatrizoic acid 60% amp 106 diatrizoic acid 65% amp 107 diazepam 5 mg / ml 2 ml amp 108 diazepam 2 ml amp 109 diclofenac sodium 25 mg / ml 3 ml amp 110 diclofenac sodium inj for intravenous use surfactant free 1 amp 111 dicyclomine 10mg / ml 2 ml vial 112 digoxin i.p. 0.5mg / 2 ml amp 113 diltiazem 25mg / 5ml vial 114 diphtheria antitoxin 1000 iu vial 115 dobutamine 50 mg / ml 5 ml amp 116 docetaxel 120mg inj 117 dopamine hydrochloride 40 mg / ml 5 ml amp 118 doxorubicin ( lypholozed ) 10 mg / vial 119 doxorubicin 50 mg / vial 120 drotaverin 40mg / 2ml amp 121 edavarane 60 mg inj 122 enalapril maleate inj 1.25 mg per ml 2ml vial 123 enoxaparin 40mg inj amp 124 enoxaparin 60mg inj amp 125 ephedrine 30mg / ml inj 126 epirubicin 100mg inj 127 epirubicin 50mg inj 128 erythropoetin 4 k inj 129 erythropoietin 10000iu inj 1ml pfs 130 erythropoietin 40000iu inj 1ml pfs 131 esmolol / 40mg / ml 5 ml vial 132 ethamsylate 125 mg inj 133 ethamsylate 2ml / 125mg / amp 134 etiophylline + theophylline inj 220mg / 2ml amp 135 etomidate 2 mg / ml emulsion with mct 10ml vial 136 etoposide 100 mg inj 137 fat emulsion 20% 250 ml bottle 138 fentanyl 100 microgran 2 ml amp 139 fentanyl 50 microgran 2 ml amp 140 filgrastim 300 mcg 1ml pfs 141 fluanxol depot 25 mg inj 142 fludarabin 50 mg vial 143 fluorescein 20% 5 ml amp 144 flupenthioxl 20 mg inj 145 fluphenazine 25 mg / ml 1 ml amp 146 frusemide 10mg / 2ml amp 147 g.c.s.f. 300 unit inj 148 ganciclovir 500 mg vial 149 gas gangrene antitoxin 10, 000 iu / ml 40000 iu 4ml amp 150 gatifloxacin vial 151 gemcitabine 1 gm vial 152 gemcitabine 1.4 gm vial 153 gentamycin 80mg / 2ml amp 154 glargine 100iu / 3ml amp 155 glycopyrrolate 0.2 mg / ml 1 ml amp 156 glycopyrrolate 0.5mg + neostigmine 2.5mg 5ml amp 157 haemocoagulase 1 iu ( reptilase ) botropose inj 158 haloperidol 5 mg / iv / im inj 159 haloperidol 50 mg / ml 1 ml inj 160 heparin 5000 iu ( 1000 iu / ml 5 ml vial ) 161 heparin 25000 iu ( 5000 iu / ml 5ml vial ) 162 hepatitis b vaccine / 1ml 163 hepatitis immunoglobulin 100iu vial 164 human albumin 20 % / 100ml bottle 165 hyaluronidase 1500 iu / 2ml amp 166 hydrocortisone dry powder 100 mg / vial ( hydrocortisone sodium succinate inj ) 167 hydroxy progesterone caproate 250mg / ml vial 168 hydroxypropylmethylcellulose 2% inj pre filled syringe 169 hyoscine butyl bromide / 20mg / 2ml amp 170 ifosfamide 1 gm vial 171 ifosfamide 2 gm vial 172 ifosphamide + mesna 1gm inj 173 imipenem 1g vial 174 imipenem 1gm+cilastatin sodium 500 mg vial 175 iohexol 350 mg i / ml ( non ionic contrast medium in sterile aqueous solution ) 100 ml bottle 176 irinotecan 100mg inj 177 irinotecan 40mg inj 178 iron sucrose n20 mg / ml 5 ml amp n 179 isoprenalin inj 1ml amp 180 isoxsuprine hcl 5mg / ml 2ml amp 181 iv human immunoglobulin 5% iv ig ( 5gm / 100ml bottle, injection 182 ketamine hydrochloride 50 mg / ml 10 ml 183 labetalol 20 mg ( 5mg / 1 ml 4 ml amp ) 184 l asparaginase 5000iu inj 185 levetiracetam 100mg / ml 5ml amp 186 levosulpride inj amp 187 lignocaine ( preservative free ) 2% 50 ml vial 188 lignocaine for spinal anaesthesia nlignocaine 5% + destrose 7.5% 2 ml amp heavy n 189 lignocaine hydrochloride + adrenaline n2% + 0.005 mg / ml 30 ml vial n 190 lignocaine hydrochloride 2% 21.3 mg / ml 30 ml vial 191 lignocaine / lidocaine 4%, 30 ml vial 192 liposomal doxorubicine 2mg / ml inj 193 lmwh low molecular weight heparin 40mg vial 194 lmwh low molecular weight heparin 60mg vial 195 lorazepam 2 mg / ml, 1 ml vial 196 lorazepam 2 mg / ml, 2 ml vial 197 l ornithine l aspartats 10ml inj 198 low molecular weight dextran 40000 vial 199 magnesium sulphate inj 50% w / v 10ml amp 200 meningococcal polysaccharide vaccine groupe a, c, y and w 135 combined vial 201 mephentermine 30 mg / ml 10 ml 202 meropenem 1 gm / vial 203 meropenem 500 mg / vial 204 metaclopromide 5mg / ml 2ml amp 205 methacarbamol 100 mg. / 10ml vial 206 methotrexate 15 ( preservative free ) inj 207 methotrexate 50 mg / 2 ml, 2 ml vial 208 methyl ergometrine maleate 0.2 mg / ml, 1 ml amp 209 methylcobalamine ( vitamin b12 ) 500 mcg / ml, 3 ml amp 210 methylene blue 1% 10ml inj 211 methylprednisolone 125mg vial 212 methylprednisolone 1 gm vial 213 methylprednisolone 40 mg / vial 214 methylprednisolone sodium succinate 500 mg / vial 215 metoprolol 5mg / ml 5ml vial 216 micronised progesterone 50mg / ml 2mlamp 217 micronized progesterone 200 ml vial 218 midazolam 1mg / ml, 1 ml amp 219 midazolam 1mg / ml 5ml vial 220 milrinone 1mg / ml solution for injection / infusion 221 mitomycin c 10mg / 40mg inj 222 mitoxantrone 15 mg inj 223 mixed.25 / 75 ( 25% insulin lispro+75% lispro insulin protamin ) 100iu / ml 224 mixed.30 / 70 insullin biphasic isophane 40 iu / ml 10 ml vial 225 morphine supaphate 10mg / ml 1ml amp 226 multivitamin 10 ml amp 227 nabpaclitaxel 100mg / vial 228 n acetyl cysteine inj 200mg / ml 10 ml amp 229 naloxone 0.4 mg / ml, 1 ml 230 nekethamide amp 231 neostigmine 0.5 mg / ml, 1ml amp 232 nitroglycerine ( glyceryl tri nitrate ) 25 mg / 5 ml 5 ml amp 233 noradrenaline bitartrate 2 mg base / 2 ml amp 234 octreotide 100microgram / ml solution for injection 1 ml amp 235 octreotide 50 microgram / ml solution for injection 1 ml amp 236 olanzapine 10 mg inj 237 olenzapine depot inj 238 ondansetron 2 mg / ml 2 ml amp 239 ondansetron 2 mg / ml 4 ml amp 240 oxaliplatin 100mg inj 241 oxaliplatin 50mg inj 242 oxytocin 5 iu / ml, 1 ml amp 243 paclitaxel 100mg inj 244 paclitaxel 260mg inj 245 panitumumab 100mg / 5ml inj 246 pantoprazole 40 mg / vial 247 paracetamol 150mg / ml 2ml amp 248 paracetamol 2ml amp for i / v use 249 peg gcsf 6 mcg 250 pembrolizumab 100mg / 4ml ( 25mg / ml ) 251 pemetraxed 100 mg inj 252 pemetraxed 500 mg inj 253 penicillin v 125 mg inj 254 pentazocin lactate 30mg / ml 1ml amp. 255 pentoxiphylline 20 mg / ml 256 perinorm 2ml 257 pertuzumab 30mg / ml ( 420mg / 14ml ) 258 pheniramine maleate ip 22.75 mg, 2 ml amp 259 phenobarbitone 100mg / ml 1ml amp. 260 phenobarbitone 200mg / ml 1ml amp. 261 phenytoin sodium 50mg / ml 2ml / amp 262 pilocarpine 0.5 % / 1ml amp 263 piperacillin 4 gm + tazobactum 500 mg, vial 264 piperacillin tazobactum 1.125 gm vial 265 pneumococcal vaccine 10 ml vial 266 potassium chloride inj. 150mg / 10ml amp 267 pralidoxime 20 ml vial 268 pregabalin inj 269 progesterone b.p.100mg vial 270 prolution depot 250mg inj 1ml amp 271 promethazine 2 ml / 2.5% vial 272 propofol sodium with mct / lct 1% w / v 10 mg / ml, 20 ml vial 273 protamine sulphate 1%, 10mg / 5ml amp 274 quinine sulphate 300 mg / ml, 2 ml amp 275 rabeprazole 20 mg vial 276 ranitidine 50mg / 2ml amp 277 remdesivir inj 100mg / 20ml vial 278 rituximab 100mg inj 279 rituximab 500mg inj 280 ropivacaine hydrochloride 0.2% 40mg / 20ml vial ( 2mg / ml ) 281 ropivacaine hydrochloride 0.75% 150 mg / 20 ml vial ( 7.5mg / ml ) 282 ropivacaine 10mg / ml 2.5ml vial 283 ropivacaine 0.5% 20 ml vial 284 ropivacaine 0.75% 4ml amp 285 sargramostin 500 mg inj 286 soda bicarbonate 10ml, 7.5% inj 287 sodium thiopentone inj 0.5gm powder / vial 20ml vial 288 sodium valproate 100 mg / ml, 5 ml 289 streptokinase 150000iu ( 15 lac ) amp 290 streptomycin 0.75 mg vial 291 succinyl choline 50 mg / ml, 10 ml vial 292 surfactant bovine ( 135 mg phopholipid per 5 ml / 5ml vial ) , vial 293 tecoplanin 400mg vial 294 terbutalime 0.5mg / ml aml amp 295 teriparatide 600mcg 3 ml amp 296 terlipressin 1 mg / 10 ml amp 297 tetanus immunoglobulin usp 500 iu / vial 298 tetanus toxide 0.5ml ampoule 299 thiamine hydrochloride inj.100mg / ml 2ml vial multiple dose ( vit.b1 ) 300 thiopentone sodium 0.5gm powder / vial, 20 ml vial 301 thiopentone sodium 1 gm / vial 302 tigecycline, 50 mg, vial 303 tobramycine 80 mg vial 304 tocilizumab 400 mg inj 305 torsemide inj 2ml amp 306 tramadol 50 mg / ml, 2 ml amp 307 tramadol 50 mg inj 308 tranexamic acid 100mg inj 309 tranexamic acid 500 mg / 5 ml, 5 ml amp 310 trastuzumab 440mg inj 311 triamcinolone acetate 40 mg / ml 1 ml amp 312 trypan blue opthalmic solution 0.06% pre filled syringe 313 urokinase 500000 iu vial 314 vancomycin hydrochloride 1000 mg / vial 315 vancomycin hydrochloride 500 mg / vial 316 vasopressine 40 iu / ml amp 317 vasopressine 20unit amp 318 vecuronium bromide 2 mg / ml, 2 ml amp 319 verapamil hydrochloride 2.5 mg / ml amp 320 vinblastine 10 mg / 10 ml, 10 ml 321 vincristine 1 mg / ml, 1 ml vial 322 vinorelbin 10 mg inj 323 vinorolbine 50mg inj 324 vit. cynocobalamin 500mcg +folic acid 15mg+niacinamide 200 mg + ascorbic acid inj 325 vit. cynocobalamin 500mcg +folic acid 15mg+niacinamide 200 mg inj 326 vit. methylcobalamin 1500 mcg +folic acid 0.7mg+niacinamide 12 mg inj 327 vitamin b complex inj 328 vitamin k 1ml, 10mg / ml 329 voriconazole 10 mg / ml, 200 mg / vial 330 water for injection 10 ml amp 331 zoledronic acid 4 mg / 100 ml vial 332 amino acid infusion 5 % 100 ml 333 amino acids 10% w / v in glass bottle 500ml, n 334 aminoacid ( essential ) 10% 100 ml ffs bottle 335 balanced crystalloid solution 500 ml bottle 336 ciprofloxacin 100 mg / 50 ml 100 ml ffs bottle 337 dextrose 40% 100 ml bottle 338 dextrose 5 % with normal saline 0.45% n500 ml glass bottel with rubber cork n 339 dextrose saline ( dns ) n5% + 0.9% 500 ml ffs bottle n 340 dextrose, 25% 100 ml ffs bottle 341 dextrose, d 10 10% 500 ml ffs bottle 342 dextrose, d 5, 5% 500 ml ffs bottle 343 dextrose, d 50 50% 100 ml ffs bottle 344 electrolyte m ( multi electrolyte with 5% dextrose iv injection ntype iii ip ) , type iii ip 500 ml ffs bottle n 345 electrolyte p ( multiple electrolytes & dextrose injection type i ip ) ntype i ip 500 ml ffs bottle n 346 fat emulsion 20% 0.2 ( 250 ) ml 347 fluconazole 100ml bottle. 2mg / ml. 348 glutamine dipeptide 100ml bottle 349 glycine irrigation solution ip 3000 ml bottle 350 hydroxyethylstarch 6% solution with sodium chloride 0.9% iv infusion 500 ml ffs bottle 351 levofloxacin 500 mg / 100 ml 100 ml ffs bottle 352 linezolid 200 mg / 100ml 300 ml bottle 353 mannitol 20%100 ml ffs bottle 354 mannitol 20% 350ml 355 metronidazole 500 mg / 100 ml 100 ml ffs bottle 356 normal saline 0.9% 100 ml ffs bottle 357 normal saline 0.9% 3 ltrs bottle 358 normal saline 0.9% 500 ml ffs bottle 359 normal saline 1.6% 500 ml bottle 360 normal saline 3% 100 ml ffs bottle 361 normal saline glass bottle 100ml 362 normal saline glass bottle 500ml 363 ofloxacin 100 ml / 200mg bottle 364 omega 3 fatty acid 100 ml bottle 365 paracetamol 1000 mg 100 ml ffs bottle 366 ringer lactate i / v 0.24 % v / v of lactic acid ( eq. to0.32% w / v of sodium lactate ) , 0.6 % w / v sodium chloride, 0.04 %w / v potassium chloride and 0.027 % w / v calcium chloride 500 ml ffs bottle n 367 ringer lactate i / v 0.24 % v / v of lactic acid ( eq. to0.32% w / v of sodium lactate ) , 0.6 % w / v sodium chloride, 0.04 %w / v potassium chloride and 0.027 % w / v calcium chloride 500 ml glass bottle n 368 sodium chloride hyper tonic n / 2 ( 0.45% ) 500 ml ffs bottle 369 sodium chloride ( 1 / 2 n ) + dextrose n0.45% + 5% 500 ml ffs bottle n 370 total parenteral nutrition 1000 ml with 763 kcal n dextrose 15% w / v, amino acids 10% w / v with electrolytes & intravenous fat emultion triglycerides 20% w / v ) ( all in one in three chamber bag ) , 1000ml n 371 tpn ( total parenteral nutrition ) including carbohydrate + proteins + fats solution ) 15% dextrose 10% amino acids 2000 ml 372 budesonide respules 0.5mg 373 desflurane 240ml bottle 374 formeterol + budesonide 120 mdi respules 375 ipratropium bromide 250 mcg / ml amp 376 ipratropium bromide 40 mcg + levosalbutamol 200 mcg respules 377 isofluran 250 ml bottle 378 salbutamol nebuliser solution bp sabutamol sulphate eq. to salbutamol 1mg per ml ( 2.5 ml amp ) , ampule 379 salmeterol 25 mcg + fluticasone 250 mcg 120 mdi 380 sevoflorane 250ml. 381 6 mercaptopurine , 50mg 382 acamprosate, 333 mg 383 aceclofenac 100mg tablet 384 aceclofenac 100mg+paracetamol 325mg , tablet 385 aceclofenac 100mg+paracetamol 325mg + chlorzoxazone 250mg tab ( ) , tablet 386 aceclofenac 100mg+paracetamol 325mg + serratiopeptidase 10mg tab ( ) , tablet 387 aceclofenac 100mg+paracetamol 500mg , tablet 388 acenocoumaro / nicoumalone 2 mg tab 389 acetazolamide 250 mg tab ( dimox ) 390 acyclovir 400 mg 391 acyclovir 800 mg 392 afatinib 40 mg 393 agomelantine 025 mg tab 394 albendazole 400 mg 395 albendazole 400 mg + ivermectin 6 mg tab 396 alendronate 70 mg 397 alfuzocin hcl 10mg 398 alfuzosin 10mg+dutasteride 0.5 mg 399 allopurinol 100 mg 400 alprazolam 0.25 mg 401 amiodarone 200 mg 402 amisulpride 100 mg 403 amisulpride 200 mg 404 amisulpride 50 mg 405 amitriptyline 25 mg 406 amitriptyline 50 mg 407 amitriptyline 75 mg 408 amlodipine 2.5 mg 409 amlodipine 5 mg 410 amlodipne 10 mg tab 411 amolodipine 5mg +atenolol 50mg 412 anastrozole 1mg 413 aripiprazole 10 mg 414 aripiprazole 15 mg 415 aripiprazole 30 mg 416 artesunate 50 mg+sulphadoxine 500 mg+pyrimethamine 25 mg tab 417 aspirin 150 mg 418 aspirin 75 mg 419 atenolol 25 mg tab 420 atenolol 50 mg 421 atiomoxetin 10 mg tab 422 atiomoxetin 25 mg tab 423 atorvastatin 10 mg 424 atorvastatin 20 mg 425 atorvastatin 40 mg 426 axitinib 5mg 427 azathioprine 50 mg tab 428 azithromycin 500 mg 429 azithromycin 250 mg tab 430 azithromycin+fluconazole+secnidazole ( 1gm+150mg+1gm ) tab 431 baclofen 10 mg 432 baclofen od 20 mg 433 baclofen od 30 mg 434 baclofen od 40 mg 435 betahistine 16 mg tab 436 betahistine 8 mg tab 437 betamethasone 0.5 mg 438 bicalutamide 50 mg 439 bisacodyl 5 mg 440 blonameserire 2 mg 441 blonameserire 4 mg 442 buprinoprhin 4mg 443 buprinoprhin 8 mg 444 bupropion 150 mg 445 buspirone 10 mg 446 buspirone 5 mg 447 cabargolin 0.25 mg 448 calcium acetate 667 mg tab 449 calcium carbonate tab 450 calcium d3 / 500mg 451 calithromycin 250 mg 452 capecitabine 500mg 453 carbamazepine 200 mg 454 carbamazepine sr 100 mg 455 carbamazepine sr 200 mg 456 carbamazepine sr 400 mg 457 carbimazole 5mg 458 carvedilol 6.5 mg. 459 carvedilol 3.125 mg tab 460 cefixim 200 mg + clavulanic acid 125 mg 461 cefixime 100 mg 462 cefixime 200 mg 463 cefodoxime 200mg tab 464 cefpodoxime 50 mg 465 cefuroxime 500 mg 466 cetirizine 10 mg 467 chlordizepoxide 10mg 468 chlordizepoxide 25mg 469 chloroquine phosphatetab. 250 mg 470 chlorpheniramine maleate tab 4 mg 471 chlorpromazine 50mg 472 chlorpromazine 100 mg 473 chlorthalidon 50 mg tab 474 chymotrypsin & trypsin tab 475 cinnarizine 25 mg tab 476 cinnarizine tab. 5mg 477 ciprofloxacin 500 mg 478 clindamycin 600mg 479 clobazam 10 mg 480 clobazam 5 mg 481 cloimipramine 50mg 482 clonazepam 0.25 mg tab 483 clonazepam 0.5 mg tab 484 clonazepam 1 mg 485 clonazepam 2 mg 486 clonidine 100 mcg 487 clonidine 100 mg tab 488 clopidogrel 75 mg 489 clopidogrel aspirin 490 clotrimazole vaginal 500mg tab 491 clozapine 100 mg 492 clozapine 25 mg 493 clozapine 50 mg 494 crizotinib 250mg 495 cyclophosphamide 50 mg tab 496 deferasirox dispersible 500 mg tab 497 dexamethasone 4 mg tab 498 diazepam 10 mg 499 diazepam 5 mg 500 diclofenac 50mg + paracetamol 325mg + serratuioeotudase 10mg tab 501 diclofenac 50mg + paracitamole 500mg 502 diclofenac 50mg + serrtiopeptidase 503 diclofenac sodium 50 mg 504 dicyclomine tab 10 mg. 505 digoxin 0.25 mg 506 diltiazem 30mg 507 diphenylhydramine 50 mg 508 disulfiram 250 mg 509 divalproex sodium 250 mg 510 domperidone 10 mg tab 511 domperidone+ranitidine 150mg tab 512 donepezil 10 mg 513 donepezil 5 mg 514 dosatinib 100mg / 50 mg 515 doxophylline 400 mg 516 dudrogesterone 10mg 517 duloxetine 20 mg tab 518 duloxetine 30 mg tab 519 enalapril maleate 2.5 mg 520 enalapril maleate 5 mg 521 erlotinib 100mg 522 erlotinib 150mg 523 escitalopram 10 mg 524 escitalopram 20 mg 525 escitalopram 5 mg 526 ethamsylate 500 mg 527 etizolam 0.5mg 528 etophylline 77 mg+ theophyllin 23 mg 529 etoposide 50 mg 530 everolimus 2.5mg / 5mg / 10mg 531 famutaz 40 mg 532 ferrous ascorbate 100 mg tab ( elemental iron +folic acid 1.5 mg tab 533 ferrous sulphate tab. 200mg ( equivalent to 60mg elemental iron ) 534 flavoxate hcl 200mg 535 flebuxostat 40mg 536 fluconazole 150 mg 537 fludrocortisone 0.1mg tab 538 flunarizine 10 mg 539 flunarizine 5 mg 540 fluoxetine 40 mg 541 fluvoxamine 50 mg 542 folic acid 5 mg 543 frusemide 40 mg 544 gabapentin 300 mg. 545 gabapentine 100 mg 546 gefitinib 250mg 547 glibenclamide 2.5mg tab 548 glibenclamide 5mg tab 549 gliclazide 80 mg 550 glimeperide 2 mg 551 glimeperide 1 mg 552 glimipride 1mg+metformine 500mg 553 glyceryl trinitrate 0.5 mg sublingual tab 554 haloperidol 1.5 mg 555 haloperidol 10 mg 556 haloperidol 5 mg 557 hydrochlorothiazide 12.5 mg 558 hydrochlorothiazide 25 mg 559 hydrocortisone 10 mg 560 hydroxychloroquine sulphate 400 mg 561 hydroxychloroquine ( 200 mg ) , tablet 562 hyoscine butylbromide tab 10mg 563 ibuprofen 400 mg 564 ibuprofen 400 mg + paracetamol 325 mg 565 imatinib 100mg 566 imatinib 400 mg 567 imipramine hcl 25 mg 568 imipramine hcl 75 mg 569 iron folic acid tab ferous sulphate dessicated ip 333 335mg equivalent to 100mg of elemental iron +folic acid ip 0.5mg tab ferrous sulphate of elemental iron +folic acid ip 0.5tab ferrous sulphate dessicated ip mg equivalent to 20mg 570 iso sorbitrate dinitrate sublingual 5mg 571 isosorbide 5 mononitrate 20 mg 572 ivermectin 12 mg 573 labetalol 100mg 574 lacosamide 50 mg tab 575 lactobacillus tab 60 million spores 576 lamotrigine 100 mg 577 lamotrigine dt 50 mg tab 578 lapatinib 250 mg 579 lenalidomide 10 mg 580 lenalidomide 10mg / 25mg 581 letrozole 2.5mg 582 levetiracetam 250 mg 583 levetiracetam 500 mg 584 levocetirizine 5mg tab 585 levocetirizine 5mg+ monteleukast 10 mg tab 586 levodopa + carbidopa 100+10mg 587 levofloxacin tab 500mg 588 linezolid 600mg 589 lithium carbonate 300 mg 590 lithium carbonate 400 mg 591 lorazepam 1 mg 592 lorazepam 2mg tab 593 lorcaserine 10 mg tab 594 losartan 50 mg tab 595 losartan 50 mg+hydroclorothiazide 12.5 mg tab 596 mag. oxide 200 mg 597 mebendazole 100 mg tab 598 mefenamic acid + dicyclomine tab ( 250 mg + 10 mg ) , tablet 599 mefenamic acid + drotaverine hcl tab ( 250 mg + 80 mg ) , tablet 600 megestrol acetate 40mg 601 memantine 10 mg 602 mesalamine ( 5 aminosalicylic acid ) 400 mg tab 603 metformin 500 mg 604 metformine 500 mg + glimipride 2 mg tab 605 metformine 500 mg+ gliclazide 80 mg tab 606 metformine 500 mg+glibenclamide 5 mg tab 607 methimazole 10 mcg tab 608 methocarbamol 500 mg. 609 methotrexate 10 mg 610 methotrexate 2.5 mg 611 methotrexate 7.5 mg 612 methyephendate 10 mg 613 methyephendate 20 mg 614 methyephendate 5 mg 615 methyl prednisolone 16 mg 616 methyl prednisolone 4 mg tab 617 methyl prednisolone 8 mg tab 618 methylcobalamin 500 mcg 619 methylcobalamin 1500 mcg+alpha lipoic acid 100 mg+folic acid1.5 mcg thiamine mononitrate 10 mg ( pyridoxine hcl 3 mg ) cap. 620 methyldopa 250 mg tab 621 metoclopramide 05 mg 622 metoclopramide 10 mg 623 metolazone 5 mg 624 metoprolol tab 50 mg 625 metronidazol 400mg 626 mifepristone 200mg ( 1 tab ) +misoprostol 200mcg ( 4 tab ) ( combipack ) , tab. mtp kit 627 mirtazapine 15 mg 628 mirtazapine 30 mg 629 mirtazapine 7.5 mg 630 misoprostol 200 mg 631 modafinil 100 mg tab 632 morphine 10 633 multivitamin tab nfi formula sugar coated vit a 2500 iu, vit b12 , vit b 6, 0.5 mg, vit c 50mg vit d3 200iu, niacinamide 25mg folic acid 0.2mg ( with approximateoverages ) 634 mycophenolate mofetil, 500 mg 635 n acetylcysteline 600 mg 636 naltrexone, 50 mg 637 nicorandil 5 mg tab 638 nifedepine 10mg 639 nifedepine r 20mg 640 nilotinib 200mg 641 nitazoxnide 200 mg 642 nitrofurantoin ip , 100 mg 643 norfloxacin 400 mg 644 norfloxacine 400 mg + tinidazole 600 mg 645 ofloxacin 200mg +tinidazole 600mg tab 646 olanzapine 5 mg 647 olanzapine 10 mg 648 olanzapine 2.5 mg 649 olanzapine 20 mg 650 olanzapine 7.5 mg 651 olmesartan 40mg 652 ondansetron 4 mg 653 ondansetron 8mg 654 orlistate 120 mg tab 655 orlistate 60 mg tab 656 ornidazole 500 mg 657 oxcarbazapine 300mg tab 658 oxcarbazapine 600mg tab 659 oxcarbazepine 150 mg 660 pacitane 2mg tab 661 palbociclib 100 mg 662 palbociclib 125 mg 663 palbociclib 75 mg 664 paliperidone 1.5 mg 665 paliperidone 3 mg 666 pantoprazole 40 mg 667 pantoprazole 40 mg+ domperidon 10 mg 668 paracetamol 500 mg 669 paracetamol 650mg tab 670 paroxetine cr 12.5 mg 671 pazopanib 200mg / 400mg 672 penicillin v 250 mg tab ( phenoxymethyl penicillin potassium ) 673 pentoxifylline 400mg 674 phenobarbitone 30 mg. 675 phenobarbitone 60 mg. 676 phenytoin sodium 100 mg 677 piogliatazone 15 mg tab 678 piogliatazone 30 mg tab 679 piracetam 400 mg 680 piracetam 800 mg 681 prazosin 5 mg 682 prednisolone 10 mg 683 prednisolone 5 mg 684 pregabalin 75 mg tab 685 primaquine 7.5 mg 686 primaquine 15 mg tab 687 procyclidine 5 mg 688 promethazine 2 5 mg 689 propranolol la 40 mg 690 propranolol 10 mg 691 propranolol 20 mg 692 propylthiouracil 693 pyridoxine 40 mg tab 694 quetiapine 100 mg 695 quetiapine 200 mg 696 quetiapine 50 mg 697 quinine sulphate 300 mg 698 rabeprazole 20 mg tab 699 racecadotril 100mg 700 ramipril 2.5 mg tab 701 ramipril 5 mg tab 702 ranitidine 150 mg tab 703 resperidon 0.5mg 704 resperidon 2 mg 705 resperidon 4 mg 706 rivaroxaban 20 mg tab 707 rosuvastatin. 10 mg 708 sacubtril plus valsartan 709 secnidazole 500 mg tab 710 sertraline 100 mg 711 sertraline 50 mg 712 sildenafil 50 mg tab 713 sitagliptin 100 mg tab 714 sitagliptin 50 mg tab 715 sodium valporate 300 mg 716 sodium valproate 200 mg 717 sodium valproate 500 mg 718 sorafinib 200mg 719 spironolactone 100 mg tab 720 spironolactone 25 mg 721 spironolactone+frusemide 20mg +50mg 722 sulfamethoxazole and trimethoprim ( 100mg+ 20mg ) tab 723 sulfamethoxazole and trimethoprim ( 800mg+ 160mg ) tab 724 sunitinib 50 mg 725 tadalafil 10 mg 726 tamoxifen 10 mg 727 tamoxifen 20mg 728 tamsulosin 0.4mg 729 tamsulosin$dutasteride 0.4mg+0.5mg 730 telmisartan 40 mg. 731 telmisartan hydrochlorthiazide 40mg+12.5mg tab 732 terbutaline sulphate 2.5mg tab 733 tetrabenazine 20 mg tab 734 thiamine 100mg 735 thiamine 75mg 736 thyroxine sodium 100mg 737 thyroxine sodium 25 mg 738 thyroxine sodium 50mg 739 thyroxine sodium 75 mcg 740 tianeptine 12.5 mg 741 topiramate 100 mg tab 742 topiramate 25 mg 743 topiramate 50 mg 744 topotecan 1 mg 745 torasemide 10 mg 746 tramadol – 100 mg tab 747 tramadol – 50 mg 748 tranexamic acid 500 mg 749 trifluoperazine 5 mg 750 trihexyphenidyl 2 mg 751 ursodeoxycolic acid 300 mg 752 venlafaxine sr 150 mg 753 venlafaxine sr 75 mg 754 verapamil 40 mg 755 vildagliptin 50 mg +metformin 500 mg tab 756 vildagliptin 50 mg tab 757 vit b complex tab. nfi ( prophylactic ) b1 2mg, b2 2mg, b6 0.5mg, niacinamide 25mg, calciuym pantothenate 1mg ( with appropriate overges ) 758 vit d3 60000 k tab 759 vitamin c 500 mg ( ascorbic acid ) 760 voglibose 0.3 mg tab 761 voriconazole 200 mg 762 warfarin 5 mg tab 763 zinc sulphate ( dispersible ) 20 mg 764 zolpidem 10 mg tab 765 zonisamide 100 mg tab 766 zonisamide 50 mg tab 767 zyloric acid 100 mg 768 aceborophylline 100 mg 769 amoxicillin 250 mg cap 770 amoxycilline – 500 mg 771 amoxycilline + clavulanic acid 625 mg cap. 772 ampicillin 250mg+ cloxacillin 250mg 773 ampicilline – 500 mg 774 cyclosporine 100 mg 775 cyclosporine 50 mg 776 doxycycline 100 mg 777 fluoxetine bp 20 mg 778 hydroxy urea 500 mg cap. 779 imatinib mesylate 100 mg 780 itraconazole 100 mg 781 ivabradin 5mg 782 omeprazole 20 mg 783 oseltamivir ( 45mg ) , capsule 784 oseltamivir ( 75mg ) , capsule 785 pregabalin 75 mg + methylcobalamin 750 mcg 786 rifaximine 400 mg 787 temozolamide 100 mg 788 temozolamide 250 mg 789 sildenafil 20mg 790 vit. e 400 mg 791 acyclovir 3% 792 atropine sulphate 1% 5 ml vial 793 carboxymethylcellulose solu. eye drop 1% 794 carboxymethylcellulose solu. eye drop 0.5% 795 ciprofloxacin eye drop 0.3% 796 fluromethanol eye drop 797 gentamycin eye drop 798 homotropine drop 2% eye drop 799 hypersol s ( 5% ) 800 lignocaine hcl 4% eye drop 801 loteprednol eye drop 802 natamycin eye drop 803 nepafenac ophthalmic solution 804 methyl cellulose / visco elastic 805 moxifloxacin 0.5% eye drop 806 moxifloxacin +prednisolone eye drope 807 ofloxacin 0.3% 5 ml vial 808 polyethelene glycol 400 & propylene glycol ophthalmic solution 10ml 809 pilocarpine eye drops 2% 810 polyvinyle alcohol 1.4% 5 ml 811 prednisolon eye / drop. 812 proparacaine 813 sodium chloride 5% eye drop ( nacl 5% ) 814 timolol maleate 0.5% 5 ml vial 815 tobramycin 0.3% 5ml eye drop 816 tropicamide 1% 5 ml vial 817 topicamide +phenylephrine eye drop 818 olopatidine hydrochloride ophthalmic solution 0.1% 819 benzocaine 2.7 w / v + chlorbutol 5% w / v +paradichlorobenzene 2% w / v+ turpentine oil 15% w / v ear drop 820 tobramycin eye oint.3gm tube 821 acyclovir 3% eye oint.5 gm tube 822 atropine eye oint. 3gm tube 823 chloramphenicol eye ointment 5 gm tube 824 ciprofloxacin eye ointment 5 gm tube 825 hydroxypropylmethylcellulose 2% w / v ophthalmic solution ocular lubricant 5gm ointment 826 diclofenac gel 1% 30 gm 827 ecg gel 250ml bottle 828 lignocain jelly 2% 829 oxetacaine 10mg + aluminium hydroxide 291mg + milk of magnesia 98 mg per 5ml 200 ml bottle 830 prostaglandin e2 n0.5 mg 3 gm pre filled syringe n 831 ultra sonograph gel 250ml bottle 832 white petroleum jelly kg 833 acyclovir 5%, 5 gm 834 beclomethasone+ clotrimazole +neomycin sulphate cream 835 betamethasone valerate ointment 0.1%, 15 gm tube 836 betamethosome valerate cream 0.05% 15gm 837 clobetasol propionate 0.05%, 15 gm tube 838 clotrimazole 2%w / w 15 gm 839 fusidic acid 2%, 15 gm 840 human placental extract 841 mupirocin 2%, 15 gm 842 magnesium sulphate, sulphacetamide, urea, proflavin ( in glycerine base ) ointment75 gm 843 neomycin sulphate 5 mg + bacitracin zinc 500 iu / gm, 15 gm 844 papin urea 15 gm tube 845 povidone iodine 5 % w / w + metronidazole 1 % w / w, 15 gm tube 846 povidone iodine 5%, 250 gm 847 povidone iodine 7.5%, 500 gm 848 salicylic acid 2%, 30 gm 849 silver sulphadiazine cream usp 1% w / w 250gm 850 mct oil 100 ml bottle 851 lactobacillus, 150 million spores, 852 arginine sachet 10gm 853 hmf lactocex plus sachet 854 orodispersible probiotic sachet 855 ors who powder glucose anhydrous 13.5g / l, sodium chloride 2.6g / l, potassium chloride 1.5g / l, trisodium citrate 2.9g / l 856 formula milk for infants 500gm 857 potassium permegnet powder 400 gm pkt 858 neomycin sulphate powder 5gm 859 povidone iodine powder 5% 860 framycetin sulphate 1% w / w 30 gm tube 861 permethrin 5% w / v 30gm 862 permethrin 5% 60 ml lotion 863 calamini lotion 50 ml bottle 864 alcoholic handrub with triple action:50%2 propano+25%1.propanol+2.5% chx+0.5 triclosan.500 ml 865 antiseptic hospital concentrate contdaining 20% chlorohexidine soln ip 7.5% v / v cetrimide ip 15%w / v iso peopyl alchohol 6 8% 1000ml. 866 citric acid 500 ml bottle 867 compound benzointincture, benzoin, aloe, storax, tolu balsam and enough alcohol to make a tincture ( 74 80% alcohol ) , 100 ml 868 formaldehyde ( formalin ) 37% acq. 450 ml bottle 869 glutaral dehyde solution 2% w / v stabilized 5 ltr cans 870 glycerine 500ml bottle 871 glycerine enima 872 hand wash.sol . ( sol.isoprapanol, propanol, mecetronium, skin care additives ) 500 ml bottle 873 hydrogen peroxide soln 20% 500 ml bottle 874 hypo solution 5% 5 ltr 875 liquid paraffin ip 500ml bottle 876 povidone iodine ( surgical scrub ) , 7.5%, 500 ml bottle 877 povidone iodine, 5 %, 500 ml bottle 878 surface & environmental disinfectant n each 100 gm contains: 1.6 dihydroxy, 2 5 dioxahexane 11.2 g. glutaraldehyde 5.0 g. benzalkonium chloride ip 5.0 g.5 ltr 879 aluminium hydro gel syp ( antacid ) 100 ml bottle 880 ambroxol 15mg + terbutaline 1.25mg + guaiphenesin 50mg, 100ml bottle 881 amoxicillin 125mg / 5ml 30ml bottle syp 882 amoxicillin and clavulanic acid 200+28.5mg suspension 30 ml bottle syp 883 azithromycin 200mg / 5ml suspension 15 ml bottle 884 bromhexine hydrochloride syp. 4 mg / 5ml ( bottle ) 885 calcium carbonate with vitamin d3 and minerals like phosphorus, zinc, magnesium syp 100 ml bottle 886 calcium phosphate, 2:1 ratio, 100 ml bottle 887 cefixime , 100 mg / 5 ml, 30 ml bottle 888 cetirizine, 5 mg / 5 ml , 60 ml bottle 889 chloroquine phosphate , 160 mg / 10 ml ( 50 mg / 5 ml base ) , 60 ml bottle 890 ciprofloxacin 125mg / 5ml syp 60 ml bottle 891 co trimoxazole 30 ml 892 cyclosporine 50 ml syp 893 cyproheptadine hcl 2 mg + tricholine citrate 275 mg, 200 ml bottle 894 dextromethorphan 100 mg ( bottle ) 895 diphenhydramine 14.08mg+ammonium chloride 138mg +sodium citrate 57.03mg / 5 ml 896 di sodium hydrogen citrate 200 ml bottle 897 domperidon suspension 1mg / ml 30 ml bottle 898 etiophylline + theophylline pediatric syp. ( 46.5+14mg / 5ml ) 60 ml bottle 899 glycerol 100ml 900 ibuprofen+paracetamol 60ml 901 iron 200ml 902 lactulose , 3.35 gm / 5 ml , 100 ml bottle 903 levetiracetam 100 ml bottle 904 metronidazole 200mg / 5ml suspension 60ml bottle 905 milk of megnasia + liquid paraffine 100 ml 906 nitazoxanide 100mg / 5ml 30 ml bottle 907 norfloxacine suspension ( 30 ml bottle ) 908 ofloxacin suspension 50mg / 5ml 60ml 909 ondenstrone 30ml. 2mg / 5ml. 910 paracetamol oral solution 150mg / ml 15 ml bottle with dropper 911 phenobarbitone syp 30ml. 20mg / 5ml. 912 phenytoin sodium suspension 30mg / 5ml 913 potassium chloride syp 100 ml bottle 914 salbutamol sulphate , 2 mg / 5 ml , 60 ml bottle 915 sodium valproate , 200 mg / 5 ml , 100 ml bottle 916 sucralfate 100 ml 917 sulfamethoxazole and trimethoprim suspension ( 200mg+ 40mg / 5ml ) 100 ml bottle 918 vitamin a syp 100000 unit / ml ( 100 ml bottle ) 919 vitamin b complex, nfi formula, 100 ml bottle 920 zinc 20mg / 5ml 30 ml bottle 921 multivitamin multimineral with antioxidant syp 200 ml 922 budesonide nasal spray 923 fluticasone nasal spray 924 lignocaine spray 10% 925 xylometazolin 0.1% nasal drop 10 ml vial 926 nasoclear nasal mist spray 20 ml spray 927 nasoclear nasal gel 15 gm tube 928 nasoclear nasal wash 3gm kit 929 chlorhexidine mouth wash 50 ml bottle 930 mouth wash 0.2% 50 ml 931 mouth paint clotrimazole 1%15 ml 932 absorable cotton roll, net 500gm 933 abdominal binder no 34 934 abdominal drain set 28 no. 935 abdominal drain set 32 no 936 absorbable gelatine spangstron ip 80mmx50mmx10mm 937 accessory spikes 938 adhesive plaster 7.5 cm x 10 mtrs 939 ag ion impregnated central venous double lumen polyurethane catheter, 7.5 fr, g 16x18 length 16cm 940 ag ion impregnated central venous triple lumen polyurethane catheter, 7.5 fr, g 14x18x18 length 16cm 941 ag ion impregnated triple lumen catheter for haemodialysis, fr 12, l 15cm, with polyurethan extention tube, flow rate per lumen – 320ml / min 942 air bed matterses with complete set 943 airway size 3, 4, 5, 5.5 944 airway size 6, 7.5 945 alcohal based hand sanitizer 500ml bottle with dispenser ) 946 ambu bag adult 947 ambu bag pediatric 948 antimicrobial incise drape 3 m 949 artery catheter 950 av blood lines with av pressure transducer ( acceptable for fitting to all standard dialyzer ) with side tubing ( for heparinization and av pressure monitorig ) blood tubing set dialysis 951 barium sulphate powder susp 95% w / v powder ( hd ) 95% 400gm 952 bionet connector 953 biopsy forceps ntype with / without spike / hot biopsy, length : 110cm / 160 cm / 210 cm, sterile for single use only, diameter – 1.8 mm / 2.5 mm as ordered 954 biopsy gun 955 bipap mask 956 biploar forceps cable 957 bipolar cable 958 bis monitor electrode 959 black thread ( stitching ) big 960 bleaching powder gr ii 25 kg bag 961 blood administration ( transfussion ) set 962 blood bag double 350 ml 963 blood bag double 350 ml cpd solu 964 blood bag double 350 ml with sagam 965 blood bag quadruple 350 ml top bottom with cpd sagam solu 966 blood bag quadruple 450 ml top bottom with cpd sagam solu 967 blood bag single 350 ml 968 blood bag transfer 350 ml 969 blood bag triple 350 ml 970 blood bag triple 350 ml sagam 971 blood collection tube clot activator with rubber cap 972 blood culture bottles 973 blood transfusion set ndouble molded chamber without airway 974 blood transfusion set nsingle molded chamber without airway 975 bone marrow aspiration needles ( 14 ) ( medevolution ltd ) 976 bone marrow aspiration needles ( 15 ) ( medevolution ltd ) 977 bone marrow aspiration needles ( 16 ) ( medevolution ltd ) 978 bone marrow aspiration needles 13 g ( medevolution ltd ) 979 bone marrow biopsy needle 980 bone wax 981 bp cuff adult & pead. 982 camera cover 983 cannula fixer set 984 carbolic acid 500 ml 985 c arm cover 986 catheter mount adult size 987 catheter mount peadiatric size 988 cautery pencil 989 cautery plate ( reusable ) 990 central line double luman 16g 991 central line singal luman 992 cerebral catheter reservoir 12mm dia chamber 993 cerebral catheter reservoir 18mm dia chamber 994 chest drainage catheter size: fg20 to fg40 995 chest drainage catheter size: fg20 to fg40 with trocar 996 chlorhexidine gauze dresssing b.p antiseptic tulle gas dressing 10cmx10cm 997 collagen patch 30x30 998 colostomy kit 999 computer radiography x ray film ( fuji ) 10x12 pkt 1000 computer radiography x ray film ( fuji ) 14x17 pkt 1001 computer radiography x ray film ( fuji ) 8x10 pkt 1002 condom catheter 1003 cord clamp 1004 craniotomy cutter blade 1005 craniotomy drape ( 1.6 x 3.2 mtrs ) 1006 crape bandage 2 1007 crape bandage 4 1008 crape bandage 6 1009 cvc line double lumen polyurethane catheter ( flexon material ) with bls introducer and nitinol j guide wire, 7fr, g 16x16 length 15cm 1010 cvc line triple lumen polyurethane catheter ( flexon material ) with bls introducer and nitinol j guide wire, 7.5 fr, g 14x18x18, length 15cm, 20cm ( anti microbial coated ) 1011 cvp manometer 1012 cylinder connection nut 1013 cylinder key 1014 cylinder spanner 1015 d.j.stent 5 fr, 6 fr , 3fr, 4fr 1016 dengue card test 100 test kit 1017 dialyser 1.5 / 1.6 dialyzers multiple use made of polysulphone or polyethersulfone low / middle flux, hi performance dialyser performance enhanced technology with hi biocompatibility housed in medical grade polycarbonate openable ends for easy cleaning caps ( for dialysate inlet utlet for safer storage openable caps ( red and blue ) hi quality sterilisation procedure using gamma radiation and should meetings standards of european ce / iso13485:2003sterlised ) 1018 disp paper gloves 1019 dispo cap 1020 dispo face mask triple layer ( standard ) 1021 dispo hiv full protecatin kit 1022 dispo. n95 mask 1023 disposable needle 18g ( single use ) 1024 disposable needle 20g ( single use ) 1025 disposable needle 22g ( single use ) 1026 disposable needle 23g ( single use ) 1027 disposable needle 24g ( single use ) 1028 disposable needle no 26gx1 / 2 1029 disposable spinal needle 18 1030 disposable spinal needle 22 1031 disposable spinal needle 23 1032 disposable spinal needle 24 1033 disposable spinal needle 25 1034 disposable sterile gown 1035 disposable suction catheter all size 1036 distilled water 5 lit. 1037 double lumen peripherally inserted central venous silicon catheter ( 3fr, 4fr, 4.5fr, 5fr ) length 60cm 1038 double lumen peripherally inserted central venous silicon catheter ( 7fr, 9fr, 11fr, 14fr ) length 90cm, with subcutaneous cuff for long term venous access 1039 drap sheeth 120cm x 210cm sterile 1040 ear buds 1041 ecg disposabile electrode 1042 ecg paper ( wax coated ) 50mmx30 mtr roll 1043 ecg paper computerized triple channel 20m 1044 edta tube 1045 elastic adhesive bandage 10cm x 4 1046 elastic adhesive bandage 10cm x 6 1047 elastomeric pump for post operative analgesia 1048 endotracheal tube cuffed 3.0 1049 endotracheal tube cuffed 3.5 1050 endotracheal tube cuffed 4 1051 endotracheal tube cuffed 5 , 5.5 1052 endotracheal tube cuffed 6 1053 endotracheal tube cuffed 6.5 1054 endotracheal tube cuffed 7 1055 endotracheal tube cuffed size7.5 1056 endotracheal tube cuffed size 8 1057 endotracheal tube cuffed size 8.5 1058 endotracheal tube cuffed size 9 1059 endotracheal tube cuffed size 9.5 1060 endotracheal tubes plain without cuff size 2, 2.5, 3, 3.5, 4, 4.5 1061 endotracheal tube with secondary lumen for surfactant therapy, size 2, 2.5, 3, 3.5, 4, 4.5 1062 epidural kit ( needle & catheter 16g, ) 1063 epidural kit ( needle & catheter 18g ) 1064 epidural kit ( needle & catheter 19g, ) 1065 epidural needle 1066 examination gloves medium pair 1067 examination gloves small pair 1068 examination gloves large pair 1069 exchange transfusion catheter with four way adaptor size 4cm, l 40 cm 1070 extention line 10cm 1071 extention line 50cm 1072 extention line 100cm 1073 extention line 150cm 1074 extention line 200 cm 1075 extra ventricular drain ( evd ) 1076 feeding tube size 3, 4, 5, 1077 feeding tube size 6, 7, 8, 9, 10 1078 flexo metallic tube no 6, 6.5, 7, 7.5, 8, 8.5 1079 fluroscein strips pkt 1080 fogharty cathetor 5fr 1081 foley balloon catheter three way ( a ) fg 16, 18, 20, 22 1082 foley catheter size 12 2 way 1083 foley catheter size 14 two way 1084 foley catheter size 16 two way 1085 foley catheter size 18 two way 1086 foley triway no 20 two way 1087 foley urinary catheter size 8 10 pediatrics 1088 gigli saw wire 1089 glass slide 1090 glass tube 125x150 1091 glucometer strips 1092 gudel airway all size soft and smooth 1093 guide wire 0.35 no 1094 guide wire 0.38 no 1095 guide wire 150cm staight tip 1096 guide wire 80cm. 1097 halogen bulb holder ( heavy duty ) 1098 hemodialysis fluid for bicarb made ( part a 10 ltr + part b 500gm2 / pkt ) 1099 hernia flat mesh size: 10x15 1100 hernia flat mesh size: 15x15 1101 hernia flat mesh size: 15x20 1102 hernia flat mesh size: 3x5 1103 hernia flat mesh size: 6x6 1104 hickman catheter double lumen 7.7 no 1105 hickman catheter single lumen 4.7 no 1106 hickman catheter single lumen 6.6 no 1107 hickman catheter single lumen 7.7 no 1108 hme filter 1109 humbeys knife disposable blade 1110 hydrocephalus shunt medium pressur ( vp shunt ) 1111 icd bag 1112 implantable pain port with epidural catheter for long term pain management 1113 insulin syringe 1114 intravenous drip set adult size 1115 intravenous drip set pediatric size 1116 iv .regulator set ( control drop set ) 1117 iv cannula size 16 g 1118 iv cannula size 18g 1119 iv cannula size 20g 1120 iv cannula size 22g 1121 iv cannula size 24g 1122 iv cannula size 26g 1123 j r c bag 1.5 ltr , 1 ltr 1124 j r c bag 1 / 2 ltr 500ml 1125 juglar catheter 12 fr ( adult ) 1126 juglar catheter 8fr ( pediatric ) 1127 k 90 catheter 1128 kallis pad disposable 1129 liga clip 200, 300, 400 1130 long length quincke spinal needle for pain management, size – g 22, length – 120mm & 150mm 1131 lung excersizer 1132 lysol ( cresol with soap solution ) 5ltr jar 1133 mackintosh double colour water proof 1134 malecot rubber catheter no 12 1135 malecot rubber catheter no 16 1136 malecot rubber catheter no 20 1137 malecot rubber catheter no 22 1138 malecot rubber catheter no 24 1139 mesure volume set soft chamber, with bulb latex 110ml 1140 micro drip set with bulb latex 1141 micropore 6” 1142 monopolar coutry wire 1143 mucous extractor with connector for bronchoscope capacity 70 ml 1144 mucus extractor 1145 nebulazation mask ( set ) adult & pediatric 1146 neonatal urine collection and measurement bag 1147 niv mask venti cpap ( large & medium ) 1148 non sterile surgical rubber gloves 6.5 no. ( pair ) made of natural latex micro rough finish for better grip 1149 non sterile surgical rubber gloves 7 no. ( pair ) made of natural latex micro rough finish for better grip 1150 non sterile surgical rubber gloves 7.5 no. ( pair ) made of natural latex micro rough finish for better grip 1151 o maya large / small 1152 oxygen catheter 1153 oxygen connection for central line 1154 oxygen connection for cylinder 1155 oxygen high pressure hose pipe 1156 oxygen mask adult & pediatric 1157 paediatric double lumen polyurethan cvc line, 3 fr, l 10cm, 15cm, 1158 paediatric double lumen polyurethane cvp catheter, 4.5 fr, g – 20x20 length – 6cm, 12.5cm 1201 1159 paediatric triple lumen polyurethan cvc line with nitinol j guide wire, 4.5 fr, g 20*23*23, l 6cm, 8cm, 10cm, 12.5cm 1160 paper adhesive plaster microporous surgical tape 2inch x 10mt roll 1161 paper adhesive plaster microporous surgical tape 3inch x 10mt roll 1162 paper adhesive plaster microporous surgical tape 4inch x 10mt roll 1163 pediatric diapers 1164 pediatric ventilator circuit complete set 1165 peripheral inserted central catheter 4 fr 1166 peripheral inserted central catheter 5 fr 1167 peritonial dialysis catheter 200mm peadiatric 1168 peritonial dialysis catheter 280mm adult 1169 peritonial dialysis fluid 1ltr. 1170 pigtail catheter no 10 1171 pigtail catheter no 14 1172 plain vial with screw cap12x75 1173 plaster of paris bandage 3 1174 plaster of paris bandage 4 1175 plaster of paris bandage 6 1176 plaster of paris powder ip 1 kg pkt 1177 plastic apron 1178 plastic nozel cap 1179 plastic test tube 3 1180 post exposure prophylaxis kits ( pep kits ) 1181 probe for oxygen 1182 pt vial / tube ( prothrombin vial / tube ) 1183 radial a catheter 1184 rectified sprit 4.5 ltr. 1185 ryles tube size 10, 12, 14, 16, 18 1186 schirmer strips 1187 short catheter with straight / j tip guide wire ( l 20, fr 2, g 22 ) 1188 short pencil point spinal needle g 25 / 22, l 38mm. 1189 sics kit ( small incision cataract surgery ) 1190 silicon / double nasal prong with universal connector. all sizes. 1191 silicon cautery plate 1192 silicon mask size 0, 1, 2, 3, 4 & 5 1193 soda lime for anesthesia workstation 5kg 1194 soft roll 15cm x 3 meter 1195 spatula for papsmear 1196 sterilant cold disinfectant for dialysis containing peraetic acid hydrogen peroxide acetic acid 5 ltr. 1197 sterile adhesive iodine drape large 1198 sterile alcohol swabs 1199 sterile disposable syringe 1ml 1200 sterile gauze swab / pad packets 1201 sterile hypodermic syringe with needle 03 ml 1202 sterile hypodermic syringe with needle 10ml 1203 sterile hypodermic syringe with needle 20ml 1204 sterile hypodermic syringe with needle 2ml 1205 sterile hypodermic syringe with needle 50ml / 60ml 1206 sterile hypodermic syringe with needle 5ml 1207 sterile luerlock syringe 10 ml 1208 sterile luerlock syringe 5 ml 1209 sterile leurlock syringe 20ml 1210 sterile leurlock syringe 50ml 1211 sterlie gloves isi 6.5 made of natural latex, micro rough finish for better grip 1212 sterlie gloves isi size 7.5 made of natural latex, micro rough finish for better grip 1213 sterlie gloves isi size 8 made of natural latex, micro rough finish for better grip 1214 sterlie gloves isi size 7 made of natural latex, micro rough finish for better grip 1215 sterlie powder free gloves size 6.5 made of natural latex, micro rough finish for better grip 1216 sterlie powder free gloves size 7 made of natural latex, micro rough finish for better grip 1217 sterlie powder free gloves size 7.5 made of natural latex, micro rough finish for better grip 1218 sterlie powder free gloves size 8 made of natural latex, micro rough finish for better grip 1219 surgical blade size 11 1220 surgical blade size 15 1221 surgical blade size 22 1222 surgical blade size 24 1223 t.piece circuit with oxygen tubing set ( complete set ) 1224 tegaderm ( cvl dressing ) 10 cm*12 cm 1225 tegaderm ( cvl dressing ) 7 cm* 8.5 cm 1226 tegaderm ( samll ) i / v 1227 thermometer 1228 thomas splint 1229 transducer set for invasive b.p. 1230 three way stop cock 1231 tmt paper 1232 tounge depresser 1233 tracheostomy tube cuffed plastic 5, 5.5, 6, 6.5, 7, 7.5, 8, 8.5 1234 triway with extention 10, 50, 100, 150, 1235 turp set 1236 twin nasal cannula adult 1237 twin nasal cannula paed. 1238 urine collecting bag 1239 urine collecting bag with urometer 1240 urine sugar diagnostic stick 1241 vaccum jar 1000 ml 1242 vaccum jar 2000 ml 1243 vaccum pump belt 1244 vaccum pump oil 1245 vaccum regulator 1246 vaporizer 1247 ventilator catheter mount 1248 ventilator circuit 1249 ventilator circuit ( heated wire ) 1250 ventilator circuit ( neonatal ) 1251 ventilator circuit full kit ( tubing+hmf+filter+catheter mount+bacteria filter ) 1252 ventilator mask 1253 ventilator nebulization kit with t piece 1254 ventilator single tubing circuit ( adult ) 1255 water bed 1256 wipes 1257 wound suction set no 11 / 12 / 14 / 16 / 18 1258 x ray casset 12x15 1259 x ray casset 10x12 1260 x ray casset 8x10 1261 x ray developer 22.5 lit. 1262 x ray films size 10x12 50film per pkt 1263 x ray films size 12x15 50film per pkt 1264 x ray films size 8x10 50film per pkt 1265 x ray fixer 22.5 lit 1266 x ray hangers ( clip type ) 10x12 1267 x ray hangers ( clip type ) 12x15 1268 x ray hangers ( clip type ) 8x10 1269 x ray screen high speed 12x15 1270 x ray screen high speed 8x10 1271 x rayscreen high speed 10x12 1272 yankar suction catheter ( complit set ) 1273 pacing leads 6 fr 1274 introducer sheath 6fr 1275 pigtail catheter 6 fr ( 150 cm ) 1276 j tip 0.035 mm guidewire 1277 black braided silk eyeless needled suture usp, code 5036 size 2 0 suture length in cm 76cm, needle length & description 3 / 8 circle reverse cutting 45mm 1278 black braided silk eyeless needled suture usp, code 5082 size 4 0 suture lengthin cm 76cm, needlelength & description 3 / 8 circle round bodied 16mm 1279 black braided silk eyeless needled suture usp, code 5333 size 2 0 suture lengthin cm 76cm, needle length & description 1 / 2 circle round bodied 30mm 1280 blackbraided silk eyeless needled suture usp, size 5 0 suturelengthin cm 76cm, needlelength & description 1 / 2 circle round bodied 30mm 1281 blackbraided silk eyeless needled suture usp, size 6 0 suturelengthin cm 76cm, needlelength & description 1 / 2 circle round bodied 30mm 1282 blackbraided silk eyeless needled suture usp, code 5049 size 4 0 suturelengthin cm 76cm, needlelength & description 1 / 2 circle round bodied 16mm 1283 blackbraided silk eyeless needled suture usp, code 5070 size 3 0 suturelengthin cm 76cm, needlelength & description 1 / 2 circle round bodied 25mm 1284 blackbraided silk eyeless needled suture usp, code 5087 size 3 0 suture length in cm 76cm, needle length & description 1 / 2 circle round bodied 20mm 1285 blackbraided silk eyeless needled suture usp, code 5334 size 1 0 suturelengthin cm 76cm, needlelength & description 1 / 2 circle round bodied 30mm 1286 braided synthetic absorbable eyeless needled suture usp code 2423, size 1 0 suture ( os ) 1287 braided synthetic absorbable eyeless needled suture uspbraided ab. suture 6 / 0 r.b. 1288 braided synthetic absorbable polyglactin 910 eyeless needled suture usp code 2341, size 2 0 suture length in 70cm 1 / 2 circle round bodied 30mm 1289 braided synthetic absorbable polyglactin 910 eyeless needled suture usp code 2346, size 1 0 suture length in 90cm 1 / 2 circle 40mm heave 1290 braided synthetic absorbable polyglactin 910 eyeless needled suture usp code 2347, size 1 suture length in 90cm 1 / 2 circle 40mm heave 1291 braided synthetic absorbable polyglactin 910 eyeless needled suture usp code 2421, size 1 suture length in 90cm 1 / 2 circle rc 40mm os needle 1292 braided synthetic absorbable polyglactin 910 eyeless needled suture usp code 2534, size 1 0 suture 90cms, 1 / 2 circle rc 36mm, os6 needle 1293 oxidized regenerated cellulose ( absorbable hemostat fibrillar ) 1 in x 2 in ( 2.5cm x 5.1cm ) 1294 oxidized regenerated cellulose based topical absorbable hemostar thicker weave 4x8 1295 oxldlzed regenerated cellulose; rayon fiber with 18% to 21% w / w caboxyllc contnt and 1.9% w / w moisture content as per us phrmcopela standards enforceable by us fda with bactericidal property 2x3 1296 oxldlzed regenerated cellulose; rayon fiber with 18% to 21% w / w caboxyllc contnt and 1.9% w / w moisture content as per us phrmcopela standards enforceable by us fda with bactericidal property 3x4 1297 polyamide black size 10 / 0 3 / 8 circle spachula needle 6mm 1298 polyamide black size 8 / 0 3 / 8 circle revers cutting needl 6mm 1299 sterlized absorbable eyeless needled suture usp, code 2341, size 2 0 suture length in cm 70cm needle length & description 1 / 2 circle round bodied 30mm 1300 sterlized absorbable eyeless needled suture usp, code 2345, size 2 0 suture length in cm 70cm needle length & description 1 / 2 circle round bodied 40mm 1301 sterlized absorbable eyeless needled suture usp, code 2304, size 4 0 suture length in cm 70cm needle length & description 1 / 2 circle round bodied 20mm 1302 sterlized absorbable eyeless needled suture usp, code 2317, size 2 0 suture length in cm 90cm needle length & description 1 / 2 circle round 30mm 1303 sterlized absorbable eyeless needled suture usp, code 2427, size 3 0 suture length in cm 70cm needle length & description 1 / 2 circle round bodied 30mm 1304 sterlized absorbable eyeless needled suture usp, code 2437, size 3 0 suture length in cm 70cm needle length & description 1 / 2 circle round bodied 20mm 1305 sterlized absorbable polyglycolic acid eyeless needled suture usp, code 2303, size 5 0 suture length in cm 45cm needle length & description 1 / 2 circle round bodied 16mm 1306 sterlized absorbable polyglycolic acid eyeless needled suture usp, code 2442, size 5 0 suture length in cm 45cm needle length & description 3 / 8 circle cutting 16mm 1307 sterlized monofilament polyamide eyeless needled suture usp, code 3317, size 5 0 suture length in cm 70cm needle length & description 3 / 8 circle reverse cutting cutting 12mm 1308 sterlized monofilament polyamide eyeless needled suture usp, code 3318, size 4 0 suture length in cm 70cm needle length & description 3 / 8 circle cutting cutting 16mm 1309 sterlized monofilament polyamide eyeless needled suture usp, code 3328, size 3 0 suture length in cm 70cm needle length & description 3 / 8 circle reverse cutting cutting 26mm 1310 sterlized monofilament polyamide eyeless needled suture usp, code 3336, size 2 0 suture length in cm 70cm needle length & description 3 / 8 circle reverse cutting cutting 45mm 1311 sterlized monofilament polyamide eyeless needled suture usp, code 3347, size 1 suture length in cm 100cm needle length & description 1 / 2 circle round bodied 40mm heavy 1312 sterlized monofilament polyamide eyeless needled suture usp, code 7003, size 10 0 suture length in cm 30cm needle length & description 3 / 8 circle double arm 6mm heavy 1313 sterlized monofilament polyamide eyeless needled suture uspsize 6 0 suture length in cm 70cm needle length & description 3 / 8 circle reverse cutting cutting 12mm 1314 sterlized monofilament polypropylene eyeless needled suture usp, code 829, size 6 0 suture length in cm 70cm needle length & description 3 / 8 circle round bodied 13mm double armed. 1315 sterlized monofilament polypropylene eyeless needled suture usp, code 841, size 2 0 suture length in cm 70cm needle length & description 1 / 2 circle round bodied 30mm 1316 sterlized monofilament polypropylene eyeless needled suture usp, code 842, size 1 0 suture length in cm 70cm needle length & description 1 / 2 circle round bodied 30mm 1317 sterlized monofilament polypropylene eyeless needled suture usp, code 823, size 6 0 suture length in cm 70cm needle length & description 3 / 8 circle slim blade cutting 15mm. 1318 sterlized monofilament polypropylene eyeless needled suture usp, code 843, size 1 suture length in cm 70cm needle length & description 1 / 2 circle round bodied 40mm heavy 1319 sterlized monofilament polypropylene eyeless needled suture usp, code 849, size 4 0 suture length in cm 70cm needle length & description 1 / 2 circle round bodied 16mm 1320 sterlized monofilament polypropylene eyeless needled suture usp, code 870, size 4 0 suture length in cm 70cm needle length & description 3 / 8 circle cutting 16mm 1321 sterlized monofilament polypropylene eyeless needled suture usp, code 881, size 5 0 suture length in cm 70cm needle length & description 3 / 8 circle round bodied 16mm. 1322 sterlized monofilament polypropylene eyeless needled suture usp, code 882, size 5 0 suture length in cm 70cm needle length & description 3 / 8 circle round bodied 16mm.double 16mm armed 1323 sterlized surgical chromic gutsutue eyeless needied usp, code 4201, size3 / 0, suture length in cm 76cm, needle length & description 3 / 8 circle cutting 22mm. 1324 sterlized surgical chromic gutsutue eyeless needied usp, code 4216, size2 / 0, suture length in cm 76cm, needle length & description 3 / 8 circle round bodied 30mm. 1325 sterlized surgical chromic gutsutue eyeless needied usp, code 4217, size1 / 0, suture length in cm 76cm, needle length & description 3 / 8 circle round bodied 30mm. 1326 sterlized surgical chromic gutsutue eyeless needied usp, code 4221, size1 / 0, suture length in cm 76cm, needle length & description 3 / 8 circle round bodied 40mm. 1327 sterlized surgical chromic gutsutue eyeless needied usp, code 4227, size 1, suture length in cm 100cm needle length & descriptio 1 / 2 circle round bodied 45mm heavy. 1328 sterlized surgical chromic gutsutue eyeless needied usp, code 4237, size3 / 0, suture length in cm 76cm, needle length & description 1 / 2 circle round bodied 20mm. 1329 sterlized surgical chromic gutsutue eyeless needied usp, code 4259, size1, suture length in cm 76cm, needle length & description 1 / 2 circle round bodied 40mm heavy. 1330 sterlized surgical chromic gutsutue eyeless needied usp, code 4268, size5 / 0, suture length in cm 76cm, needle length & description 3 / 8 circle reverse cutting 12mm. 1331 surgical silk braded ( sutupack ) sterile foilover wrappack code 213 size 2 0 suture length in 2 x 75cm 1332 surgical silk braded ( sutupack ) sterile foilover wrappack code 214 size 1 0 suture length in 2 x 75cm 1333 surgical silk braded ( sutupack ) sterile foilover wrappack code 215 size 1 suture length in 2 x 75cm 1334 vicryl 6.0 rount body needle 1335 20g round body cutting needle 1 / 2 circle 1336 copolymer of glycolied and e caprolactone, 1 0 ct 1 needle and 45cm suture length unidirectional spiral 15 degree anchoring, with 20 anchours 1337 copolymer of glycolied and e caprolactone, 3 0 rb 1 needle and 45cm suture length unidirectional spiral 15 degree anchoring, with 20 anchours 1338 monofilament glycomer 631* 3 0 75cm , undyed 24mm 3 / 8 circle reverse cutting 1339 monofilament glycomer 631* 3 0 75cm , violet 22mm 1 / 2 circle taper point 1340 monofilament glycomer 631* 1 , 90cm , violet 40mm 1 / 2 circle taper point 1341 monofilament glycomer 631* 2 0 , 75cm , violet 27mm 1 / 2 circle taper point 1342 monofilament glycomer 631* 0, 90cm , violet 40mm 1 / 2 circle taper point 1343 ( coated braided polyglctin 910 with triclosan coating sut. ) with 1 / 2 cir rb needle 20mm length 75cm size 3 / 0. 1344 ( coated braided polyglctin 910 with triclosan coating sut. ) with 1 / 2 cir rb needle 30mm length 100cm size 2 / 0. 1345 ( coated braided polyglctin 910 with triclosan coating sut. ) with 1 / 2 cir rb needle 36mm length 90cm size 3 / 0 1346 ( coated braided polyglctin 910 with triclosan coating sut. ) with 1 / 2 cir rb needle 40mm length 100cm size 1 1347 ( coated braided polyglctin 910 with triclosan coating sut. ) with 1 / 2 cir rb needle 40mm length 100cm size 1 / 0 1348 poliglecaprone 25 undyed with irgcare mp3 0, 3 / 8 circle reverse cutting26mm 70cm. 1349 polydioxanone lrgacare mp coated 150cm usp1 0 rb ctx, 1 / 2 circle, 48mm 1350 suture dyed polyester poly ( p dioxxanone ) 1 0, 24x4cm, 1 / 2 circle 36mm rb 20 anchors / inch bidirctional. 1351 180 absorbable polyglyconate knotless wound closure device with unidirectional & dual angled cut barbs geometry * 0 30cm , green 37mm 1 / 2 circle taper point 1352 180 absorbable polyglyconate knotless wound closure device with unidirectional & dual angled cut barbs geometry * 2 0 30cm , green 37mm 1 / 2 circle taper point 1353 90 glycomer 631 knotless wound closure device with unidirectional & dual angled cut barbs geometry 3 0 58cm , undyed 24mm 3 / 8 circle reverse cutting 1354 90 glycomer 631 knotless wound closure device with unidirectional & dual angled cut barbs geometry 2 0 45cm , undyed 24mm 3 / 8 circle reverse cutting 1355 copolymer of glycolied and e caprolactone, 2 0 ct 1 needle and 45cm suture length unidirectional spiral 15 degree anchoring, with 20 anchours 1356 copolymer of glycolied and e caprolactone, 3 0 rb 1 needle and 20cm suture length unidirectional spiral 15 degree anchoring, with 20 anchours 1357 synthetic absorbable surgical suture , polyglactin 910 with irgacare mp coated, undyed 1, 1 / 2 circle round body taper point ct 1 36 mm , 90 cm undyed 1358 synthetic absorbable surgical suture irgacare coated monofilament poliglecaprone 25 suture, length 70 cm, size 2 0 with 3 / 8 circle oval round body visi black jb needle 26 mm 1359 absorbable unidirectional barbed device symmetric anchoring pattern, triclosan coated polydioxanone size 1, 40 mm 1 / 2 circle taper point needle 45 cm 1360 absorbable adhesion barrier in the form of off white knitted fabric prepared by oxidized regenerated cellulose indicated for both open and laparoscopic procedures 1361 polyster braided polybutylatecodated 1 / 2 circle tapercut double needle with 17 mm needle and suture lenght 90cm 1362 triclosan antibacterial coated polyglactin 910 with 23 mm needle suture length 70cm, reverse cutting portt heavy needle size 1 no. 1363 protective disk with chg hydrophilic polyurethane absorptive foam with 92 g chlorhexidine gluconate ( chg ) 1 disk ( 2.5 cm ) 7mm center hole with radial slit usfda approved 1364 protective disk with chg hydrophilic polyurethane absorptive foam with 92 g chlorhexidine gluconate ( chg ) 1 disk ( 2.5 cm ) 4.0 mm center hole with radial slit usfda approved 1365 self gripping polyester monofilament mesh pre cut with pla grips with size 12 x 08 cm for right side, fda approved 1366 self gripping polyester monofilament mesh pre cut with pla grips with size 12 x 08 cm for left side, fda approved 1367 self gripping polyester monofilament mesh pre cut with pla grips with size 14 x 09 cm for left side , fda approved 1368 self gripping polyester monofilament mesh pre cut with pla grips with size 14 x 09 cm for right side, fda approved 1369 absorbable intraperitoneal umbilical patch of polyester mesh with collagen barrier and having absorbable pgla expanders with size 6 cm circle fda approved 1370 absorbable intraperitoneal umbilical patch of polyester mesh with collagen barrier and having absorbable pgla expanders with size 8 cm circle, fda approved 1371 ada kit 1372 aluminium ammonium sulphate powder 500gm 1373 ana 96 well 1374 anti a lactin 05ml 1375 anti ab sera 10ml 1376 anti d igg+ igm 10ml 1377 anti d igm 10ml 1378 anti h lactin 05ml 1379 anti human globulin ( ahg ) 05ml 1380 anti a sera 1381 anti ab sera 1382 anti a lactin 1383 anti b sera 1384 banded use in blood bank 1385 benedict reagent 5 lit cane 1386 blotting paper sheet 1387 blue tip 2ml 1388 bovine albumin 22% 05ml 1389 buffer solution for hiv 50ml 1390 ca 125 1391 calcium chloride 05ml / vail 1392 capillary tube 1393 couplin jar 1394 cover slips size 18x18mm 1395 cover slips size 22x22mm 1396 cyto fix spray 1397 diagnostic strip for urine ( sugar and albumin ) 1398 diamond pencil 1399 dpx mount 250ml ( urgent ) 1400 ehlrich aldehyde reagent 125 1401 fouchet reagent 250ml 1402 glass slide iso mark no 12mm 1403 haematoxylene 5gm ( urgent ) 1404 hbsag elisa test kit 4th generation 96 test 1405 hbsag rapid test kit 50 test 1406 hbv elisa test kit 4th generation 96 test 1407 hbv rapid test kit 1408 hcv elisa test kit 4th generation 96 test 1409 hcv rapid test kit 1410 hiv elisa test kit 4th generation 96 test 1411 hiv rapid test kit 1412 i.d. microtyping abd card 1413 i.d. microtyping gel card ahg 1414 immersion oil 1415 iso propyl alcohol 1416 leucoreductionfilter ( bed side ) 1417 liss diluent for gel card 1418 m .p elisa 1419 mercuri oxide 25gm 1420 methanol 2.5lit 1421 mgg 480ml 1422 mp antigen test kit rapid 1423 n / 10 hcl 500ml 1424 nitrile gloves size small / medium / large 1425 p t tubes 3.8% sodium citrate 1426 pandys reagent 125ml 1427 papanicalou ea 125ml pea 030 1428 papanicalou og 6 125ml pea 010 1429 paraffin wax 58 60c 1430 pasture pipette 1431 polythene gloves 1432 retic stain 125ml 1433 slide tray 1434 steel cassets for tissue processing 1435 sulpho salicylic acid 500ml 1436 tissue paper roll 1437 vdrl elisa test kit 1438 vdrl rapid test strip 1439 vdrl rpr test kit 1440 wafers cutting blade for tube welders 1441 xylene 1442 yellow gel tube vaccum blood collection tube 1443 yellow tip plastic 1444 massons trichrome stain 1445 acetone detection kit 1446 acetic acid solution 3% 100ml 1447 barium chloride 10 % 500 ml 1448 glacial acetic acid 100 ml 1449 glucose kit god / pod 1450 h2so4 25 % 500 ml bottle 1451 leishman stain 500 ml 1452 sharp collection containers disposable 1.5 ltrs 1453 sharp collection containers disposable 5 ltrs 1454 total protein kits 100 ml 1455 field stain a 500 ml 1456 field stain b 500 ml 1457 multi parameter urine strips ( 100 in 1 box ) 1458 bismark brown stain 100 gm 1459 light green stain 100 gm 1460 disposable microtome blade ( 50 blades in one ) 1461 csf protein kit 1462 filter paper 12.5 cm 0.1 micron ( 50 per pkt ) 1463 tips for auto pippets ( 2 to 100 micron yellow 1000 / pkt ) 1464 tips for auto pippets ( 200 to 1000 micron blue 500 / pkt ) 1465 surgical blade 22 no carbon steel 1466 sugar albumin uristics ( bi parameter ) 1467 sulpgar powder 500 gm 1468 liquid ammonia 500 ml 1469 nitric acid 500 ml 1470 blotting paper 50 / pkt 1471 pas stain 1472 blood culture media aerobic for pediatric ( bac t / alert pf plus ) 1473 blood culture media anaerobic for pediatric ( bac t / alert pf plus ) 1474 ki67 / mib 1 06 ml antibody kit 1475 glial fibrillary acidic protein ( gfap ) 1476 s 100 1477 ae 1 / ae 3 1478 ema 1479 nfp 1480 synaptophysin 1481 estrogen receptor epi monoclonal 1482 progestron receptor monoclonal 1483 anti her / erbb2 monoclonal 1484 myogenin 1485 sma 1486 cd34 1487 bcl 2 1488 cyclin d 1 1489 cox 2 1490 p 53 1491 nkx 3 1 1492 amacr 1493 vimentin 1494 desmin 1495 tris buffer gr 1496 titriplexiii pure ( edta ) 1497 sodium chloride for analysis 1498 tween 20 for synthesis 1499 hydro chloride acid about 36.46% 1500 poly l ltsin solution p8920 1501 pap pen 1502 hpr polymerr kit with dab chromogen 1503 pricking lancet 1504 leucoreductionfilter ( lab side ) 1505 haemoglobin strip 1506 single donor platelet kit make haemonotics / terumo penpol ( close system ) 1507 disposable circular stapler 26mm diameter 1508 disposable circular stapler 29mm diameter 1509 disposable circular stapler 31mm diameter 1510 disposable circular stapler – 32mm diameter 1511 disposable circular stapler 33mm diameter 1512 disposable circular stapler iii rows 1513 disposable linear stapler with fixed staple height 55mm 60mm size 1514 disposable linear stapler with fixed staple height 75mm 90mm size 1515 reload 55 60mm for thin / vascular tissue white compatible with linear cutter. 1516 reload 55 60mm for medium thick tissue blue compatible with linear cutter. 1517 reload 75 80mm for medium thick tissue blue compatible with linear cutter. 1518 reload 75 80mm for thick tissue green compatible with linear cutter. 1519 disposable hemorrhoidal stapler 1520 disposable hemorrhoidal stapler iiirows 1521 disposble skin stapler with pins 1522 disposable hemorrhoidal stapler with detachable anvil. 1523 reload for linear stapler with fixed staple height 35mm 45mm size blue 1524 reload for linear stapler with fixed staple height 35mm 45mm size green 1525 reload for linear stapler with fixed staple height 55mm 60mm size blue 1526 reload for linear stapler with fixed staple height 55mm 60mm size green 1527 disposable curved cutter stapler 1528 polycearbonte bladeless frocar with reducer seal 5mm 1529 polycearbonte bladeless frocar with reducer seal 10mm 1530 polycearbonte bladeless frocar with reducer seal 12mm 1531 reload for linear cutter 55mm 60mm size blue 1532 reload for linear cutter 55mm 60mm size green 1533 reload for linear cutter 75mm 80mm size blue 1534 reload for linear cutter 75mm 80mm size green 1535 reload for linear cutter 90mm 100 mm size blue 1536 reload for linear cutter 90mm 100 mm size green 1537 reusable laparoscopic clip applicator for medium large titanium clips with non detachable jaw assembly 1538 reusable laparoscopic clip applicator for large titanium clips with non detachable jaw assembly 1539 mesh fixation device with non absorbable titatinum tacks 15 / 20 / 30 1540 mesh fixation device with non absorbable titatinum tacks 15 1541 mesh fixation device with non absorbable titatinum tacks 20 1542 mesh fixation device with non absorbable titatinum tacks 30 1543 mesh fixation device with 30 poly ( lactide co glycolide ) absorbable tacks 1544 mesh fixation device with 15 poly ( lactide co glycolide ) absorbable tacks 1545 partially absorbable mesh with absorable & semi absorbable sides 10cm x 15cm 1546 partially absorbable mesh with absorable & semi absorbable sides 15cm x 15cm 1547 polyprplene with polyglecaprone 25 partially absorbable mesh 7.6cm x 15cm 1548 polyprplene with polyglecaprone 25 partially absorbable mesh 10cm x 15cm 1549 skin staple remover with plastic handle 1550 distal tip closure titanium ligation clip small size 1551 distal tip closure titanium ligation clip medium size 1552 distal tip closure titanium ligation clip medium large size 1553 distal tip closure titanium ligation clip large size 1554 reusable laparoscopic clip applicator for large titanium clips. 1555 reusable laparoscopic clip applicator for medium large titanium clips with 28cm 30 cm length 1556 reusable laparoscopic clip applicator for large titanium clips with 15cm 20cm length 1557 dispoable trocar 05mm 1558 dispoable trocar 10mm 1559 dispoable trocar 12mm 1560 dispoable trocar 15mm 1561 disposable curved cutter stapler 1562 reload compatible with curved cutter 1563 endoscopic cutter & staplter 60mm long length 1564 endoscopic cutter & staplter 60mm regular length 1565 reload endoscopic cutter & staplter 60mm white / 1566 reload endoscopic cutter & staplter 60mm gold 1567 reload endoscopic cutter & staplter 60mm green 1568 reload endoscopic cutter & staplter 60mm blue 1569 reload endoscopic cutter & staplter 60mm / black 1570 reload endoscopic cutter & staplter 45mm green 1571 reload endoscopic cutter & staplter 45mm blue 1572 endosuturing device 10mm with toggle lever 1573 absorbable 2 0 endo suture cartridge 48 length 1574 non absorbable 2 0 endo suture cartridge 48 length 1575 disposable clip applier medium 5mm with 16 clips 1576 disposable clip applier medium 10mm with 20 clips 1577 multifire clip applier small size 20 clip 1578 multifire cliip applier long size 15 clips 1579 reusable linear cutter 55 60mm with 200 firing 1580 reusable linear cutter 75 80mm with 200 firing 1581 suture locking 1582 plastic locking clip applicator medium / large 1583 locking clip cartridge medium / large 1584 open clip appkicator 100 lt / 200 lt / 300 lt / 400 lt 1585 titanium clip 100 lt / 200 lt / 300 lt / 400...

Indian Army - Madhya Pradesh

26114280 purchase of med stores as per rfp , medicines : , vacutainer sterile gel without needle , glucose powder , g6pd kit ( 1x10 tests ) , glycerin , fdp test ( 1x15 tests ) , disposable microtome blade , ( ptte coated , low profile ) , petri dish disposable , urine pregnancy test card , ckmb ( erba ) semi auto analyser , prothrombin time ( 12x5 ml ) , stromatolyser sysmax 3x500ml , cell pack 20ltr for ( sysmax ) , cell clean 50ml ( sysmax ) , tricontrol for sysmax ( 3x1 . 0ml ) , uristix ( 2 parameter ) , ketone uristix , troponin i ( 1x25 tests ) ...

Netaji Subhash Chandra Bose Medical College - Madhya Pradesh

24467253 supply of reagent , chemical , glass ware , stationary and general items 2 manual kits 3 acid phosphates kit 4 albumin 5 alkaline phosphates kit 6 amylase 7 aptt 8 aso titre test 9 billirubin direct 10 billirubin total 11 blood urea kit 12 calcium 13 chicken gunia rapid kit igm 14 cholesterol kit 15 ck mb 16 cpk mb 17 c reactive protein 18 rpr 19 crp kit 20 csf protein 21 dengue rapid kit for igg & igm 22 dengue rapid kit for igg&igm 23 drinking water testing (12 parameters) 24 factor 8,9 kit 25 g6pd kit 26 glucose kit god method 27 glycosylate hb% 28 hbsag card test 29 mountax test 5 tu/ppd 30 pragnancy test hcg card test 31 pregnancy test, latex agglutination inhibition test 32 prothombin time kit 33 ra factor test 34 rapid test kit for anti hcv ab 35 s.acid phosphtac 36 s.alkaline phosphate 37 s.analyese 38 s.cholestrol kit 39 s.glucose kit 40 s.h.d.l. 41 s.triglyceride 42 s.uric kit 43 serum bilirubin kit 44 serum calcium kit 45 serum cretinine kit 46 serum protein kit 47 serum uric acid kit 48 sgot 49 sgpt 50 t3 elisa test kit 51 t4 elisa test kit 52 total protein 53 triglyceride kit 54 tsh elisa test kit 55 urea enzymatic 56 urea kit 57 vdrl card test tpha 58 vdrl latex test/ rpr 59 widal kit 60 widal test 61 crp latex agglutination test (50 test x 01kit) 62 ra factor test (50 test x 01kit) 63 aso titre test (50 test x 01kit) 64 robertson cooked medica (rcm) meat media (500gm x 01pck) 65 liquid paraffin (500ml x 01 bottle) 66 mac conkey agar (500 gm x 01pack) 67 cled media (500 gm x 01pack) 68 tcbs media (250 gm x 01pack) 69 nutrient agar (500 gm x 01pack) 70 muler hinton agar (500 gm x 01pack) 71 potassium per magnet (500gm x 01 pack) 72 loffers serum agar (250gmx01pack) 73 bile salt agar(bsa)(250gms x 01 pack) 74 carry blair transport media base (500gms x 01 pack) 75 sodium doxycholate (100 gms x 01 pack) 76 xylose (250 gms x 01 pack) 77 potassium chloride (500 gms x 01 pack) 78 asperagine (100 gms x 01pack) 79 potassium di hydrogen phosphate (kh2p04)(500gms x 01pack) 80 glycerol (500ml x 01bottle) 81 methyl red (100gms x 01pack) 82 kits & chemicals 83 iso propyl alchohol (1 liters) (merck/qualigen/fisher) 84 benzene (1 liters) (merck/qualigen/fisher) 85 formaline (1 liters) (merck/qualigen/fisher) 86 hematoxyline powder (fisher/loba) 87 dpx (500ml) (merck/qualigen/fisher) 88 microtome blade (leica/chile) 89 alluminium potassium sulphate (1kg) (merck/qualigen/fisher) 90 mercuric oxide (100 gm)(merck/qualigen) 91 carbolic soap 92 ammonium potassium sulphate (500 gm) 93 nitric acid (merck/qualigen) 94 hiv kit elisa 95 hiv kit rapid 96 hcv kit elisa 97 hcv kit rapid 98 hbsag kit elisa 99 hbsag kit rapid 100 rpr (vdrl) kit 101 rpr kit strip 102 rapid malaria antigen detection test card for pv& pf antigen 103 anti abd monoclonal (igm) 10ml 104 anti d blend, monoclonal (igm + igg) anti sera 105 anti a1 lectin 106 anti ab monoclanal 107 anti h 108 activated papain enzyme stablized solution 109 anti c 110 anti c 111 anti e 112 anti e 113 coombs anti sera 114 id gel cross match card (ahg) (cooms) test card 115 gel diluent 2 liss 116 blood bag double 350ml 117 blood bag double 450 ml 118 blood bag triple 450ml 119 single donor platelet /plasma kit, with acd a bag 500ml (for apheresis) 120 chemical 121 mannitol 122 absolute alcohol 123 acetone 124 albumin flakes 125 alpha naphthol 126 alpha naphthylamine 127 ammonium di hydrogen phosphate 128 ammonium molybdat 129 ammonium oxalate 130 ammonium sulphate 131 barium chroride 132 basic fuschin 133 benzidine powder 134 betadin solution 135 bile salt 136 bismuth ammonium citrate 137 bleaching powder 138 blood group anti serum a,b & o 139 bole billirudin 140 bole billiverdin 141 bromine liquid 142 bromothymol blue 143 calcium pure 144 casein 145 conc. h2so4 146 conc. hno3 147 concentrated hcl 500,l 148 copper acetate 149 cotton roll 150 creatinine powder 151 crystal voilet 152 cuso4 crystal 153 d.p.x. mount 154 dextrose 155 di methyl amino benzaldehyde 156 di pot. hydrogen phasphate 157 di sodium ortho phosphate 158 dibasic sod. phosphate 159 disodium hydrogen phosphate 160 distill water 5 ltr 161 e.d.t.a. powder 162 ecg jelly 250gm 163 eosin (cdh/merck) 164 eosin stain (for histology staining) 165 ferric chloride (fecl3) 166 field stain a&b 167 filter paper sheet whathman, no.1 168 fontana stain 169 formaldehyde (formalin) 37% 170 formaldehyde (formalin) 37% 171 formaldehyde (formalin) 37% 172 formaldehyde 40% 200 kg pack 173 formaldehyde 40% 500 ml pack 174 fructose 175 gelatin 176 giemsa powder 177 giemsa stain 178 glacial acetic acid 179 glucose 180 glycerine 05 liter pack 181 gms stain 182 h2o2 183 hand lotion 250ml antiseptic washing 184 hand sanitizers 185 hydrogen peroxide (500 ml x 1bottle) 186 hydrogen peroxide (h2o2) 187 hydrogen peroxide soln 20% 188 india ink 189 iodine 190 kovacs indole reagent 191 l.asparagine 192 lactic acid 193 lactophenol cotton blue 194 lactose 195 lead acetate 196 leishman stain solution 197 lens cleaner 2000ml 198 liquid paraffin heavy 199 liquid praffin 500ml 200 liquor ammonia (merk/ran/kem/fisher/qualigen) 201 lysozyme 202 malachite green (50gm x 01 pack) 203 maltose 204 mercury for b.p. instrument 500gm 205 methanol 206 methyl red (ph indicator) 207 methyl violet 208 methylene blue 209 na natroprusside 210 nalc powder 211 neutral red indicator 212 paraffin wax (merck/qualigen/fishe) 213 paraffin wax roll for test tube sealing 214 peptone 215 ph strips (ph 1 10) 216 phenol crystal 217 phenolphthalein 218 phenyl hydrazine hydrochloride 219 phosphate pure 220 picric acid 221 pot. dichromate 222 pot. hydroxide 223 potassium alum 224 potassium iodide 225 pottassium iodide 226 rectified spirit 227 ressorcinol 228 saffranine 229 salphate pure 230 silver nitrate 231 sodium acetate 232 sodium carbonate 233 sodium chloride 234 electrolite kit 235 sodium dihydrogen phosphate 236 sodium hydroxide 237 sodium hydroxide (flakes) 238 sodium hydroxide pellets 239 sodium hypochloride 240 sodium sulphate 241 sodium taurocholate (bile salt) 242 spirit 243 starch 244 sterile ontainer 245 sucrose 246 sulphur powder 247 sulphuric acid 248 tetra methylparaphenyl diaminodihydro chloride (oxidase reagent) 249 thallus acetate 250 thymol crystals 251 tincture benzoin co 252 tri sodium citrate 253 trichloro acetic acid 254 urea 255 urea powder 256 whatmas filter paper no. (standard size) 257 xyline (1liters) (merck/qualigen/fisher) 258 yeast extract powder 259 aluminium ammonium sulphates 12 hydrate (cdh) powder 260 glass ware 261 amplifire for neurograph 262 anaerobic gas pack for 3.5 lit capacity, disposable oxygen absorbing, carbon dioxide generating agent used in anaerobic system no need to use catalysts or pressure gauge 263 anaerobic indicator tables for anaerobic system (for anaerobic system ) 264 anaerobic system rubber rings (for anaerobic system ) 265 arnold sterilizer 266 b.p. appraturs (stand type) 267 b.p. blade 24 no. 268 beaker (1000cc) 269 beaker (100cc) 270 beaker (500cc) 271 beaker (50cc) 272 beaker 100ml 273 beaker 200ml 274 blood bag tube stripper mannual 275 bone marrow aspiration needle (16,18,20 no.) 276 bone marrow trephine biopsy needle 277 bottle with clear transparent glass 50ml 278 capillary tube 1 mm (long) 279 capillary tube 1mm or all size 280 centrifuge tube 15ml 281 centrifuge tube 2ml (p.p) 282 chamical balance 283 charging droppers 284 collection vail 2ml 285 collection vail 5ml 286 colony counter digital for bacteriology, digital display to cout 9999 287 colorimeter cuvetts 288 conical flask flat bottom (1000cc) 289 conical flask flat bottom(250cc) 290 conical flask flat bottom(500cc) 291 conical flask flat bottom(50cc) 292 coplins jar 50ml 293 coppling jars (horizontal) 294 demonstration stethoscope with multiple earpiece 295 distilled water plant (all glass) 296 dropping bottel 297 dropping bottles for stains (plastic) 298 durhams tube 299 e.s.r. tube 300 ecg roll 301 eeg electrodes for neurograph 302 esr tube (wwstergren) 303 flask bottom flask 2 ltr capaciy 304 flat bottom flask 5 liter capacity 305 flat bottom ph electrode for ph determination for use on soft moist surface like agar gel plate and both on solid and semisolid surface 306 funnel 307 glass pipetts each of each size 308 glass slide (sunbeam / bluestar) 309 glass slide (size 76x55mm) thickness 1.35mm (sunbeam / bluestar) 310 glass slide(size 76x26 / 75x25mm) thickness :1.45mm) (sunbeam / bluestar) 311 glass trough pneumatic 312 glycerine 313 haemocytometer 314 haemoglobinometer (sahils) 315 hammer (reflex) 316 hb tube 317 ink well for neurograph 318 jar glass (2ltr) 319 lovibond comparators 320 lp bone marrow needle 321 lp needle (top spinal ) 22x89mm 322 mackartaneys bottle 323 maker pen for digital colony counter 324 measuring cylinder 1000ml 325 measuring cylinder 100ml 326 measuring cylinder 500ml 327 micro coverslips (18mmx18mm) 328 micro coverslips (19mmx19mm) 329 micro coverslips (22mmx22mm) (sunbean / bluestar) 330 micro coverslips (22mmx25mm) 331 micro coverslips (22mmx30mm) 332 micro coverslips (22mmx30mm) 333 micro coverslips (22mmx40mm) (sunbean / bluestar) 334 micro coverslips (22mmx500mm) (special) 335 micro coverslips (22mmx50mm) (sunbean / bluestar) 336 micro coverslips (22mmx60mm) (special) (sunbean / bluestar) 337 micro coverslips (24mmx24mm) (special) 338 micro coverslips (24mmx40mm) (special) 339 micro coverslips (24mmx60mm) (special) (sunbean / bluestar) 340 micro coverslips (24mmx60mm) (special) 341 micro coverslips (25mmx50mm) (special) 342 micro coverslips (25mmx60mm) (special) 343 micro coverslips 18mm circular 344 micro coverslips 19mm circular 345 micro coverslips 22 mm circular 346 micro coverslips 24mm circular 347 micro pippete 10 ul 348 micro pippete 20 ul 349 micro pippette 1000 ul 350 micro pippette 100ul 351 micro pippette 200 ul 352 micro pippette 50 ul 353 micro pippette 500ul 354 micro pippette tips (200 1000ul) 355 micro pippette tips (2 200ul) 356 micro tips yellow size small 357 micrometer stage 358 micropipate (00 to 210 micro litter) 359 micropipate (00 to 1500 microlitter) 360 micropipette tips 0 200µl 361 micropipette tips 1000µl 362 micropipette tips 200 µl 363 microscope oil immersion moveable stage abbe condenser etc 364 multichannel micropipette 10µl (fixed volume, 8 channel with built in tip ejector 365 multichannel micropipette 100µl (fixed volume, 8 channel with built in tip ejector 366 multichannel micropipette 200µl (fixed volume, 8 channel with built in tip ejector 367 multichannel micropipette 50µl (fixed volume, 8 channel with built in tip ejector 368 museum jar (rectangular with lid) 369 n 95 mask 370 patri dish 9cm glass 371 pcv tube (wintrobe) 372 petri plate carrier for 10 paltes anerobic system 373 ph meter digital 374 pippete 1ml 375 pippete 5ml 376 plastic container for collection of stool, pus, sputum, with sepcimens 20ml capacity, sterile 377 plastic container for collection of stool, pus, sputum, with sepcimens 50ml capacity, sterile 378 platinum wire loop 379 postmortem glvoes size 8 ½ 380 pricking needles 381 priestley smith perimeter 382 rack for patridish 383 reagent bottle (1000cc) 384 reagent bottle (100cc) 385 reagent bottle (2000cc) 386 reagent bottle (250cc) 387 reagent bottle (500cc) 388 reagent bottle (50cc) 389 reagent bottle 100ml 390 reagent bottle 50ml 391 regent bottle 250ml 392 rubber bulb for pipettes big 393 rubber bulb for pipettes small 394 rubber teats varium volume 395 scissors big size 396 single channel fixed volume micropipette 10µl 397 single channel fixed volume micropipette 100µl 398 single channel fixed volume micropipette 25µl 399 single channel fixed volume micropipette 50µl 400 single channel micropipette variable volume 100 1000µl 401 slide 76mmx25mm 402 spatula 403 spirit lamp 404 staining trough 405 stature needles (half dozen stainless stell) cat no. round bodied half circle size 1 406 surgical gloves 7 407 surgical glvoes 6 ½ 408 test tube borocilicated (100x12mm) 409 test tube borocilicated (150x18mm) 410 test tube borocilicated (75x12mm) 411 test tube basket 412 test tube glass 5ml 413 test tube holder 414 test tube plastic with cap 5ml 415 test tube stand (big) 416 test tube washing brush 417 test tube with rim 05 cm 418 test tube with rim 10cm 419 thermometer 420 urinometer 421 vdrl shaker 422 water both (serological)56c 423 writing pen for neurograph 424 stationary 425 ctg roll paper (bpl company) 426 photocopy paper a3 size (75gsm 500sheets) 427 photocopy paper a4 size (75gsm 500sheets) 428 photocopy paper fs size (75gsm 500sheets) 429 photocopy paper a4 (green color) (75gsm 500sheets) 430 ruled regiter 100 pages 431 ruled regiter 200 pages 432 ruled regiter 300 pages 433 ruled regiter 400 pages 434 ruled regiter 600 pages 435 ruled regiter 800 pages 436 attendance register student 437 attendance register staff 438 stock register 100 pages 439 stock register 200 pages 440 stock register 300 pages 441 examination copy 24 pages(size 32x20cm) 60 gsm with numbering neolith paper 442 examination supplementary copy 12 pages(size 32x20cm) 60 gsm with numbering neolith paper 443 file cover 444 file folder 445 file pad 446 index file 447 dak book 448 envelop small 449 envelop a4 size 450 carbon paper 451 lace 452 tag 6 inch 453 flag 454 poker 455 paper weight 456 duster 457 pin cushion 458 stapler hp 45 459 punching machine (big size) 460 stapler pin (24/6 1m) 461 stamp pad (small) 462 stamp pad (big) 463 pad ink 464 scissor (big) 465 chalk white 466 chalk colour 467 sealing wax 468 dusting cloth 469 pen (red, blue,black) 470 locker 471 bastha cloth 472 led bulb (45 watts) 473 led tube 474 gum bottle (small) 475 gum bottle (big) 476 fs size printing single side 477 fs size printing double side 478 a4 size printing single side 479 a4 size printing double side 480 a5 size printing single side 481 a5 size printing double side 482 a3 size printing single side 483 a3 size printing double side 484 cleaning materials 485 nirma powder 1 kg 486 life boy soap 487 hand wash 488 phenyle (1ltr) 489 acid 5ltr pack (isi marked ) 490 naphthaline balls 491 dustbin small 492 dustbin big (50 ltr) 493 plastic bucket 50 ltr 494 toilet brush 495 date broom 496 coconut broom 497 wiper 498 bamboo stick 5 fit 499 bamboo stick 12 fit 500 bamboo basket 501 floor cleaning moper 502 plastic mug 503 mop 504 general items 505 macantosh sheet 506 jaggrey (gud) (1kg) 507 sugar (1 kg) 508 common salt (1 kg) 509 urea 510 dap 511 alum (fitkary) (1kg) 512 limestone ( grind chuna) (1kg) 513 pily electrolyte (pack) 514 bio culture (pack) ...

Netaji Subhash Chandra Bose Medical College - Madhya Pradesh

24006435 supply of kits / chemicals / stationary / glass ware 2 manual kits 3 acid phosphates kit 4 albumin 5 alkaline phosphates kit 6 amylase 7 aptt 8 aso titre test 9 billirubin direct 10 billirubin total 11 blood urea kit 12 calcium 13 chicken gunia rapid kit igm 14 cholesterol kit 15 ck mb 16 cpk mb 17 c reactive protein 18 rpr 19 crp kit 20 csf protein 21 dengue rapid kit for igg & igm 22 dengue rapid kit for igg&igm 23 drinking water testing ( 12 parameters ) 24 factor 8, 9 kit 25 g6pd kit 26 glucose kit god method 27 glycosylate hb% 28 hbsag card test 29 mountax test 5 tu / ppd 30 pragnancy test hcg card test 31 pregnancy test, latex agglutination inhibition test 32 prothombin time kit 33 ra factor test 34 rapid test kit for anti hcv ab 35 s.acid phosphtac 36 s.alkaline phosphate 37 s.analyese 38 s.cholestrol kit 39 s.glucose kit 40 s.h.d.l. 41 s.triglyceride 42 s.uric kit 43 serum bilirubin kit 44 serum calcium kit 45 serum cretinine kit 46 serum protein kit 47 serum uric acid kit 48 sgot 49 sgpt 50 t3 elisa test kit 51 t4 elisa test kit 52 total protein 53 triglyceride kit 54 tsh elisa test kit 55 urea enzymatic 56 urea kit 57 vdrl card test tpha 58 vdrl latex test / rpr 59 widal kit 60 widal test 61 consumables for fully automated biochemistry analizer closed system ( make erba model elite 580 ) 62 erba protime ls 63 erba sample cuvette for pt inr 64 erba elite h580 lyse 1 65 erba elite h580 lyse 2 66 erba elite h580 lyse 3 67 erba elite h clean 68 erba elite h580 diluent 69 erba glucose ( 10 x44ml ) 70 erba hdl cholesterol with calibrator ( 4x30 / 4x10 ml ) system pack 71 erba triglyceride { r1 5 x 44 ml / r2 5 x 11 ml } ( system pack ) 72 erba cholesterol { r1 10 x 44 ml } ( system pack ) 73 erba urea { r1 5 x 44 ml / r2 5 x 11 ml } ( system pack ) 74 erba creatinine { r1 5 x 44 ml / r2 5 x 11 ml } ( system pack ) 75 erba sgot ( 6x44 / 3x22 ml ) 76 erba sgpt ( 6x44 / 3x22 ml ) 77 erba bilirubin direct { 6 x 44 ml / 3 x 22 ml } ( system pack ) 78 erba bilirubin total { 6 x 44 ml / 3 x 22 ml } ( system pack ) 79 erba uric acid ( 5 x 11 ml / 5 x 4 ml ) 80 erba albumin 81 erba total protein { 10 x 44 ml } ( system pack ) 82 erba calcium ( 5 x 6 ml ) 83 erba alkaline phos ( 5 x 22 ml / 5 x 6.8 ml ) 84 erba lipase ( 1x44 ml r2; 1x11 ml ) 85 erba amylase ( 5 x 11 ml ) 86 erba ckmb ( 2 x 11 ml / 2 x 4 ml ) 87 erba gamma gt ( 2 x 22 ml 2 x 6.8 ml ) 88 erba hba1c system pack 89 erba adenosine deaminase ( ada ) 90 erba magnesium 91 erba auto wash kit ( ( 10x100ml ) system pack ) 92 erba xl multical ( { 4 x 3 ml } ( system pack ) ) 93 erba path kit 94 erba norm kit 95 consumables for fully automated biochemistry analizer closed system ( make randox model imola ) 96 albumin ( liquid ) ( 9x15 ) 97 alt ( gpt ) ( liquid ) ( r1 6x51, r2 6x14 ) 98 alk.phos ( liquid ) ( r1 6x51, r2 6x14 ) 99 ast ( got ) liquid ( r1 6x51, r2 6x14 ) 100 amylase ( liquid ) ( r14x16, r2 4x5 ) 101 bilrubin ( direct ) ( liquid ) ( r1 2x30, r2 8x4 ) 102 bilirubin ( total ) ( r1 2x50, r2 8x4 ) 103 calcium ( liquid ) ( mono reagent ) ( 9x51 ) 104 co2 total ( r1 4x21.7 ) 105 cholesterol ( liquid ) ( 9x51 ) 106 hdl cholesterol ( liquid ) ( r1 3x51, r2 3x20 ) 107 ldl cholesterol ( liquid ) ( r1 3x51, r2 3x20 ) 108 ck nac ( r1 4x20, r2 4x6 ) 109 ck mb ( r1 4x20, r2 4x6 ) 110 complement component 3 ( liquid ) ( r1 3x20, r2 3x6 ) 111 complement component 4 ( liquid ) ( r1 3x20, r2 3x6 ) 112 crp ( liquid ) ( r1 6x20, r2 3x9 ) 113 creatinie ( liquid ) ( r1 6x51, r2 3x28 ) 114 ferritin ( r1 3x20, r2 3x11 ) 115 fructosamine ( liquid ) ( r1 4x19.8, r2 4x6.9 ) 116 glucose ( liquid ) ( 9x51 ) 117 gamma gt ( liquid ) ( r1 6x51, r2 6x14 ) 118 hba1c / hb ( liquid ) ( r1 3x14, r2 3x14 ) 119 haptoglobin ( r1 1x12, r2 2x2.75 ) 120 lga ( liquid ) ( r1 3x20 , r2 3x14 ) 121 lgg ( liquid ) ( r1 3x20 , r2 3x14 ) 122 lgm ( liquid ) ( r1 3x20 ) 123 lactate ( 4x95t ) 124 ld pyruvate lactate ( liquid ) ( r1 6x20, r2 3x11 ) 125 ld lactate pyruvate ( liquid ) ( r1 6x20, r2 3x18 ) 126 lipase ( r1 3x9 , r2 3x6 ) 127 lithium _2 ( liquid ) ( r1 2x18.3 r2 2x6.5 ) 128 aso ( r1 2x9, r2 2x14 ) 129 apolipoprotein a 1 ( liquid ) ( r1 4x30, r2 4x12 ) 130 apolipoprotein b ( liquid ) ( r1 4x20, r2 4x6 ) 131 microalbumin ( liquid ) ( r1 6x20, r2 3x8 ) 132 mahesium ( liquid ) ( mono reagent ) ( 6x20 ) 133 myglobin ( liquid ) ( r1 1x7 , r2 1x6 ) 134 transthyretin ( prealbumin ) ( liquid ) ( r1 6x20, r2 3x11 ) 135 phosphorus ( inorganic ) ( liquid ) ( r1 6x20, r2 3x20 ) 136 rheumatoid factor ( liquid ) ( r1 2x20, r2 2x8 ) 137 phenobarbital ( r1 2x17, r2 2x6 ) 138 phenytoin ( r1 2x17, r 2x6 ) 139 digoxin ( r1 2x8, r2 2x6 ) 140 theophylline ( r1 2x17, r2 2x5 ) 141 gentamicin ( r1 2x15, r2 2x5 ) 142 valproic acid ( r1 2x12, r2 2x5 ) 143 carbamazapine ( r1 2x12, r2 2x5 ) 144 wash solution no1 ( 6x25 ) 145 wash solution no2 ( 6x25 ) 146 wash solution no3 ( 6x25 ) 147 c1 wash solution no ( 2500 ) 148 iron ( liquid ) ( r1 6x20, r2 3x11 ) 149 transferrin ( liquid ) ( r1 6x20, r2 3x14 ) 150 total iron binding capacity ( r1 4x9, r2 4x4 ) 151 total protein ( liquid ) ( mono reagent ) ( 9x51 ) 152 triglycerides ( liquid ) ( 6x51 ) 153 uric acid ( liquid ) ( r1 6x51, r24x20 ) 154 urea ( liquid ) ( r1 6x51, r24x20 ) 155 calibration sera level 3 ( 20x5 ) 156 hdl / ldl cholesterol calib. ( 3x1 ) 157 ck mb control ( 10x2 ) 158 ck mb calib. ( 10x1 ) 159 crp calib. ( multi point, liquid ) ( 3x1 ) 160 hba1c calib. series ( 1x8, 5x2 ) 161 hba1c control level 1 and level 2 ( 2x2x0.5 ) 162 human assayed multi sera level 3 ( 20x5 ) 163 human assayed multi sera level 2 ( 20x5 ) 164 lipid control level 1 ( 5x3 ) 165 lipid control level 2 ( 5x3 ) 166 lipid control level 3 ( 5x3 ) 167 aso. calib. ( 5x1 ) 168 apoliportein calibrator ( 3x1 ) 169 microalbumin control level 1 & level 2 ( liquid ) ( level 1 3x1 ) 170 microalbumin calib. series ( 6x2 ) 171 specific protein assayed control level 1 ( liquid ) ( 3x1 ) 172 specific protein assayed control level 2 ( liquid ) ( 3x1 ) 173 specific protein assayed control level 3 ( liquid ) ( 3x1 ) 174 rhemumatoid factor calib. series ( 5x1 ) 175 therapeutic drug calib. series ( 6x3 ) 176 drug control level 1 ( 20x5 ) 177 drug control level 2 ( 20x5 ) 178 drug control level 3 ( 20x5 ) 179 consumables for fully biochemistry analizer closed system ( make randox, model modena ) 180 alk.phos ( liquid ) ( r2 6x14 ) 181 amylase ( liquid ) ( r1 4x16, r2 4x5 ) 182 co2 total ( r1 4x21.7 ) 183 ldl cholesterol ( liquid ) ( r1 3x51, r2 3x20 ) 184 ck nac ( r1 4x20, r2 4x6 ) 185 ck mb ( r1 4x20, r2 4x6 ) 186 complement component 3 ( liquid ) ( r1 3x20, r2 3x6 ) 187 complement component 4 ( liquid ) ( r1 3x20, r2 3x6 ) 188 fructosamine ( liquid ) ( r1 4x19.8, r2 4x6.9 ) 189 lga ( liquid ) ( r1 3x20 , r2 3x14 ) 190 lgg ( liquid ) ( r1 3x20 , r2 3x14 ) 191 lgm ( liquid ) ( r1 3x20 ) 192 lactate ( 4x95t ) 193 ld pyruvate lactate ( liquid ) ( r1 6x20, r2 3x11 ) 194 ld lactate pyruvate ( liquid ) ( r1 6x20, r2 3x18 ) 195 lithium _2 ( liquid ) ( r1 2x18.3 r2 2x6.5 ) 196 mahesium ( liquid ) ( mono reagent ) ( 6x20 ) 197 myglobin ( liquid ) ( r1 1x7 , r2 1x6 ) 198 transthyretin ( prealbumin ) ( liquid ) ( r1 6x20, r2 3x11 ) 199 phosphorus ( inorganic ) ( liquid ) ( r1 6x20, r2 3x20 ) 200 rheumatoid factor ( liquid ) ( r1 2x20, r2 2x8 ) 201 phenobarbital ( r1 2x17, r2 2x6 ) 202 digoxin ( r1 2x8, r2 2x6 ) 203 theophylline ( r1 2x17, r2 2x5 ) 204 gentamicin ( r1 2x15, r2 2x5 ) 205 valproic acid ( r1 2x12, r2 2x5 ) 206 carbamazapine ( r1 2x12, r2 2x5 ) 207 wash solution no1 ( 6x25 ) 208 wash solution no2 ( 6x25 ) 209 wash solution no3 ( 6x25 ) 210 c1 wash solution no ( 2500 ) 211 transferrin ( liquid ) ( r1 6x20, r2 3x14 ) 212 total iron binding capacity ( r1 4x9, r2 4x4 ) 213 total protein ( liquid ) ( mono reagent ) ( 9x51 ) 214 calibration sera level 3 ( 20x5 ) 215 hdl / ldl cholesterol calib. ( 3x1 ) 216 ck mb control ( 10x2 ) 217 ck mb calib. ( 10x1 ) 218 crp calib. ( multi point, liquid ) ( 3x1 ) 219 hba1c control level 1 and level 2 ( 2x2x0.5 ) 220 human assayed multi sera level 3 ( 20x5 ) 221 human assayed multi sera level 2 ( 20x5 ) 222 lipid control level 1 ( 5x3 ) 223 lipid control level 2 ( 5x3 ) 224 lipid control level 3 ( 5x3 ) 225 aso. calib. ( 5x1 ) 226 apoliportein calibrator ( 3x1 ) 227 microalbumin control level 1 & level 2 ( liquid ) ( level 1 3x1 ) 228 microalbumin calib. series ( 6x2 ) 229 specific protein assayed control level 1 ( liquid ) ( 3x1 ) 230 specific protein assayed control level 2 ( liquid ) ( 3x1 ) 231 specific protein assayed control level 3 ( liquid ) ( 3x1 ) 232 rhemumatoid factor calib. series ( 5x1 ) 233 therapeutic drug calib. series ( 6x3 ) 234 drug control level 1 ( 20x5 ) 235 drug control level 2 ( 20x5 ) 236 drug control level 3 ( 20x5 ) 237 consumables for blood cell counter closed system ( make mindray ) 238 m18 dilluent ( 20 liter ) 239 m18 cfl lyse ( 500 ml ) 240 m18 rinse ( 20 liter ) 241 m18 e z cleaner ( 100 ml ) 242 m18 probe cleaner ( 17ml ) 243 paper roll ( 30mts ) 244 quality control ( 1 set ) 245 m53 diluent ( 20 liter ) 246 m53 leo 1 ( 1000 ml ) 247 m53 leo ii ( 400 ml ) 248 m53 lh lyse ( 500ml ) 249 m53 cleanzer ( 1000ml ) 250 m53 probe cleaner ( 50ml ) 251 m30 diluent ( 20 liters ) 252 m30 rinse ( 20 liters ) 253 m30 cfl lyse ( 500 ml ) 254 m30 e z cleaner ( 100ml ) 255 m30 probe cleaner ( 15ml ) 256 m52 diluent ( 20 liters ) 257 m52 lh lyse ( 100ml ) 258 m52 diff lyse ( 500 ml ) 259 m52 probe cleaner ( 50ml ) 260 consumables for closed system ( stago fully automated coagulation analyzer ) 261 sta neoplastine cl+5 ( 6 x 5 ml ) 262 sta cephascreen 4 ( 12 x 4 ml ) 263 sta stellite cuvettes ( 6 x 220 ) 264 sta coag control n+p ( 12 x 2 x 1 ml ) 265 sta system control n+p ( 12 x 2 x 1 ml ) 266 sta liatest control n+p ( 12 x 2 x 1 ml ) 267 sta thrombin 2 ( 12 x 2 ml ) 268 sta liquid fib ( 12 x 4 ml ) 269 sta cacl 2 0.025m ( 24 x 15 ml ) 270 sta uniclibrator ( 6 x 1 ml ) 271 ptt la ( 6 x 2 ml ) 272 sta dificient viii ( 6 x 1ml ) 273 sta dificient ix ( 6 x 1ml ) 274 sta dificient vii ( 6 x 1ml ) 275 sta dificient v ( 6 x 1ml ) 276 sta dificient ii ( 6 x 1ml ) 277 sta dificient xi ( 6 x 1ml ) 278 sta dificient ix ( 6 x 1ml ) 279 sta sificient x ( 6 x 1ml ) 280 sta staclot protein c ( 3 x 1 ml ) 281 sta staclot protein s ( 2 x 1 ml ) 282 sta stachrom at iii 3 ( 4 x 3 ml ) 283 sta owren koller ( 24 x 15 ml ) 284 sta cleaner solution ( 6 x 2500 ml ) 285 sta desorb u ( 24 x 15 ml ) 286 white stirring bar ( 1 pc ) 287 red stirring bar ( 1 pc ) 288 sta micro cups ( 100 pc ) 289 consumables for fully automatic biochemistry analyzer closed system ( bio systems ) ( ba 400 ) 290 protien ( total ) ( 600 ml ) 291 protien ( urine ) ( 240 ml ) 292 creatinine ( 600 ml ) 293 glucose ( 600 ml ) 294 cholestrol ( 600 ml ) 295 phosphorus ( 340 ml ) 296 iron ferrozine ( 300 ml ) 297 bilirubin ( total ) ( 600 ml ) ) 298 urea / bun uv ( 600 ml ) 299 g glutamyltransferase ( g gt ) ( 300 ml ) 300 uric acid ( 600 ml ) 301 triglycerides ( 600 ml ) 302 ast / got ( 600 ml ) 303 alt / gpt ( 600 ml ) 304 aplha amylase eps ( 150 ml ) 305 albumin ( 600 ml ) 306 aplha amylase dirrect ( 160 ml ) 307 cholesterol hdl direct ( 160 ml ) 308 calcium arsenzo ( 600 ml ) 309 lactate dehydrogenase ( ldh ) ( 600 ml ) 310 lactate dehydrogenase ( ldh ifcc ) ( 600 ml ) 311 cholesterol ldl direct ( 160 ml ) 312 alkaline phosphates ( alp ) dea ( 300 ml ) 313 alkaline phosphates ( alp ) amp ( 300 ml ) 314 creatinine kinase ( ck ) ( 150 ml ) 315 creatinine kinase mb ( ck mb ) ( 150 ml ) 316 lipase ( 120 ml ) 317 magnesium xylidyl ( 150 ml ) 318 alpha amylae pancreatic ( 150 ml ) 319 bilirubin ( direct ) as ( 300 ml ) ) 320 microalbumin ( 300 ml ) 321 anti streptolysin o ( aso ) ( 150 ml ) 322 apoliprprotein ( apo a 1 ) ( 150 ml ) 323 apolipoprotein ( apo b ) ( 150 ml ) 324 anti thrombin iii ( 150 ml ) 325 a 1 acid glycoprotein ( 120 ml ) 326 a 1 microglobulin ( 150 ml ) 327 beta 2 microglobulin ( 150 ml ) 328 carbon dioxide ( co2 ) ( 120 ml ) 329 cholinesterase ( che ) ( 150 ml ) 330 complement componene c3 ( 120 ml ) 331 complement componene c4 ( 120 ml ) 332 c reactive protein ( crp ) ( 300ml ) 333 c reactive protein hs ( crp hs ) ( 150 ml ) 334 ferritin ( 120 ml ) 335 fibrinogen ( 150 ml ) 336 immunoglobulin a ( iga ) ( 120 ml ) 337 immunoglobulin g ( igg ) ( 120ml ) 338 immunoglobulin m ( igm ) ( 120 ml ) 339 rheumatoid factors ( ra ) ( 300 ml ) 340 pre albumin ( 120 ml ) 341 transferrin ( 120 ml ) 342 hemoglobin a1c direct nconc washing solution nreaction rotor ( 144ml ) 343 conc washing solution ( 500 ml ) 344 reaction rotor ( 10 pc ) 345 exhaust fan 346 washing solution 347 waste bottle 348 connectors ( operating arm hose ) 349 needle probe ( each arm ) 350 whole outer body 351 filter each 352 dispensing teflon tube 353 flat cable 354 power cable 355 arm cable 356 washing system pump 357 rotor belt 358 calibrator / control / standards for closed system ( bio systems ) ( ba 400 ) 359 bilirubin standard ( 1x5ml ) 360 biochemistry calibrator ( 5x5 ml ) 361 apolipoprotein al standard ( 1x1 ml ) 362 apolipoprotein b standard ( lx1 ml ) 363 hdl / ldl standard ( 1x1 ml ) 364 haemoglobin alc control normal ( 1x0.5ml ) 365 haemoglobin alc control elevated ( 1x0.5ml ) 366 control urine ( 1x5 ml ) 367 micro albumin standard ( lx1 ml ) 368 aso standard ( 1x1 ml ) 369 ada control ( 2x1 ml ) 370 ada standard ( 1 ml ) 371 lipid controli ( 3x1 ml ) 372 lipid control ii ( 3x1 ml ) 373 biochemistry control serum ( human ) li ( 5x5 ml ) 374 biochemistry control serum ( human ) l2 ( 5x5 ml ) 375 biochemistry control serum l1 ( 5x5 ml ) 376 biochemistry control serum l1 ( 20x5 ml ) 377 biochemistry control serum l2 ( 5x5ml ) 378 biochemistry control serum l2 ( 20x5 ml ) 379 rheumatoid control serum l1 ( 3x1 ml ) 380 rheumatoid control serum l2 ( 3x1 ml ) 381 crp / hs crp standard ( lx1 ml ) 382 ferritin standard ( 1x3 ml ) 383 hbalc standard ( 4x0.5 ml ) 384 rf standard ( 1x3 ml ) 385 pediatric cups ( lx1000 ) 386 analyzer for closed system ( bio systems ) ( ba 400 ) 387 a amylase ( 6x25 ml ) 388 a amylase ( 5x5ml ) 389 acid phosphatase ( 1x40ml ) 390 alanine aminotransferase ( alt / gpt ) ( 1x50ml ) 391 alanine aminotransferase ( alt / gpt ) ( 1x200ml ) 392 alanine aminotransferase ( alt / gpt ) ( 1x500ml ) 393 albumin ( 1x250ml ) 394 albumin ( 2x250ml ) 395 alkaline phosphatase ( amp ) ( 1x200ml ) 396 alkaline phosphatase ( dea ) ( 1x200ml ) 397 aspartate naminotransferase ( ast / got ) ( ix50ml ) 398 aspartate naminotransferase ( ast / got ) ( 1x200ml ) 399 aspartate naminotransferase ( ast / got ) ( lx500ml ) 400 bilirubin ( direct ) ( 4x50ml ) 401 bilirubin ( direct ) ( 2x500ml ) 402 bilirubin ( total ) ( 4x50ml ) 403 bilirubin ( total ) ( 2x500ml ) 404 bilirubin ( total&direct ) ( 2+2x50ml ) 405 bilirubin ( total&direct ) ( 500+500ml ) 406 calcium az ( 1x200ml ) 407 calcium az ( 1x500ml ) 408 cholestrol ( 1x50ml ) 409 cholestrol ( 1x200ml ) 410 cholestrol ( 1x500ml ) 411 cholestrol hdl direct ( lx80ml ) 412 cholestrol ldl direct ( 1x80ml ) 413 cholestrol hdl ( 2x50+2x50ml ) 414 cholestrol hdl ppt ( 1x50ml ) 415 cholestrol ldl ppt ( 1x20ml ) 416 ck ifcc liq ( lx50ml ) 417 ck ifcc liq ( 4x50ml ) 418 ck mb liq ( 1x50ml ) 419 creatinine ( 2x50ml ) 420 creatinine ( 4x50ml ) 421 creatinine ( lx1000ml ) 422 fructosamine ( 2x50ml ) 423 ggt ( lx50ml ) 424 glucose ( 1x500ml ) 425 glucose ( 5x200ml ) 426 iron ferrozine ( 4x50ml ) 427 iron chromazurol ( 4x50ml ) 428 iron binding capacity ( tibc ) ( 50test ) 429 lactate dehydrogenase ( ldh ) ifcc ( 1x50ml ) 430 lipase ( 1x60ml ) 431 magnesium ( 4x50ml ) 432 phosphorus ( 170ml ) 433 total protein ( 1x250ml ) 434 total protein ( 2x250ml ) 435 protein ( urine ) ( 4x50ml ) 436 triglycerides ( lx50ml ) 437 triglycerides ( 4x50ml ) 438 triglycerides ( 2x250ml ) 439 urea ( bun colour ) ( 4x50ml ) 440 urea ( bun uv ) ( 4x50ml ) 441 urea ( bun uv ) ( 2x250ml ) 442 uric acid ( 1x50ml ) 443 uric acid ( 1x200ml ) 444 fructose ( lx50ml ) 445 citrate ( 1x50ml ) 446 micro albumin ( 1x20ml ) 447 micro albumin ( 1x50ml ) 448 apolipoprotein a1 ( 1x50ml ) 449 apolipoprotein b ( 1x50ml ) 450 hs crp ( 1x50ml ) 451 complement component c3 ( 1x50ml ) 452 complement component c4 ( 1x50ml ) 453 ferritin ( lx15ml ) 454 ferritin ( 1x45ml ) 455 immunoglobilin a ( iga ) ( lx50ml ) 456 immunoglobilin a ( igg ) ( 1x50ml ) 457 immunoglobilin a ( igm ) ( 1x50ml ) 458 transferrin ( 1x50ml ) 459 aso ( 1x50ml ) 460 crp ( 1x50ml ) 461 rf ( lx50ml ) 462 prealbumin ( lx50ml ) 463 anti thermbin lll ( lx50ml ) 464 al acid glycoprotein ( 1x50ml ) 465 b2 mircoglobulin ( 1x50ml ) 466 anti streptolysin ( aso ) slide test ( 50test ) 467 anti streptolysin ( aso ) slide test ( 150 test ) 468 c reactive protein ( crp ) slide test ( 50test ) 469 c reactive protein ( crp ) slide test ( 150 test ) 470 rheumatoid factor ( rf ) slide test ( 50test ) 471 rheumatoid factor ( rf ) slide test ( 150test ) 472 hbaic direct ( 1x60 ml ) 473 bilirubin standard ( 1x5ml ) 474 biochemistry calibrator ( 5x5ml ) 475 apolipoprotein al standard ( 1x1 ml ) 476 apolipoprotein b standard ( lxlml ) 477 protein calibrator ( 5x1ml ) 478 hdl / ldl standard ( lx1 ml ) 479 prealbumin standard ( 1x1ml ) 480 heamoglobin alc control normal ( 1x0.5ml ) 481 heamoglobin alc control elevated ( 1x0.5 ml ) 482 control urine ( 1x5ml ) 483 micro albumin standard ( lx1 ml ) 484 aso standard ( lx1 ml ) 485 alpha 1 microglobulin standard ( 3ml ) 486 ada control ( 2xlml ) 487 ada standard ( iml ) 488 lipid controll ( 3xlml ) 489 lipid control ll ( 3xlml ) 490 biochemistry control serum ( human ) nl1 ( 5x5 ml ) 491 biochemistry control serum ( human ) nl2 ( 5x5 ml ) 492 biochemistry control serum l1 ( 5x5ml ) 493 biochemistry control serum l1 ( 20x5 ml ) 494 biochemistry control serum l2 ( 5x5ml ) 495 biochemistry control serum l2 ( 20x5 ml ) 496 rheumatoid control serum l1 ( 3xlml ) 497 rheumatoid control serum l2 ( 3xlml ) 498 crp / hs crp standard ( lx1ml ) 499 ferritin standard ( 1x3ml ) 500 hbalc standard ( 1x2ml ) 501 rf standard ( 1x3ml ) 502 prevecal human control serum ( 12x5ml ) 503 protein ( total ) ( 10x50ml ) 504 protein ( urine ) ( 5x50ml ) 505 creatinine ( 10x50ml ) 506 glucose ( 10x50ml ) 507 cholestrol ( 10x50ml ) 508 phosphorus ( 2x50ml ) 509 iron ferrozine ( 5x50ml ) 510 bilirubin total ( 5x50ml ) 511 bilirubin direct ( 5x50ml ) 512 magnesium ( 2x50ml ) 513 alkaline phosphate dea ( 5x20ml ) 514 urea / bun uv ( 5x50ml ) 515 alkaline phosphate amp ( 5x20ml ) 516 ggt ( 5x50ml ) 517 uric acid ( 10x50ml ) 518 triglycerides ( 10x50ml ) 519 aspartate aminotransferase n ( ast / got ) ( 5x50ml ) 520 alanine aminotransferase ( alt / gpt ) ( 5x50ml ) 521 albumin ( 5x50ml ) 522 a amylase ( 5x20ml ) 523 hdl direct ( 4x20ml ) 524 ldl direct ( 4x20ml ) 525 calcium az ( 10x50ml ) 526 lactate dehydrogenase ( ldh ) ( 5x50ml ) 527 ada ( 4x10ml ) 528 ck ( 3x15ml ) 529 ck mb ( 3x15ml ) 530 lipase ( 3x15ml ) 531 conc washing solution ( 100 ml ) 532 conc system liquid ( 1000ml ) 533 electrolyte management kit ( 900ml ) 534 consumables for closed system ( siemens centaur xp ) 535 t3 ( 400 test / kit ) 536 t4 ( 500 test / kit ) 537 tsh ( 500 test / kit ) 538 ft3 ( 250 test / kit ) 539 ft4 ( 250 test / kit ) 540 cal a for t3 ( 1 test / kit ) 541 cal a for t4 ( 1 test / kit ) 542 cal b for tsh ( 1 test / kit ) 543 ancillary reagent for t3 ( 1 test / kit ) 544 ancillary reagent for t4 ( 1 test / kit ) 545 sample tips 546 sample cups 547 cuvettess 548 wash 1 549 acid base ( a&b ) solution 550 cleaning solution 551 plain tubes with cap 552 kits & chemicals 553 iso propyl alchohol ( 1 liters ) ( merck / qualigen / fisher ) 554 benzene ( 1 liters ) ( merck / qualigen / fisher ) 555 formaline ( 1 liters ) ( merck / qualigen / fisher ) 556 hematoxyline powder ( fisher / loba ) 557 dpx ( 500ml ) ( merck / qualigen / fisher ) 558 microtome blade ( leica / chile ) 559 alluminium potassium sulphate ( 1kg ) ( merck / qualigen / fisher ) 560 mercuric oxide ( 100 gm ) ( merck / qualigen / fisher ) 561 carbolic soap 562 ammonium potassium sulphate ( 500 gm ) 563 nitric acid 564 hiv kit elisa 565 hiv kit rapid 566 hcv kit elisa 567 hcv kit rapid 568 hbsag kit elisa 569 hbsag kit rapid 570 rpr ( vdrl ) kit 571 rpr kit strip 572 rapid malaria antigen detection test card for pv& pf antigen 573 anti abd monoclonal ( igm ) 10ml 574 anti d blend, monoclonal ( igm + igg ) anti sera 575 anti a1 lectin 576 anti ab monoclanal 577 anti h 578 activated papain enzyme stablized solution 579 anti c 580 anti c 581 anti e 582 anti e 583 coombs anti sera 584 id gel cross match card ( ahg ) ( cooms ) test card 585 gel diluent 2 liss 586 blood bag double 350ml 587 blood bag double 450 ml 588 blood bag triple 450ml 589 single donor platelet / plasma kit, with acd a bag 500ml ( for apheresis ) 590 chemical 591 mannitol 592 absolute alcohol 593 acetone 594 albumin flakes 595 alpha naphthol 596 alpha naphthylamine 597 ammonium di hydrogen phosphate 598 ammonium molybdat 599 ammonium oxalate 600 ammonium sulphate 601 barium chroride 602 basic fuschin 603 benzidine powder 604 betadin solution 605 bile salt 606 bismuth ammonium citrate 607 bleaching powder 608 blood group anti serum a, b & o 609 bole billirudin 610 bole billiverdin 611 bromine liquid 612 bromothymol blue 613 calcium pure 614 casein 615 conc. h2so4 616 conc. hno3 617 concentrated hcl 500, l 618 copper acetate 619 cotton roll 620 creatinine powder 621 crystal voilet 622 cuso4 crystal 623 d.p.x. mount 624 dextrose 625 di methyl amino benzaldehyde 626 di pot. hydrogen phasphate 627 di sodium ortho phosphate 628 dibasic sod. phosphate 629 disodium hydrogen phosphate 630 distill water 5 ltr 631 e.d.t.a. powder 632 ecg jelly 250gm 633 eosin ( cdh / merck ) 634 eosin stain ( for histology staining ) 635 ferric chloride ( fecl3 ) 636 field stain a&b 637 filter paper sheet whathman, no.1 638 fontana stain 639 formaldehyde ( formalin ) 37% 640 formaldehyde ( formalin ) 37% 641 formaldehyde ( formalin ) 37% 642 formaldehyde 40% 200 kg pack 643 formaldehyde 40% 500 ml pack 644 fructose 645 gelatin 646 giemsa powder 647 giemsa stain 648 glacial acetic acid 649 glucose 650 glycerine 05 liter pack 651 gms stain 652 h2o2 653 hand lotion 250ml antiseptic washing 654 hand sanitizers 655 hydrogen peroxide 656 hydrogen peroxide ( h2o2 ) 657 hydrogen peroxide soln 20% 658 india ink 659 iodine 660 kovacs indole reagent 661 l.asparagine 662 lactic acid 663 lactophenol cotton blue 664 lactose 665 lead acetate 666 leishman stain solution 667 lens cleaner 2000ml 668 liquid paraffin heavy 669 liquid praffin 500ml 670 liquor ammonia 671 lysozyme 672 malachite green 673 maltose 674 mercury for b.p. instrument 500gm 675 methanol 676 methyl red ( ph indicator ) 677 methyl violet 678 methylene blue 679 na natroprusside 680 nalc powder 681 neutral red indicator 682 paraffin wax 683 paraffin wax roll for test tube sealing 684 peptone 685 ph strips ( ph 1 10 ) 686 phenol crystal 687 phenolphthalein 688 phenyl hydrazine hydrochloride 689 phosphate pure 690 picric acid 691 pot. dichromate 692 pot. hydroxide 693 potasium alum 694 potassium iodide 695 pottassium iodide 696 rectified spirit 697 ressorcinol 698 saffranine 699 salphate pure 700 silver nitrate 701 sodium acetate 702 sodium carbonate 703 sodium chloride 704 sodium chloride 705 sodium dihydrogen phosphate 706 sodium hydroxide 707 sodium hydroxide ( flakes ) 708 sodium hydroxide pellets 709 sodium hypochloride 710 sodium sulphate 711 sodium taurocholate ( bile salt ) 712 spirit 713 starch 714 sterile ontainer 715 sucrose 716 sulphur powder 717 sulphuric acid 718 tetra methylparaphenyl diaminodihydro chloride ( oxidase reagent ) 719 thallus acetate 720 thymol crystals 721 tincture benzoin co 722 tri sodium citrate 723 trichloro acetic acid 724 urea 725 urea powder 726 whatmas filter paper no. ( standard size ) 727 xyline ( 1liters ) ( merck / qualigen / fisher ) 728 yeast extract powder 729 glass ware 730 amplifire for neurograph 731 anaerobic gas pack for 3.5 lit capacity, disposable oxygen absorbing, carbon dioxide generating agent used in anaerobic system no need to use catalysts or pressure gauge 732 anaerobic indicator tables for anaerobic system ( for anaerobic system ) 733 anaerobic system rubber rings ( for anaerobic system ) 734 arnold sterilizer 735 b.p. appraturs ( stand type ) 736 b.p. blade 24 no. 737 beaker ( 1000cc ) 738 beaker ( 100cc ) 739 beaker ( 500cc ) 740 beaker ( 50cc ) 741 beaker 100ml 742 beaker 200ml 743 blood bag tube stripper mannual 744 bone marrow aspiration needle ( 16, 18, 20 no. ) 745 bone marrow trephine biopsy needle 746 bottle with clear transparent glass 50ml 747 capillary tube 1 mm ( long ) 748 capillary tube 1mm or all size 749 centrifuge tube 15ml 750 centrifuge tube 2ml ( p.p ) 751 chamical balance 752 charging droppers 753 collection vail 2ml 754 collection vail 5ml 755 colony counter digital for bacteriology, digital display to cout 9999 756 colorimeter cuvetts 757 conical flask flat bottom ( 1000cc ) 758 conical flask flat bottom ( 250cc ) 759 conical flask flat bottom ( 500cc ) 760 conical flask flat bottom ( 50cc ) 761 coplins jar 50ml 762 coppling jars ( horizontal ) 763 demonstration stethoscope with multiple earpiece 764 distilled water plant ( all glass ) 765 dropping bottel 766 dropping bottles for stains ( plastic ) 767 durhams tube 768 e.s.r. tube 769 ecg roll 770 eeg electrodes for neurograph 771 esr tube ( wwstergren ) 772 flask bottom flask 2 ltr capaciy 773 flat bottom flask 5 liter capacity 774 flat bottom ph electrode for ph determination for use on soft moist surface like agar gel plate and both on solid and semisolid surface 775 funnel 776 glass pipetts each of each size 777 glass slide ( sunbeam / bluestar ) 778 glass slide ( size 76x55mm ) thickness 1.35mm 779 glass slide ( size 76x22mm ) thickness :1.45mm ) 780 glass trough pneumatic 781 glycerine 782 haemocytometer 783 haemoglobinometer ( sahils ) 784 hammer ( reflex ) 785 hb tube 786 ink well for neurograph 787 jar glass ( 2ltr ) 788 lovibond comparators 789 lp bone marrow needle 790 lp needle ( top spinal ) 22x89mm 791 mackartaneys bottle 792 maker pen for digital colony counter 793 measuring cylinder 1000ml 794 measuring cylinder 100ml 795 measuring cylinder 500ml 796 micro coverslips ( 18mmx18mm ) square 797 micro coverslips ( 19mmx19mm ) square 798 micro coverslips ( 22mmx22mm ) square 799 micro coverslips ( 22mmx25mm ) rectangular 800 micro coverslips ( 22mmx30mm ) rectangular 801 micro coverslips ( 22mmx30mm ) rectangular 802 micro coverslips ( 22mmx40mm ) rectangular 803 micro coverslips ( 22mmx500mm ) rectangular ( special ) 804 micro coverslips ( 22mmx50mm ) rectangular 805 micro coverslips ( 22mmx60mm ) rectangular ( special ) 806 micro coverslips ( 24mmx24mm ) square ( special ) 807 micro coverslips ( 24mmx40mm ) rectangular ( special ) 808 micro coverslips ( 24mmx60mm ) rectangular ( special ) 809 micro coverslips ( 24mmx60mm ) rectangular ( special ) 810 micro coverslips ( 25mmx50mm ) rectangular ( special ) 811 micro coverslips ( 25mmx60mm ) rectangular ( special ) 812 micro coverslips 18mm circular 813 micro coverslips 19mm circular 814 micro coverslips 22 mm circular 815 micro coverslips 24mm circular 816 micro pippete 10 ul 817 micro pippete 20 ul 818 micro pippette 1000 ul 819 micro pippette 100ul 820 micro pippette 200 ul 821 micro pippette 50 ul 822 micro pippette 500ul 823 micro pippette tips ( 200 1000ul ) 824 micro pippette tips ( 2 200ul ) 825 micro tips yellow size small 826 micrometer stage 827 micropipate ( 00 to 210 micro litter ) 828 micropipate ( 00 to 1500 microlitter ) 829 micropipette tips 0 200μl 830 micropipette tips 1000μl 831 micropipette tips 200 μl 832 microscope oil immersion moveable stage abbe condenser etc 833 multichannel micropipette 10μl ( fixed volume, 8 channel with built in tip ejector 834 multichannel micropipette 100μl ( fixed volume, 8 channel with built in tip ejector 835 multichannel micropipette 200μl ( fixed volume, 8 channel with built in tip ejector 836 multichannel micropipette 50μl ( fixed volume, 8 channel with built in tip ejector 837 museum jar ( rectangular with lid ) 838 n 95 mask 839 patri dish 9cm glass 840 pcv tube ( wintrobe ) 841 petri plate carrier for 10 paltes anerobic system 842 ph meter digital 843 pippete 1ml 844 pippete 5ml 845 plastic container for collection of stool, pus, sputum, with sepcimens 20ml capacity, sterile 846 plastic container for collection of stool, pus, sputum, with sepcimens 50ml capacity, sterile 847 platinum wire loop 848 postmortem glvoes size 8 ½ 849 pricking needles 850 priestley smith perimeter 851 rack for patridish 852 reagent bottle ( 1000cc ) 853 reagent bottle ( 100cc ) 854 reagent bottle ( 2000cc ) 855 reagent bottle ( 250cc ) 856 reagent bottle ( 500cc ) 857 reagent bottle ( 50cc ) 858 reagent bottle 100ml 859 reagent bottle 50ml 860 regent bottle 250ml 861 rubber bulb for pipettes big 862 rubber bulb for pipettes small 863 rubber teats varium volume 864 scissors big size 865 single channel fixed volume micropipette 10μl 866 single channel fixed volume micropipette 100μl 867 single channel fixed volume micropipette 25μl 868 single channel fixed volume micropipette 50μl 869 single channel micropipette variable volume 100 1000μl 870 slide 76mmx25mm 871 spatula 872 spirit lamp 873 staining trough 874 stature needles ( half dozen stainless stell ) cat no. round bodied half circle size 1 875 surgical gloves 7 876 surgical glvoes 6 ½ 877 test tube borocilicated ( 100x12mm ) 878 test tube borocilicated ( 150x18mm ) 879 test tube borocilicated ( 75x12mm ) 880 test tube basket 881 test tube glass 5ml 882 test tube holder 883 test tube plastic with cap 5ml 884 test tube stand ( big ) 885 test tube washing brush 886 test tube with rim 05 cm 887 test tube with rim 10cm 888 thermometer 889 urinometer 890 vdrl shaker 891 water both ( serological ) 56c 892 writing pen for neurograph 893 stationary 894 attendance register 2 qr 895 attendance register 4 qr 896 calculator 897 carbon paper ( 8x13 blue ) 898 chalk color ( 1x100 per pkt, non dust type ) 899 chalk white ( 1x100 per pkt, non dust type ) 900 correcting fluid [ white fluid with diluter, 30 ml ( 15ml fluid + 15ml diluter ) ] 901 cotton tag ( 6 long ) 100 pcs per bunch ) 902 dak book 2qr 903 envelope ( 11x5, laminated 100gsm ) 904 envelope ( 11x5, white 57gsm ) 905 envelope ( 12x16, brown paper 100gsm ) 906 envelope ( 8x10, laminated 100gsm ) 907 examination copy 24 pages ( size 32x20cm ) 60 gsm with numbering neolith paper 908 examination supplementary copy 12 pages ( size 32x20cm ) 60 gsm with numbering neolith paper 909 favicol 50gms 910 file cover 911 file folder 912 file lace ( 18 cloth green / white 924 ) 913 file pad 914 glue stick ( 18gms ) 915 glue stick ( 8gms ) 916 gum bottle ( 150ml ) 917 gum bottle ( 700ml ) 918 ink pad ( medium size ) 919 paper clip ( 15mm ) 920 paper clip ( 41mm ) 921 paper pin 400gm 922 paper punching machine big size 923 paper weight 924 photocopy pape a3 size ( 75gsm 500sheets ) 925 photocopy pape a4 size ( 75gsm 500sheets ) 926 photocopy pape fs size ( 75gsm 500sheets ) 927 pin cushion ( magnet type, standard size plastic body ) 928 ruled regiter 3 qr ( 8 ½ x 13 ½ ) 929 ruled regiter 6 qr ( 8 ½ x 13 ½ ) 930 ruled regiter 8 qr ( 8 ½ x 13 ½ ) 931 ruled reigter 4 qr ( size 8 ½ x 13 ½ ) 932 sealing wax 933 stamp pad ( big size ) ( 7cm x 14cm metal case ) 934 stamp pad ( small size ) 935 stamp pad ( small size ) ( 5cmx9cm ) metal case 936 stapler big size no. 24 / 6 937 stapler hp 45 938 stapler pin no.10 939 stapler pin no.24 / 6 940 tag ( big green ) 941 a4 size printing single side 942 a4 size printing double side 943 a5 size printing single side 944 a5 size printing double side 945 a3 size printing single side 946 a3 size printing double side...

Indian Army - Madhya Pradesh

23078958 supply of expendable medical stores: 1 haemocult rapid card test ( occult blood test ) kit of 50 tests 2 keto diastixbott of 50 strips 3 pregnancy test strip ( upt ) 4 urine glucose and protein strips ( bottle of 100 ) sd 5 urine multi stix 10 sg siemens 6 abst octa disc ready made ( gnb ) 7 abst octa disc ready made ( gpc ) 8 acetone commercial 9 alcohol dehydrated ( ethanol ) 10 bactec / alert aerobic biomerieux 11 bactec / alert aerobic paediatric 12 blood agar base 13 cled agar 14 d p x mounting med 15 formalin ( 05 ltr can ) 16 hydrogen peroxide solution 500 ml 17 kit for pas ready to use 18 knife bard parker, blade size 2 fitting ( commercial no.22 ) packet of 6 19 mgg stain kit ( may grunwald giemsa ) 20 pap stain rapid 21 paper, filter, round ( greens no. 795 ) 9 cm, pkt of 100 22 paper, filter, square ( greens no. 795 ) 51 cm x 51 cm, pkt of 100 23 paraffin liquid 24 paraffin wax ( tissue embedding ) 25 parrafin tissue block moulds ( metal / steel ) 26 perl’s iron stain kit 27 petri dish 90 mm disposable 28 cover slip, microscopic, rectangular 22x50 mm 29 slide, microscope, size 75mm x 25mm 30 sterile containers 50ml ( wide mouth, sealed ) 31 sterile swab sticks 32 tissue embedding rings ( pack of 500 ) 33 tissue cassettes ( plastic ) 34 uti agar 35 xylene ( xylol pure ) 36 gram’s stain 37 zn stain kit readymade 38 slee microtome blade ( pack of 50 ) 39 macconkey agar media 40 mha agar media 41 giemsa stain ready to use 42 glycerine ar ( glycerol ) 43 methanol 44 hiviral transport medium ( vtm ) ( pack of 25 tests ) 45 centrifuge tube , 50ml pw1224 46 cell clean for sysmex xp 100 ( 50 ml ) 47 cell pack 20lt ( sysmex xp 100 ) 48 e check calibrator for sysmex xp 100 49 eightcheck 3wp ( set of three controls ( low, normal, high ) compatible with sysmex xp 100 50 g6pd kit of 10 test 51 leishman’s stain ready to use with buffer for bone marrow study ( 500ml ) 52 printer roll for sysmex hemat analyzer ( xp 100 ) 53 pt ( prothrombin time ) reagent ( vial of 25 tests ) 54 pttk reagent with kaolin 55 reticulocyte stain kit readymade 56 malarial antigen detection kit ( pf pv antigen based hrp 2, parasitic ldh ) 57 stromatolyser wh ( 500 ml ) 58 hiv elisa kit 59 hbsag elisa kit 60 hiv i & ii rapid test kit ( tridot / quadro ) 61 rapid card screening for hbv 62 rapid card screening for hcv ( tridot ) 63 hav rapid test 64 hev rapid test 65 vdrl rapid test 66 bovine albumin 22% 67 anti – h lactin 68 anti –a1 lactin 69 serum anti human globulin 70 serum haemaglutinating gp. b ( anti a ) ( monoclonal ) 71 serum haemaglutinating gp. a ( anti b ) ( monoclonal ) 72 serum haemaglutinating gp. ab ( anti ab ) ( monoclonal ) 73 serum anti. d ( for saline tube test ) 74 micropipettes, tips for 1 200 ul 75 micropipettes, tips for 200 1000 ul 76 distilled water 77 crp rapid kit ( 35 test each ) 78 dengue ns1, igg, igm test combo 79 erba wash kit 4x50 ml 80 kit for estimation of amylase ( 12x5ml ) 81 kit for estimation of bilirubin t / d ( 2x60ml, 2x60ml ) 82 kit for estimation of calcium ( 2x50 ml ) 83 kit for estimation of ck mb ( 2x8 ml, 2x2 ml ) 84 kit for estimation of cpk ( 2x8 ml, 2x2 ml ) 85 kit for estimation of hdl cholesterol ( 2x50 ml ) 86 kit for estimation of ldh ( 4x8 ml, 1x8 ml ) 87 kit for estimation of lipase ( 1x20 ml ) ( 1x5ml ) 88 kits for estimation of alkaline phosphatase ( 2x50 ml ) actual 4x24, 4x6 ml 89 kits for estimation of creatinine ( 4x60 ml ) 90 kits for estimation of sgot ( ast ) , 5x20 ml 91 kits for estimation of sgpt ( alt ) , 5x20 ml 92 kit for triglyceride estimation ( 5x20 ml ) 93 kits for estimation of total protein ( 5x50 ml ) 94 kits for estimation of albumin ( 5x50 ml ) 95 kits for estimation of cholestrol ( 5x20 ml ) 96 kits for estimation of glucose ( 2x200 ml ) 97 kits for estimation of urea ( 5x20 ml ) 98 kits for estimation of uric acid ( 5x20 ml ) 99 protein csf kit ( 1x50 ml ) micro protein 100 tube, test, 75 mm x 12 mm, rimless 101 widal test kit ( 4 x 5 ml ) , 50 tests per kit 102 ehrlich haematoxylin stain 103 tissue paper roll 104 vaccutainer sterile with gel, 5ml, gold bd 105 vaccutainer edta, 3ml, lavender bd 106 vaccutainer sodium fluoride 3ml , gray bd 107 vaccutainer heparin tubes, 4ml , green bd 108 vaccutainers sodium citrate, 2.7ml ( plastic citrate tube, m / 3.2%, 13 x 75mm, 2.7 ml, light blue ) bd 109 vaccutainers sterile, 4ml, red bd 110 micropipette variable volume ( 0 200 microlitre ) 111 micropipette variable volume ( 200 1000 microlitre ) 112 rheumatoid factor rapid testing kit ( 35 tests ) 113 aso titre rapid kit 114 dextrose monohydrate for oral use ( glucose powder ) 115 hand gloves size 7 116 hand gloves size 7 1 / 2 117 hand gloves size unsterile 118 sterilium 119 cotton wool absorbent 120 syringe disposable, plastic, sterile 5 ml with needle 121 syringe disposable, plastic, sterile 10 ml with needle 122 chloroxylenol solution ( dettol ) 123 sodium hypochloride 5% soln ( can of 5 ltr ) ...

Shyam Shah Medical College - Madhya Pradesh

22481749 supply of caimecals and reagents 1 paraffin wax 58 60 2 potassium aluminum sulfate purified ka (s04)2 12h2o 3 disposable microtome blades ultra size 4 formaldyhide 40% 5 filterpaper 2 nos 6 nitric acid 7 isopropyl 8 xylene 9 glass slide 10 heamatoxyline stain qualigens 11 dpx mount 12 glass cover size 22x 50 mm 13 glycerol 14 thymol crystal 15 hcl....

Indian Army - Madhya Pradesh

21195159 supply of expendable medical stores: 1 cover slips 22 x 30 mm 2 haemocult rapid card test ( occult blood test ) kit of 50 tests 3 keto diastixbott of 50 strips 4 pregnancy test strip ( upt ) 5 urine glucose and protein strips ( bottle of 100 ) sd 6 urine multi stix 10 sg siemens 7 abst octa disc ready made ( gnb & gpc ) 8 acetone commercial 9 alcohol amyl 10 alcohol dehydrated ( ethanol ) 11 bactec / alert aerobic biomerieux 12 bactec / alert aerobic paediatric 13 biomerieux reflectance standards ( bact alert ) complete set 14 blood agar base 15 cled agar 16 d p x mounting med 17 formalin ( 05 ltr can ) 18 hydrogen peroxide solution 500 ml 19 kit for pas ready to use 20 knife bard parker, blade size 2 fitting ( commercial no.22 ) packet of 6 21 mgg stain kit ( may grunwald giemsa ) 22 pap stain rapid 23 paper, filter, round ( greens no. 795 ) 9 cm, pkt of 100 24 paper, filter, square ( greens no. 795 ) 51 cm x 51 cm, pkt of 100 25 paraffin liquid ( 500ml ) 26 paraffin wax ( tissue embedding ) 27 parrafin tissue block moulds ( metal / steel ) 28 perl’s iron stain kit 29 petri dish 90 mm 30 cover slip, microscopic, rectangular 22x50 mm 31 slide, microscope thickness 1.15 mm to 1.35mm, size 76mm x 50mm 32 slide, microscope, size 75mm x 25mm 33 sterile containers 50ml ( wide mouth, sealed ) 34 sterile swab sticks 35 tissue embedding rings ( pack of 500 ) 36 tissue cassettes ( plastic ) 37 uti agar 38 xylene ( xylol pure ) 39 gram’s stain 40 zn stain kit readymade 41 slee microtome blade ( pack of 50 ) 42 microbiological water testing field kit ( h2s indicator ) 43 macconkey agar media 44 mha agar media 45 giemsa stain ready to use 46 glycerine ar ( glycerol ) 47 methanol 48 hiviral transport medium ( vtm ) ( pack of 25 tests ) 49 centrifuge tube , 50ml pw1224 50 cell clean for sysmex xp 100 ( 50 ml ) 51 cell pack 20lt ( sysmex xp 100 ) 52 disposable auto sucking esr tube ( westerngrens ) 53 e check calibrator for sysmex xp 100 54 eightcheck 3wp ( set of three controls ( low, normal, high ) compatible with sysmex xp 100 55 g6pd kit of 10 test 56 leishman’s stain ready to use with buffer for bone marrow study ( 500ml ) 57 printer roll for sysmex hemat analyzer ( xp 100 ) 58 pt ( prothrombin time ) reagent ( vial of 25 tests ) 59 pttk reagent with kaolin 60 reticulocyte stain kit readymade 61 malarial antigen detection kit ( pf pv antigen based hrp 2, parasitic ldh ) 62 stromatolyser wh ( 500 ml ) 63 hiv elisa kit 64 hbsag elisa kit 65 hiv i & ii rapid test kit ( tridot / quadro ) 66 rapid card screening for hbv 67 rapid card screening for hcv ( tridot ) 68 hav rapid test 69 hev rapid test 70 vdrl rapid test 71 bovine albumin 22% 72 anti – h lactin 73 anti –a1 lactin 74 serum haemaglutinating gp. b ( anti a ) ( monoclonal ) 75 serum haemaglutinating gp. a ( anti b ) ( monoclonal ) 76 serum haemaglutinating gp. ab ( anti ab ) ( monoclonal ) 77 serum anti. d ( for saline tube test ) 78 micropipettes, tips for 1 200 ul 79 micropipettes, tips for 200 1000 ul 80 distilled water 81 crp rapid kit ( 25 test each ) 82 dengue ns1, igg, igm test combo 83 eppendorf tubes ( 1000ul ) 84 erba wash kit 4x50 ml 85 kit for estimation of amylase 86 kit for estimation of bilirubin t / d 87 kit for estimation of calcium 88 kit for estimation of ck mb 89 kit for estimation of cpk 90 kit for estimation of hdl cholesterol 91 kit for estimation of ldh 92 kit for estimation of lipase 93 kits for estimation of alkaline phosphatase 94 kits for estimation of creatinine 95 kits for estimation of sgot ( ast ) 96 kits for estimation of sgpt ( alt ) 97 kit for triglyceride estimation 98 kits for estimation of total protein 99 kits for estimation of albumin 100 kits for estimation of cholestrol 101 kits for estimation of glucose 102 kits for estimation of urea 103 kits for estimation of uric acid 104 protein csf kit ( micro protein ) 105 tube, test, 75 mm x 12 mm, rimless 106 widal test kit ( 4 x 5 ml ) , 50 tests per kit 107 ehrlich haematoxylin stain 108 tissue paper roll 109 vaccutainer sterile with gel, 5ml, gold bd 110 vaccutainer edta, 3ml, lavender bd 111 vaccutainer sodium fluoride 3ml , gray bd 112 vaccutainer heparin tubes, 4ml , green bd 113 vaccutainers sodium citrate, 2.7ml ( plastic citrate tube, m / 3.2%, 13 x 75mm, 2.7 ml, light blue ) bd 114 micropipette variable volume ( 0 200 microlitre ) 115 micropipette variable volume ( 200 1000 microlitre ) 116 ra factor rapid kit 117 aso titre rapid kit 118 dextrose monohydrate for oral use ( glucose powder ) 119 sodium hypochloride 5% soln ( can of 5 ltr ) 120 liquid developer can of 5 ltr 121 abg cartilage eg7+ 122 abg cartilage cg4+ 123 abg cartilage cg3+ 124 i stat abg machine paper printer 125 thermal printing paper size 110mm x 20mtr...

Indian Army - Madhya Pradesh

20111529 supply of expendable medical stores: 1 cover slips 22 x 30 mm 2 haemocult test ( occult blood test ) kit of 50 tests. 3 keto diastixbott of 50 strips 4 pregnancy test strip ( upt ) 5 urine glucose and protein strips ( bottle of 100 ) sd 6 urine multi stix 10 sg siemens 7 abst octa disc ready made ( gnb & gpc ) 8 acetone commercial 9 alcohol amyl 10 alcohol dehydrated ( ethanol ) 11 bactec / alert aerobic biomerieux 12 bactec / alert aerobic paediatric 13 biomerieux reflectance standards ( bact alert ) complete set 14 blood agar base 15 cled agar 16 d p x mounting med 17 diamond glass writing 240 / 240 18 formalin ( 05 ltr can ) 19 hydrogen peroxide solution 500 ml 20 kit for pas ready to use 21 knife bard parker, blade size 2 fitting ( commercial no.22 ) packet of 6 22 mgg stain kit ( may grunwald giemsa ) 23 pap stain rapid 24 paper, filter, round ( greens no. 795 ) 9 cm, pkt of 100 25 paraffin liquid ( 500ml ) 26 paraffin wax ( tissue embedding ) 27 parrafin tissue block moulds ( metal / steel ) 28 perl’s iron stain kit 29 petri dish 90 mm 30 cover slip, microscopic, rectangular 22x50 mm 31 slide, microscope thickness 1.15 mm to 1.35mm, size 76mm x 50mm 32 sterile containers 50ml ( wide mouth, sealed ) 33 sterile swab sticks 34 tissue embedding rings ( pack of 500 ) 35 tissue cassettes ( plastic ) 36 uti agar 37 xylene ( xylol pure ) 38 gram’s stain 39 zn stain kit readymade 40 slee microtome blade ( pack of 50 ) 41 microbiological water testing field kit ( h2s indicator ) 42 macconkey agar media 43 mha agar media 44 cell clean for sysmex xp 100 ( 50 ml ) 45 cell pack 20lt ( sysmex xp 100 ) 46 disposable auto sucking esr tube ( westerngrens ) 47 e check calibrator for sysmex xp 100 48 eightcheck 3wp ( set of three controls ( low, normal, high ) compatible with sysmex xp 100 49 g6pd kit of 10 test 50 leishman’s stain ready to use with buffer for bone marrow study ( 500ml ) 51 mpo stain kit => limited...

Indian Army - Madhya Pradesh

12364517 supply of medical stores, => limited tender 1 inj adrenalin amp of 2ml 2 inj noradrinaline 2mg / ml amp of 2ml 3 tab pheniramine maleate 25mg 4 inj phenargan 50mg vial of 2ml 5 inj phenobarbitone 200mg / ml amp of 1ml 6 tab letrozole 2.5mg 7 tab folic acid 5mg 8 inj esmolol 10mg vial of 10ml 9 inj metoprolol 1mg / ml amp of 5ml 10 tab warfarin 5mg 11 oint clobetazole tube of 15gm 12 oint soframycin tube of 20gm 13 inj lasix 20mg amp of 2ml 14 syp antacid bott of 100ml 15 tab clarithromycin 500mg 16 inj perinorm 5mg / ml amp of 2ml 17 inj dicyclomine 10mg amp of 2ml 18 denoprostadine ( cerviprime ) gel 19 inj lispro vial of 300ml 20 tab metformin sr 1gm 21 inj atracurium 10mg / ml amp of 2.5ml 22 inj pancuronium bromide 2mg / ml amp of 2ml 23 ciprofloxacin eye ointment tube of 20gm 24 drop iron bott of 15ml 25 tab lithium carbonate 300mg 26 ipravent resp bott of 15ml 27 asthalin 200mcg mdi 28 asthalin solution bott of 15ml 29 syp cough expectorant bott of 100ml 30 glucose powder pkt of 500gm 31 inj dextrose 50% 32 inj calcium gluconate 50mg vial of 10ml 33 calciferol sachet pkt of 34 budecort resp bott of 15ml 35 tab ethambutol 800mg 36 inj ketamine 10mg vial of 10ml 37 tab augmentin 625mg 38 tab augmentin 1gm 39 tab acyclovir 800mg 40 guedals airway ( red, green, yellow ) 41 tab haloperidol 5mg 42 syp avil bott of 100ml 43 oint miconazole tube of 15gm 44 oint nopil tube tube of 50gm 45 tab doxylamine succinate 10mg 46 tab anastrazole 1mg 47 tab rasagiline 1mg 48 cap harty d 49 tab terbinafine 250mg 50 syp colimex bott of 30ml 51 syp ondansetron bott of 30ml 52 syp zincovit bott of 15ml 53 rotahaler 54 silver sulphadiazide cream tube of 20mg 55 duolin resp bott of 15ml 56 tab setmatil 5mg 57 tab vildagliptin 50mg 58 cream luliconazole 59 e / d carboxy methyl cellulose 0.5% bott of 10ml 60 barium powder 61 tab rizatriptan 5mg 62 sporolac sachet pkt of 4 sachet 63 inj tetanus toxoid vial of 10ml 64 inj hepatitis b vial of 5ml 65 tab pencillin g 400mg 66 inj dextrose 10% 67 inj vancuronium 4mg amp of 2ml 68 vasopressin 20 units / ml inj 1ml amp 69 inj tramadol amp of 2ml 70 inj rabies vaccine amp of 1ml 71 inj rabies immunoglobulin 300iu 72 inj rabies immunoglobulin 100iu 73 ultrasound gel 74 tab chymoral forte 75 pentasure protein powder bott of 400gm 76 r / c duolin 77 inh foracort bott of 120mdi 78 code free glucose strips bott of 50 test 79 tab quetiapine sr 200mg 80 inj succinylcholine chloride inj vial of 1ml 81 gram stain 82 giemsa stain 83 micro pore 6cm 84 multi strips bott of 50 strips 85 uro strips bott of 50 strips 86 aec fluid bott of 250ml 87 pandys reagent bott of 100ml 88 thermal roll paper ( 57mmx25 ) sony 89 microtome blade 90 h & e stain 91 minoxidil 5% lotion bott of 60ml 92 pap stain 93 absolute alcohol bott of 500ml 94 paraffin wax bott of 500ml 95 abst disk ( gpc & gnb ) 96 suger set ( ready made ) 97 micro pipette ( 0 500 micro lit ) 98 blood culture bottle ( adult & child ) 99 micro pipette ( 0 5 micro lit ) 100 micro pipette ( 50 200 micro lit ) 101 micro pipette ( upto 1ml ) 102 i gel ( lma ) 103 lg stain bott of 500ml 104 retic stain 105 gms ( gomoris methenamine silver stain ) bott og 500ml 106 h & t stain bott of 500ml 107 perls stain bott of 250ml 108 mpo stain bott of 250ml 109 pas stain bottt of 250ml 110 congo red stain bott of 250ml 111 anti sera a, b, d ( combo pack ) 112 ahg 113 zn stain 100ml 114 fdp 60test 115 ael fluid 116 micro protein 117 dengue kit of 10 test 118 trop t kit of 5 test 119 widal 5x2ml 120 ra factor 5x2ml 121 crp 5x2ml 122 aso 5x2ml 123 cidex bott of 5ltr 124 elastoplaster 3mtr 125 pencil cell aa 126 surgical skin stapler 127 tot ( trans operated tape ) tapes 128 tot huks 129 tigaderm 7x4cm 130 laryngeal mask airway size 1 131 laryngeal mask airway size 1.5 132 laryngeal mask airway size 2 133 laryngeal mask airway size 2.5 134 paediatric central line 3f 135 paediatric central line 5f 136 umbilical catheter 3f 137 umbilical catheter 5f 138 vygon bacterial filters iv 139 exchange transfusion set 140 paediatric dialysis set 141 double lumen iv extention line 142 cpap circuits 143 ventilator circuit paediatric 144 neonatal ventilator circuit 145 gluco strips alere g1 bott of 50 strips 146 sodium valporate chrono 750mg 147 tab torsemide 20 mg 148 iv catheter double luman 149 multi catheter triple lumen 3f 150 multi catheter triple lumen 5f 151 pure savlone bott of 500 ml 152 syp frusemide 153 aminivin solution 154 hepamerz sachet 155 tab fertisure m...