Government College - Madhya Pradesh

38007489 rate contract for medical items , equipments / instruments , hbsagcard 50 , hiv card 50 , urine for albumin / sugar 100 , urine for pregnancy stip and card 50 , malaria antigen pf / pv 50 , urine strip for 5 para 100 , syphlis card for vdrl 50 , rapidaso ( latex slide test ) 20 , rapid crp ( latex slide test ) 20 , rapid ra ( latex slide test ) 20 , rapid widal ( o, h, ah, bh ) slide test 4*5ml , widal ( o, h, ah, bh ) test tube method 4x50ml , blood group kit ( antisera ) 3*10ml , glucose ( god pod ) 4x50ml , cholesterol ( chod pod mathod ) 4x25ml , direct hdl cholesterol 2 x 24 / 2 x 8 ml , triglycerides ( gpo pap 4x25ml , bilirubin ( t&d ) ( modified jendrassik method ) 4x50ml , sgot ( ast ) kinetic 5*10ml , sgpt ( alt ) kinetic 5*10ml , alkaline phosphatase ( pnpp ) kinetic 3*10ml , uric acid ( uricase ) 5x5ml , urea ( ned kinetic ) 4 x 20 / 4 x 5ml , creatinine fk ( kinetic ) 2 x 25 / 2 x 25ml , ra ( quantitative immune turbid metric 50ml , aso ( quantitative ) 50ml , calcium ( ocpc ) 1x50ml , crp ( rapid quantitativetest finecare ) 25 test , crp ( quantitative ) 2 x 20 / 2 x 5ml , hba1c ( rapid quantitativetest finecare ) 25 test , sodium hypochlorite 5 lt , vitamin d ( rapid quantitativetest finecare ) 25 test , psa ( rapid quantitativetest finecare ) 25 test , ca 125 ( elisa ) 96 test , vitamin b12 ( elisa ) 96 test , lh ( elisa ) 96 test , fsh ( elisa ) 96 test , prl ( elisa ) 96 test , hbsag ( elisa ) 96 test , ferritin ( elisa ) 96 test , t3 ( rapid quantitativetest finecare ) 25 test , t4 ( rapid quantitativetest finecare ) 25 test , tsh ( rapid quantitativetest finecare ) 25 test , il 6 ( rapid quantitativetest finecare ) 25 test , d dimer ( rapid quantitativetest finecare ) 25 test , t3 ( elisa ) 96 test , t4 ( elisa ) 96 test , tsh ( elisa ) 96 test 96 test , bariumchloride 10% w / v 500ml , benedictsreagent 5lt , fouchet’s reagent 250ml , drabkins solution with standard ( for hb ) 5000ml , glacial acetic acid 500ml , edta 5% w / v 500ml , sulfuric acid con. 500ml , field stain a 500ml , field stain b 500ml , hydrochloric acid n / 10 500ml , immersion oil ( microscopy grade ) dropping bottle 30ml , immersion oil ( microscopy grade ) dropping bottle 25 ml , wbc diluting fluid 500ml , rbc diluting fluid 500ml , reticulocyte counting fluid ( biolab ) 25 ml , semen diluting fluid 100ml , formalin 5 lt , formalin 30lt , fructose 100ml , acetone 250 test , leishman stain with buffer 250ml , sulphur powder 500g , liquor ammonia solution 500gm , sodium nitroproside 100gm , carbol fuchsin ( zn strong ) 500ml , methy line blue 500ml , xyline 2.5ltr , needle 23, 24 1x100nos , spirit 4.5 ltr ( methy ) , distilled water 5ltr , paps smear staining , slide stand albuminium , esr niddle , micropipet stand , hemocytometer , glucometre dr morphen , glucometerstrips 1x50nos dr morphen , micropipette fix volume , micropipette variable volume 0.5 5ul , micropipette variable volume 5 50ul , micropipette variable volume 10 100ul , micropipette variable volume 20 200ul , micropipette variable volume 100 1000ul , incubator ( inner chamber ss digital with fan ) 14x14x14 , water wath ( digital ) 10x12x7 , hemoglobin meter with set , urinometer , slide box , pipette glass 2.0ml , pipette glass 5.0ml , pipette glass 0.2ml , pipette glass 0.1ml , pipette glass 10*75mm , pipette glass 10*75mm , test tube without rim plastic 1x100nos , test tube without rim 1x100nos , glass rod , rbc pipette 100 , wbc pipette 10gm , capillary tube 1x100nos , cover slip 18, or 22mm 1x20 nos pack , wintrobe tube for esr , test tube cleaning brush , pipette bulb , test tube holder , tourniquet , citrate vail , edta k3 vail , fluoridevail , plain vail ( activator ) , ria vail 100 , chattels forceps straight ss , urine container sterile 30 ml 1 pack , micropipete tips 10 100 u and 100 1000 u, 1 pack , tissue paper roll , filterpaper 100 pack , insulin syringe , polythene gloves 100 , surgical gloves 6; no 7 n0 , non dispo gloves 100 pack , postmortem gloves 1 pack , syringe 50ml , syringe , 20 ml , syringe 10 ml , syringe , 5ml , syringe 2ml , ecg gelly 250ml , usg gelly 250ml , cotton roll 500 g , usg roll upp 1105 in ( 110mmx20m ) thirmal print media ) , povidione solution 500 ml , povidione ointment 15gm , savlon 1ltr , dettol 1ltr., , dettol500ml, , hydrogen peroxide 450 ml , lignocaine gelly 2% , lignocaine inj with adrenol 2% 30ml , lignocaine spray 10 % , lignocaine inj 2% , lignocaine inj 4% , lignocaine tropical vial 4% , tinbenzone 100ml , bandage ( antiseptic ) , micropore 2inch , micropore 4inch , n. saline, dns, d5, d10 , scalpvan set , berbar thred 20 no. , enema pot , enema pipe with nozal , hot water beg , rubber catheter red , bandage than , roll bandage 0.5x 0.5, 7 , roll bandage 5x 5 , roll bandage 10x5 , ecg roll ( 12 channel gotiz ) , mechintosh1 mtr , head cap disposable 100 , sanitizer 100 ml with sprey , x ray film digital fuzi 14x17 , x ray film digital duzi 8 x 10 , nylon silk suture4.0 , 31inch*72inch color white non woven fabric for single use bedsheet , weighing machine adult , weighing machine child , weighing machine digital , stethoscope adult , stethoscope child , bp instrument led mercury , glucometer strips 1x50nos dmorphen , formalin4.5 lt , pulse oximeter , non contact thermometer , face mask disposable 3 layer , n 95 face mask , occult blood card , lugols iodine ( bottle 100ml ) , diluent ( 5pda ) ( 20l ) merril , fbh lyse ( 500 ml ) merril , fdoi lyse ( 500 ml ) merril , fdti ( 200ml ) merril , celquant 5 detergent ( 4x100ml ) merril , stop watch digital , rectangular mildred glass jars with lids sizes5.5 cm length4.5cm width 9. 5cm height , rectangular mildred glass jars with lids sizes10.5 cm length 8.5 cm width 15.5 cm height , foetal doppler , iui canula ( 17cm ) , fumigator , infant feeding tube , sterilizer 10*12 , oxygen cylinder 40 tft , dressing drum ( big ) 8*10 , dressing drum ( big ) 10*12 , dressing drum ( big ) 12*12 , surgical scissor medium ss , surgical forceps medium ss , needle holder medium ss , surgical artery forcep mediumss , hole sheet 2 ½, 4 cotton , plan sheet 2 ½, 3cotton , ot table cover 3, 7cotton , plastic apron , restoration gic , light cure composite kit ( tech econom plus ) , light cure flowable gic , light cure caoh2 dressing , suture needle holder , suture cutting scissors , 3 0 silk suture reverse cutting edge , mouth prop ( small ) , mouth prop ( medium ) , mouth prop ( large ) , cryer elevator , root elevator standard , mouth mirror , kidney tray medium ss , composite filling instruments kit ( plastic filling instrument ) , normal big size scissors , matrix band kit , wedges , patient drape , 3ml syringe 26g 1½, needle ( unolock ) luer lock , explorer , periosteal elevator , root elevator ( right&left plain ) , luting gic , diamond bur round , diamond bur inverted cone 2 , diamond bur flame shape , airotor ( push button ) , scaler tips ( dte d1 ) 1set , avilinjection 2 ml , dexamethasoneinjection 2 ml , atropine injection 1ml , hydrocort injection 10ml , compose injection 2ml , i v metrogyl 100ml , i v ciplox100ml , dynapar injection 1ml , botroclot solution , tab formalin , iv set , silk thread 1 , silk thread 0, 2 , silk thread 0, 3 , silk thread 0 , wikoryl throat 2.0 , catgut 2 , catgut 0, 1 , catgut 0 , catgut 01 , catching needle 01 no , iv cannula 20 no , iv cannula 22 no , surgical blade 11 no , model dissection of the right mammary gland , model anastomosing arteries around the scapula , model dissection of left gluteal region. gluteus maximus and gluteus medius have been removed, and quadratus femoris has been reflected. in the specimen, the inferior gluteal artery was medial to the internal pudendal instead of lateral to it. , model dissection of left popliteal fossa. the upper boundaries have been pulled apart and the aponeurosis to which the two heads of the gastrocnemius are attached has been split and the heads separated. for deeper dissection. , model dissection of gluteal region and back of thigh , model dissection of front and lateral side of leg. , model284:304dissection of+b273 dorsum of foot , model superficial dissection of leg viewed from posteromedial side, showing veins and nerves. note the numerous anastomoses between the great and the small saphenous veins , model superficial dissection of leg viewed from posterolateral side showing veins and nerves. in the specimen there were numerous large anastomosing channels between the small and the great saphenous veins , modeldeep dissection of back of leg , modeldissection of medial side of ankle, showing the relations of the flexor retinaculum. ( model no. 1 ) , modeldissection of leg and foot showing synovial sheaths. ( model no. 2 ) , modelsuperficial dissection of sole of foot to show plantar aponeurosis. the skin and superficial fascia, except the superficial transverse ligament, have been removed, and the fibrous flexor sheaths partially opened. , modelsuperficial dissection of sole of foot. the plantar aponeurosis has been revomed. the abductor digiti minimi & the abductor hallucis have been pulled aside , modeldissection of sole of foot. most of the flexor digitorum brevis has been removed. deep dissection of sole of foot… model 1 , model dissection of sole of foot. most of the flexor digitorum brevis has been removed. deep dissection of sole of foot…model 2note : allmodels are of 18x34 or 18x20 inchesin size , made up of fiber glass, unbreakable, washable and again paintable. note : allmodels are of 18x34 or 18x20 inchesin size , made up of fiber glass, unbreakable, washable and again paintable. , specimen jars with knobbed stopper ( 4x1.5 ) , specimen jars with knobbed stopper ( 6x2 ) , specimen jars with knobbed stopper ( 8x2 ) , specimen jars with knobbed stopper ( 10x2 ) , specimen jars with knobbed stopper ( 12x2 ) , specimen jars with knobbed stopper ( 8x3 ) , specimen jars with knobbed stopper ( 10x3 ) , specimen jars with knobbed stopper ( 12x3 ) , specimen jars with knobbed stopper ( 15x3 ) , specimen jars with knobbed stopper ( 6x4 ) , specimen jars with knobbed stopper ( 8x4 ) , specimen jars with knobbed stopper ( 10x4 ) , specimen jars with knobbed stopper ( 12x4 ) , specimen jars with knobbed stopper ( 15x4 ) , specimen jars with knobbed stopper ( 8x6 ) , specimen jars with knobbed stopper ( 12x6 ) , specimen jars with knobbed stopper ( 15x6 ) , baird parker agar medium , bismuth sulphite agar medium , caseinsoyabean digest agar medium , cetrimide agar medium , brilliant green agar medium , macconkey agar medium , macconkey brothmedium , mannitol salt agar medium , nutrient agar medium , nutrient broth medium , urea broth medium , vogel johnson agar medium , dioxysholate citrate agar medium , sabouraud dextrose agar medium , plate count agar ( pca ) , primary secondry amine , 1% acetic acid in acetonitrile , benedicts reagent , tollen reagent , molish reagent , sudan iv , millon reagent , mayer reagent , hagers reagent , dragendorffs reagent , anisaldehyde sulphuric acid , vanillin sulphuric acid , india ink stain , alvert stain , mrvp agar , motility agar , mrvp reagent , andole reagent , bhi broth , cled agar , sda agar , oxidase disc , lj media , hi crome agar , kovacs reagent , 2% glucose mha , afb stain , mucller hinton agar , triple sugar iron agar , peptone , gram stain , safaranin solution , lead apron ( for x ray ) , thyroid shield ( for x ray ) , gonad shield ( for x ray ) , lead gloves pair ( for x ray ) , lead goggles ( for x ray ) ...

Police Department - Madhya Pradesh

38003211 tender for supply of various equipments absolute alcohol acetic acid glacial acetone ammonium sulphate ammonia benzene chloroform diethyl ether p nehape n heptane methanol nesslers reagent palladium chloride petroleum ether (60 80°c) petroleum ether (40 60°c) silica gel silica gel g 60 f254 pre coated tlc plate aluminium sheets (20 x 20 cm) silica gel g glass plate (20 x 20 cm) schiffs reagent test tubes 20 ml bromoform 98% benzidine hydrogen peroxide eosin prepared reagent haemotoxilin prepared reagent glacial acetic acid microscopic cover glass/cover slips marker for body examination fluid filter paper 46x 57 cm or more filter paper size 18 x 22 inch or more sanitizer/hand disinfectant hand wash tough tag dropper/ pasteur pipette surface sterilizer test tubes 200 test tubes 100...

Directorate Of Health Services - Madhya Pradesh

37800141 tender for supply of drugs and medicines during the year 2023 2024 1 (group a medicine) year 2023 24 2 inj.acyclovir 250mg/vial 3 inj.adenosine2 ml amp. 4 inj.adrenaline i.p. 1 mg/ ml 5 inj.adrenochrome monosemicarbazone 0.75 mg/ml 6 inj. anti diptheria serum vial 7 inj.alfa beta artether 2 ml/im 8 inj.amikacin 500 mg 9 inj.amikacin 100 mg/ 2ml vial 10 inj.amikacin 250 mg/ 2ml vial 11 inj.aminophylline 25 mg/ml 10 ml amp 12 inj.ampicillin 250 mg/ vial 13 inj.ampicillin 500 mg/ vial 14 inj.ampicillin 1gm/vial 15 inj. ampicilline + chloxacilline 250mg+250mg 16 inj amoxycillin 500mg 17 amoxycillin and potassium clavulanate injection i.p. (1 gm + 0.2 gm)/10 ml 18 inj amoxicilin + clavulanic acid 19 inj anawin 5ml spinal anaesthesia 20 inj. act1nomycin d 0.5 mg 21 inj.anti d vaccines vial 22 inj.antitetanous immunoglobuline 250 iu vial 23 inj.artesunate 60mg/vial 24 inj.atropine sulphate 0.6 mg/ ml (sc/im/iv) 2ml 25 inj.b1, b6, b12 10ml 26 inj.b complex 10ml 27 inj.benzathine penicilline 12 lac unit 28 inj.benzathine penicilline 6 lac unit 29 inj.betamethasone 1 ml 30 inj.botrapase 31 inj. bortezomib 2 mg 32 inj.budesonide 0.25 m/g 2ml amp 33 inj.bupivacaine hydrochloride 0.25 % 10 ml vial 34 inj.calcium chloride 1.4mg/ml 10ml 35 inj.calcium gluconate 10% 10 ml amp 36 inj.calcium with vitamin d 3 37 inj.capnea 2ml 38 inj.carboprost250 mg pgf2a 39 inj. calcium leucovorin 50 mg 40 inj. carboplatin 150 mg 41 inj. carboplatin 450 mg 42 inj. carmustine 100 mg 43 inj. cetuximab 100 mg 44 inj. cetuximab 500 mg 45 inj. cisplatin 10 mg 46 inj. cisplatin 50 mg 47 inj. cyclophosphamide 200 mg 48 inj. cyclophosphamide 500 mg 49 inj. cytra.bine 100 mg 50 inj. cytrabine 1000 mg 51 inj. cyenocoballine 30mg 52 inj.cefaparazone 1 gm. 53 inj.cefaparazone 2 gm. 54 inj.cefaparazone 1000mg + sulbactan 1000mg 55 inj.cefazolin sodium500mg 56 inj.cefazolin sodium 1gm 57 inj.cefazolin sodium 250mg, 58 inj.cefotaxime sodium 1 gm 59 inj.cefotaxime sodium 250mg 60 inj.cefotaxime sodium 500mg 61 inj.cefotaxime + subectum 1gm+500mg 62 inj.ceftazidine 1 gm. 63 inj.ceftazidine 250 mg. 64 inj.ceftazidine 500 mg. 65 inj.ceftriaxone+tazobactum 1gm+125mg 66 inj.ceftrioxone 1 gm. / vial 67 inj.ceftrioxone 250 mg/ vial 68 inj.ceftrioxone 500 mg./ vial 69 inj.ceftriaxone + sulbectum 1gm+500gm 70 inj.ceftriaxone + sulbectum 500+250 71 inj.cefurexime 250 mg 72 inj.cefurexime 750 mg 73 inj.chloroquine phosphate 64.5 mg./ml 30 ml vial 74 inj.chlorpheniramine maleate 10mg/ml 10ml 75 inj.clonidine 1mcg/10 ml 76 inj.desferrioxamine 500mg vial 77 inj.desmopressin 40mg/ml 2ml 78 inj.dexamethasone sodium phosphate 4 mg/ ml vial 79 inj.diazepam 5 mg./ ml 2 ml amp. 80 inj.diclofenic sodium 25 mg. / ml 3 ml amp 81 inj.dicyclomine 10 mg./ ml 2 ml amp. 82 inj.digoxin 250 mg/ ml 2 ml amp 83 inj.diltizem im 5mg/ml 5 ml 84 inj.diphenhydramine 50mg/ml 2 ml 85 inj.diptheria antitoxin 10000 iu 10 ml 86 inj.dobutamine 50 gm / ml 5 ml amp 87 inj.dopamine 40 mg/ml 88 inj.drotaverine 40 mg /ml 10ml vial 89 inj. doxorubicin 10mg (lypholized) 90 inj.doxorubicin 10mg (ready to use) 91 inj. dacarbazine (dtic) 200mg 92 inj. dacarbazine (dtic) 500 mg 93 inj.daunorubicin 20mg 94 inj.decitabine 50mg 95 inj.docetaxel 120mg with solvent 96 inj.enalapril maleat 1.25mg/ml 2ml amp. 97 inj.epinephrine hydrochloride 1 mg/ ml of adrenaline ( 1 ml amp.) 98 inj.etophylline+theophylline 220mg/2 ml amp. 99 inj.epirubicin 10mg 100 inj.epirubicin 100mg 101 inj.epirubicin 50mg 102 inj.erythropoietin 10000 iu 103 inj.fresh frozen plasma 7 unit plasma 200 250 ml vial 104 inj.frusemide10mg/ml 2ml 105 inj. 5 fluro uracil 250mg 106 inj. 5 fluro uracil 500mg 107 inj.gentamycin 40 mg/ml 108 inj. gemcitabine 1 gm 109 inj. gemcitabine1.4gm 110 inj. gemcitabine200mg 111 inj.granisetron 3mg 112 inj. granulocyte colony stimulating factor 300 microgram prefilled syringe 113 inj. granulocyte colony stimulating factor prefilled syringe (pegylated) 6 mg 114 inj.glyceryl trinitrate 5 mg/ ml 115 inj.haloperidol 5 mg.1 ml 116 inj.halothane bp 250 ml 117 inj.heparin 1000 iu / ml 5 ml vial 118 inj.heparin 5000 iu / ml 5 ml vial 119 inj.hyaluronidase 1500 iu. 1 ml vial 120 inj.hydrocortisone sodium succinate 100 mg. / vial 121 inj.hydrocortisone sodium succinate 200 mg. / vial 122 inj.hydrocortisone sodium succinate 400 mg. / vial 123 inj.hyoscine butylbromide 20 mg./ ml 1 ml vial 124 inj.i.v. ciprofloxacin 100mg/50ml (100 ml bott.) 125 inj.i.v. dextran 70 solution 500 ml 126 inj.i.v. dextrose 10% 500 ml 127 inj.i.v. dextrose 25% 500 ml 128 inj.i.v. dextrose 5% 500 ml 129 inj.i.v. dextrose 50% 50 ml 130 inj.i.v. dextrose with saline (5%+0.9%) 500 ml 131 inj.i.v. electrolyte e(dextose 5gm sodium acetate .64gmsodium chloride 5gm potassium chloride 75mg sodium citrate 75mg calcium chloride 52mg magnisium chloride 31mg sodium meta bi sulphate 20mg) 500 ml 132 inj.i.v. electrolyte g 500 ml 133 inj.i.v. electrolyte m 500 ml 134 inj.i.v. electrolyte p 500 ml 135 inj.i.v. mannitol 10% 350ml 136 inj.i.v. mannitol 20% 350ml 137 inj.i.v. metronidazole 500mg/100ml 138 inj.i.v. ofloxacin 100 ml bottle 139 inj.i.v. omperazole 100 ml bottle 140 inj.i.v. pentaprazole 100 ml bottle 141 inj.i.v. ringer lactate500 ml 142 inj.i.v. sodium chloride 0.9% 500 ml 143 inj.insulin 30:70 mixtard 10 ml vial 144 inj.insulin soluble 40 iu / ml 10 ml vial 145 inj.iron dextran 50 mg. el iron / ml 1.5 ml amp. 146 inj.iron sucrose 50 mg/ml 1.5ml amp. 147 inj.isoxsuprine 5 mg. / ml 2ml amp. 148 inj. ifosphamide + mesna 1gm 149 inj. ifosphamide + mesna 2gm 150 inj.ketamine hydrochloride 10mg/ ml vial 151 inj.lignocaine 2 % (21.3 mg/ml) 30 ml vial 152 inj.lmwh low molecular weight heparin 4000 iu/ml 153 inj.magensium sulphate b.p. 50 % w/v 2 ml amp. 154 inj.mephentermine 30mg/ml 155 inj.metaprolol 1mg/ml 5ml vial 156 inj.methyl ergometrine 0.2 mg/ml 1 ml amp. 157 inj.methyl prednisolone sodium succinate usp 500 mg. vial 158 inj.methotraxate 1.5mg( preservative free) 159 inj.methotraxate 50mg 160 inj.metoclopramide 5 mg/ ml 10ml vial 161 inj.metoclopramide 5 mg/ ml 2 ml amp. 162 inj.micronised progestron 200 mg. 50 mg/ 1 ml 2ml amp. 163 inj.midazolam 1mg/ml 164 inj.morphine sulphate i.p. 10 mg / ml 1 ml amp 165 inj.mvi 10ml amp 166 inj.meropenem inj 1000 mg (vial) 167 inj.meropenem 500 mg / vial 168 inj.mephentermine inj 15mg/ml 10ml vial 169 inj.naloxone 0.4 m/g ml 1 ml amp 170 inj.neostigmine 0.5mg./ml 171 inj.nikethamide 2ml amp.b18 172 inj.nitroglycerine 25 mg. / 5 ml amp. 173 inj.noradrenaline 2mg base/2ml amp. 174 inj.ondancetron 2mg/ml 2ml 175 inj.oxytocin 5 iu/ ml 1 ml amp. 176 inj.oxaliplatin 100mg 177 inj.oxaliplatin 50mg 178 inj.pancuronium 2mg/ ml amp. 179 inj.pemetrexed 100mg 180 inj.pemetrexed 500mg 181 inj.phenergan 2ml 182 inj. paclitaxel 100mg 183 inj. paclitaxel 260mg 184 inj. paclitaxel 30mg 185 inj. paclitaxel 300mg 186 inj.palonosetron 0.25mg 187 inj.pentaprazole 40mg vial 188 inj.pentazoin lactate 30 mg. ml 1 ml amp. 189 inj.pethidine hydrochloride 50mg/ml 190 inj.pheniramine maleate 22.75 mg/ ml 2 ml amp. 191 inj.phenobarbitone 200 mg. / ml 1 ml amp. 192 inj.phenytion sodium 50 mg/ ml inj.2 ml amp. 193 inj.piperacillin 4mg+ tezobactan .5mg 194 inj.potassium chloride150 mg. / 10 ml amp. 195 inj.powder for crystalline penicillin 10 lac 196 inj.powder for crystalline penicillin 5 lac 197 inj.pralidoxime (pam) 25 mg. / ml amp. 198 inj.procaine penicillne 4 lac i.p.vial 199 inj.promethazine 25mg/ml 2ml amp. 200 inj.propofol 1 % 10 mg/ ml 10 ml amp 201 inj.protamine sulphate 10mg/ml 202 inj.pyroxicam 2ml amp. 203 inj.quinine sulphate 300 mg./ ml 2 ml amp. 204 inj.rabies immunoglobines 150iu vial 205 inj.rabies immunoglobines 300iu vial 206 inj.rabies vaccine i.p. human (chick embryo/vero cellculture) 2.5 iu/single dose 207 inj.rabies vaccinetissue culture vaccines vial2.5 iu/single dose 208 inj.ranitidine 50 mg/ 2 ml amp. 209 inj rituximab 100mg 210 inj rituximab 500mg 211 inj.snake venom anti serum 30 ml vial polyvalent anti snake. venum serum enzyme refined reconstitute with 10 ml of sterile water for injection. contain equivalent of 10 ml of purified equine globulins, 1 ml of reconstued serum 10 ml 212 inj.snake venom anti serum ip (liquid form ) 213 inj.sodium bicarbonate 7.5% w/v 10 ml amp. 214 inj.sodium chloride 1/2normal, hypertonic & dextrose 5% 215 inj.sodium thiopentone 0.5 gm powder / vial 20 ml vial 216 inj.streptokinase 7.5 lac set. 217 inj.streptokinase 1500000 iu vial 218 inj.succinyl choline 50 mg/ ml 10 ml amp. 219 inj.surafactant bovine (intracheal) nature4ml 220 inj.tebutaline sulphate 0.5 mg/ ml 1 ml amp. 221 inj.tetanus immunogobulin sup 250 iu / vial 222 inj.tetanus toxiod 5 ml vial 223 inj.tetanus toxiodamp 224 inj.torasemide 100mg/2ml 225 inj.tracrium amp 226 inj.tramadol 100 mg 2ml amp. 227 inj.tramadol 50mg/ml 2ml amp. 228 inj.tranexamice acid 125mg/ml 229 inj.trimcinolone acetate 10 mg 40 mg/ ml 1 ml amp. 230 inj trastuzumab 150mg 231 inj trastuzumab 440mg 232 inj.valethamate bromide 8 mg/ml 1 ml amp. 233 inj.vit. a 1 lac iu/2ml 234 inj.vit. k 10 mg. / ml 1 ml amp. 235 inj. vit.k1/kanadium 236 inj. vit.k3 237 inj.water for inj. 5 ml 238 inj zoledronic acid 4mg 239 cap anti oxidente 240 cap amoxicillin 250 mg 241 cap amoxicillin 500 mg 242 cap amoxicilline 250mg+ chloxacine 250mg 243 cap amoxicilline 250mg+ chloxacine 250mg + lacticacid bacillius 244 cap ampicilline 250 mg 245 cap ampicilline 500 mg 246 cap ampiciline 250mg+ chloxacine 250mg 247 cap b complex with vit.c 248 cap cephalexine 250 mg. 249 cap cephalexine 500 mg. 250 cap chloxacilline 250mg 251 cap chloxacilline 500mg 252 cap doxycilline 100 mg 253 cap fluoxetine bp 20 mg 254 cap indomethason 25mg 255 cap. imatinib mesylate 100 mg 256 cap. imatinib mesylate 400 mg 257 cap nifedipine 10mg 258 cap nifedipine 5mg 259 cap methylcobaline 260 cap omeprazole 20 mg. 261 cap. procarbazine 50 mg 262 cap remipril 1.25 mg. 263 cap remipril 5 mg. 264 cap tetracycllin 500mg 265 cap. procarbazine 50mg 266 cap. temozolomide 100 mg 267 cap. temozolomide140 mg 268 cap. temozolomide180 mg 269 cap. temozolomide20 mg 270 cap. temozolomide250 mg 271 cap vit. a usp soft gelatin capsule each vit.a 1 lac iu 272 cap vit. a usp soft gelatin capsule each vit.a 2 lac iu 273 cap vitamin a&d 274 tab.acetazolamide 250 mg. 275 tab. aceclofenac + paracetamol + serritiopeptadase 276 tab. aceclofenac + paracetamol + chloraxone 277 tab.acyclovir ip 200 mg 278 tab.acyclovir ip 400 mg 279 tab.albendazole ip 200 mg. 280 tab.albendazole ip 400 mg. 281 tab.alprazolam 0.25 mg 282 tab.alprazolam 0.5 mg 283 tab.amitriptyline ip 25 mg. sugar coated 284 tab.amlodepine 10mg 285 tab.amlodepine 10mg + losartan 50mg 286 tab.amlodepine 5mg 287 tab.amoxycilline dispersible usp. 125 mg. 288 tab.amoxycilline+clavulanic acid dispersible228 mg 289 tab.amoxycilline+clavulanic acid dispersible625 mg 290 tab.aspirine low dose 75 mg 291 tab.asprin ( low dose ) 100mg 292 tab.asprin ( low dose ) 150mg 293 tab.atenolol 100 mg 294 tab.atenolol 50 mg 295 tab.atorvastatin ip 10 mg 296 tab.azithromycin 250 mg 297 tab.azithromycin 500 mg 298 tab.betamethasone 299 tab.bisacodyl5 mg. 300 tab.calcium carbonate 500 mg 301 tab.calcium gluconate 500 mg 302 tab.calcium with vit. d 303 tab.calcium with vit. d3 304 tab.carbamazepine 200 mg 305 tab.cefixime 100 mg 306 tab.cefixime 200 mg. 307 tab.cetrizin 10mg 308 tab.chlorine isi mark 0.5 mg. 309 tab.chloroquine phosphate 250 mg. 310 tab.chlorpheniramine meleate4 mg. 311 tab.ciprofloxacin500 mg. 312 tab.ciprofloxacin 250 mg. 313 tab.ciprofloxacine & tinidizole (250 mg.&300mg) 314 tab.ciprofloxacine &tinidizole (500 mg.&600 mg) 315 tab.clonidine 100 mcg 316 tab.clopidogrel75mg. 317 tab.clotrimazole vaginal pessary 100 mg. 318 tab.cyclophosphamide 50mg 319 tab.dexamethasone 320 tab.diazepam 5 mg. 321 tab.diclofenic sodium & paracetamole (325 mg. & 50 mg.) 322 tab.diclofenac + paracetamol + serritiopeptadase 323 tab.diclofenac + paracetamol + chloraxone 324 tab.diclofenice sodium 50 mg. 325 tab.dicyclomine 10 mg 326 tab.dicyclomine 20 mg 327 tab.dicyclomine with diclofenic sodium 328 tab.diethylcarbamazine 100 mg. 329 tab.digoxin 0.25mg. 330 tab.dilantin sodium 331 tab.diltiazem 30 mg. 332 tab.diltiazem 60mg 333 tab.domperidon 10 mg 334 tab.domperidone + pentaprazole 335 tab.doxycyciline 100 mg 336 tab.doxylamine succinate10mg.+pyridoxine10 mg 337 tab.enalapril maleate 2.5 mg. 338 tab.enalapril maleate 5 mg. 339 tab.erythromycine 250mg 340 tab.erythromycine 500 mg. 341 tab.etophylline+theophylline sr 300 mg 342 tab everolimus 10mg 343 tab everolimus 5mg 344 tab.exemestane 25mg 345 tab.fluconozole 150 mg 346 tab.fluconozole 50 mg 347 tab.folic acid ip 5 mg 348 tab.formaline 349 tab.frusemide 40 mg 350 tab.glibenclamide 5mg 351 tab.gliclazide 80 mg. 352 tab.glimepiride 1 mg. 353 tab.glimepiride 2 mg. 354 tab.glyceryl trinitrate 0.5 mg sublingual 355 tab.grisofluwin ip 125 mg. 356 tab.haloperidol 1.5 mg 357 tab.haloperidol 5 mg 358 tab.hyoscine butylbromide10 mg. 359 tab.ibuprofen + paracetamol(400 mg+325 mg) 360 tab.ibuprofen 200 mg. 361 tab.ibuprofen 400 mg. 362 tab.iron & folic acid entric coated of elemental iron (adult)+fa 0.5mg 363 tab.iron & folic acid entric coated. dessicated ip 67 mg equivalent to 20 mg of elemental iron 364 tab.iron folic acid ferrous sulphate dessicated ip 333 335 mg (equivalent to 100 mg of elemental iron ) + folic acid ip0.5 mg. tab.ferrous sulphate of elemntal iron ) + folic acid ip 0.5 mg. tab.ferrous sulphate dessicated ip 67 mg. (equivalent to 20mg of) 365 tab.isosorbide dinitrate ip 5 mg 366 tab.isosorbide mononitate 20mg. 367 tab.isoxsuprine 10 mg. 368 tab.labetalol 369 tab.lactobacillus 60 million spores 370 tab.levonorgeastrel emergency contraceptive 0.75mg 371 tab.losartan 25mg 372 tab.losartan 50 mg. 373 tab letronazole 2.5mg 374 tab.magnesium hydroxide + aluminium hydroxide (500 mg + 250 mg) 375 tab.matronidazole 200mg 376 tab.matronidazole 400mg 377 tab.mebendazole 100 mg 378 tab.metachlopramide 10 mg. 379 tab.metformin 500 mg 380 tab.methyl ergometrine maleate .125 mg. 381 tab.methyl prednisolone sodium suc.8mg 382 tab.methylclopramide 10mg 383 tab.methyldopa 250 mg 384 tab.metopropolol25 mg. 385 tab.metopropolol50 mg. 386 tab.mifepristone 200 mg. 387 tab.misoprostal 200mg 388 tab.multivitamin nfi formula sugar coated vit a 2500 iu.vit. b119mg b 1 2 mg. vit b 6 0.5 mg. vit c 50 mg, vit d 3 200 iu, vit b2 2 mg.niacinaide 25 mg. folic acid 0.2 mg, ( with appropriate overages) 389 tab.nemuselide + serritiopeptadase 390 tab.nalidixic acid 250mg 391 tab.nifedipine 10 mg 392 tab.nirlotinib 150mg 393 tab.nirlotinib 200mg 394 tab.norflox + tinidazole 395 tab.norfloxacin100 mg 396 tab.norfloxacin400 mg 397 tab.ofloxacine200 mg. 398 tab.ofloxacine400 mg. 399 tab.ofloxacine + tinidazole 200+500mg 400 tab.ofloxacine with ornidazole 200+500mg 401 tab.ondencetrone 10mg 402 tab.ornidazole 200 mg. 403 tab.ornidazole 500 mg. 404 tab.paracetamol500 mg. 405 tab.pentaprazole + domperidom 406 tab.pentaprazole 40 mg. 407 tab.phenobarbitone 30mg 408 tab.phenobarbitone 60 mg. 409 tab.phenytoin sodium 100 mg. 410 tab.piogliatazone 30 mg 411 tab.povidine iodine vaginal pessary 200 mg 412 tab.prazosin 5 mg 413 tab.prednisolone 10mg 414 tab.prednisolone 20mg 415 tab.prednisolone 5mg 416 tab.primaquin7.5mg. 417 tab.primaquin2.5mg. 418 tab.primaquin 15 mg. 419 tab.quinine sulphate 300 mg. 420 tab.ranitidine 150 mg. 421 tab. salbutamol 4 mg 422 tab.serritopeptidase 5mg 423 tab.sodium valporateip 200 mg. enteric coated 424 tab.sulfadoxine+pyrimethamine 500 mg.+25 mg. 425 tab.sulfamethoxazole + trimethoprim800 mg. + 160 mg 426 tab.sulfamethoxazole + trimethoprim 400 mg + 80 mg 427 tab.sulfamethoxazole +trimethoprim 100 mg. + 20 mg 428 tab.terbutaline sulphate 2.5 mg. 429 tab.throxine sodium 100 mcg. 430 tab.thyroxine sodium 100mcg 431 tab.thyroxine sodium 50mcg 432 tab.thyroxine sodium 25mcg 433 tab.thyroxine sodium 12.5mcg 434 tab.tinidazole 500 mg. 435 tab.torasemide 10 mg 436 tab.tramadol 100 mg 437 tab.tramadol 50 mg 438 tab.tamoxifen 10mg 439 tab.tamoxifen 20mg 440 tab.verapamilip 40mg sugar coated 441 tab.vit. c 500 mg. 442 tab.vit.b complexnfi(prophylactic ) b1 2mg. b2 2mg.b6 0.5 mg. niacinamide 25 mg. calcium pantothanate 1 mg. (with appropriate overage) 443 tab. furazolodine 100 mg 444 tab dispersable zinc 20mg 445 syp.albendzole 200mg/5ml (10mlbott.) 446 chlormphenicol eye applicate (1x100) 447 drop. dicyclomine 100 mg./ ml 10 ml 448 drop. iron (elemental iron 10mg. in 1 ml 25 ml) 449 drop.ciprofloxacin eye drops 450 drop. zinc (elemental zinc 20 mg in 1 ml 25ml) 451 drop gentamicin eye/ear drop 5ml 452 drop moxifloxacin eye drop 5ml 453 drop toberammycine eye drop 5ml 454 drop norfloxacine eye drop 5ml 455 drop dexamethasone eye drop 5ml 456 drop chlormphecol eye drop 5ml 457 ofloxacin 10 ml eye drop 458 drop.multivitamin(approx 22drops)each mlcotains vit a ip3000 iu.vit b1 ip1mg. riboflavine phonsphate sodium ip 2mg. d panthenol ip 2.5mg.niacinamide ip 10mg.pyridoxine ip 1mg. cyanocobalamine ip1mcg,lysine hcl usp10mg. 15ml 459 syp. b.complex( vitamin a, c, d, e, b12, b1, b6, cupper, k without iron folic acid) 25 ml bottel 460 syp. diphenhydramine 12.5mg/ml (100 ml) 461 syp. drop amoxciline 100 mg. in 1 ml 25 ml 462 syp. iron (elemental iron 30 mg. in 5 ml without folic acid 100 ml.bottle) 463 syp. iron folic acid 100ml (pedr.) 464 syp. zinc 20mg. in 5ml. 100 ml 465 syp. zinc sulphate 100ml 466 syp.alkaline citrate with potassium15 ml 467 syp.amoxycillin 125mg/5ml 30 ml 468 syp.azithromycin suspension 200 mg / 5 ml 15 ml 469 syp.barium sulphate . 95%w/v 470 syp.bromhexine hydrochloride 4mg./ 5ml 50ml 471 syp.cephalexine 125 mg/ 5ml 30ml 472 syp.chloroquine phosphate 160 mg / 10 ml 60 ml 473 syp.ciprofloxacin + tinidazole 30 ml 474 syp.co trimexazole 60ml 475 syp.cough mixtur 100 ml 476 syp.cough mixtur 450 ml 477 syp.dextromethorphan 30 mg. / 5 ml 50 ml 478 syp.domperidone susp. 1 mg/ ml 30 ml 479 syp.erythromycin 40ml 480 syp.etophylline+theophylline paed.(46.5+14 mg/5 ml)100 ml 481 syp.furazolidone susp. 25 mg. / 5 ml 60 482 syp.ibuprofin 60ml 483 syp.magnesium hydroxide + aluminium hydroxide gel (625 mg + 312 mg/ 5 ml) 120 ml 484 syp.metronidazole + norfloxacin 30 ml 485 syp.metronidazole 60 ml 486 syp. mulitivitamin 100 ml 487 syp. mulitivitamin 200 ml 488 syp.ofloxacine suspension 50 mg / 5 ml 60 ml 489 syp.paracetamol125 mg/ 5 ml 60 490 syp.phenobarbitone 200mg/5ml 491 syp.phenytoin sodium 25mg/ml 492 syp.potessium chlorid 1.5gm/15ml 100ml bott. 493 syp.promethazine 5 mg / 5 ml 60 ml 494 syp. protein tonic 100ml 495 syp.sulfamethoxazole+trimethoprim 200mg+40mg/ 5 ml 50ml 496 syp.tinidazole powder for susp.150mg./5ml 60ml 497 syp.vitamin a 100000 iu/ml 100ml with spoon 498 oint. povidine + iodine500 gm. 499 oint. povidine + iodine 15 gm. 500 oint. povidine + iodine 10 gm. 501 oint. povidine + iodine 20 gm. 502 noesprin powder 503 ors (who) sodium chloride 3.5 g, potassium chloride 1.5g,sodium citrate 2.9, dextrose 20 g 27.9 g pouch 504 syp. oflaxacin+ornidazole 30ml 505 syp. ammoxicillin+clavulanic acid 30ml 506 tab oflaxacin+ornidazole 507 inj. mithyl ergometrin 508 gel. diclofenac + menthol 509 oint. povidine + iodine 250 gm. 510 inj. chlorpheniramine maleate 511 syp. cetrizine 30ml 512 syp. ibuprofen + paracetamol 513 tab. aceclofenac + paracetamol 514 tab. diclofenac + serretiopeptidase 515 syp. iron + folic acid 50ml 516 drop ondancetron 30ml 517 drop paracetamol 30ml 518 enzyme syrup 100ml 519 enzyme syrup 200ml 520 enzyme drop 15ml 521 tab. pantoprazole + domperidone 522 eye drop mxifloxacin 523 eye drop ciprofloxacin + dexamethasone 524 gentian violet paint 525 tab. iron and folic acid 45 mg 526 gamma benzyl benzoate 100 ml 527 multivitamin and protien 200ml 528 tab. calcium citrate 250 mg 529 (group b pathology regents & material ) year 2023 24 530 10% sodium tungstar 531 10xlens 532 2/3 sulphuric acid 533 22% bovine albumin 10 ml 534 3.8 sodium citrate(500ml bottle) 535 5xlens 536 acid phosphates kit erba,coral,span 537 albert stain a& b 538 aliguli plastic test 539 alkaline phosphate kit erba,coral,span 540 ammonium chloride 541 ammonium sulphate (500 gm pkt) 542 amylase kit erba,coral,span 543 anti a1 5 ml 544 anti h5 5 ml 545 anti sera ab set 10ml 546 anti sera abd set 10ml 547 anti sera abd set 5ml 548 antihuman globin 10 ml 549 aso titler test kit erba,span,coral 550 australian antigen card(hbs ag) 551 australian antigen strip (hbs ag) 552 australian antigen test kit (hbs ag) 553 auto analyser (erma)paper roll 554 auto analyser (aspen)paper roll 555 auto clean for c.b.c (aspen) 556 auto dil for c.b.c (aspen) 557 auto lyse for c.b.c (aspen) 558 barium chloride 559 benedict solution qualitative 560 benzdin powder 561 bilirubinometer 562 biochemistry analyser fully automatic 563 biochemistry analyser semi automatic 564 blood culture complete kit 565 blood culture complete media 566 blood sugar kit (span,erba,becon) 567 blood sugar strip for glucometer (acu. chek/dr. morpan) 568 blood urea kit (span,erba,becon) 569 c.p.d. blood collection bag 100 ml (j mitra ,polymod,span,coral) 570 c.p.d. blood collection bag 350 ml (j mitra ,polymod, span,coral) 571 calcium test kit erba, coral, span 572 calorimeter 573 capillary tube 574 carbol fuchsin 575 cbc tube rotater 576 cell counter 577 centifuge tube 578 centrifuge machine 12 tube 579 centrifuge machine 6 tube 580 centrifuge machine 8 tube 581 chikenguniya test kit 582 chloride test kit erba, coral, span 583 ckmb test kit erba,coral,span 584 cleaning solution b 585 complete stain kit 586 copper solution 587 cover slip 588 crp analyser 589 crp kit erba,coral,span 590 crp lates 591 culture pot 592 dengue test kit 593 dengue test kit (ns1) 594 dionised distiled water (d.w.) 5ltr. can 595 dispo. mug for urine 596 e.d.t.a. powder 597 e.d.t.a. vial for blood sample collection 598 e.s.r. tube 599 e.s.r. tube stand 600 field stain a 500 ml 601 field stain b 500 ml 602 filter paper 603 folin wu tube for sugar 604 fouchet reagent 605 g 6 pd 606 germs iodine 607 giemsa stain 608 glacial acetic acid 609 glass pipette 0.1 ml 610 glass pipette 0.2 ml 611 glass pipette 0.5 ml 612 glass pipette 10 ml 613 glycerine 614 gram stain 615 h.c.l. n/10 500 ml 616 h.c.v. card (span,sd,jmitra,aspen) 617 h.c.v. kit rapid(span,sd,jmitra,aspen) 618 h.c.v. strip(span,sd,jmitra,aspen) 619 h.d.l. d cholestrol test kit erba,coral,span 620 h.i.v. card 1/2 (biodot)(jmitra ,span) 621 h.i.v. combaiaids(span,sd,jmitra,aspen) 622 h.i.v. kit of card(span,sd,jmitra,aspen) 623 h.i.v. strip(span,sd,jmitra,aspen) 624 h2o2(hydrogen peroxide) 625 haemocitometer 626 haemoglobinometer 627 hemoglobin pipette 628 hemoglobin tube 629 hemoglobin tube graduated 630 hemoglobinomter hemotocrom digital 631 hdl cholestrol (span,coral,erba) 632 incubator 633 k3 e.d.t.a. vails with plastick cap 634 l.d.l. d cholestrol kiterba,coral,span 635 leishman stain solution 636 lence cleaning paper 637 lieshman stain solution 638 lint roll 639 liqour ammonia 500 ml 640 liquid paraffine oil 500 ml 641 liquor ammonia 500 ml 642 litmous paper blue 643 litmous paper red 644 lugol lodine 645 magnesium cylinder 100 ml 646 malaria antibody card 647 malaria test antigen card (pf & pv)sd,span,jmitra,bacon 648 malaria test card (pf & pv)sd,span,jmitra,bacon 649 measuring cylinder 100 & 500 ml 650 methylene blue 651 micro centrifuge 652 micro pippete 0 100 micro litre 653 micro pippete 0 50 micro litre 654 micro pippete 100 micro litre 655 micro pippete 1000 micro litre 656 micro pippete 30 micro litre 657 micro pippete 500 micro litre 658 microscope glass slide 659 microscope lens 660 midrofin lenc big size 661 multi stick for urine test 662 multi strip for urine test 663 nitric acid (conc.) 664 nitro phurisite 665 oil immursion lens 666 pandys reagent 667 ph strip for stool test 668 phosphomolybdate reagent 669 pilot test tube 670 pipette (teath) pump 671 pipette tips large 672 pipette tips small 673 posture pipette with ruber tubes 674 potassium test kit erba,coral,span 675 pregnancy test kit 676 pricking needle 677 ptt test coagulometer 678 pus. culture complete. kit media 679 pus. culture media 680 r.b.c. diluting fluid 681 ra factor kit erba,coral,span 682 rapid esr analyser 683 ruber teeth pippet 684 s. bilirubin kit (span.erba,coral) 685 s.g.o.t. (coral,span.erba) 686 s.g.p.t. (coral,span.erba) 687 semen diluting fluid 688 serum bilirubin kit (span,erba,becon) 689 serum cholestrol kit (span,erba,becon) 690 serum creatinine kit (span,erba,becon) 691 serum. protein test kit erba,coral,span 692 sodium citrate 3.8% solution 693 sodium citrate 3.8/5 694 sodium fleride crystals 695 sodium nitrophuside crystle 696 sodium test kit erba,coral,span 697 sprit lamp (steel) 698 sulfur powder 699 sulphuric acid (conc.) 700 t3, (elisa mehod) 701 t4, (elisa mehod) 702 test tube 10x75 mm 703 test tube 12x100 mm 704 test tube 12x75 mm 705 test tube holder 706 test tube rack plastic 12 tube 707 test tube rack plastic 6 tube 708 thermal printing paper 709 throat swab culture 710 thyroide analyser 711 tissue paper roll 712 torch penal test lgg 713 torch test lgm 714 triglyciride test kit erba,coral,span 715 tsh, (elisa mehod) 716 turnicate 717 typhoide test card 718 uric acid kit erba,coral,span 719 urine culture complete kit 720 urine culture complete media 721 urine jar 722 urino strip (urine sugar & albumin) 723 urinometer 724 vdrl card (rpr) 725 vdrl rotater 726 vdrl test kit (antigen) (rpr) 727 w.b.c. diluting fluid 728 wafer 729 wen(sheeling capillary) 730 widal test kit (j mitra, span,erba) 731 wintro tube for e.s.r. 732 wintro tube stand 733 slide box for hundrad slide 734 slide box for fifty slide 735 disposable sputum container 4.5cm x 4 cm 736 slides (microscopic 76x26 m.m,1.1 1.3 , mm thick) 737 lens cleaning paper 738 toilet tissue roll 739 concentrate h2so4 500mlpackpurity 95 97 %, color clear 740 concentrate h2so4 500mlpackpurity 95 97 %, color clear 741 methylene blue powdermethylthionine chloride, [c16h18cln3s, molecular wt: 319.9.] 742 methylene blue powdermethylthionine chloride, [c16h18cln3s, molecular wt: 319.9.] 743 methylene blue powdermethylthionine chloride, [c16h18cln3s, molecular wt: 319.9.] 744 powder carbol fuchsin basic(:pararosaniline hydrochloride, chemical structure: c20h20cln3 mol wt:337.86) 745 powder carbol fuchsin basic(:pararosaniline hydrochloride, chemical structure: c20h20cln3 mol wt:337.86) 746 powder carbol fuchsin basic(:pararosaniline hydrochloride, chemical structure: c20h20cln3 mol wt:337.86) 747 phenol crystal ( carbolic acid crystals) c6h5oh, molecular wt:94.11, melting point:40°c + 2, 748 phenol crystal ( carbolic acid crystals) c6h5oh, molecular wt:94.11, melting point:40°c + 2, 749 methylated spirit chemical name: ethanol denatured + 5% lsopropyl alcohol + 5% methanol, molecular structure: c2h5oh, molecular wt: 46.07. 750 methylated spirit chemical name: ethanol denatured + 5% lsopropyl alcohol + 5% methanol, molecular structure: c2h5oh, molecular wt: 46.07. 751 methylated spirit chemical name: ethanol denatured + 5% lsopropyl alcohol + 5% methanol, molecular structure: c2h5oh, molecular wt: 46.07. 752 filter paper15 c.m. 753 auramine o (25gm)(for led microscope) 754 alcohol (abs 99.9% ethanol) (for led microscope) 755 potassium permanganate(for led microscope) 756 hydrochloride acid (con.) 757 distilled water 5 lit. 758 diamond marker 759 immersion oil 760 burning spirit 761 burning spirit 762 burning spirit 763 glass rod (solid) 764 slide stand 765 measuring cylinder 766 measuring cylinder 767 measuring cylinder 768 measuring cylinder 769 measuring cylinder 770 dropingglass bottle 771 funnel 772 flask (flat bottom) 773 flask (flat bottom) 774 flask (flat bottom) 775 flask (flat bottom) 776 flask (flat bottom) 777 phenolic compound (phenyle ) household disinfectant, containg phenolic compounds such as monochlorophenol, chloroxylenol, coal tar acid, oils & emulsifiers etc. 778 spirit lamp 779 savlon solution (hospital concentrate) 780 foot operated buckets for phenol solution 10 litter 781 foot operated dust been 10 litter 782 falcons tube(provide sample) 783 paraffin strip (parafilm bundle)(provide sample) 784 face mask standard (provide sample) 785 disposable gloves standard (provide sample) 786 absorbent cotton bundle450gm pack 787 small cardboard box with lid facilitating one falcon tube into i.e. slightly bigger than falcon tube(provide sample) 788 big cardboard box with lid facilitating six small cardboard boxes inside 789 ice jell pack(provide sample) 790 ice jell pack(provide sample) 791 sputum sample carrier (provide sample) 792 thermacol box (provide sample) 793 glucometer 794 weighing machine 795 weighing machine 796 variable pipette(provide sample) 797 variable pipette(provide sample) 798 amber colour bottle(provide sample) 799 amber colour bottle(provide sample) 800 amber colour bottle(provide sample) 801 amber colour bottle(provide sample) 802 selwinhoffs reagent 803 absolute methanol 804 blood grouping antiserum abd 805 total protien kit 806 serum creatinin kit 807 sgpt kit 808 sgot kit 809 3.8%sodium citrate 810 bilirubin kit 811 cholesterol kit 812 urea kit 813 10% barium chloride 814 fouschets reagent 815 sulphur powder 816 n/10 hcl 817 plan (biochemistry vacutaner tube) 818 urine & sputum container 50ml 819 heamoglon colorscale book for hb testing (1*1000test) 820 glucose kit (god,pod) 821 (group cequipments & machinery) yaer 2023 24 822 2.4 thresded rill guide for 1.8 mm drill bit 823 2.7 thresded rill guide for 2 mm drill bit 824 abdominal hysterectomy kit ( (polyglactin 910 violet) sutre 180 cm. size 1. 40 mm 1/2 circle round body tapercut double needle, 1 foil (polyglactin 910 violet) suture 90 cm, size 1, 40mm 1/2 circle round body needle, 1 foil (polyamide black) suture 70 cm, size 2 0, 45mm 3/8 circle reverse cutting needle, 1 foil 825 absorbent cotton wool ip 100gm 826 absorbent cotton wool ip 500gm 827 adhesive paper tape size 2.5cmx9mts 828 adhesive plaster usp 10 cm x 10 mts / roll 829 adhesive plaster usp 10 cm x 5 mts / roll 830 adhesive plaster usp 7.5 cm x 5 mts / roll 831 air rotor burs 832 air rotor hand piece oil spray 833 allen key for drill bit stopper 834 allis forceps s.s. size 6inch 835 allis forceps s.s. size 8inch 836 almirah steel full size (3ft x 6 ft x1.5 ft) 837 ambu bag adult 838 ambu bag child 839 amputation saw and sealed 840 artery forceps straight size 6inch s.s. 841 artery forceps curved size 6inch s.s. 842 artery forceps straight size 8inch s.s. 843 artery forceps curved size 8inch s.s. 844 articulating pack 845 autoclave electric doubledrum 846 autoclave electric single drum 847 b. p. apparatus (dial type) 848 b. p. apparatus with led light 849 b.p. handle s.s. n0. 3 & 4 850 b.p. instrument mercury 851 b.p. instruments digital 852 b.p. instruments digital with newnate cuff 853 b.p. instruments mercury stand model 854 baby masks size 0, 1 855 baby towel std. size white 856 baby tray 12x18 inch 857 bacillocid 500 ml 858 backout 5liter jar 859 bandage roll 10cm x 1mtr. 860 bandage roll 10cm x 5mtr. 861 bandage roll 4 inch x 1mtr. 862 bandage roll 5 inch x 5mtr. 863 bandage roll 5cm x 1mtr. 864 bandage roll 7.5 inch x 5mtr. 865 bandage than1mtr x 20 mtr 866 barbed broachessize 21mm size 25mm 867 bed pan with cover m & f polythene 868 bedsheet coloured printed (4ftx6ft) 869 benzyl benzoate emulsion 25% 100 ml 870 benzyl benzoate emulsion 25% 450ml 871 bio medical waste dispoable beg red & black(biodegradable non chlorinated polymer material with minimum thickness of 55 micron.) 872 bleaching powder 25 kg bag 873 bone awl with eye 874 bone gauze fiber handle 10 mm 875 boric acid 400 gm 876 bp apparatus (air dial) 877 broken screw removal hollow mill shaft for 2.7mm screws 878 broken screw removal hollow mill shaft for 4.5/5mm screws 879 broken screw removal hollow mill shaft for3.5mm screws 880 bucket g.i. sheet without cover12inch 881 bucket with cover e.i. 12inch 882 bucket with cover s.s. 12inch 883 caesarean section kit i (polyglactin 910 violet) sutre 180 cm. size 1. 40 mm 1/2 circle round body tapercut double needle, 1 foil (polyamide black) suture 70 cm, size 2 0, 45mm 3/8 circle reverse cutting needle, 1 foil 884 caesarean section kit ii ( (polyglactin 910 violet) sutre 180 cm. size 1. 40 mm 1/2 circle round body tapercut double needle, 1 foil (ploylecaprone 25 undyed) suture 70 cm, size 3 0, 25mm 3/8 circle cutting needle, 1 foil ) 885 calcium hydroxide powder and zinc phosphate cement 886 cbc analyzer (semiautomatic) 887 cheatle forcep 888 codon set 889 composite anterior micro fill 890 composite material nano hybrid (light cure) 891 computer chair (standard size revolving) 892 computer set(i3 processor,8gb ram, 20 inch led monitor,1000 gb hard disk) 893 computer set(i5 processor,8gb ram, 20 inch led monitor,1000 gb hard disk) 894 computer table (standard size) 895 conical extraction t handle for 3.5mm screws 896 conical extraction t handle for 4.5/5mm screws 897 cotton thread n0. 10400 mtr. (janger brond ) length 898 cotton thread roll for stitch 899 counter sink for 3.5/4.5 mm screw 900 counter sink for 4.5/6.5 mm screw 901 countersink quick coupling for 2.4/2.7mm screws 902 countersink quick coupling for 3.5mm screws 903 countersink quick coupling for 4.5/5mm screws 904 crabe bandage 4 inch 905 crabe bandage 6 inch 906 cream betamethasone valerate ip 0.12% 15 gm. 907 cream cetrimiedbp 20 gm 908 cream cetrimiedbp 500 gm 909 cream cetrimiede+chlorhexidine (conc.)15%+7.5%) 1 ltr. 910 cream clotrimazole cream 1% 15gm 911 cream nitrofurazone 500g 912 cream silver sulphadiazine usp 1% w/w 25 gm 913 cream silver sulphadiazine usp 1% w/w 500 gm 914 cream whitefields oint. 25gm 915 cresol with soap solution 5ltr. 916 cuff for b.p. instrument 917 delivery cord clamp 918 delivery tray 919 dental instruments set s.s. 920 deodrizine disinfec solution 1ltr 921 depth gauze for 2.7mm screws 922 depth gauze for 2/2.4mm screws 923 depth guage measuring range upto 110 mm 924 depth guage measuring range upto 60 mm 925 detachable slide hammer 926 developer 13.5 liter 927 developer 22.5 liter 928 diagnostic sticks for urine (sugar + protiene) 100 no. 929 dialysis part a 930 dialysis part b 931 dialyzer 932 digital weighing machine (adult) 933 disectingforceps plain & teeth size 6inch s.s. 934 disposable needle 18 g (single use) 935 disposable needle 20 g (single use) 936 disposable needle 22 g (single use) 937 disposable needle 23 g (single use) 938 disposable needle 24 g (single use) 939 disposable needle 26 g (single use) 940 disposable needle assorted size 1inch&1.5inch 941 disposable plastic gloves 942 disposable scalpe vein set size 22 g 943 disposable scalpe vein set size 23 g 944 disposable scalpe vein set size 24 g 945 disposable suction cather size 12, 14 946 disposable surgical blade with handle 11no. 947 disposable surgical blade with handle 22no. 948 disposable syringe with needle 0.5 ml 949 disposable syringe with needle 1 ml 950 disposable syringe with needle 2 ml 951 disposable syringe with needle 3 ml 952 disposable syringe with needle 5 ml 953 disposable syringes with needle 10 ml 954 disposable syringes with needle 20 ml 955 disposable syringes with needle 50 ml 956 double drill guide 2.4/1.8mm 957 double drill guide 2.7/2mm 958 double drill guide 3.5/2.5mm 959 double drill guide 4.5/2.5mm 960 double drill guide 4.5/3.2mm 961 double drill guide 6.5/3.2mm 962 double femoral line set 963 dressing bowl 964 dressing drum s.s. 12inchx10inch 965 dressing drum s.s.11inchx9inch 966 dressing drum s.s.12inchx15inch 967 dressing scissor curved size 6inch s.s. 968 dressing scissor curved size 7inch s.s. 969 dressing scissor curved size 8inch s.s. 970 dressing scissor st size 6inch s.s. 971 dressing scissor st size 7inch s.s. 972 dressing scissor st size 8inch s.s. 973 drill and tap sleeve 3.2mm/4.5mm 974 drill bit 1.8mmx100mm quick coupling 975 drill bit 2.4mmx100mm quick coupling 976 drill bit 2.5 mm x125mm quick coupling 977 drill bit 2.7mmx100mm quick coupling 978 drill bit 2.8 mm x165 mm with stopper quick coupling 979 drill bit 2mmx100mm quick coupling 980 drill bit 3.2 mm with quick coupling 981 drill bit 3.5 mm for neutral and load position 982 drill bit 4.3 mm x221 mm with stopper quick coupling 983 drill bit 4.5 mm for neutral and load position 984 drill bit plane2.7 mm 985 drill bit plane3.2 mm 986 drill bit plane4.5 mm 987 e.c.g. rol 105 mm x 20 meter 988 e.c.g. rol 60 mm x 20 meter 989 e.t. tube 2 no. 990 e.t. tube 2.5 no. 991 e.t. tube 3 no. 992 e.t. tube 3.5 no. 993 e.t. tube 4 no. 994 ecg gel 250 gm tube 995 ecg paper (wax coated) 50 mm x 30 mts. 996 ecg paper computerzed triple channel 997 edta gel 998 edta solution 999 elastic nail impactor 2.0mm 1000 elastic nail impactor 2.0mm 1001 elastic nail impactor 2.5mm 1002 elastic nail impactor 3.0mm 1003 elastic nail impactor 3.5mm 1004 elastic nail impactor 4.0mm 1005 elastic nail impactor oblique4.5mm 1006 elastic nail inserter rod 1007 elastic nail inserter with universal ss chuck 1008 electrolyte analyser 1009 electrolyte reagent 1010 endodontic absorbent paper points size 15 40 1011 endoflox 1012 epistomic scissor 1013 executive chair (revolving standard size) 1014 extraction screw 3.5mm 1015 extraction screw 5mm 1016 f toll reduction 1017 featal dopler 1018 feeding tube 5 no. 1019 feeding tube 6 no. 1020 feotal doppler 1021 feotal moniter 1022 fistula needle 16 no 1023 fixer 13.5 liter 1024 fixer 22.5 liter 1025 flower cleansing solution 1ltr 1026 foeto scope 1027 foleys catheter 16 no. 1028 foleys catheter 18 no. 1029 formalin 1 litre bottle 1030 fowler bed 1031 fully automatic random access clinical chemistry analyzer should be a fully automated random access bench top model clinical chemistry analyzer to perform end point,kinetic, fixed time kinetic,and immunoturbidimetry tests.minimum through put should be 250 tests/hour,minimum requirement of 40 cooled position for reagents.should have 90 individual reusable cuvettes on board.final reaction volume of reagent should be 150ul for reducing cost of tests.should have capacity to increase reagent volume in steps of 1 micro litre.should have minimum of 40 cooled sample positionsreagent /sample probe in the system should teflon quoted and should have facility to wash the probes inside and outside using pre warmed distilled water for reducing carry over.photometric absorbance range should be from 0 to 4.0 abs.have static photometer connected with fiber optics for better precision should have a minimum of 9 measurement wavelenghts from 340nm to 700nm.should have a separate mixer probe for mixing of reagents and samples.should have facility 1032 g.v.paint 50 ml bottle 0.25% 1033 g.v.paint 50 ml bottle 0.5% 1034 gauze than 90cm x 20 mtr 1035 gel. diclofenic sodium30 gm. 1036 gentamaycin 25 gm. ointment 1037 glass ionomer silver reinforced 1038 glass ionomer cement (gic) type 2 1039 glucometer digital 1040 glucometer strip 1041 gluteraldehide 5% (5ltr) 1042 glycerine ip 500 ml 1043 granulated high density glass ionomer powder +filling purpose 1044 graphics aluminium box with silicone fitting 1045 guide sleeve for 1.2mm k wires 1046 guide sleeve for 2mm k wires 1047 guide wire threaded trocar 2mm x 280 mm 1048 gutta percha points(all sizes ) in sepearte boxes. gutt percha individual size 15,20,25,30,35,40,45 ,50,55,60,65,70,75,80 15 40 and 45 80 each pack contrain 100 no. and 28mm long flat ended gp ponts 1049 h2o2 1050 hammer fiber handle 500 gm 1051 hammer s.s. size large 1052 hammer s.s. size medium 1053 hammer s.s. size small 1054 hand rub solution 500ml jar 1055 hand wash soap solution with dispenser 500ml 1056 handle screw head removal forceps ratchet lock 1057 handle screw head removal forceps speed lock 1058 hba1c analyser to measure hba1c by hpcl method. measuring range 3 % 18 % with repeatability cv< 3% & stability cv< 5% result in 4 mins/sample. auto sample loader with 28 positions. automatic addition of hemolysin and sample pretreatment.photometer of 415nm chromatography column upto 220 test 8 tft true color lcd touch screen. display barcode scanner or touch keyboard.10,000 sample result storage rs 232 connection. compatible with his/lis system power 100 240 v, 50/60 hz, 150 va weight < 20 kg 1059 head light comp. with transformer elect. operated 1060 head mirror complete 1061 heavy duty nail cutter 1062 heggerinch™s dilator set complete 1063 hemoglobin analyser hpcl method .should have standard mode, variant analysis mode, b thalassemia analysis mode. test range 3% 18% with cv< 1%. test speed 1.5sample venous blood, finger periphred blood , lyophilized whole blood. sample volume <7 ul. auto sample station with 110 position + 1 stat position photometer 415 nm+500 nm led> 19000 hrs. life span chromatography column: available test > 1500 t, filter > 400 t.lcd touch screen 8 tft. windows xp software reagents: eluents, a, b, c hemtycin, calibrator, qc material , information input by scanner or touch key pad. storage 719 000 samples rs232, usb lan & lis compatible. thermal printer. external laser. printer attachment. power ac100 inch“ 240 v 50/60hz, s 150 va weight 50 kgmin/sample. 1064 herat men forceps s.s. crocodile 1065 hexagonal lade screw driver 1066 hexagonal screw driver shaft quick coupling for 2.4/2.7 mm screws 1067 hexagonal screw driver shaft quick coupling for 3.5 mm screws 1068 hexagonal screw driver shaft quick coupling for 4.5/5 mm screws 1069 h files 15 40 (21mm,25mm,31mm) 45 80 (21mm,25mm,31mm) headstorm files h files size no. 15,20,25,30,35,40,45,50,55,60,65,70,75,80 15 40 and 45 80 1070 hohmann recactor 6mm 1071 hohmann retractor 12 mm 1072 hohmann retractor 25 mm 1073 hot plate electrically operated 1074 hot water bag i.r. hospital size 1075 humpfys knife with blades 1076 i.v. set (micro)/pediatric drip set 1077 i.v. set adult 1078 i.v. stand heavy base 1079 icu bed 1080 infussion pump (not syringe pump) 1081 infussion pump (syringe pump) 1082 insert drill sleeve 3.5/2.5mm 1083 insert drill sleeve 4.5/3.2mm 1084 instrument sterilizer electrically operated s. 12inchx6inchx4inch 1085 instrument sterilizer electrically operated s. 16inchx6inchx4inch 1086 instrument sterilizer electrically operated s. 20inchx8inchx6inch 1087 instrument sterilizer electrically operated s.10inchx5inchx3inch 1088 instrument sterilizer electrically operated s.18inchx8inchx6inch 1089 intrauterine contraceptive devices ( te/ cu 250 3years, te/tu375 5years te/tu 380 10years) 1090 ishra colour book imported 1091 iv cannula ( two way ) size 23 g 1092 iv cannula ( two way ) size 24 g 1093 iv cannula ( two way) size 18 g 1094 iv cannula ( two way) size 22 g 1095 iv cannula ( two way) size 26 g 1096 iv. cannula sizes 18 g with injection valve (port) 1097 iv. cannula sizes 24 g with injection valve (port) 1098 kallian nasal gouge 1099 karrich adjustable alluminum 1100 karrich adjustable wooden 1101 k claver leaf nails for femer size 32, 34, 36, 38, 40, 42, cm.x 5,6,7,8,9,10,11,12 mm. 1102 kelleyinch™s pad disposable 1103 kelleyinch™s pad rubber for douching i.r. 1104 k files 15 40 (21mm,25mm,31mm) 45 80 (21mm,25mm,31mm) endodontic files kfiles size no. 15,20,25,30,35,40,45,50,55,60,65,70,75,80 15 40 and 45 80 1105 kidney tray 1106 kirschner wire 1.8 x150mm 1107 k nail extractor 1108 kunteschers nails femer 9,10,11 mm. x 38,40,42 cm. 1109 k wire both ended pointed all size 1110 k wire introducer 1111 l.p. needles assorted size 1112 laringoscopesadult 1113 laringoscopes paediatric 1114 laryngoscope complete with 3 blades s.s. 1115 lions bone holding forceps for femer 1116 locking pliers 1117 lotion povidine iodine 5% 100 ml 1118 lotion surgical scrub povidine iodine7.5% 500 ml 1119 lower root forceps 1120 lowmaninch™s bone holding forceps for femer 1121 lowmaninch™s bone holding forceps for radius ulna 1122 mackintosh double colur water proof 1123 microscope (binacular) 1124 microscope (monocular) 1125 mosquito forceps st/curved s.s. 5inch 1126 mosquito haemostatic forceps st/curved s.s. 1127 mother and child care kit ( sterlised surgical gloves 6.5 no. one pair ,sterlised surgical gloves 7 no. one pair,bp blade 15 no.,infant feeding tube,bp handle for blade,absorbent cotton 50 gm, gauze sponge 20x20 cm, disposable suction bulb, umblical cord clamp, polysheet 60x60 cm, disp non woven towel, disposable gown, placenta bag 14x9 size, carbolic soap) 1128 n95 mask 1129 nebulizer 1130 needle cutter 1131 needle holder s.s. size 6inch 1132 needle holder s.s. size 8inch 1133 needle hypodermic insulin needle (metallic non. sterile ) size 26 g x 1/2 1134 needle syringe distroyer electric 1135 new born kit with 4 pieces (cotton cloth) 1136 new born kit with 6 pieces (cotton cloth) 1137 nitrous oxide cylinder 20 cft. 1138 oleraven screw 3inch, 4inch,5inch 1139 operation table pad complete. 1140 ophthalmoscope electrically operated 1141 ophthalmoscope electronic operatedwith remote 1142 orthopedic bedcomplete 1143 orthopedic table 1144 osteotome s.s. assorted size 1145 ovum forceps s.s. 10inch 1146 oxygen concentrator 1147 oxygen cylinder complete 40 qft. 1148 oxygen cylinder complete220 cft. 1149 oxygen flowmeter with humidifier bottle 1150 oxygon flow meter tube with metal complete 1151 p.m. gloves assorted size 1152 paper adhesive plaster microporous surgical tape 1 inch x 9 m / roll [700122] 1153 paper adhesive plaster microporous surgical tape 2 inch x 5m /roll [700124] 1154 paper adhesive plaster microporous surgical tape 4 inch x 9 m / roll [700123] 1155 paper adhesive plaster microporous surgical tape 6 inch x 5m /roll [700125] 1156 parda printed (4ftx4ft) 1157 parda printed (4ftx6ft) 1158 periastel elevator fibre handle 10mm 1159 periastel elevator fibre handle 6mm 1160 phenyl isi mark grade i 1161 phosphoric acid etchant 1162 photo therapy double single surface 1163 photo therapy unit single surface 1164 pin cutter for nail 14 inches 1165 pine cleaner 500ml 1166 plair with cutter 1167 plaster cutter s.s. large 1168 plaster cutter s.s. medium 1169 plaster cutter s.s. small 1170 plaster of paris 1171 plastic tubing for suction apparatus. 1172 plate bender 1173 plate bending template 1174 plate holding forceps ratchet lock 1175 proctoscope s.s. adult 1176 proctoscope s.s. child 1177 prolene n0. 1 on needle 1178 prolene n0. 1 0 on needle 1179 prolene n0. 2 on needle 1180 prolene n0. 2 0 on needle 1181 pully for skin traction 1182 pulp devitalize 1183 puls oxymeter new nets 1184 pulse oxymeter (finger tip) 1185 radiant warmer 1186 radio opaque calcium hydroxide cavity liner paste of ca(oh)2 paste and catalyst 1187 radious and ulna nails extractor 1188 reduction forcep bend tip ratchet lock 1189 reduction forcep pointed ratchet lock 1190 reduction forcep pointed ratchet lock 150 mm 1191 reduction forcep pointed ratchet lock 200 mm 1192 reduction forcep serratedratchet lock 150 mm 1193 reduction forcep serratedratchet lock 200 mm 1194 reduction forcep serrated ratchet lock 1195 refrigerator 1196 room heater 1197 root canal disinfectant consisting of thymol dexamethasone 1198 root canal sealer 1199 rubber catheter n0. 4 ,5, 6 ,7, 8 1200 ryles tube (p.v.s) children size 10, 12 1201 ryles tube (p.v.s) children size 16, 18 1202 ryles tube (p.v.s) children size 5 1203 ryles tube (p.v.s) children size 6 1204 ryles tube (p.v.s) children size 8 1205 safe delivery kit 1206 salbutamal sol. for nebulizer 5mg/ml 1207 salbutamol repsule inhaler for inhalation 1208 salbutamol sulphate inhalation 1209 sanitary/maternity pad/napkin with belt large weight 8 10gms (10 pad pack) 1210 sanitary/maternity pad/napkin without belt regular weight 6 8gms (6 pad pack) 1211 savlon 500ml 1212 scale with guge s.s. 1213 scalerinch™s universal, push marginal and sickets. 1214 scissor curved s.s. size 6.5 1215 scissor curved s.s. size 7.5 1216 scissor curved s.s. size 8.5 1217 scissor straight s.s. size 6.5 1218 scissor straight s.s. size 7.5 1219 scissor straight s.s. size 8.5 1220 screw driver hexagonal holding sleeve for 27mm locking screws 1221 screw driver hexagonal holding sleeves 2.5 mm tip 1222 screw driver hexagonal holding sleeves 3.5 mm tip 1223 screw driver quick coupling for 2.4/2.7 mm locking screws 1224 screw driver quick coupling for 3.5mm locking & 3.5mm cortical 1225 screw driver quick coupling for 5mm locking & 45 mm cortical 1226 screw driver torque for 2.4/2.7 mm locking screws 1227 screw driver torque for 3.5mm locking screws 1228 screw driver torque for 5mm locking screws 1229 screw holding forceps 1230 screws impactor shaft quick coupling large 1231 screws impactor shaft quick coupling medium 1232 screws impactor shaft quick coupling small 1233 self centering bone holding forcep speed lock 190mm 1234 self centering bone holding forcep speed lock 250mm 1235 semi automated biochemistry analyser 1236 semi fowler bed 1237 sharp hook 1238 slottted screw driver shaft quick copuling for large 1239 slottted screw driver shaft quick copuling small 1240 sodium hypochloride 5ltr jar 1241 sonography roll 1242 spary ethyl chloride 1243 spinal needdle 23 no. 1244 sponge holding forceps s.s. 10inch 1245 sponge stone complete. 1246 spreader 15 40 (21mm,25mm,31mm) 1247 sprit lamp 40 z 1248 sputam afb test reagent 1249 squar nails for radious & ulna 2, 2.5, 3 mmx 18,20, 22 cm. 1250 steel rack three side cover full (3ft x 6 ft x1.5 ft) 1251 steinmin pin s.s. 1252 sterile gloves size 6 isi mark 1253 sterile gloves size 6 1/2 isi mark 1254 sterile gloves size 7 isi mark 1255 sterile gloves size 7. 1/2 isi mark 1256 sterile gloves size 8 isi mark 1257 sterillium 500 ml 1258 stitch cutting scissor s.s. 1259 stomatch tube i.r. 1260 stop watch complete 1261 suction disposable tips 1262 suction machein isi mark electronic opp. with pollycorbonate jar 1263 suction tube no. 6 1264 suction tube no. 8 1265 surgeon apron plastic full size 1266 surgical blade size 22 (100 in each pack) 1267 surgical spirit 100 ml 1268 surgical spirit 500 ml 1269 surgical tray 10x12inch 1270 surgical tray 8x10inch 1271 sutur mersilk 2 0 for nsv 1272 t handle quick coupling 1273 tailor scissor 1274 tap 4.5mm 1275 tap for 2.4 mm screws quick coupling 1276 tap for 2.7 mm screws quick coupling 1277 tap for 4.5mm cortical screw quick coupling 1278 tap for 6.5mm cortical screw quick coupling 1279 tap t handle for 3.5mm cortical screw 1280 tap t handle for 4mm cancellous screw 1281 temperorary restoration material 1282 test tubeborosil size 3inch 1283 test tubeborosil size 4inch 1284 test tubeborosil size 5inch 1285 test tube basket 1286 test tube stand s.s. 1287 test tubes holder 1288 thomus splint large 1289 thomus splint mediun 1290 thomus splint small 1291 threaded drill guide 3.5 for drill bit 2.8mm 1292 threaded drill guide 5.0 for drill bit 4.3mm 1293 three layer surgical mask 1294 thyoride analyser fully autometic 1295 tincture benzoin 500 ml 1296 tincture iodine 500 ml 1297 toilet cleaner 1ltr jar 1298 toilet soap 1299 tongue forceps s.s. 1300 tonometer complete imported 1301 tonsil snare complete s.s. 1302 towel clip cross action s.s. 1303 tracheotomy tube silver asserted size 1304 trephine 1305 trial case complete 1306 tubing 1307 turkis towel white std size 1308 u.s.g. gel 100ml 1309 urinary drainage bag 1310 urine accession strip 1311 urine collection bag 1312 uterine dressing forceps s.s. 10inch 1313 weghing machine adult size isi mark 1314 weghing machine electronic for child 1315 weighing machine child size isi mark 1316 wheel for stretcher rubber size 2inch 1317 wheel for stretcher rubber size 3inch 1318 wheel for stretcher rubber size 4inch 1319 wheel for stretcher rubber size 6inch 1320 wheel for stretcher rubber size 8inch 1321 x ray developer 1322 x ray film 10inchx 12inch 1323 x ray film 12inchx15inch 1324 x ray film 8inchx 10inch 1325 x ray film size 2.2cmx3.5cm 1326 x ray film size 3cmx4cm 1327 x ray film6 .5inchx 8.5inch 1328 x ray fixer 1329 zinc oxide powder 1330 zinc oxy phosphate cement powder with liquid (heaved cement) ...

Madhya Pradesh Police Department - Madhya Pradesh

37668647 tender for supply of chemical items of dna units of m.p. 1 chemical item 2 absolute alcohol 3 acetic acid glacial 4 acetone 5 ammonium sulphate 6 ammonia 7 benzene 8 chloroform 9 diethyl ether 10 n hexane 11 n heptane 12 methanol 13 nesslers reagent 14 palladium chloride 15 petroleum ether ( 60 80oc ) 16 petroleum ether ( 40 60oc ) 17 silica gel 18 silica gel g 60 f254 pre coated tlc plate aluminium sheets ( 20 x 20 cm ) 19 silica gel g glass plate ( 20 x 20 cm ) 20 schiff’s reagent 21 test tubes 20 ml 22 bromoform 98% 23 benzidine 24 hydrogen peroxide 25 eosin prepared reagent 26 eosin prepared reagent 27 haemotoxilin prepared reagent 28 haemotoxilin prepared reagent 29 glacial acetic acid 30 microscopic cover glass / cover slips 31 marker for body fluid examination 32 filter paper 46x 57 cm or more 33 filter papersize 18 x 22 inch or more 34 sanitizer / hand disinfectant 35 hand wash 36 tough tag 37 dropper / pasteur pipette 38 surface sterilizer 39 test tubes 200 40 test tubes 100...

Government Medical College - Madhya Pradesh

37436544 supply for central lab consumable and other items supply for central lab consumable and other items in gmc ratlam , three part automated cell counter model : swelab alfa plus basic close system , swelab alfa plus diluents , swelab alfa plus lyser , boule control normal , boule control low , boule control high , automatic coagulation analyzer model : sta compact max 3 close system , stac cacl20, 0025m (00367) , sta cephascreen 10(00310) , sta cleanser solution 6x2500ml(00973) , sta coag control n+p(00679) , sta desorb u24x15ml (00975) , sta liatest control n+p (00526) , sta liatest d di (00662) , sta @ neoptimal 5. (01163) , sta owren koller 24x15ml(00360) , chemicals , xylene (sulphar free) , paraffin wax (58 60 temperature) , acetone , eosin (2%) , distyrene plasticizer xylene (dpx mountant) , glacial acetic acid , formic acid (100%) , nitric acid (100%) , propanol (45%) , sodium metabisulphate , sodium nitroprusside , liquor ammonia , ammonium sulphate , sulphosalicilic acid solution , og 6 , ea 50 , semen analysis diluting fluid , formaline , spirit alcohol , sulphuric acid , reticulocyte count fluid , distilled water , sodium hypochloride , methanol , glucose pouch , perls stain (long expiray) , pas stain (long expiray) , mpo sstain (long expiray) , benzidine solution (long expiray) , alpha napthol , copper acetate , glucose (dextrose) 1 , fructose , iodine cristal , resorcinol , sprit lamp (steel) , sprit 100% (flammable) , sodium hydroxide , starch soluble , sodium nitrite , lead acetate , sodium carbonate , trichloroacetic acid , ammonium malybdate , sulphar powder , ammonia solution , egg albumin powder , fouchets reagent , organic solvent (sprit) , funnel poly lab , mercuric sulphate , copper sulphate , ninhydrin ar , bile salt , kits , reticulocyte count kit , field stain kit , giemsa stain kit , pt/inr kit , hbsag elisa kit , hbsag rapid cards , reagent , benedict reagent (long expiray) , ehrlich’s reagent (long expiray) , esbech’s reagent (long expiray) , fouchet reagent (long expiray) , other consumable items , casset , glass dish staining jar , hand wash , bubbler (plastic screw) , volumetric flask 100ml , filter paper 12.5dm , diamond pencil , knife (grossing) , speciman jar with lid (glass) (200x200x70 mm) , speciman jar with lid (glass) (150x150x60mm) , museum jar with lid (glass) (220x150x100mm) , museum jar with lid (glass) (220x195x80mm) , museum jar with lid (glass) (250x165x140mm) , museum jar with lid (glass) (360x150x100mm) , museum jar with lid (glass) (150x150x80mm) , museum jar with lid (glass) (250x250x120mm) , museum jar (10x10x15 inches) , museum jar (18x12x12 inches) , museum jar (25x15x10 inches) , pippette 1 ml (borosilicate) , pippette 5 ml (borosilicate) , glass rod (solid ) , slide holder (steel) , slide staining rack , application plastic stick , sprit lamp glass , tube holder , rbc pipette , wbc pipette , pasture pipette , tissue embedding mold , embedding o ring , test tube 15 ml , test tube 20 ml , centrifuge tube 15ml , centrifugr graduated tube 15 ml , reagent bottle 100 ml , reagent bottle 250ml , measuring cylinder 100 ml , measuring cylinder 5 ml , detergent powder , culture media , agar powder , alkaline peptone water , anhydrous barium chloride , arabinose , arginine dihydrolase powder , automated blood culture bottle (adult) compatible withbact/alert 3d 480, bio merieux , automated blood culture bottle (paediatrics) compatible withbact/alert 3d 480, bio merieux , lowenstein jansens medium(ready prepared) , lactose , lysine decarboxylase , macconkey broth single strength (for water testing) , maltose , mannitol , pyr agar , robertson cooked meat medium base , sodium deoxycholate , sucrose , tcbs agar , antibiotic disc , cefepime 50ug , cefoperazone / sulbactum , cefotaxime+clavulanate , cefpodoxime , ceftazidime+clavulanate , ceftriaxone sulbactum 30/15ug , colistin (0.016 256 mcg/ml) , cotrimoxazole(25 ?g) , doripenem(10 ?g) , ertapenem(10 ?g) , imipenem 10 mcg , meropenam 10ug , novobiocin(5 ?g) , quinopristin dalfopristin(15 ?g) , teicoplanin , ticarcillin clavulanate(75/10 ?g) , vancomycin (0.016 256 mcg/ml) , bacitracin(0.4 u) , sterile disc , v factor , x factor , x+v factor , optochin(5 ?g) , kits & chemical , acetone solution , acid fast staining kit , albert’s metachromatic stain kit , andrade’s indicator , anti hav igm (elisa kit) , anti hcv antibody kits (elisa kit) , aso kit(25 test/packet),consumable , basic carbol fuchsin for afb staining(powder) , conc hcl , crystal violet powder , formaldehyde solution , filarial antigen card test , ferric chloride (500 gm) , formaldehyde 40% (conc. formaline) , giemsa stain (merck / span) , glycerol , gram iodine , gram staining kit , h2so4 (sulphuric acid) 25% , hbv elisa test kit , hepatitis e virus anti hev igm antibody (elisa) , hydrogen peroxide 6% solution , india ink , kovac’s reagent (indole) , lacto phenol cottons blue stain , lead acetate strip , leishman stain , liquid paraffin , methyl blue for (z n) , methyl alcohol , nitrate reagent a , nitrate reagent b , oxidase disc , oxidase reagent (tetra methyl para phenylene di amine di hydro chloride) , phenol crystals , pyr reagent , urea 40% supplement (for urea agar base) , voges proskauer reagent a , voges proskauer reagent b , xylene , zinc dust , biological indicator for autoclave (indicator vial) , glassware, plasticware& other item , autoclavable aluminium foil , autoclavable reusable transparent bags , bcg(1 ml each) , bloting paper (paper) , burning sprit , cedar wood oil , concavity slide , cover slip , cryogenic vial , disposable plastic loop 2mm , disposable plastic loop 4mm , disposable sharp collection containers(5 ltr) , dropping bottle plastic 100 120 ml capacity , durham’s tube , filter paper sheet((whatmann no 01) , gaspak (3.5 liter) , glass marking pen (diamond ) , glass reagent bottle (5 litre) , glass test tube 12 x 50 borocilicate glass autoclavable , metal loop holder , soap , sterile disposable/hypodermic syringe for single use(5ml ) , sterile disposable/hypodermic syringe with needle for single use(2ml ) , sterile disposable/hypodermic syringe with needle for single use(10ml ) , test tube stand, polypropylene, 3 tier(for keeping 10 ml vtm vials/ tier) , utility gloves(medium) , atcc strain & antisera , acinetobacter baumannii nctc 13304 , enterococcus faecalis atcc 29212 , klebsiella pneumoniae atcc 700603 , pseudomonas aeruginosa atcc 27853 , staphylococcus aureus 25923 , escheriachia coli 25922 , staphylococcus aureus atcc43300 (mrsa) , shigella boydii polyvalent c antisera , shigella dysentriae polyvalent a antisera , shigella flexneri polyvalent b antisera , shigella sonnei polyvalent d antisera , vibrio cholera o1(ogawa)antisera , vibrio cholera o1( inaba)antisera , vibrio cholera (o139 )antisera , salmonella typhi poly o antisera , salmonella typhi o 2 antisera , salmonella typhi o 7 antisera , salmonella typhi o 9 antisera , rt pcr kits, chemical & consumable , 0.2 ml pcr tube (sterile, flat cap shaped) dnase/rnase free , 15 ml polypropylene centrifuge tubes, sterile, {certified nonpyrogenic and dnase /rnase free, disposable conical bottom with seal caps(the tubes should have printed graduations and a large white marking spots)} , alcohol 70% (laboratory grade) , bio medical waste bins red (15 ltr) , bio medical waste bins red (25 ltr) , bio medical waste bins red (40 ltr) , bio medical waste bins yellow (15 ltr) , bio medical waste bins yellow (25 ltr) , bio medical waste bins yellow (40 ltr) , bmw polybags red colour (18 kg capacity) , bmw polybags red colour (28 kg capacity) , bmw polybags red colour(45 kg capacity) , bmw polybags red colour (05 kg capacity) , bmw polybags yellow colour (18 kg capacity) , bmw polybags yellow colour (28 kg capacity) , bmw polybags yellow colour (45 kg capacity) , cryotags / freezer labels, for 1.5 2.0 ml cryovials {ability to withstand cryogenic temperatures upto minus 80 degree c for a wide variety of plastic and glass vials, test tubes, cryogenic boxes and plates} , diluent for dna extraction/ ethanol, molecular(biology grade) , filter barrier tips 20 ul (in box packing, sterile dnase rnase pyrogenfree compatible with nichipet ex2 pipette (make nichiriyo)) , filter barriertips 10 ul (sterile dnase rnase pyrogenfree compatible with nichipet ex2 pipette (make nichiriyo)) , filter barriertips 1000 ul (sterile dnase rnase pyrogenfree compatible with nichipet ex2 pipette (make nichiriyo)) , filter barriertips 200 ul (sterile dnase rnase pyrogenfree compatible with nichipet ex2 pipette (make nichiriyo)) , micro centrifuge tube 0.5 ml (polypropylene tubes, resistance to chemicals, mechanical stress and temperature extremes,(autoclavable, dnase, rnase/endotoxin free)) , micro centrifuge tube 1.5 ml(polypropylene tubes, resistance to chemicals, mechanical stress and temperature extremes,(autoclavable, dnase, rnase/endotoxin free)) , micro centrifuge tube 2 ml(polypropylene tubes, resistance to chemicals, mechanical stress and temperature extremes,(autoclavable, dnase, rnase/endotoxin free)) , micro pipette tips 5 300ul , microcentrifuge tube rack (20 tube/24 tube capacity)(for 1.5/2ml tube) , microcentrifuge tube rack (80 tube/96 tube capacity) reversible one side for 1.5ml tube and other( side with 0.2 ml pcr tubes) , non latex purple nitrile gloves (large) (sterile dnase rnase pyrogenfree ) , non latex purple nitrile gloves (medium) (sterile dnase rnase pyrogenfree ) , optical adhesive covers for pcr 96 well rxn plates 0.2ml (compatible with biorad cfx 97 dx opm) , optical adhesive covers for pcr 96 well rxn plates 0.2ml (compatible with thermo fisher a28574 quant studiort pcr machine) , parafilm roll (size approx 2 inch width and 250 inch length) , pcr 96 well rxn plates 0.2ml (compatible with biorad cfx 97 dx opm) , pcr 96 well rxn plates 0.2ml (compatible with thermo fisher a28574 quant studiort pcr machine) , pcr strips 0.1 ml (strip of 4) (compatible with qiagen 5plex rotorgene rt pcr machine) , pcr strips 0.2 ml with attached cap (strip of 8) (compatible with thermo fisher a28574 quant studiort pcr machine) , pcr strips 0.2 ml with attached cap (strip of 8) (compatible with biorad cfx 97 dx opm) , rnase/ dnase away solution (for complete removal of rnase/ dnase contamination from work surfaces, pipettes and equipments(should be stable at room temperature)) , sterile pasteurppipettes 3ml , viral transport media with swabs (3ml vial with 2 regular swabs i.e. one nasal swab and one throat swab (1.viral transport medium (vtm) with swab with complete directions for collection, storage, transport and carrying. 2.sterile dacron, polyester or rayon sterile swabs with plastic shafts)) , aluminium foil (9 meters length) thickness 11 microns, width 30 cm , compertable with transasia xl 1000fully automated biochemistry analyser , erba gamma gt kit (5x44ml/5x11 ml ) , compertable with transasia semi auto analyzer erbachem 5x , ldh kit , ck mb kit , hdl kit , micropippte((0.5 50 ul)) , external quality control vial for routine biochemistry (erba chem 5x) , protein csf kit , lamp. (erba chem 5x) , calcium (50x1 ml) , ada , compertable with gelmatrix system model : tulip , ahg (coombs) test card , complete grouping card , diluent 2 liss , ngl xcf 3000 blood component separator machine , platelet apheresis bag...

Kendriya Vidyalaya Sangathan - Madhya Pradesh

36473488 bids are invited for physics and chem lab equipment volumetric flask 100ml , watch glass , wash bottle , 24dnp , agaragar , ammonium chloride , ammonium phosphate , benzene , benzoic acid , chloroform , copper sulphate , distilled water , magnessium ribbon , manganese dioxide , phenophthalein , potassium chromate , potassium hydroxide , potassium sulphate , strontium chloride , sulphuric acid , zinc sulphate , zinc rod , benzaldehyde , volumetric flask 500ml , volumetric flask 250ml , ammonium hydroxide , sodium metal , parafin liquid , sodium thiosulthate , hydrogen peroxide , sodium sulphite , stopwatch , polythene bottle 250ml , alumium metal chip , sulphar powder , carbon di sulphide , lead nitrate , plain slides , cover slips , droppers , acetocarmine stain , glacial acetic acid , sucrose , potassium nitrate , neutral litmus solution , universal indicator , ethanol , calcium carbonate , sodium bicarbonate , phenolphthalein , bacteria , paramecium , euglena , chlamydomonas , volvox , entamoeba , budding of yeast , rhizopus , spirogyra , epidermal peel with stomatas , parenchyma collenchymas scelerenchyma , pollen germination on stigma , t.s. testis of any mammal , t.s.ovary f any mammal , t.s.blastula of any mammal , t.s.morula gastrula of any mammal , cardiac muscles striated muscles smooth muscles , w.m. of nerve cell , glass rod , test tube brushes , wash bottle total quantity : 623...

Directorate Of Medical Education - Madhya Pradesh

36434740 kits chemical and comsumable, reagents tender regarding kits chemical and comsumable, reagents , name of department : pathology , diluent ( m 53 ) , lyse ( lh ) ( m 53 ) , leo ( ii ) ( m 53 ) , leo ( i ) ( m 53 ) , cleanser ( m 53 ) , probe cleanser ( m 53 ) , quality control ( m 53 ) , calibrator ( m 53 ) , bendedicts qualitative reagent , reticulocyte kit , leishmann stain sol. with buffer tablet ph , methanol ( acetone free ) , occult blood test kit ( haem test kit ) , drabkins solution , vaccutainer edta ( k3 vial with needles ) , immersion oil ( merck / span ) , test tube glass ( 12 x75 ) borosil / pyrex , tips ( micropipette ) ( 5 200?l ) , glass capillary tube , lancet , ( 10 ml syring ( piston with rubber bang ) , disodium hydrogen phosphate ( anhydrous ) , sodium di hydrogen phosphate , protein for csf ( calorimeter ) , albumin for csf ( albumin ) , rubber gloves 6.5, 7.0, 75 size , strips for urine albumin and sugar , hypochlorite so. ( conc. ) , ehrilichs aldehyde reagent , semen diluting fluid , wbc diluting fluid , sulphur powder , test tube holder , manual cellcounter , neubaerscounting chamber new improved , urinometer for specific gravity , h2o2 ( conc. ) , leishman staining powder , esr wintrobe tube ( glass ) , ammonia sol. , tissue paper roll , fouchets reagent , esbachsreagent , ehrlichs reagent , litmus paper , total protein reagent , filter paper , forceps 6 & 4 , tissue roll , vaccutainer needles holder , tourniquet , sodium citrate vail , cell pack , stromatolyzer 4 dl , stromatolyzer 4 ds , sulfolyzer , cell clean , g6pd kits , coombs , leishmann stain sol. with buffer tablet ph leishmans , waxparaffin ( 60 62 digree ) high grade, , formaline , microtome blade ( thermo ) m x 35 ultra 34 / 80 mm , nitric acid , filter paper sheet size 460mm x 570mm , popy lysine coated slide , poly lysine solusion , citric acid , tri sodium , sodium di hydrogen phosphate , disodium hydrogen phosphate , sodium chloride , tris ( hydroxy methyl ) amino methane , pas staining kit , microtome blades ( spencer’s rottary ) high profile , ptah staining kit , microtome blades ( thermo ) hp35 ultra 34 / 75 mm , cryomatrix gel ( thrmo ) , crytome ( fe ) cryocassette ( block hider ) , reticuline stain , messon tricrome , l mold ( brass metal ) size 6x03x02cm , cassette ( for tissue processing ) metal , dimond pencil , formic acid , runing water tray ( for histology ) , grossing nife ( ss ) , forcep 6’’ , scissors 6’’ , slide tray aluminium , coplinjar , tissue paper , cover slipe ( 22x50mm ) histology+ cytology , glycerol , con. hcl , muccuric oxide , iron alum amunium potesium sulphate , fericammonium sulphate , mucicarmine stain , alcian blue stain , congo red stain , staining rack , gold chloride , sliver nitrate , liquer ammonia , ph paper , slide filing cabinets , alcohol ( isopropyle alcohol ) histology + cytology , glass slide histology, cytology, cpl , xylene sulpher free histology + cytology , cover slips22x22 mm histology + cytology+cpl , d.p.x. 250 ml histology + cytology , haematoxyline powder 5 gm histology + cytology , glacial acetic acid histology + cytology+cpl , cover slips22x50 mm histology + cytology , cover slips22x40 mm histology + cytology , ea 50 , og 06 , eosin , carbal fuchsin , acid fast , methylene blue , cytospin filter card , cytospin filter cup with clips , plain plastic tube , glass test tube , filter paper sheet , diamond pencil , sta neoptimal cl 10 ( 00667 ) , sta ptt automate 5 ( 00595 ) , sta c.k. prest 5 ( 00597 ) , sta thrombin 2 ( 0611 ) , sta lia testd di plus ( 00662 ) , sta coag control ( n+p ) ( 00679 ) , sta lia test control n+p ( 00526 ) , sta lia test vwf:ag ( 00518 ) , sta immnodef def f viii ( 00728 ) , sta immnodef def f ix ( 00734 ) , sta pool norm ( 00539 ) , sta desorb u ( 00975 ) , sta cacl2 0.025 m ( 00367 ) , sta cleanersolution ( 00973 ) , sta cuvettes ( 38669 ) , sta cuvettes satellite ( 39430 ) , sta liquid cooling glycol ( 38640 ) , sta ptt la ( 00599 ) , sta liquid fib ( 00673 ) , sta pm kits ( 89567 ) , sta system control ( 00678 ) , sta uni calibrator ( 00675 ) , water bath measures ( with thermostate ) , aggregometer , digital stop watchs , incubator ( variable tempresure medium size ) , micro ppt ( finn pipette ) variable , ( a ) 20 200 ? l , ( b ) 05 100 ? l , ( b ) 1000 5000 ? l , ( d ) 50 500 ? l , centrifuge digital without carbon bush ( remi r 8c bc ) , thermametre ( mercury ) centrigrate , diamond pencil , semi automatic coagulometer ( 04 tube ) , cell pack , stromato lyser 4 dl , stromato lyser 4 ds , sulfo lyser , cell clean , e check trilevel , scs 1000 calibrator , g6pd kits ( qualitative ) , coombs sera , tri sodium citrate , amonium sulphate ( erba pure ( nh4 ) so4 , lieshman stain with buffer , mpo stain , iron stain ( perls ) , liquar amonia solution , sodium hypo cloride , distilled water , normal saline ( ns ) , immersion oil , methanol ( acetone free ) , chloroform ( chcl3 ) , potassium ferocyanide , sodium meta bisulfite ( ar ) , h2o2 ( hydrogen peroxide ) , dpx mountant , sodium dihydrogen phosphate , di sodium hydrogen phosphate , bovine albumin ( 22 % ) , acetone solution , syringe plastice 02 ml , piston with rubber bag 5 ml ( syringe ) , piston with rubber bag 10 ml ( syringe ) , hand gloves ( ruber ) , gauze , cotton roll , tissue paper , filter paper roundshape , hand wash shop / solution , citrate test tube ( 3.2% ) 2 ml mark , edta vial 2ml mark ( vacutainer ) , plain plastice 5 ml test tube with stopper , microtips ( unirersal type ) , micro centrifuge tubes ( 1.5ml size ) , glass slides ( blue star ) , cover slips ( blue star ) , glass test tubes ( borsil ) , glass test tubes ( borsil ) , glass ppt. ( mark up to tip ) , glass ppt. ( mark up to brosil ) , rubber bulb for ppt , glass fimmd ( borosil ) , bio rad d 10 tm dual program , lyphochek a2 control ( 553 ) l1+l2 , plastic aliquos polypropylane vials with pierceable caps ( sample vials 1.5 ml ) , micropipettes ( 100 1000 micro lt. ) , micropipettes ( 05 50 micro lt. ) , microtips+macrolips ( large ) , microtips+macrolips ( small ) , thermal printer paper ( 4 ) , rb a hu3c comlenent / fitc , rb a hu igg / fitc , rb a hu igm / fitc , rb a hu iga / fitc , miscellaneous item , igg , iga , igm , c3 , cig , c4d ( tansplant ) , fibrinogen , kappa ( kidnev only ) , lambds ( kidnev only ) , fitc ( florescent isothiayank , rhodaminc , feulgen stain , michelsmidium ( transport midium ) , er immuneo , pr immune , her 2 / neu , hpv 16 & hsv immuno stains , proliferative marker p 53 , proliferative marker kit 67 , pancytokeratin , ck 7 , ck 20 , ema , cea , hmwck , apf , vimentin , s 100 , desmin , nse , chromogranin , synaptophysin , msa , c kit / cd 117 , cd 34 , cd 31 , lca , bcl 2 , bck 6 , cd 3 , cd 5 , cd 10 , cd 20 , cd 15 , cd 1a , cd 30 , cd 68 , cd 99 , alk 1 , ca 125 , hmb 45 , gfap , myoglobin , cd 19 , plap , cd 33 , mpo , leucognost alpa , leucognost est , leucognost pas , leucognost pox , leucognost basic set , hematognost fe , basic set / reduction set , ttf 1 , p16 , mannual kits for liquid based cytology , cd 34 , cd 31 , lca , andriogenreceptro , myogenin , pten , cyclin d1 , lbc manual kits for cervical cancer screening , ihc basic kit , pap pen , humod chamber , name of department :pediatric medicine , crp ( turbidometry quantitative ) , crp slide ( latex / slide ) , urea ( modified berthelot ) , creatinine ( alkaline picrate kinetic ) , bilirubin t+d ( dmso ) , protein ( total ) { biuret } , printer paper ( thermal ) , sodium hypochlorite , tips – small ( 5 100 ul ) , tips – 1 ml ( big ) , micropipette – 1 ml , micropippete 50 ul , micropippete 10 ul , micropippete 5 50ul , dengue card , caliberator 1 and 2 , na electrode , k electrode , ca electrode , reference electrode , complete tubing set , paper roll , electrolyte filling solution , reference electrode filling solution , albumin ( bcg method ) , name of department :medicine , sterilant hot disinfectent for dialysis containing 21% ( approx ) ( citrostrile disinfectent ) for dialysis machine , sodium hypochlorite solution 5% for dialysis machine , dialyzer / a.v line reprocessing sterilant cold disinfectent for dialysiscontaining pracetic acid hydrogen peroxide acetic acid , equipment disinfecten gluteraldehyde solution 2% , bi_ carb h.d. fluid , bi_ carb potassium free h.d fluid , 1. wash cartridge 2. measurement cartridge for siemens abg machine , serum glucose kit method – god pod , blood urea kits modified birthlot method , serum creatinine method – jaffe’s kinetic method , eeg paste , eeg electrode , ncv electrode , emg needle , diluents ( abx minidil lmg ) method horiba abx micros es 60 , abx miniclean cleanser method horiba abx micros es 60 , abx mini lysevio method horiba abx micros es 60 , abx mono clair method horiba abx micros es 60 , urine strip method deka phan laura 10p make transasia , methanol , field stain a , field stain b , drabkin’s reagent method – cyanmethemoglobin , name of department : biochemistry department , murcuric sulphate , barium chloride , cupric acetate , creatinine powder , casine powder , formaldehyde , fructose powder , glucose powder , gelatin powder , lactose powder , mercuric chloride , maltose powder , phenyl hydrazine hydro chloride , resorcinol , sodium nitro prosside , sodium hydroxide , sodium tarcholate , sodium meta bisulphate , sucrose powder , starch , sodium chloride , sodium nitrite , sulphuric acid , hydro chloric acid , glacial acitic acid , nitric acid , ? napthol , phloroglucinol powder , ninhydrine powder , hydrogen peroxide , liquor ammonia , chloroform , albumin powder , ethanol ( abs.alcohol ) , amyl alcohal , ammonium molebdate , bromine ampule , burning spirit , sodium tungstate , lead oxid ( yellow ) , silver nitrate , urea powder , megnsium sulphate , uric acid , trichlora acitic acid , frerric chloride , cupper sulphate , ammonium oxalate , sulpher powder , bromocresal green ( liquid ) , picric acid , phenopthline indicator , lead acetate , orthophosphoric acid , sodium carbonate , lactic acid , barium nitrate , barium hydroxide , potassium chloride , sodium phosphatase ( hydrated ) , sodium pyrophosphate , n butanol , ether , phenol ( carbolic acid ) , phaspho molybdic acid , phasphotungstate , potassium hydroxide , sodium acetate , sodium carbonate , sodium hypo chloride , sodium tungstate , acetone , calcium chloride , ferrous sulphate , bilirubin powder , sodium benzoate , sodium dihydrogen phosphate monohydrate , thioberbituric acid , sodium citrate , sodium meta bisulphate , methanol , tannic acid , acitic anhydride , sodium diethyle dithio carbamate , sodium sulphate , ferric ammonium sulphate , perchloric acid , adrenaline bi tartrate , l tyrophan , l alanine , l arginine , l aspartic acid , l cysteine , l glycine , l tyrisine , l serine , l histidine , l methionine , l phenyl alanine , pera nitrophynele phosphate , sodium citrate dihydrate , filter paper 1, 2, 3 , filter paper circular 1, 2 ( circular ) , filter paper plane , cellulose strip ( for electrophoresis ) , beaker , beaker , beaker , beaker , beaker , beaker , volumetric flask , volumetric flask , volumetric flask , funnel ( plastic ) , flat bottom flask , flat bottom flask , merking acid bottles ( hcl ) , merking acid bottles ( h2so4 ) , merking acid bottles ( hno3 ) , dropping bottles brown , dropping bottles plane , reagent bottle , test tube , test tube , spirit lamp , test tubes holder , fallin uw tube , slide glass , cover slip , doramess urea meter , measuring clyinder , measuring clyinder , measuring clyinder , measuring clyinder , test tube stand ( bigsize hole 12 test tubes ) , drapper ( big size ) , glucose god pod , urea birth lot , uric acidpap method , cholesterolchod pap method , total protein biurate , albuminbcg colorimetric test , csf protein ( end point ) , sgotifcc / uv kinetic method , sgptifcc / uv kinetic method , alkaline phosphatase pnpp amp kinetic assay , triglyceride , hdl cholestrol , serum bilirubinjendrassik & grof method , serum creatinine jeff s reaction ( alkaline picric method ) , serum calcium , serum phophorus , calibrator solution 1& 2 ( carelyte electrolyte analyzer ) ( electrode method ) , enzyme cleaning solution , sodium conditioner , reagent pack ( careline electrolyte analyzer ) ( electrode method ) , control level 1 , control level 2 , d proteinization solution , sodium conditioner , cleaning solution , glucose god pod ( ba 400 ) , urea urease / glumate dehydrogenase , serum creatinine jaffe compensated , sgotifcc , sgpt ifcc , alkaline phosphate amp2 amino 2 methly 1 propanal , total bilirubindicholophenyl dizo buffer ( ifcc ) , serum direct bilirubindicholophenyl dizonium , serum protein biuret , serum albumin bromocresol green , cholesterol cholesterol peroxidase method , triglyceride glycerol phaphate oxidase / peroxidase , hdl cholesteroldirect , hdl / ldl standard , ldl cholesterol direct , serum uric acid uricase peroxidase , serum calcium arsenazo iii , serum phosphorus , serum amylase direct substract , serum lipase colour method , cpk ( ck ) ifcc , ck mb ifcc , serum ferritinlatex , serum ferritin standard , hba1c direct , hba1c standard , crp , crp standard , ldh kit , magnesium kit , biochemistry calibrator , biochemistry control , wash solution concentrate , reaction rotor , pd cups , extran ma 02 , protein electrophoresis in blood ( serum kit ) code no.7004058 , normal control serumcode no.58305 , wash solution code no. 58595 , destaining solution code no.58694 , hb electrophoresis , d 10 hemoglobin a1c program recorder pack ( code no 220 0101 ) , d 10printer paper ( code no 220 0375 ) , liquichek diabetes control level 1 ( code no 171 ) , liquichek diabetes control level 2 ( code no 172 ) , tips ( 10 200 ul ) , tips ( 10 1000 ul ) , allicates , clot vaccutainer , distill water ( ltr ) , tissue paper roll , t3 elisa , t4 elisa , tsh elisa...

Directorate Of Medical Education - Madhya Pradesh

36184405 tender for supply of chemical and reagents for mdru dep , item name , mdru kits and reagents , ammonium chloride 500gm , potassium bi carbonate 500gm , sodium chloride 500gm , tris hcl 500gm , sds 500gm , saturated phenol 500ml , chloroform 500ml , sodium acetate 250gm , isoamyl alcohol 500ml / 1ltr , glacial acetic acid 500ml / 1ltr , molecular biology grade agarose powder 250gm , bromophenol blue dye 2ml*5=1pack , ethidium bromide 10ml , molecular weight ( dna ladder ) 100bp & 1kb 1 vial , molecular weight ( dna ladder ) 50bp 1 vial , molecular weight ( dna ladder ) 25bp 1 vial , taq polymerase 500units / vial , amplitaq gold dna polymerase master mix 500units / vial , mgcl2 5ml , dntp mix 1ml , dnase 1000 unit , rnase 1000 unit , proteinase k 1000 unit , tris edta 500 gm , edta 250gm / 500gm , boric acid 250gm / 500gm , teepol5 liter , xylene cynol 10 gm , dmso 50 ml , tips i. 0.2 20 ?l tips , superscript ii rnase reverse transcriptase / episcript™ rnase h reverse transcriptase ( episcript rt ) 400 / 500 reaction pack. , power sybrgreen pcr master mix 5 ml , power sybrgreen rt pcr reagent kit 5 ml , oligo ( dt ) 12 18 primer25ug ( 0.5ug / ul ) , absolute ethanol 500ml , pcr plates ( light cycler 480 compatible ) pack of 50 / pack of 100 , sealing foil ( rt pcr / qpcr grade ) ( light cycler 480 compatible ) pack of 50 / pack of 100 , filter tips each pack contains 1000 psc. , mct variable tubes each pack contains 1000 psc. , i. 20 200?l tubes , ii. 200 600 ?l tubes , iii. 500 2000 ?l tubes , nitrile autodextorous gloves each pack contains 1000 psc. , mctstands for variable tubes sizes each pack contains 10 psc. , i. 20 200?l tubes stand , ii. 200 600 ?l tubes stand , iii. 500 2000 ?l tubes stand , filter tip boxes each pack contains 10 psc. , i. 0.2 20 ?l filter barrier tip box , ii. 20 200 ?l filter barrier tip box , iii. 200 1000 ?l filter barrier tip box , rt pcr grade water pack size of 20ml ( 20 ml * 5 ) , tip discard box ( 1 2 liter capacity ) each , graduated measuring cylinders 50, 100, 500, 1000 ml each , graduated beakers 50, 100, 500, 1000 ml each , flat bottom tube 5ml ( with screw cap ) pack size of 500 psc. , tube stand ( 15ml falcon, 5ml, 2ml, 0.5ml, 0.2ml mct ) pack size of 10 psc. , graduated conical flask 50, 100, 500, 1000ml pack size of 5 psc. , test tube 5, 10 ml each pack contains 100 psc. , slide+cover slips ( 25mm*75mm ) each pack contains 100 psc. , tissue paper roll pack size of 12 psc. , fine tissue cloth roll pack size of 12 psc. , cotton pack size of 10 psc. , wash bottle / dropping bottle, 200ml, 500ml, 1ltr each , funnels variable range each , plastic bottle, 200, 500, 1000ml each , syringe + needle 2 ml, 5 ml pack size of 100 psc. each , nitrile gloves; medium and large size box pack size of 1000 psc. , dna isolation kit { blood } per kit , rna isolation kit per kit , phenol 500 ml , hno3 ( nitric acid ) 500 ml , propionaldehyde pure ( 97% ) 500 ml , phthalic anhydride 500 ml , glacialacetic acid ar 500 ml , hydrochloric acid ar 500 ml , sulfuric acid ar 500 ml , 2 amino ethanol 500 ml , pyridine ar 500 ml , ammonia solution ar 500 ml , ammonia chloride ar 500 ml , acetyl salicylic acid 500 ml , acetone ar 500 ml , anthranilic acid ar 500 ml , activated charcoal 500 ml , silica gel g 500 ml , benzoicacid ar 500 ml , sds 500 gm , colin ( cleaning detergent solution ) 500 ml , sterilium ( hand sanitizer ) 100 ml * 5 , dettol / lifeboy alcohol based hand sanitizer 100 ml * 5 , floor cleaner phenyl 1 l * 5 , cleaning mop per psc , broom per psc , microwave gloves per pair , brown paper for autoclaving per roll , liquid nitrogen 10 / 25 ltr. , phosphate buffer saline ( 10x; ph 7.4; rnase free ) 500 ml , formalin ( formaldehyde aqueous solution; lab grade ) 500 ml , paraffin wax ( 58 600c for histology ) 500 gm , xylene ( molecular lab grade ) 500 ml , glycerol500 ml , ammonia ( nh4oh; extra pure ) 250 ml / 500 ml , methanol ( methyl alcohol, ch3oh ) 500 ml , acrylamide / bis ar 500 ml , 10x tbe buffer 500 ml , urea ( ultra pure; mol bio grade ) 500 gm / 1kg , ammonium persulfate 100 gm , temed ( ultra pure; mol bio grade ) 100 ml / 250 ml , 4’, 6 diamidino 2 phenylindole 50 ml , diethyl pyrocarbonate 5 gm / 25 gm , tae buffer , sybr gold 100ul , restriction enzyme – mnl i250 / 300 / 500 units , restriction enzyme – bcli1000 / 1500 / 2500 / 3000 units , restriction enzyme – hpych4v100 / 500 units , restriction enzyme – hpych4iii200 / 250 / 1000 / 1250 units , restriction enzyme – sau96i 1000 units , restriction enzyme – sfci200 / 1000 units , restriction enzyme – bcci1000 units , restriction enzyme – scrfi500 / 1000 / 2500 units , restriction enzyme – afliii250 / 1250 units , restriction enzyme – scai500 / 1000 / 1250 units , restriction enzyme – avai1000 / 2000 units , restriction enzyme – bsmi200 / 500 / 1000 / 2500 units , restriction enzyme – tspri ( also share cleavage site withtscai ) 1000 units , restriction enzyme – mboii250 / 300 / 1250 / 1500 units , restriction enzyme – bsh1236i500 / 1000 / 2500 units , restriction enzyme – banii1000 / 1500 / 2000 units , restriction enzyme – mph1103i1000 / 5000 units , restriction enzyme – dde i200 / 500 / 1000 / 2500 units , restriction enzyme – bsmb i ( also share cleavage site withesp3i ) 200 / 400 / 1000 units , restriction enzyme – afa i ( also share cleavage site withrsa i ) 1000 / 5000 units , restriction enzyme – bal i ( also share cleavage site withmlu ni ) 50 / 100 / 200 / 250 units , restriction enzyme – fspi ( also share cleavage site withnsbi ) 400 / 500 / 1000 / 2500 units , restriction enzyme – hpa ii ( also share cleavage site withmspi ) 1000 / 2000 / 4000 / 5000 / 10000 units , restriction enzyme hinf i , restriction enzyme hpych4 , restriction enzyme mboii , restriction enzyme bstui , restriction enzyme mvai , primers , fmr1 set 1 –f5 tcaggcgctcagctccgtttcggtttca 3 r5 5 aagcgccattggagccccgcacttcc 3 , mecp2 exon 1 set 1 f5 gttatgtctttagtctttgg–3´ r5 tgtgtttatcttcaaaatgt–3´ , exon 2set 1 f5 cctgcctctgctcacttgtt–3´ r5 ggggtcatcatacatgggtc–3´ , exon 2set 2 f5 agcccgtgcagccatcagcc–3´ r5 gttccccccgaccccaccct–3´ , exon 3 set 1 –f5 tttgtcagagcgttgtcacc–3´ r5 cttcccaggacttttctcca–3´ , exon 3 set 2 f5 aaccacctaagaagcccaaa–3´ r5 ctgcacagatcggatagaagac–3´ , exon 3 set 3 f5 ggcaggaagcgaaaagctgag–3´, r5 tgagtggtggtgatggtggtgg–3´ , exon 3 set 4 – f5 5´–tggtgaagcccctgctggt–3´ r5 ctccctcccctcggtgtttg–3´ , exon 3 set 5 f5ggagaagatgcccagaggag–3´ r5 cggtaagaaaaacatccccaa–3´ , exon3 ( l100v ) f5 aaccacctaagaagcccaaa 3 r5 gcttaagcttccgtgtccagccttcaggta 3 , putative promoter and exon 1. f5 gggtgcaatgaaacgctta 3 r5 tttaccacagccctctctcc 3 , mc4r rs17782313 f 5 aagttctacctaccatgttcttgg 3 r 5 ttccccctgaagcttttcttgtcattttgat 3 fto rs9939609 f 5 aactggctcttgaatgaaataggattcaga 3 r5 agagtaacagagactatccaagtgcagtac 3 , adipoqrs2241766 – f5 tgtgtgtgtggggtctgtct 3 r 5 tgtgatgaaagaggccagaa 3 , rs1501299 f5 ctacactgatataaactatatggag 3 r5 ccccaaatcacttcaggttg 3 , pcsk1 rs155971 – f5’tatatgcagccaccaatcca 3’ r5’aaaatgaagggagaagcacaaa3’ , pomcrs6232 f5 ttgtgcccttcatctgaaca 3 r5 tgtagcaactttggcatgga 3 , rs155971 f5tatatgcagccaccaatcca 3 r5 aaaatgaagggagaagcacaaa 3 , ppar g ( pro12ala ) f5gcc aat tcaagc cca gtc 3r5gat atgttt gca gac agt gta tca gtg aaggaa tcg ctttcc g 3 , kcnj11 ( rs5219 ) f5 gactctgcagtgaggcccta 3’ r5 acgttgcagttgcctttctt 3’ , capn10 ( rs3792267 ) f5 cacgcttgctgtgaagtaatgc 3’r5 tgattcc catggtctgtagcac 3’pik3ca set 1 forward 5’ ggagtatttcatgaaacaaatgaatgatgcg 3’ reverse 5’ gagctttcattttctcagttatctt 3’ , bat 25 set 1 f 5’ tcgcctccaagaatgtaagt 3’r 5’ tctgcattttaactatggctc 3’bat 26 set 1 f5’ tgactacttttgacttcagcc 3’r5’ aaccattcaacatttttaaccc 3’ , d2s123 set 1 f5’ aaacaggatgcctgccttta 3’ r5’ ggactttccacctatgggac 3’ , d5s346 set 1 f 5’ actcactctagtgataaatcggg 3’ r5 agcagataagacagtattactagtt 3 , d17s250 – set 1 f5’ ggaagaatcaaatagacaat 3’ r5’ gctggccatatatatatttaaacc 3’ , impdh2 set 1 f5 gtttctgcggtatcccaatc 3 r5 cgagcaagtccagcctat 3 bmp6 rs73719353 f5’ gctcctttgcacttcgctgt 3’ , r5’ aggctctgctg agctcctac 3’ , bmp6 rs73719341 f 5’tgaacttcccattcccctct 3’ r5’ataaaattagcattgatcca 3’ , bmp6 rs73719318 f5’caggtgctgtgcaacttctt 3’ r 5’agagggcaccatggttgcct 3’ , bmp6 rs73381662 f 5’ ctgagattcaattaggccca 3’ r 5’taaagaacagcaaaagtctg 3’ , bmp6 rs73381650 f 5’cacataaagattgctgcatt 3’ r 5’tagtaatcctaaaaatggga 3’ , anxa2 rs7170178 f 5’ ttcacagcagttcaaaatac 3’ r 5’ ctgggtttccagagatggaa 3’ , anxa2 rs73435133 f 5’ gagtgcaaggtgctgaggat 3’ r 5’ gatttcagacagcccttgca 3’ , anxa2 rs73418020 f 5’ tctgagagtgaaaggtgcac 3’ r 5’ tcccatcccctgaatccctg 3’ , anxa2 rs72746635 f 5’ cctgactcattgtcacatca 3’ r 5’ aagtggctttccactgccc 3’ , anxa2 rs73418025 f 5’ cttctcatcttactttt 3’ r 5’ agggaaggatacagaggaga 3’ , hsp 70 primer sequence5 agcgt aacac cacca ttcc 3 ( forward ) 5 tggct cccac cctat ctc 3 ( reverse ) , the gapdh sequence forward primer 5 agc cac atc gct gag aca c 3, reverse primer 5 gcc caa tac gaccaa atcc 3. , mthfr f:5 tgtggtctcttcatccctcgc 3;r: 5 ccttttggtgatgcttgttggc 3. , dpyd f:5 actcaatatctttactctttcatcaggac 3. r: 5 acattcaccaacttatgccaattct 3. , tyms f:5’ ggtacaatccgcatccaactatta 3’ r:5’ ctgataggtcacggacagattt 3’ , imp3 forward:5’atgactcctccctacccg3’ reverse:5’gaaagctgcttgatgtgc3’ , cxcl1forward: 5’ccagacccgcctgctg 3’and reverse:5’cctcctcccttctggtcagtt 3’ , cox 2 forward: 5 cagccatacagcaaatcc 3; reverse: 5 tcgcacttatactggtcaa 3 , hmlh1f 5 ttt tga tgt aga tgt ttt att agg gtt gt 3r 5 acc acc tcatcataa cta ccc aca 3 , ppar g ( pro12ala ) , f5gcc aat tcaagc cca gtc 3 , r5gat atgttt gca gac agt gta tca gtg aaggaa tcg ctt tcc g 3 , methylated ( hmlh1 ) f 5 acg tagacg ttt tat tag ggt cgc 3 r 5 cct catcgtaac tac ccg cg 3 , hmsh2 f 5 ggt tgt tgt ggt tgg atg ttg ttt 3 r 5 caa cta caa cat ctc ctt caa cta cac ca 3 , methylated ( hmsh2 ) f 5 tcg tgg tcg gac gtc gtt c 3 r 5 caa cgt ctc ctt cga cta cac cg 3 , ? actin: forward: 5’ ctacgtcgccctggacttcgagc 3’ ß actin: reverse: 5’ gatggagccgccgatccacacgg 3’ , kras forward: 5 gactgaatataaacttgtggtagttggacct 3.reverse: 5 ctattgttggatcatattcgtcc 3. , braf forward: 5 tcataatgcttgctgatagga 3. reverse: 5 ggccaaaaatttaatcagtgga 3. , mthfr ( c677t ) ‘‘5 gcacttgaaggagaaggtgtc 3” and reverse primer ‘‘5 aggacggtgcggtgagagtg 3” , mthfr ( a1298c ) forward ‘‘5 ctt tgg gga gct gaa gga cta cta c 3” and reverse ‘‘5 cac ttt gtg acc att ccg gtt tg 3” primers. , total rna isolation mini kit ( from human skin tissue ) / rneasy fibrous tissue mini kit ( for rna extraction from human skin tissue ) ( qiagen ) per kit ( each kit pack is for 50 reactions ) , purospin™ fibrous tissue rna purification kit ( luna nanotech ) ( for rna extraction from human skin tissue ) per kit ( each kit pack is for 250 reactions ) , aurum™ total rna fatty and fibrous tissue kit ( biorad ) / mp biomedicals fastrna pro green kitper kit ( each kit pack is for 50 reactions ) , human leptin elisa kit per kit ( each kit pack is for 96 reactions ) , human adiponectin elisa kit per kit ( each kit pack is for 96 reactions ) , human adipsin elisa kit per kit ( each kit pack is for 96 reactions ) , human resistin elisa kit per kit ( each kit pack is for 96 reactions ) , human iron elisa kit ( serum iron ) per kit ( each kit pack is for 96 reactions ) , human ferritin elisa kit ( serum / ferritin ) per kit ( each kit pack is for 96 reactions ) , gdf15 human elisa kit per kit ( each kit pack is for 96 reactions ) , spexin human elisa kit per kit ( each kit pack is for 96 reactions ) , human pai 1 elisa kit per kit ( each kit pack is for 96 reactions ) , thyroid estimation kit per kit ( each kit pack is for 96 reactions ) , ice maker machine for laboratory purpose 1 unit , microwave gloves each packet contains one pair of gloves. , pcr mini cooler / coolcube microplate and pcr tube cooler each , horizontal gel apparatus: 18 – 20 cm ( length ) x 25 – 30 ( breadth ) x 5 7.5 cm ( height ) , 40 60 samples, multichannel pipette compatible combs and gel caste each , mini horizontal gel apparatus: 9 cm w x 11 cm l with grooves ( 8.7 cm l x 1.2 cm h ) on the side for gripping the gel tray. it should have two comb slots on the same tray area. buffer capacity should be 600 ml for the buffer tanks and optimum gel runs with a fill line indicator for buffer levels along the unit side each , multi size forceps lab set each packet containsmulti size forceps lab set , liquid nitrogen sample storage tanks each , liquid nitrogen sample handling gloves each packet contains one pair of gloves. , l mold each , tissue cassette steel each , electric tissue float bath ( thermostate ) each , coupling jar each pack contains 2 psc. , staining rack each , whatman filter paper grade 1 & 2 each packet contains 50 psc.. , harri’s hematoxylin powder 25 / 50 / 100 / 250 / 500 gm , yellow eosin powder 25 / 50 / 100 / 250 / 500 gm , coverslip 18x18 ( microscopic ) each packet contains 100 psc.. , dpx mount 100 ml / 250 ml , hot plate each , mx35 premier microtome blade ( 34 / 80mm ) 50 blades each box contains 50 psc.. , diamond point marker pen ( histopathology use ) each , embedding mold and embedding ring each , qiamp dna ffpe tissue kit ( 50 rxns ) , genomic dna purification kit ( promega ) , rna extraction kit from tissue , cdna synthesis kit , superscript ii rnase reverse transcriptase , sybr green pcr master mix , sodium bisulphite , page loading dye , formamide , n’n’ methylene bisacrylamide , ammonium persulfate , temed , polyacrylamide , wizard dna clean up system ( promega ) , 2 mercaptoethanol , silver stain , hydroquinone , urea , blotting paper , dna ladder 10 bp , pas stain , histopathology plastic cassettes , poly – l – lysine coated slides , deep well mortar and pestle homogenizers ( medium size ) , deep well mortar and pestle ( small size ) , rneasy minielute cleanup kit , phase – lock gel heavy5 prime phase – lock gel heavy5 prime , qiazol lysis reagent , rneasy minielute cleanup kit , cryo vial 1 pkt contains 50 psc. , deep well mortar and pestle ( small size ) ...

Government Medical College - Madhya Pradesh

35627530 supply for central lab and cssd consumables and other item supply for central lab and cssd consumables and other items in gmc raltam , three part automated cell counter model : swelab alfa plus basic , swelab alfa plus diluents , swelab alfa plus lyser , boule control normal , boule control low , boule control high , five part fully automated cell counter model : bc 6800 , m 68lh lyse , m 68 lb lyse , m 68 dr diluent , m68 ld lyse , m 68 ln lyse , m 68 ds diluent , 68 fd dys , 68 fr dys , 68 fn dys , probe cleanser , controls and calibrators , aspen bc – 6d control set (6x4.5ml (2l, 2n, 2h)) , aspen bc – ret control set (6x4.5ml (2l, 2n, 2h)) , aspen sc – cal plus calibrator , automatic coagulation analyzer model : sta compact max 3 , stac cacl20, 0025m (00367) , sta cephascreen 10(00310) , sta cleanser solution 6x2500ml(00973) , sta coag control n+p(00679) , sta desorb u24x15ml (00975) , sta liatest control n+p (00526) , sta liatest d di (00662) , sta @ neoptimal 5. (01163) , sta owren koller 24x15ml(00360) , chemicals , ethanol (99.9%) , xylene (sulphar free) , paraffin wax (58 60 temperature) , acetone , hematoxyline , eosin (2%) , distyrene plasticizer xylene (dpx mountant) , glacial acetic acid , formic acid (100%) , nitric acid (100%) , propanol (45%) , oil immersion , n/10 hcl , sodium metabisulphate , urine strip 10 para , sodium nitroprusside , liquor ammonia , ammonium sulphate , sulphosalicilic acid solution , sulphur powder , leishmen stain , wbc diluting fluid , rbc diluting fluid , og 6 , ea 50 , semen analysis diluting fluid , formaline , spirit alcohol , sulphuric acid , reticulocyte count fluid , distilled water , barium chloride , sodium hypochloride , methanol , glucose pouch , perls stain (long expiray) , pas stain (long expiray) , mpo sstain (long expiray) , benzidine solution (long expiray) , kits , reticulocyte count kit , pt kit , aptt kit , field stain kit , rapid pap stain kit , giemsa stain kit , g6pd kit , antisera a , antisera b , antisera d , sickle cell test kit , pt/inr kit , reagent , benedict reagent (long expiray) , ehrlich’s reagent (long expiray) , esbech’s reagent (long expiray) , fouchet reagent (long expiray) , other consumable items , microscopic glass slide (75x25) , jam microscopic cover glass (22x50) , casset , microtome blade , slide box , tissue paper roll , plastic dropper (small) , plastic dropper (big) , test tube 5ml , coupling jar , test tube 10ml , slide carrying tray , aluminium slide tray , slide staining stand , glass dish staining jar , test tube stand , measuring cylinder (10 ml borosilicate) , glass tube brush , hand wash , beaker glass (100 ml borosilicate) , beaker glass (500 ml borosilicate) , conical flask (100 ml borosilicate) , conical flask (500 ml borosilicate) , bubbler (plastic screw) , graduate pipette (borosilicate ) 10ml , volumetric flask 100ml , filter paper 12.5dm , diamond pencil , capillary tube for bt ct (glass) , k3 edta vial , urine container , knife (grossing) , speciman jar with lid (glass) (200x200x70 mm) , speciman jar with lid (glass) (150x150x60mm) , museum jar with lid (glass) (220x150x100mm) , museum jar with lid (glass) (220x195x80mm) , museum jar with lid (glass) (250x165x140mm) , museum jar with lid (glass) (360x150x100mm) , museum jar with lid (glass) (150x150x80mm) , museum jar with lid (glass) (250x250x120mm) , museum jar (10x10x15 inches) , museum jar (18x12x12 inches) , museum jar (25x15x10 inches) , pippette 1 ml (borosilicate) , pippette 5 ml (borosilicate) , glass rod (solid ) , slide holder (steel) , slide staining rack , urinestripe 4 parameter (1.ph 2.specific gravity3. sugar 4.albumin(protein)) , sodium citrate vial , esr tube (wintrobe) , esr western green tube , cover slip10 gm , application plastic stick , sprit lamp glass , tube holder , rbc pipette , wbc pipette , wester green stand , wintrobe stand , pasture pipette , disposable pap smear kit , torniqute , tissue embedding mold , embedding o ring , test tube 15 ml , test tube 20 ml , centrifuge tube 15ml , centrifugr graduated tube 15 ml , reagent bottle 100 ml , reagent bottle 250ml , reagent bottle 500 ml , measuring cylinder 100 ml , measuring cylinder 5 ml , dropping bottle 250 ml , detergent powder , culture media , agar powder , alkaline peptone water , anhydrous barium chloride , arabinose , arginine dihydrolase powder , automated blood culture bottle (adult) compatible withbact/alert 3d 480, bio merieux , automated blood culture bottle (paediatrics) compatible withbact/alert 3d 480, bio merieux , bile esculin agar , blood agar powder , brain heart infusion broth , candida crome agar , cary blair medium base , christensens urea agar base , cled agar , corn meal agar , decarboxylase broth moeller , dermatophyte test medium , glucose , glucose phosphate broth , hugh leifson medium , lowenstein jansens medium(ready prepared) , lactose , lysine decarboxylase , macconkey agar without crystal violet , macconckeys agar with crystal violet , macconkey broth double strength (for water testing) , macconkey broth single strength (for water testing) , maltose , manitolmotility test medium , mannitol , mannitol salt agar , manual blood culture bottle with sds (adult) 70ml , manual blood culture bottle with sds (paediatrics) 20ml , muller hinton agar , nutrient agar , nutrient broth , peptone powder , phenyl alanine agar , pyr agar , robertson cooked meat medium base , sabouraud dextrose agar with chloramphenicol with cycloheximide , sabourauds dextrose agar powder , sabroud dextrose agar with chlorophenicol , selenite f broth , simmons citrate agar , sodium deoxycholate , sucrose , tcbs agar , triple sugar iron agar , xld agar , antibiotic disc , amikacin 30 mcg , amoxicillin , amoxycillin clav 20/10ug , ampicillin 10 mcg , ampicillin sulbactam(10/10 ?g) , azithromycin 15 mcg , aztreonam(30 ?g) , cefazoline 30 mcg , cefepime 50ug , cefoperazone / sulbactum , cefoperazone 75 mcg , cefotaxime(30 ?g) , cefotaxime+clavulanate , cefoxitin 30ug , cefpodoxime , ceftazidime 30 mcg , ceftazidime+clavulanate , ceftriaxone 30 mcg , ceftriaxone sulbactum 30/15ug , cefuroxime 30 mcg , chloramphenicol 30 mcg , ciprofloxacin 5mcg , clarithromycin(15 ?g) , clindamycin 2 mcg , co trimoxazole(sulpha/trimethoprim) 25 mcg (23.75/1.25) , colistin (0.016 256 mcg/ml) , colistin 10 mcg , cotrimoxazole(25 ?g) , doripenem(10 ?g) , doxycycline hydrochloride 30 mcg , ertapenem(10 ?g) , erythromycin 15 mcg , gatifloxacin(5?g) , gemifloxacin(5 ?g) , gentamicin 10 mcg , imipenem 10 mcg , linezolid(30 ?g) , lomefloxacin(10 ?g) , meropenam 10ug , minocycline(30 ?g) , moxifloxacin(5 ?g) , nitrofurantion 300 mcg , norfloxacin 10 mcg , novobiocin(5 ?g) , ofloxacin(5 ?g) , oxacillin(1 ?g) , penicillin 10 units , piperacillin 100 mcg , piperacillin/tazobactam 100/10 mcg , polymyxin b , quinopristin dalfopristin(15 ?g) , teicoplanin , teicoplanin 30 mcg , tetracycline 30 mcg , ticarcillin clavulanate(75/10 ?g) , tobramycin 10 mcg , trimenthoprim(5 ?g) , vancomycin (0.016 256 mcg/ml) , vancomycin 30 mcg , bacitracin(0.4 u) , sterile disc , v factor , x factor , x+v factor , optochin(5 ?g) , kits & chemical , acetone solution , acid fast staining kit , albert’s metachromatic stain kit , andrade’s indicator , anti hav igm (elisa kit) , anti hav igm (rapid test) , anti hcv antibody kits (elisa kit) , aso kit(25 test/packet),consumable , basic carbol fuchsin for afb staining(powder) , conc hcl , crp test kit , crystal violet powder , dengue ns 1 elisa , formaldehyde solution , field stain a , field stain b , filarial antigen card test , ferric chloride (500 gm) , formaldehyde 40% (conc. formaline) , giemsa stain (merck / span) , glycerol , gram iodine , gram staining kit , h2so4 (sulphuric acid) 25% , hbv elisa test kit , hepatitis e virus anti hev igm antibody (elisa) , hiv (rapid)(whole blood finger prick test kit) , hiv elisa test kit , hydrogen peroxide 6% solution , india ink , kovac’s reagent (indole) , lacto phenol cottons blue stain , lead acetate strip , leishman stain , liquid paraffin , malaria bivalent antigen detecting rapid diagonstic tests(rdts) , methyl blue for (z n) , methyl alcohol , methyl red indicator , methylene blue powder , nitrate reagent a , nitrate reagent b , occult blood test kit (haem test kit) , oxidase disc , oxidase reagent (tetra methyl para phenylene di amine di hydro chloride) , phenol crystals , pyr reagent , ra factor rapid kit , rpr test kit , safranine (gram stain) , urea 40% supplement (for urea agar base) , voges proskauer reagent a , voges proskauer reagent b , widal slide test(4x5ml with control) , xylene , zinc dust , chemical indicator for autoclave (indicator tape) , biological indicator for autoclave (indicator vial) , glassware, plasticware& other item , autoclavable aluminium foil , autoclavable glass bottle with screw cap for culture media (1000ml (borosilicate glass autoclavable)) , autoclavable glass bottle with screw cap for culture media (500ml (borosilicate glass autoclavable)) , autoclavable glass bottle with screw cap for culture media (50ml (borosilicate glass autoclavable)) , autoclavable petri plate (100mm) plastic , autoclavable petri plate (150mm) plastic , autoclavable petri plate (90mm) plastic , autoclavable reusable transparent bags , bcg(1 ml each) , beaker 1000ml (borosilicate glass autoclavable) , bloting paper (paper) , burning sprit , cedar wood oil , concavity slide , conical flask (glass) 1000ml , conical flask (glass) 100ml , conical flask (glass) 2000ml , conical flask (glass) 500ml , conical flask (glass) 50ml , cover slip , cryogenic vial , disposable plastic loop 2mm , disposable plastic loop 4mm , disposable sharp collection containers(5 ltr) , dropping bottle plastic 100 120 ml capacity , durham’s tube , falcon tube sterile, (conical bottom)(50ml each plastic containers with air tight screw cap printed graduation) , filter paper sheet((whatmann no 01) , filter paper(12.5 cm, 0.1 micron) , forceps small , gaspak (3.5 liter) , glass marking pen (diamond ) , glass reagent bottle (5 litre) , glass test tube 12 x 100 (medium size) heavy quality 100/pkt(no.) , glass test tube 12 x 50 borocilicate glass autoclavable , glass test tube 15 x 125 borocilicate glass autoclavable , measuring cylinder plastic (100 ml) , measuring cylinder plastic (1000 ml) , measuring cylinder plastic (50 ml) , measuring cylinder plastic (500 ml) , metal loop holder , micropipette tips (10 ul )(for serology) , micropipette tips (100 ul )(for serology) , micropipette tips (1000 ul )(for serology) , micropipette tips (20 ul ) , micropipette tips (200 ul ) , microscope lens cleaner kit , para film sealing film , ph paper strip range (1 10) , soap , sterile cotton swab wooden stick(individually packed) , sterile disposable/hypodermic syringe for single use(5ml ) , sterile disposable/hypodermic syringe with needle for single use(2ml ) , sterile disposable/hypodermic syringe with needle for single use(10ml ) , sterile urine collection container 50ml disposable , individually packed , swab stick with tube sterile , test tube holder , test tube stand (aluminum) 10x10 holes for 12mm diameter test tube , test tube stand 10x10 holesfor 18mm diameter test tube , test tube stand 10x10 holes for 12mm diameter test tube , test tube stand, polypropylene, 3 tier(for keeping 10 ml vtm vials/ tier) , urine container size of the container shall be 30ml disposable , utility gloves(medium) , atcc strain & antisera , acinetobacter baumannii nctc 13304 , enterococcus faecalis atcc 29212 , klebsiella pneumoniae atcc 700603 , pseudomonas aeruginosa atcc 27853 , staphylococcus aureus 25923 , escheriachia coli 25922 , staphylococcus aureus atcc43300 (mrsa) , shigella boydii polyvalent c antisera , shigella dysentriae polyvalent a antisera , shigella flexneri polyvalent b antisera , shigella sonnei polyvalent d antisera , vibrio cholera o1(ogawa)antisera , vibrio cholera o1( inaba)antisera , vibrio cholera (o139 )antisera , salmonella typhi poly o antisera , salmonella typhi o 2 antisera , salmonella typhi o 7 antisera , salmonella typhi o 9 antisera , rt pcr kits, chemical & consumable , 0.2 ml pcr tube (sterile, flat cap shaped) dnase/rnase free , 15 ml polypropylene centrifuge tubes, sterile, {certified nonpyrogenic and dnase /rnase free, disposable conical bottom with seal caps(the tubes should have printed graduations and a large white marking spots)} , alcohol 70% (laboratory grade) , bio medical waste bins red (15 ltr) , bio medical waste bins red (25 ltr) , bio medical waste bins red (40 ltr) , bio medical waste bins yellow (15 ltr) , bio medical waste bins yellow (25 ltr) , bio medical waste bins yellow (40 ltr) , bmw polybags red colour (18 kg capacity) , bmw polybags red colour (28 kg capacity) , bmw polybags red colour(45 kg capacity) , bmw polybags red colour (05 kg capacity) , bmw polybags yellow colour (18 kg capacity) , bmw polybags yellow colour (28 kg capacity) , bmw polybags yellow colour (45 kg capacity) , cryotags / freezer labels, for 1.5 2.0 ml cryovials {ability to withstand cryogenic temperatures upto minus 80 degree c for a wide variety of plastic and glass vials, test tubes, cryogenic boxes and plates} , diluent for dna extraction/ ethanol, molecular(biology grade) , filter barrier tips 20 ul (in box packing, sterile dnase rnase pyrogenfree compatible with nichipet ex2 pipette (make nichiriyo)) , filter barriertips 10 ul (sterile dnase rnase pyrogenfree compatible with nichipet ex2 pipette (make nichiriyo)) , filter barriertips 1000 ul (sterile dnase rnase pyrogenfree compatible with nichipet ex2 pipette (make nichiriyo)) , filter barriertips 200 ul (sterile dnase rnase pyrogenfree compatible with nichipet ex2 pipette (make nichiriyo)) , micro centrifuge tube 0.5 ml (polypropylene tubes, resistance to chemicals, mechanical stress and temperature extremes,(autoclavable, dnase, rnase/endotoxin free)) , micro centrifuge tube 1.5 ml(polypropylene tubes, resistance to chemicals, mechanical stress and temperature extremes,(autoclavable, dnase, rnase/endotoxin free)) , micro centrifuge tube 2 ml(polypropylene tubes, resistance to chemicals, mechanical stress and temperature extremes,(autoclavable, dnase, rnase/endotoxin free)) , micro pipette tips 5 300ul , microcentrifuge tube rack (20 tube/24 tube capacity)(for 1.5/2ml tube) , microcentrifuge tube rack (80 tube/96 tube capacity) reversible one side for 1.5ml tube and other( side with 0.2 ml pcr tubes) , non latex purple nitrile gloves (large) (sterile dnase rnase pyrogenfree ) , non latex purple nitrile gloves (medium) (sterile dnase rnase pyrogenfree ) , optical adhesive covers for pcr 96 well rxn plates 0.2ml (compatible with biorad cfx 97 dx opm) , optical adhesive covers for pcr 96 well rxn plates 0.2ml (compatible with thermo fisher a28574 quant studiort pcr machine) , parafilm roll (size approx 2 inch width and 250 inch length) , pcr 96 well rxn plates 0.2ml (compatible with biorad cfx 97 dx opm) , pcr 96 well rxn plates 0.2ml (compatible with thermo fisher a28574 quant studiort pcr machine) , pcr strips 0.1 ml (strip of 4) (compatible with qiagen 5plex rotorgene rt pcr machine) , pcr strips 0.2 ml with attached cap (strip of 8) (compatible with thermo fisher a28574 quant studiort pcr machine) , pcr strips 0.2 ml with attached cap (strip of 8) (compatible with biorad cfx 97 dx opm) , rnase/ dnase away solution (for complete removal of rnase/ dnase contamination from work surfaces, pipettes and equipments(should be stable at room temperature)) , sterile pasteurppipettes 3ml , viral transport media with swabs (3ml vial with 2 regular swabs i.e. one nasal swab and one throat swab (1.viral transport medium (vtm) with swab with complete directions for collection, storage, transport and carrying. 2.sterile dacron, polyester or rayon sterile swabs with plastic shafts)) , aluminium foil (9 meters length) thickness 11 microns, width 30 cm , compertable with transasia xl 1000fully automated biochemistry analyser , erba ada kit (1x20 ml/1x10 ml) , erbaalbumin kit (10x44 ml) , erba alakaline phosphatase kit (2x44 ml /2x11 ml) , erba amylase kit (3x22 ml) , erba autowash kit (10x100 ml) , erba bilirubin total (btdca) kit (6x44 ml /3x22 ml) , erba bilirubin direct (btdca) kit (6x44 ml /3x22 ml) , erba calcium (arsenazo) kit (10x12 ml) , erba cholestrol kit (10x44 ml) , erba ck nac kit (2x44 ml /2x11 ml) , erba ck mb kit (2x44 ml /2x11 ml) , erba direct hdl cholestrol with calibrator kit (4x30ml/4x10ml) , erba direct ldl cholestrol with calibrator kit (2x30//2x10 ml) , erbacreatinine (enzymetic) kit (5x30 ml/5x10 ml) , erba gamma gt kit (5x44ml/5x11 ml ) , erba glucose kit (10x44 ml) , erba fe 125 kit (r1 4x25 ml/r2 2x12.5 ml/calibrator/2x2ml) , erba hba1c kit (r1.2x15 ml/r2 2x5 ml/5x0.5 ml) , erba ldh p kit (2x44 ml /2x11 ml) , erba lipase xl kit (1x44 ml/1x11 ml) , erba magnesium kit (2x44 ml) , erba mal kit (1x10/5x25 ml) , erba microprotein kit (10x12 ml) , erba phosphorus kit (10x12 ml) , erba total protein kit (10x44 ml) , erba sgot el kit (6x44/3x22 ml) , erba sgpt el kit (6x44/3x22 ml) , erba triglycerides kit (5x44 ml/5x11ml) , erba urea kit (5x44 ml/5x11ml) , erba uibc125 kit (r1 4x25ml, r2 2x12.5ml, calibrator 2x12.5ml ) , erba uric acid kit (5x44 ml/5x11ml) , xl turbi crp kit (2x22 ml/1x11 ml) , xl turbi rf kit (1x22/1x5.5 ml) , erba ada cail kit (1x1ml) , erba ada control kit (1x1ml) , erba hba1c con h kit (1x.0.5ml) , erbahba1c con l kit (1x.0.5ml) , erba xl multical kit (4x3 ml) , erba norm kit (1x5ml) , erbapath kit (1x5ml) , apo a1 kit , apo b kit , hs crp kit , lp(a) kit , xl auto wash ac/al kit (5x44 ml /5x44 ml) , sample cups kit , sample cup vol: 1.0 ml unique type kit , thermal paper roll (108 mm x 3 m)kit , ise module reagent pack na+/k+/cl./li+(4 channel pack) kit , ise cleaning solution kit , compertable with transasia semi auto analyzer erba chem 5x , glucose kit , urea kit , creatinine kit , total bilirubin kit , total protein kit , albumin kit , total cholesterol kit , sgpt/alt kit , sgot/ast kit , ldh kit , ck mb kit , trop i kit (qualitative) , alp kit , triglycerides tg kit , hdl kit , disposable plastic test tube , clot activater tube (plan tube) , fluoride tube , micropipette tip1000ul , micropipette tip100ul , micropippte((0.5 50 ul)) , micropippte (100 1000ml) , external quality control vial for routine biochemistry (erba chem 5x) , protein csf kit , lamp. (erba chem 5x) , calcium (50x1 ml) , uric acid , ada , ark diagnosis electrolyte analyzer , electrolyte analyzer reagent , electrolyte daily cleaner , electrolyte quality control 1,2,3 (1 box ( serum: l1 3, l2 4, l3 3,urin: l1 1, l2 1)) , pm kit , reference housing , electrode (na,k,cl) , compertable with elisa reader (tecan infinite f50 & hydroflex) , t3 , t4 , tsh , sterilizer item compertable with cisa 8 stu model no. 6412 , printer paper , door gasket , heating element , microbiological filter , print ink ribbon for washer , sterilizer item compertable withcisa 4 stu model no. 4212 , printer paper , door gasket , heating element , microbiological filter , print ink ribbon for washer , table topitem compertable with table top sterilizer 23 ltr , door gasket , microbiological filter , heating element , printer paper , washer kf 155item compertable with cisa washer 12 din , liquid alkaline detergent , liquid neutralising agent , lubrication spray , enzamatic detergent , cleaning indicator (level 1) , cleaning indicator (level 2) , cleaning indicator (level 3) , cleaning indicator (level 4) , print ink ribbon for washer , air filter (hepa) , heater element , gasket , ultrasonic washeritem compertable with cisa ultrasonic washer 30 ltr , cleaning agent for ultrasonic cleaner , heat sealeritem compertable with cisa heat sealer , print ink ribbon for heat sealer ( pack of 10 ) , consumables for operation for cssd equipmentitem compatible with cisa cssd machines , 3 line label steam , bowie dick strip , batch monitoring strip , chemical indicator class 4 , chemical indicator class 5 , biological indication steam , wrapping paper 40x40 cm , wrapping paper 50x50 cm , wrapping paper 60x60 cm , wrapping paper 75x75 cm , wrapping paper 90x90 cm , wrapping paper 100x100 cm , wrapping paper 120x120 cm , sterilization reel 50x200m , sterilization reel 75x200m , sterilization reel 100x200m , sterilization reel 120x200m , sterilization reel 150x200m , sterilization reel 200x200m , sterilization reel 250x200m , sterilization reel 300x300m , sterilization reel 350x200m , sterilization reel 400x200m , sterilization reel 500x200m , autoclave tape ( 18x50 meter ) , autoclave tape ( 24x50 meter ) , packing tape (18x50 meter) , packing tape (24x50 meter) , packing tape (36x50 meter) , packing tape (48x50 meter) , process indicator ( external labeling ) for every pack , sms paper non woven material(90 x90 mm) , sms paper non woven material (100 x100 mm) , sms paper non woven material (100 x120 mm) , sms paper non woven material (120 x 120 mm) , labelling ink role , ro plant consumables for cssd , anti scaling chemical , cip chemical , chemical for flushing , jumbo catridge filter , r.o. membrane 8040 , water softener consumables for cssd , resin , air compressor consumables for cssd , check valve kit , intake filter element , crankase filter element with felet , grease kit , piston ring set , filter , operational consumables for cssd compertable , apron heavy duty water proof , brushes for instrument cleaner , devices for cssd , pcd device for bms test , pcd device for bds test , gun for labeling , aqua zero vacuum pump (devices for cssd 8 stu) , aqua zero vacuum pump (devices for cssd 6 stu) , aqua zero vacuum pump (devices for cssd 4 stu)...

Directorate Of Health Services - Madhya Pradesh

35141987 supply of medicines and consumables the year 2022 23 1.01 5 fluorouracil ( 5 fu ) ( 250mg ) , injection 1.02 acenocoumarol / nicoumalone ( 2 mg ) , tablet [ 120003 ] 1.03 adrenochrome monosemicarbazone ( 0.75mg / ml ( ml amp ) ) , injection 1.04 aggs ( anti gas gangrene serum ) 10, 000 iu / ml 40000 iu / ml / 30000 ou / ml inj. 1.05 alpha beta arteether ( 150mg / 2ml ) , injection 1.06 alprazolam ( 0.5mg ) , tablet 1.07 amikacin ( 250mg / 2ml ) , injection 1.08 amino acid glass bottle contain amino acid 6 gm, nitrogen 0.929, essential amino acid 51%, non essential amino acid 49%, bcca 22.6%, carbohydrate 5% inj ( 6 gm ) , injection solution for 1.09 aminoacid 10% ( essential ) ivf ( 10 % ) , injection solution 1.1 aminoacid 5% ivf ( 100ml bottle ) , infusion 1.11 amiodarone tab ( 200mg ) , tablet 1.12 amlodipin ( 10mg ) , tablet ] 1.13 amoxicillin 250mg + clavulanic acid 50mg inj vial 1.14 amoxycillin dispersible tablets ip amoxicillin trihydrate ip equivalent to amoxicillin ( 250mg ) , tablet 1.15 amoxycilline and clavulanic acid inj 1.16 ampicillin ( 1 gm vial ) , injection 1.17 ampicillin inj ( 250 mg / vial ) , vial 1.18 antacid chewable tablet containing aluminum hydroxide equivalent to dried gel 250mg+ magnesium hydroxide 250mg+ simethicone 50mg usp 1.19 anti rabies immunoglobulin inj 300 iu per 2ml ( 2ml vial ) ( 300 iu per 2ml ) , injection solution for 1.2 artemether inj 80mg / ml ( 1 ml amp ) , injection 1.21 artesunate + sulphadoxine + pyrimethamine ip ( 100 mg ( 3tab ) + 750mg + 37.5mg ( 1tab ) ( age group between 5 to 8 years ) ) , combi blister pack 1.22 artesunate tablets 150mg ( 3tab ) + sulphadoxine ( 500mg+500mg ) pyrimethamine 25mg +25mg tab ip ( 2tab ) ( age group 9 to 14 years ) , combi blister pack 1.23 artesunate tablets 25mg ( 3tab ) + sulphadoxine 125mg pyrimethamine 6.25mg tablets ip ( 1tab ) ( age group of less than 1year ) , combi blister pack 1.24 artesunate + sulphadoxine + pyrimethamine ( 50 mg + 500 mg + 25 mg tablet ) , combi blister pack 1.25 aspirin low dose tab 150mg 1.26 atorvastatin ip ( 20 mg ) , tablet 1.27 azathioprine 50mg tab 1.28 azithromycin inj 100mg / 5ml 1.29 basal insulin glargine injection 300iu disposable pen 300iu with 4 needles per pen 31g needle ( ) , pen 1.3 basal insulin glargine penfill 300iu with free permanent pens one pen for each five cartridge and 10 needles per pen 1.31 beclomethasone inhalation i.p 200 mcg per dose ( 200 metered dose container ) , inhaler 1.32 benedicts solution ( qualitative ) , bottle 1.33 benzyl benzoate emulsion ( ) , emulsion 1.34 benzyl penicillin 10lac / vial ( penicillin g ) , injection 1.35 betahistine ( 16 mg ) , tablet 1.36 betamethasone valerate cream 0.05% ( 15gm tube ) , ointment 1.37 betamethasone valerate oint 0.1% ( 15 gm tube ) , ointment 1.38 betamethasone valerate oint / cream ip ( 0.12% ) , tube 1.39 bevacizumab100 mg ( 4 ml vial ) , injection 1.4 black disinfectant fluid ( phenyl ) as per schedule o grade iii 1.41 black disinfectant fluid ( phenyl ) strength : specification as per schedule o grade i 1.42 bortezomib ( 2mg ) , injection 1.43 bortezomib ( 3.5mg vial ) , injection 1.44 bromhexine hcl 4 mg+ guaiphensin 50 mg + terbutaline sulphate 1.25 mg / 5ml syp ( 100 ml bottle ) , syrup 1.45 budesonide nebulising suspension containing budesonide 0.25mg / ml ( 2ml amp ) , suspension 1.46 budesonide respules 0.25mg / 2ml inhalation ( 2ml amp / respule ) , inhaler 1.47 bupivacaine hydrochloride inj. 0.25mg ( 20 ml vial ) , injection solution for 1.48 bupivacaine hydrochloride inj. 0.5% 20ml vial ( not for spinal use ) ( ) , vial 1.49 bupivacaine hydrochloride ( not for spinal use ) ( 0.5% ) ( 4ml amp / vial ) , vial 1.5 calcium carbonate derived from oyester shell equivalent to elemental calcium 500mg and vitamin d3 250 iu ( ) , tablet 1.51 calcium chloride 0.1 ( 10 ml ) , injection 1.52 calcium citrate 1000mg ( elemental ca equivalent to 250 mg and vitamin d3 400 iu ) ( ) , tablet 1.53 calcium with vitamin d tablets calcium carbonate 650mg eq. to elemental calcium 250mg and cholecalciferol 125 iu 1.54 carbamazepine tab ( 400mg ) , tablet 1.55 carboplatin ( 150mg 15 ml vial ) , injection 1.56 carboprost trome thamine inj usp 0.25mg / ml vial ( ) , injection solution for 1.57 carboprost tromethamine injection i.p ( 15 methyl pgf2a ) inj 250mcg / 1ml ) , ampule 1.58 carboxymethylcellulose eye drop ip 1% w / v 10ml vial ( sodium cmc also accepted ) , eye drop 1.59 carvedilol ( 3.125 mg ) , tablet 1.6 carvedilol ( 6.25 mg ) , tablet 1.61 cefazolin ( 1gm ) , injection 1.62 cefazolin inj ( 500mg vial ) , injection 1.63 cefepime 1gm and tazobactam 125 mg inj ( vial ) , injection solution for 1.64 cefepime ( 500mg injection ) , injection 1.65 cefixime 50 mg dt tab ( ) , tablet 1.66 cefixime tab ip ( 100mg ) , tablet 1.67 cefoperazone 1000mg + sulbactam 1000mg inj ( vial ) , injection 1.68 cefoperazone 500mg + sulbactam 500mg ( vial ) , injection 1.69 ceftazidime ( 250mg / vial ) , injection 1.7 ceftriaxone+tazobactum ( 1gm+125mg, vial ) , injection 1.71 ceftriaxone+tazobactum 250mg+31.25mg ( vial ) , injection 1.72 ceftriaxone+tazobactum ( 500mg+62.5mg vial ) , injection 1.73 cephalexine ( 500mg ) , capsule 1.74 cetrimide + chlorhexidine ( conc. ) ( 15%+7.5% ) ( 1 liter bottle ) ( 15%+7.5% ) , liquid [ 1.75 cetrimide + choline salicylate gel for oral ulcer 15ml tube 1.76 cetrimide cream bp ( 0.1% w / w ) , tube 1.77 chloramphenicol ear drop 5% ( 5 ml vial ) , eye drop 1.78 chloramphenicol eye applicaps 1% ( 100 applicaps per bottle ) , eye drops / ointment 1.79 chloramphenicol ( 1% ( 5 ml vial ) ) , eye drop 1.8 chlorhexidine 0.2% mouth gargle ( 100 ml ) , solution 1.81 chlorhexidine gluconate solution [ 1.82 chlorhexidine gluconate solution 4% i.p. ( antiseptic ) ( 500 ml bottle ) , liquid 1.83 chlorine based compound ( sodium dicholoroiso cyanurate ) nadcc tablets 75 mg with available chloroine 45 mg bis ( 45 mg ) , tablet 1.84 chloroquine phosphate inj. 64.5mg / ml 30ml vial ( ) , injection solution for 1.85 chloroquine ( phosphate ) , syrup 1.86 chlorpheniramine maleate ( 4mg ) , tablet 1.87 chlorpromazine hydrochloride sugar coated tab ( 100 mg ) , tablet 1.88 chlorpromazine hydrochloride ( 25 mg ) , tablet 1.89 chlorpromazine hydrochloride ( 50 mg tab ) , tablet 1.9 chlorpromazine inj ip ( 25mg / ml ( 2ml amp ) ) , injection solution for 1.91 cholecalciferol concentrate ( powder form ) ph.eur. 60000iu / gm ( 60000iu / gm ) , powder 1.92 ciprofloxacin + dexamethosone ( 0.3%+0.1% ) ( 5ml ) , eye drop 1.93 ciprofloxacin + tinidazole ( 500mg+600mg ) , tablet 1.94 ciprofloxacin 0.3% ( 5ml vial ) , eye drop 1.95 ciprofloxacin inj 2 mg / ml inj 100ml glass bottle ( ) , injection solution for 1.96 ciprofloxacin inj 100 mg / 50ml ( 100ml ffs bfs bottle ) , injection solution for 1.97 cisplatin ( 10 mg vial ) , injection 1.98 cisplatin 50 mg inj ( 50 ml vial ) , injection solution for 1.99 clindamycin ( 150mg / ml ( 2 ml vial / amp ) ) , injection 2 clobetasol 0.05% + gentamicin 0.1% cream 10 gm ( 10 gm tube ) , cream 2.01 clomiphene citrate ( 25 mg tab ) , tablet 2.02 clonazepam ( 2mg ) , tablet 2.03 clopidogrel + aspirin ( 150mg ) , capsule 2.04 clopidogrel 75mg + aspirin 75mg tab ( 10x10 ) , tablet 2.05 clotrimazole 1%w / v +lignocaine 2%w / v ear drop 10ml vial bfs / ffs squeeze ( 10ml vial ) , vial 2.06 clotrimazole cream 1% ( 15 gm tube ) , cream 2.07 clotrimazole vaginal pessary tab 100mg 14 x 10 tab 2.08 clotrimazole vaginal tablet i.p. 100mg ( without applicator ) , tablet 2.09 cloxacillin sodium inj. ( 500mg ) , vial 2.1 compound benzoic acid ointment 2.11 compound tincture benzoin ip ( solution ) , bottle 2.12 cough syrup ( each 5ml contains ammonium chloride 138mg, diphenhydramine hcl 14.08mg, sodium citrate 57.03mg, menthol 2.5mg ) ( 5 ml ) , syrup 2.13 cyclophosphamide ( 1000mg vial ) , injectio 2.14 cyclophosphamide inj 500mg / vial ( each ) , injection solution for 2.15 cyclophosphamide inj ( 200 mg / vial ) , injection 2.16 dacarbazine ( 200 mg per vial ) , injection 2.17 deferasirox dispersible ( 100mg ) , tablet 2.18 deferasirox dispersible tab. 400mg 2.19 desferioxamine inj ( 0.5g / vial ) , injection solution 2.2 dextromethorphan syrup ( each 5ml contains 30 mg dextromethorphan ) ( ) , syrup 2.21 dextromethorphan syrup ( ) , syrup 2.22 dextrose 10% 500ml bfs bottle ( ) , injection solution 2.23 dextrose 10% ( ffs / bfs 500ml bottle ) , infusion 2.24 dextrose 25% inj ( 100ml ffs / bfs bottle ) , injection solution 2.25 dextrose 25% inj 500ml bfs bottle ( ) , injection solution for 2.26 dextrose 25% inj 500ml ffs / bfs bottle ( ) , injection solution 2.27 dextrose 5% 500ml bfs bottle ( ) , injection 2.28 dextrose 50% inj 100ml ffs / bfs bottle ( dextrose 50% inj 100ml ffs / bfs bottle ) , injection solution 2.29 dextrose 50% inj. bottle ( 500ml ffs / bfs ) , injection solution 2.3 dextrose with saline 5% + 0.9% inj 500ml bfs bottle 2.31 dextrose with saline 5% + 0.9% inj 500ml ffs / bfs bottle 2.32 diclofenac sodium 50mg + paracetamol ( 325mg ) , tablet 2.33 dicyclomine 10mg / ml ( 10ml with dropper ) , drop 2.34 digoxin 250mcg / ml ( 2ml amp ) , injection 2.35 dilitiazem tab 60mg 2.36 dispersible zinc tab ( 10mg ) , tablet 2.37 dobutamine ( 50 mg / 5 ml ) , injection 2.38 docetaxel 20mg inj 2.39 docetaxel 80mg inj 2.4 domperidone suspension ( 5mg / 5ml ) , suspension 2.41 doxorubicin inj 10mg ( 10mg ) , injection solution 2.42 doxycycline tab. 100mg ( ) , tablet 2.43 doxylamine succinate + pyridoxine ( 10mg+10mg ) , tablet 2.44 electrolyte e inj 500ml ffs / bfs bottle ( electrolyte e inj 500ml ffs / bfs bottle ) , injection solution 2.45 electrolyte g inj 500ml bfs bottle ( ) , injection solution 2.46 electrolyte m inj 500ml bfs bottle ( ) , injection solution for 2.47 electrolyte m inj ( 500ml ffs bottle ) , injection solution for 2.48 electrolyte m inj 500ml ffs / bfs bottle ( ) , injection solution 2.49 electrolyte p inj 500ml bfs bottle ( 500ml bfs bottle ) , injection solution 2.5 electrolyte p inj ( 500ml ffs bottle ) , injection solution 2.51 electrolyte p inj 500ml ffs / bfs bottle ( ) , injection solution 2.52 enalapril maleate tab ( 2.5mg ) , tablet 2.53 enalapril maleate tab ( 5mg ) , tablet 2.54 enoxaparin ( 60mg equivalant to 6000 iu vial / pfs ) , injection 2.55 enoxaparin ( 20mg / 0.2ml ) ( 0.2 ml prefilled syringe ) , injection 2.56 epinephrine hydrochloride inj. 1 mg / ml ( ) , injection solution for 2.57 epirubicin ( 10mg vial ) , injection 2.58 epirubicin ( 50mg vial ) , injection 2.59 equine anti rabies immunoglobulin, ( not less than 300iu / ml ) , injection 2.6 erythromycin stearate tab 250 mg 2.61 erythromycin stearate ( 500 mg ) , tablet 2.62 erythropoietin ( 4000 iu inj vial ) , injection 2.63 ethinyl estriadiol+norethisterone tab ( 35 mcg +1mg ) , tablet 2.64 etiophylline and theophylline ( paediatric ) , syrup 2.65 etiophylline theophylline sr tab. 300mg ( ) , tablet 2.66 etoposide ( 100mg vial ) , injection 2.67 filgrastim 300mcg inj 2.68 formaldehyde ( formalin ) ( 37% acq ) , bottle 2.69 formoterol + budesonide ( 6 mcg + 100 mcg / puff ( 120 mdi ) ) , inhaler 2.7 furazolidone ( 25mg / 5ml ( 60 ml bottle ) ) , suspension 2.71 gatifloxacin ( 0.3% ) , eye drop 2.72 gemcitabine ( 1000mg vial ) , injection 2.73 gemcitabine ( 200mg / vial ) , injection 2.74 gentian violet crys sol 1% 2.75 glibenclamide tab 2.5 mg 2.76 gluteraldehyde solution b.p. ( b.p. ) , solution 2.77 glycerine ip solution ( who gmp certification exempted for this item ) ( 100 ml ) , bottle 2.78 glyceryl trinitrate 5mg / ml inj 10ml vial ( nitroglycerine ) ( 5mg / ml ) , injection solution for 2.79 griseofulvin tab. ip 125 mg 2.8 haloperidol inj ( 50mg / ml ) , injection [ 2.81 haloperidol ( 10mg ) , tablet 2.82 heparin inj ( 5000iu / ml 5ml vial ) , injection 2.83 hepatitis b immunoglobulin im inj 200 iu / vial 2.84 human albumin 20% ( 50 ml vial ) 2.85 human albumin solution i.p. 20%w / v ( 100 ml vial ) ( ) , injection solution 2.86 human anti d. immunoglobulin ( polyclonal ) bp / ep / usp / ip ( 300mcg / vial ( vial / pfs ) ) , injection 2.87 human chorionic gonadotropin inj ( 5000 iu 1ml ) , ampule 2.88 hydroethylstarch 6% solution with sodium chloride 0.9% iv infusion ( hydroxy ethylstarch solution ffs / bfs ) ( 0.9% iv ) , bottle 2.89 hydroxyprogesterone caproate inj i.p. 250mg / ml 2.9 hyoscine butylbromide ( 10mg ) , tablet 2.91 ibuprofen 400mg+ paracetamol 325mg tablet ( ) , tablet 2.92 ifosphamide 1gm lyophilised each vial + 3amp of mesna 100mg / 2ml inj ( 100mg / 2ml inj ) , injection solution for 2.93 insulin aspart in disposable pen 300iu with minimum 4 needles per pen 31g needle 2.94 insulin aspart penfill 300 iu with free permanent pen ( one pen per five cartridges and ten needles per pen ) 2.95 insulin human mixtard inj. 30:70 ( ) , injection solution for 2.96 insulin lispro in disposable pen 300iu with minimum 4 needles per pen 31g needle 300iu ( prefilled syringe ) , pens 2.97 ipratropium bromide + levosalbutamol ( 20mcg+50mcg, 200 mdi ) , inhaler 2.98 ipratropium bromide powder for inhalation 250mcg / ml [ 4330004 ] 2.99 irinotecan ( 40mg / vial ) , injection 3 iron and folic acid enteric coated tab dried ferrous sulphate ip eq. to 45 mg elemental iron and 400 mcg folic acid ip ( pink color ) wifs junior ( iron and folic acid enteric coated tab dried ferrous sulphate ip eq. to 45 mg elemental iron and 400 mcg folic acid ip ( pink color ) wifs junior ) , tablet 3.01 iron and folic acid entric coated tab dessicated ip 67mg equivalent to 20mg of elmental iron 3.02 iron and folic acid entric coated tab. ferrous suplhate ip 333.335mg equivalent to 100mg of elemental ( red tablet ) , tablet 3.03 isoflurane solution ( liquid for inhalation ) 100ml ( amber color bottle ) , bottle 3.04 isosorbide mononitrate ( 20mg ) , tablet 3.05 isoxsuprine hydrochloride inj. 5mg / ml ( 2 ml amp ) ( 2 ml ) , injection solution for 3.06 ivermectin usp ( 6mg ) , tablet 3.07 ketoconazole ointment 2% 15gm tube ( 15 gm ) , ointment 3.08 ketoconazole tab 3.09 lactobacillus ( ( lactobacillus 60 million spores ) ) , tablet [ 3.1 lactulose solution ( 3.35gm / 5 ml ) , solution 3.11 l asparaginase 5000 iu lyophilized ( vial ) , injection 3.12 levocetirizine tab 5mg ( ) , tablet 3.13 levodopa +carbidopa tab 250mg + 25m 3.14 levofloxacin 500mg inj 100ml ffs / bfs bottle ( ) , injection solution 3.15 levonorgestrel emergency contraceptive ( 0.75mg ) , tablet 3.16 lidocaine 2% inj. 30 ml vial ( 30 ml ) , injection solution 3.17 lignocaine hydrochloride ( 4% ( 5 ml vial ) ) , eye drops / ointment 3.18 lignocaine hydrochloride topical solution usp ( 2% ) , vial 3.19 linezolid 200mg / 100ml ( 100ml ffs bottle ) , injection 3.2 liquid paraffin ( 500 ml, bottle ) , solution 3.21 lmwh low molecular weight heparin inj 4000iu / ml. ( ) , injection solution for 3.22 lmwh low molecular weight heparin inj. 6000_x000d_iu / ml ( ) , injection solution for 3.23 lorazepam ( 2 mg ) , tablet 3.24 losartan ( 50 mg ) , tablet 3.25 lysol ( 5ltr jar ) , solution 3.26 magnesium hydroxide and aluminium hydroxide simethecon ( 500mg + 250 mg ) , tablet 3.27 magnesium suplhate ( 50 % w / v ( 2ml amp ) ) , injection 3.28 magnesium suplhate injection i.p.50 % w / v ( 1 ml amp ) ( 1 ml amp ) , ampule 3.29 mannitol inj, 10% 100 ml bottle ( ) , injection solution 3.3 mannitol inj, 20% 350ml bfs / ffs bottle ( ) , injection solution 3.31 mannitol inj. 10% 350ml bottle ( ) , injection solution for 3.32 mannitol injection i.p. 20% 100ml bottle ( ) , injection solution 3.33 mebendazole ( 100 mg tab ) , tablet 3.34 mefloquine tab ( 250mg ) , tablet 3.35 menadione usp ( vitamin k3 ) ( 10 mg / ml ( 1 ml amp ) ) , injection 3.36 mephentermine inj 15mg / ml 10ml vial 3.37 methotrexate ( 10 mg ) , tablet 3.38 methotrexate 2.5 mg tab 3.39 methotrexate inj 15mg / ml ( vial ) 3.4 methotrexate inj 500mg vial 3.41 methotrexate inj ( 2ml ) ( 50mg ) , injection solution for 3.42 methyl prednisolone sodium succinate inj. usp 125mg ( 10ml ) , vail 3.43 methyl prednisolone sodium succinate inj.usp ( 40mg / ml vial ) , injection 3.44 methyl prednisolone sodium succinate inj. usp 500mg 3.45 methyl prednisolone sodium succinate tablet 8 mg 3.46 metoprolol inj 1 mg / ml ( 5ml vial ) , injection 3.47 metronidazole benzoate oral suspension ( 100mg of base / 5 ml ( 60ml bottle ) ) , suspension 3.48 metronidazole 500mg ( 100 ml ffs bfs bottle ) , injection 3.49 metronidazole tab ( 200 mg ) , tablet 3.5 micronised progestron inj. 200mg / m 3.51 milk of magnesia 11.25 ml, liquid paraffin 3.75ml phenolphthalein 50mg / 15ml ( cremaffin pink formula ) 170ml syr 3.52 milk of magnesia 11.25ml+liquid paraffin 1.25ml / 5ml 170ml bottle 3.53 morphine sulphate inj. ip 15mg / ml ( 15mg / ml ) , injection solution 3.54 moxifloxacine eye drop 0.5%w / v 3.55 multivitamin drops ( approx 22 drops ) ( ) , drop 3.56 multivitamin sugar coated tab. ( nfi formula ) , tablet 3.57 n acetyl cysteine inj ( 200mg / ml in 1ml amp ) , injection 3.58 nitrofruantoin tablet ip 100m 3.59 noraderanaline inj. ( 2 mg base / 2 ml amp ) , injection solution 3.6 norethisterone ( 5mg ) , tablet 3.61 ofloxacin + ornidazole ( 200mg and 500mg ) , tablet 3.62 ofloxacin 0.3% w / v of ofloxacin ph.eur. ( 5 ml vial ) , eye drop [ 110332 ] 3.63 ofloxacin suspension [ 4670003 ] 3.64 ofloxacin suspension 50mg / 5 ml ( 30 ml bottle ) , suspension [ 120224 ] 3.65 olanzapine 20mg tab [ 4710506 ] 3.66 olopotadine antiallergic ( 0.1% w / v ( 5 ml vial ) ) , eye drop [ 110337 ] 3.67 omeprazole 40mg ( vial ) , injection [ 120231 ] 3.68 omeprazole ( 20mg ) , capsule [ 120230 ] 3.69 ondansetron 8mg inj [ 4340019 ] 3.7 ors packet who formula sodium chloride 2.5g, potessium chloride 1.5g, sodium citrete 2.09g dextrose 13.6g, 20.5gm pouch ( ) , powder [ 4550004 ] 3.71 oxaliplatin ( 50mg inj 25 ml vial ) , injection [ 120239 ] 3.72 oxytocin ( 5 iu / ml ( 2ml amp ) ) , injection [ 4350048 ] 3.73 paclitaxel 260mg inj 43.4ml vial [ 4340016 ] 3.74 paclitaxel 300mg inj [ 4350372 ] 3.75 paclitaxel 30mg inj ( 30mg ) , injection solution for [ 4350305 ] 3.76 paclitaxel inj ( 100mg ) , injection 3.77 pantoprazole tab ( 40 mg ) , tablet 3.78 paraffin liquid ( liquid paraffin 1.25ml + milk of magnesia 3.75ml + sodium picosulphate 3.33mg ) , syrup 3.79 pentaprazole inj. 40mg 10ml vial ( ) , injection solution for [ 4350418 ] 3.8 pantaprazole ( 40mg tab ) , tablet 3.81 phenytoin sodium inj. ( 100 mg ) , vial 3.82 phenytoin sodium oral suspension 25 mg / ml ( 100 ml bottle suspension ( loan licencing will be accepted for this item. ) ) , suspension 3.83 pilocarpine eye drops ( 4% ) , eye drop 3.84 pilocarpine hydrochloride eye drops bp 2% 3.85 pioglitazone ( 30 mg ) , tablet 3.86 piroxicam ( 20mg ) , tablet or capsule 3.87 pneumococcal ( polysaccharide ) vaccine 23 valent / 0.5ml inj 3.88 potassium chloride inj. ( 150 mg / 10ml ) , injection solution for 3.89 potassium chloride inj. 150mg / ml 3.9 povidone iodine ointment 5% 250gm jar ( ) , each 3.91 povidone iodine surgical scrub solution. 7.5% ( 500 ml bottle ) , solution 3.92 pralidoxime chloride injection i.p. 1gm ( 20 ml ) , injection 3.93 prazosin tab ( 5 mg ) , tablet 3.94 prednisolone ( 10 mg ( dt also acceptable ) ) , tablet 3.95 prednisolone ( 10 mg / ml ) , eye drop 3.96 premixed insulin biphasic analogue 25 / 75 in penfill 300iu permanent pen one pen per five cartidges and ten needles per pen 3.97 premixed insulin biphasic analogue 30 / 70 in penfill 300iu permanent pens one pen per five cartridges and ten needles per pen 3.98 promethazine inj 25 mg / ml ( 10 ml vail ) ( 10 ml vail ) , injection solution 3.99 promethazine tab ( 25 mg ) , tablet 4 propofol sodium 1%w / v ( 10mg / ml ( 20ml vial ) ) , injection 4.01 propranolol tab ( 40 mg ) , tablet [ 4.02 protamine sulphate inj 10mg / ml 4.03 quinine sulphate 150mg / 5ml syrup 60 ml 4.04 quinine sulphate inj. ( 300mg / ml ) , injection solution for 4.05 rabies vaccine inj ( vero cell culture ) inj. intra dermal ( ) , vial 4.06 rabies vaccine ip human ( ( cell culture ) ) , injection solution 4.07 rabies vaccine ip human cell culture 2.5 iu / dose ( intra muscular use ) , vial 4.08 rabies vaccine ip human ( purified chick embryo cell culture ) ( ) , vaccine 4.09 rabies vaccine ip inj human ( chick embryo / vero cell culture ) intra muscular ( ) , injection solution 4.1 ramipril ( 5 mg ) , tablet 4.11 rectified spirit ( 90% ) solution 4.12 ringer lactate inj iv 500ml bfs bottle ( ) , injection solution 4.13 ringer lactate inj iv 500ml ffs / bfs bottle ( ) , injection solution f 4.14 rituximab ( 100mg ) , injection [ 120268 ] 4.15 salbutamol nebuliser solution bp sabutamol sulphate eq. to salbutamol 1mg per ml ( 2.5 ml amp ) , ampule 4.16 snake venom anti serum ip liquid form ( ) , injection 4.17 snake venom anti serum inj. ( ) , injection solution for 4.18 sodium chloride 0.9% injection ip 100ml bottle ( ) , injection powder for 4.19 sodium chloride 1 / 2 normal, hyper tonic and dextrose 5% inj 4.2 sodium chloride inj iv 0.9% 500ml ( glass bottle ) ( ) , injection solution 4.21 sodium chloride inj iv 500ml bfs bottle ( ) , injection solution 4.22 sodium chloride inj iv 500ml bottle ( ) , injection solution 4.23 sodium chloride n / 2 injection ip 500ml bfs bottle ( ) , bottle 4.24 sodium chloride n / 2 injection ip 500ml ffs / bfs bottle ( ) , injection solution 4.25 sodium hypochlorite 5% solution ( 5 ltr ) , solution 4.26 sodium valproate enteric coated tab. bp ( 200 mg ) , table 4.27 sodium valproate ( 200mg ) , tablet 4.28 soluble insulin 30% isophane insulin 70% 100 iu inj 4.29 spironolactone tab 100mg ( 10x10 ) , tablet 4.3 streptokinase inj ( ) , injection solution 4.31 streptomycin inj ( 0.75g ) , injection solution for 4.32 succinyl choline inj. 50mg / ml 1ml amp 4.33 sulfacetamide eye drops ( 20% ) , eye drops / ointment 4.34 sulfamethoxazole and trimethoprim ( 100 mg and 20mg ) , tablet 4.35 sulfamethoxazole 200mg and trimethoprim 40mg per 5ml suspension ( 50ml bottle ) , suspensio 4.36 sulphadoxine 500mg and pyrimethamine 25mg tab. 4.37 surfactant suspension ( for intratrcaheal ) natural surfactant inj ( 25 mg / ml ) , injection solution for 4.38 surfactant suspension ( intratrcaheal ) bovine 4ml amp natural inj ( ) , ampoule 4.39 surgical spirit bp 500 ml ( ) , bottle 4.4 syrup 100ml bottle. ( 5ml 100mg elemental fe iron & folic acid syrup ( as per the standards provided ) ( ) , syrup 4.41 tamoxifen ( 20mg ) , tablet 4.42 telmisatran ( 20 mg ) , tablet 4.43 temozolomide ( 100mg ) , capsule 4.44 temozolomide 20mg cap 4.45 temozolomide 250mg cap 4.46 terbutaline suplhate inj 4.47 terbutaline suplhate tab ( 2.5mg ) , tablet 4.48 tetanous vaccine adsorbed ip 5ml ( tetanus toxide inj ) 4.49 tetanus immunoglobulin usp / ip ( 500 iu / vial ) , vial 4.5 tetanus toxide inj 5ml ( ) , injection solution for 4.51 tetanus toxiod ( inj. ) , injection 4.52 tetracycline eye oint 1% 4.53 thyroxine sodium tab 100 mcg ( 100 tab bottle ) ( 100 tab ) , tablet 4.54 thyroxine sodium tab ( 50mcg ( 100 tab bottle ) ) , tablet 4.55 tinidazole ( 500mg ) , tablet 4.56 tobramycin ( 0.3% 5ml ) , eye drop 4.57 torsemide ( 10mg ) , tablet [ 4.58 torasemide tab ( 20mg ) , tablet 4.59 tpn ( total parenteral nutrition ) including carbohydrate + proteins + fats solution ( brand: oliclinomel n7 2000 ml ) 4.6 tramadol ( 100mg / ml ( 2 ml amp ) ) , injection 4.61 tramadol cap ip ( 50mg ) , capsule 4.62 tramadol ( 100mg ) , tablet 4.63 tranexamic acid inj. 125mg / ml amp 4.64 trastuzumab ( 440mg vial ) , injection 4.65 triamcinolone acetate 40mg / ml ( 1ml amp ) , injection 4.66 urograffin 76% solution for injection 20ml vial ( 20ml ) , injection solution for 4.67 urograffin 76% solution for injection 50ml vial bottle 4.68 urokinase ( 5 lac iu / vial inj ) , injection powder for 4.69 valethamate bromide 8mg / ml ( 1ml ) , injection 4.7 vancomycin hydrochloride ( 250mg vial ) , injection 4.71 verapamil sugar coated tab ip ( 40mg ) , tablet 4.72 vildagliptin tab ( 50 mg ) , tablet 4.73 vinblastine 10mg inj. 4.74 vincristine inj 1mg / ml 4.75 vitamin a cap usp soft gelatin capsule ( 1 lakh iu ) , capsule ] 4.76 vitamin a cap usp soft gelatin capsule ( 2 lakh iu ) , capsule 4.77 vitamin b1 10mg, b2 10mg, b6 3mg, b12 15mcg, niacinamide 100mg, calcium panthenol 50mg, folic acid 1.5mg, vitamin c 150mg, biotin 100mcg or more tab ( ) , tablet 4.78 vitamin k inj ( phytonadione inj ) 1mg / 0.5ml ( ) , injection solution for 4.79 vitamin k inj. 10 mg / ml ( 10 mg / ml ) , injection solution for 4.8 vitamin. b complex ( nfi ( prophylactic ) ) , tablet 4.81 vitamin b12 inj 500 mcg / ml ( 30 ml amp / vial ) , injection 4.82 voglibose dispersible 0.3mg tab 4.83 water for injection inj 10 ml amp 4.84 zinc sulphate syrup 20mg / 5ml ( 50 ml bottle ) , syrup ] 4.85 bcg diluent ( normal saline ) 1ml 4.86 bcg with vvm 10 doses 4.87 measles diluent ( sterile water ) 4.88 ad syringe ( 0.1 ml ) , vaccine 4.89 ad syringe ( 0.5 ml ) , vaccine 4.9 disposable syringe ( 5 ml ) , syrings 4.91 tt with vvm 10 doses [ 3790004 ] 4.92 absorbable gelatine sponge ( ip 80mm x 50mm x 10mm ) , consumable 4.93 absorbent cotton wool ip 500 grms ( each ) roll ( iso:13485:2016 ) , consumable 4.94 adhesive plasters usp 7.5 cm x 10 mts / roll 4.95 adhesive plasters usp ( 7.5 cm x 5 mts / roll ) , consumable 4.96 ascorbic acid ( vitamin c ) tab i.p. ( 500mg ) , tablet 4.97 b.b silk with 1 / 2 cir rb needle ( size:3 / 0 20 mm length 75 cm ) , consumable 4.98 b.b silk ( 12 foils / pkt ) ( 3 / 8 rcut needle 45 mm length 76 cm, size 2 / 0 ) ) , consumable 4.99 b.b. silk 6 reels x 25 mts ( size:3 / 0 length 25 mts ) , consumable 5 benzyl benzoate application i.p 25%w / w ( 100ml bottle ) , radiology 5.01 blood administrations set 5.02 ceftazidime injection i.p. ( 0.5gm / vial ) , injection 5.03 cholesterol kit end point enzymatic kit 50 test / kit 5.04 coated polyster braided with cd white d ( needle 25 mm ( curved reverse cutting or curved round body or taper cut ) size:2 / 0 ) , consumable 5.05 coated polyster with cd green needle 17 mm ( curved reverse cutting or curved round body or taper cut ) size:2 / 0 length 90cm 5.06 cpk mb kit ( kinetic ) ( 25 test / kit ) , consumable 5.07 disposable dust mask jl246c equivalent to n 95 mask 5.08 disposable examination gloves made of natural rubber latex, pre powdered, non streile, conforming to is 15354:2003 and amendment thereof. size: large 5.09 disposable needles ( is 10654:2002 22g ) , surgical material 5.1 disposable needles ( is 10654:2002 24g ) , surgical material 5.11 disposable needles ( is 10654:2002 26g x 1 / 2 ) , surgical material 5.12 disposable syringes is 10258:2002 ( with needle is 10654:2002 cgs 10cc ( in ribbon pack ) ) , surgical material 5.13 disposable syringes is 10258:2002 with needle is 10654:2002 ( cgs 2cc ( in ribbon pack ) ) , surgical material 5.14 disposable syringes is 10258 2002 with needle is 10654 2002 ( cgs 5cc in ribbon pack ) , surgical material 5.15 field stain a ( 500ml ) , digonstic 5.16 field stain b ( 500ml ) , consumable 5.17 fixer: it shall be powder fixer to produce clean radiographs available in pack size size: 13.5 ltr 5.18 fixer: it shall be powder fixer to produce clean radiographs available in pack size size: 9 ltr 5.19 foleys urinary catheter ( 3 way size 12 ) , surgical material 5.2 g6pd deficiency ( test kit 10 test ) , consumable 5.21 glass slide 75mm x 25mm 1.1 mm 5.22 hbs antigeng kit card ( pack of 10 card test with 10 dropper, 1 buffer solution, 10 pricking lancet and 10 alcohol swab ) , digonstic 5.23 hemoglobin color scale ( starter kit ) components ( 1 ) color scale 01 / kit ( 2 ) test strip 1000 / kit ( 3 ) printed literature for method of use / kit ( 4 ) lancet 1000 / kit [ 6120003 ] 5.24 infant feeding tube ( ( catheter ) size: 5g ) , consumable [ 6760003 ] 5.25 infant mucus extractor sterile pvc ( each ) , surgical material [ 6550018 ] 5.26 intravenous set with airway and needle ( ( adult ) ) , surgical material [ 6450089 ] 5.27 intravenous set with airway and needle ( children ) , surgical material [ 645090 ] 5.28 iv cannula ( two way ) ( size 20 ) , surgical material 5.29 iv cannula ( two way ) ( size 22 ) , surgical material 5.3 iv cannula size 24g with inj.valve ( port ) , surgical material 5.31 k wire length 375mm ( size:1.6mm roll ) , surgical material [ mis70 ] 5.32 k wire size:1mm 5.33 malaria antigen, p vivax, p falciparum rapid diagnostics bivalentt test card ( as per gio nvbdcp specification ) pack of 10 card test with 10 dropper, 1 buffer solution, 10 pricking lancet, and 10 alcohol swab [ 6120089 ] 5.34 micro volume ( drip set ) , digonstic 5.35 poly propylene mono filament sterile precut with 1 / 2 cir rb heavy needle 30mm length 70 cm non absorbable ( surgical sutures usp size 1 ) , digonstic [ 6450117 ] 5.36 poly propylene mono filament sterile precut with 1 / 2 cir rb ( needle 30 mm length 70 cm non absorbable surgical sutures usp size 1 / 0 ) , surgical material 5.37 poly propylene mono filament sterile precut with 1 / 2 cir rb needle 30 mm length 70 cm non absorbable surgical sutures usp size 2 / 0 ( 12 foils / pkt ) , surgical material 5.38 powder developer suitable for processing medical xray films. one developer box shall contain part a and part b which are mixed at the time of preparation of solution of specific capacity size: 13.5 ltr 5.39 pregnancy detection kit ce marked / isi marked 5.4 pregnancy detection kit ce marked / isi marked 30 test / kit ] 5.41 pyrethrum extract 2% ( 25 litre drum ) ( as per specification attached in tender ) , chemical 5.42 reuse prevention syringe sterile single use reuse prevention syringewith detachable needles complaint to iso 7886:4 type i and type b, flow wrap / blister package using medical grade breathable paper, eto sterilized, non latex stopper ( 2ml ) , surgical material 5.43 reuse prevention syringe sterile with detachable needles complaint to iso 7886:4 type i and type b, flow wrap / blister package using medical grade breathable paper, eto sterilized, non latex stopper ( preferred material thermoplastic elastomer ) ( 5ml ) , surgical material 5.44 disposable spinal ( l.p. ) needle ( 25g ) , surgical material 5.45 stainless steel wire 28g 5.46 stainless steel wire 30g 5.47 surgical blade, size 11 5.48 synthetic absorbable suture 1 with 1 / 2 circle taper cut needle ( h ) size :1 40mm length 90cm polyglycolic acid ( pga ) ( 12 foils per pkt ) ( 12 foils per pkt ) , surgical material 5.49 synthetic absorbable suture 2 / 0 with 1 / 2 cir rb needle size:2 / 0 40mm length 90cm polyglycolic acid ( pga ) [ 6450024 ] synthetic absorbable suture 3 / 0 with 1 / 2 cir rb needle size:3 / 0 20mm length 70cm polyglycolic acid ( pga ) [ 6450017 ] 5.51 synthetic absorbable suture 3 / 0 with 1 / 2 cir rb needle size:3 / 0, 40mm length 90cm polyglycolic acid ( pga ) 5.52 synthetic absorbable suture 4 / 0 with 3 / 8 cir cutting needle size:4 / 0 16mm length 45 cm polyglycolic acid ( pga ) 5.53 three layer surgical mask 5.54 urinary drainage bag 2 litre cap with non return valve ( eo sterile ) 5.55 wbc diluting fluid ( 500 ml bottle ) , consumable [ mis144 ] 5.56 x ray film 10 x 12 50 sheets / pack 5.57 x ray film 12 x 12 50 sheets / pack 5.58 x ray film 14 x 14 50 sheets / pack 5.59 x ray film 14 x 17 50 sheets / pack x ray film 6.5 x 8.5 50 sheets / pack 5.61 x ray film 8 x 10 50 sheets / pack 5.62 ceftazidime inj ( 500mg / vial ) , injection 5.63 disposable sterile gloves isi marked surgical rubber hypoallergenic latex 100% powder free 7 1 / 2 inc 5.64 disposable sterile gloves bis specification gloves, surgical rubber, made of hypoallergic latex 100%, electronically tested sterilized by gamma irradiatio eto is no:13422:1992 as amended upto , 7inch / pair ( pair ) , consumable 5.65 ventilator adult model new port e 360 [ 360 ] 5.66 k wire length 375mm ( size:1.8mm roll ) , surgical material [ mis71 ] 5.67 poly propylene mono filament sterile precut with 1 / 2 cir rb needle 25 mm length 70 cm non absorbable surgical sutures usp size 3 / 0 5.68 poly propylene mono filament sterile precut with 1 / 2 cir rb ( needle 40 mm length 70 cm non absorbable surgical sutures usp size 1 / 0 ) , surgical material 5.69 powder developer suitable for processing medical xray films. one developer box shall contain part a and part b which are mixed at the time of preparation of solution of specific capacity size: 9.0 ltr [ 6521029 ] 5.7 tetanus toxoid ( adsorbed ) ip ( 5ml vial ) , injection 5.71 disposable sterile gloves isi marked surgical rubber made of hypoallergenic latex 100% powder free 7 inches 5.72 x ray film 12 x 15 50 sheets / pack 5.73 foldable iol sterile lens + 18d ( usfda approved, as per specification ) ( each ) , consumable 5.74 foleys urinary catheter 3 way size 18 5.75 foleys urinary catheter 3 way size 20 5.76 foldable iol sterile lens + 18.5 d ( usfda approved, as per specification ) ( each ) , consumable 5.77 disposable examination gloves made of natural rubber latex, pre powdered, non streile medium 5.78 disposable examination gloves made of natural rubber latex, pre powdered, non streile small 5.79 synthetic absorbable suture 4 / 0 with 1 / 2 cir rb needle size:4 / 0 20mm length 70cm poly glycolic acid ( pga ) 5.8 reuse prevention syringe sterile with detachable needles complaint to iso ( 7886:4 typei and typeb 3ml ) , consumable 5.81 foldable iol sterile lens + 19d ( usfda approved, as per specification ) ( each ) , consumable 5.82 foldable iol sterile lens + 19.5d ( usfda approved, as per specification ) ( each ) , consumable 5.83 foldable iol sterile lens + 20d ( usfda approved, as per specification ) ( each ) , consumable 5.84 foldable iol sterile lens + 20.5d ( usfda approved, as per specification ) ( each ) , consumable 5.85 foldable iol sterile lens + 21d ( usfda approved, as per specification ) ( each ) , consumable 5.86 foldable iol sterile lens + 21.5d ( usfda approved, as per specification ) ( each ) , consumable 5.87 foldable iol sterile lens + 22d ( usfda approved, as per specification ) ( each ) , consumable 5.88 foldable iol sterile lens + 22.5d ( usfda approved, as per specification ) ( each ) , consumable 5.89 micro pipet 1000 fix and variable each 5.9 baby oxygen mask set of all sizes 5.91 catgut chromic size:2 / 0 length 150 cm 5.92 disposable syringes is 10258:2002 with ( needle is 10654:2002 20ml ) , consumable 5.93 endotracheal tube internal dia 5.5mm to 9.5mm 5.94 foleys urinary catheter silkolatex 2 way sterile, non toxic size 10 5.95 hub cutter non electric lockable safety portable box for disposal of hypodemic needles. cuts the needle from the hub of machine 5.96 sgot kit ( kinetic ) 5x20ml 200 test / kit 5.97 aciclovir 3% ( 5gm tube ) , ointment 5.98 acyclovir suspension 400mg / 5ml ( 100 ml bottle ) , suspension 5.99 aciclovir tab 400 mg ( 400 mg dt tablet also acceptable ) , tablet 6 amino infusions ( 200ml bottle ) , infusion 6.01 amitriptyline tab. ip ( 25 mg ) , tablet 6.02 ampicilline + cloxacilline injection ( 250 mg + 250 mg ) vial injection 5ml vial ( ) , injection 6.03 anti rabies immunoglobulin ( inj.150 iu per 2 ml vial ) , injection 6.04 ascorbic acid ( vitamin c ) tab. 500 mg. 6.05 atracurium besylate ( 10mg / ml inj amp ) , injection 6.06 botropase injection ( ( haemocoagulase 1cu ) 1ml ) , injection 6.07 oseltamivir h1 n1 antiviral cap 75 mg 6.08 clonidine injection, 10ml vial ( 1mg ) ( 10ml vial ) , injection 6.09 cyclophosphamide 50 mg tab 6.1 diphenhydramine syrup 12.5mg / ml 6.11 disposable cap 6.12 disposable ( needles 23g ) , consumable 6.13 disposable pricking lancet ( pkt of 200 units ) ( packet ) , consumable 6.14 enalapril maleate inj. ( 1.25 mg per ml ) , injection 6.15 ethamsylate inj ( 250mg ( 2ml amp ) ) , injection 6.16 ethamsylate tab ( 500mg ) , tablet 6.17 fluconazole iv ( 2mg / ml ( 100ml bottle ) ) , infusion 6.18 foleys urinary catheter size 16 2 way 6.19 foleys catheter size 18 2 way 6.2 glucose kit ( god / pod ) ( 350ml, digonstic ) , consumable [ mis60 ] 6.21 hcv kit card test ( 25 test / kit ) , digonstic 6.22 hydrocortisone sodium succinate inj. 200mg vial ( ) , injection 6.23 iv cannula size with inj.valve ( port ) ( 18g ) , consumable 6.24 ketamine hydrochloride inj. 50mg / ml ( 2 ml amp ) 6.25 meropenem inj 125mg / vial ( each ) , injection [ 6.26 inj.iv dns ( ) , injection 6.27 multivitamine 200ml syrup ( 200ml ) , syrup 6.28 n acetyl cysteine inj 200mg / ml in 10ml amp 6.29 nimesulide ( 100 mg ( dispersiable tablet also accepted ) ) , tablet 6.3 norfloxacine 400mg and tinidazole 600mg ( tab ) , tablet 6.31 oxygen inhelation mddial oxygen steel aluminium cylinder 10 ltr ( ) , consumable 6.32 oxygen nasal cannula ( neonatal ) , consumable 6.33 paracetamol drop ( 100 mg / ml ) , drop 6.34 paracetamol drop 10mg / ml 6.35 phenobarbitone syp 200mg / 5ml ( ) , syrup 6.36 povidone iodine cream 250 gm 6.37 salbutamol ( 2mg / 5ml ( 100ml bottle ) ) , syrup 6.38 salicylic acid ointment ( 6% ) , ointment 6.39 salt testing kit ( as per attached specification , kit ) , consumable 6.4 mesalamine ( 5 aminosalicylic acid 400 mg ) tab 6.41 thiopentone injection 1gm 6.42 tobramycin + dexamethasone ( 0.3%w / v + 0.1%w / v ( 5ml vial ) ) , eye drop 6.43 torasemide inj 100mg ( 2ml vial / amp ) , injection 6.44 umblical cotton tape length 75cm. 6.45 verapamil 80mg ( tablet ) , tablet 6.46 foldable iol sterile lens +18d ( each ) , lens 6.47 microsurgery speciality gloves ( size 6.5 ) , lens 6.48 alchohol repellent and anti static sms fabric csection drape with 16in x 14in adhesive full incise, 270 degrees pe film fluid collection pouch with malleable band and suction port and sms arm board covers and tube holders 120in x 100in 50gsm 6.49 alchohol repellent and anti static sms fabric drape with absorbent material. fluid collection pouch with malleable band and suction port, having filter screen for sample collection and graduated markings on pouch 40 in x 44 in 50gsm 6.5 silver impregnated peripherally inserted central catheter 4 fr with integrated hub 6.51 non foldable iol sterile lens pc + 18.5 ( each ) , lens 6.52 non foldable iol sterile lens pc + 19 ( each ) , lens 6.53 non foldable iol sterile lens ( pc + 20.5 ) , lens 6.54 non foldable iol sterile lens pc + 20 6.55 non foldable iol sterile lens pc + 21.5 6.56 non foldable iol sterile lens pc + 21 ( each ) , lens 6.57 non foldable iol sterile lens pc + 22 ( each ) , lens 6.58 non foldable iol sterile lens pc + 23 6.59 non foldable iol sterile lens pc + 24 6.6 non foldable iol sterile lens ac + 20 6.61 non foldable iol sterile lens ac + 18 6.62 gefitinib tab 250mg 6.63 pancreatin 170 mg+oxbile extract 50 mg+ginger oleoresin 2 mg+activated charcoal 50 mg ( tab ) , tablet 6.64 paclitaxel 260mg inj ( 260mg ) , injection 6.65 filgrastim 300 mcg ( prefilled syrings ) , vial 6.66 dacarbazine inj. ( dtic ) ( 500 mg vial ) , injection 6.67 5 fluorouracil ( 5 fu ) ( 500mg inj ) , injection 6.68 paclitaxel protein bound particles inj 6.69 tamsulosin 4mg tab 6.7 nilotinib ( 200mg ) , tablet or capsule 6.71 nilotinib ( 150mg ) , tablet or capsule 6.72 oxytocin 10 iu / ml ( 1ml ampoule ) , injection 6.73 foleys urinary catheter 3 way size 16 6.74 chymotrypsin and trypsin 100000 iu tab 6.75 l ornithine +l aspartate 5mg inj ( 5mg ) , injection 6.76 quinine sulphate ( ip 600mg ) , tablet 6.77 personal protection kit ( kit ) , consumable 6.78 oseltamivir ( 45mg ) , capsule 6.79 oseltamivir h1 n1 antiviral cap 30 mg 6.8 chromic with st rb needle ( 12 foils / pkt ) ( 60 mm length 76 cm size:2 / 0 ) , consumable 6.81 dextrose 5% inj 500ml ffs / bfs bottle ( 500ml ) , bottle 6.82 acyclovir intervenous infusion i.p ( 500mg / vial ) , injection 6.83 propofol sodium ( 1% w / v 10mg / ml, 10ml vial ) , injection 6.84 digital x ray film 8x10 ( 150 films / pkt ) 6.85 digital x ray film 10x12 ( 150 films / pkt ) 6.86 digital x ray film 11x14 ( 150 films / pkt ) ( 11x14 ( 150 films / pkt ) ) , film 6.87 ecg paper ( chemical coated ) 50mm x 30 mtr. roll 6.88 plaster of paris bandage 15cm x 2.7mtr / roll ( roll ) , bandage ] 6.89 plaster of paris bandage bp 10 cm x 2.7 mtr / roll 6.9 reuse prevention syringe sterile single use reuse prevention syringe with detachable needles compliance to iso 7886:4 type i, b, flow wrap / blister pack using medical grade breathable paper, eto sterilized ( 5ml ) , syrings 6.91 ecg jelly 250 gms ( bottle ) , jelly 6.92 ecg paper ( wax coated ) 50mm x 30 mtr, roll 6.93 nebulization mask kit ( adult ) , mask 6.94 oxygen mask adult ( standard size ) , mask 6.95 oxygen mask paediatric ( standard size ) , mask 6.96 ecg paper ( wax coated ) heavy quality 50mm x 30 mtr / roll 6.97 mackintosh double colour water proof rubber marked isi hospital rubber sheeting is:4135 1974 packing and making : as per clause no 4.1 and 4.3 / mtr 6.98 instrument sterilant 10 minute sporicidal sterilant aldehyde free containing sodium perborate ( ( 810 grm packet ) ) , powder 6.99 surface disinfectant 10 minute aldehyde free disinfectant containing potassium mono per sulphate powder ( ( 5kg packet ) ) , powder 7 b.b silk with 1 / 2 cir rb needle 20 mm length at least 75 cm non absorbable surgical suture usp size 3 0, ( 12foils / pkt ) , needle 7.01 black braided silk with 1 / 2 cir rb needle 30 mm length 75 cm 2 / 0 12 foils / pkt 7.02 black braided silk with 1 / 2 cir rb needle 20 mm length 75 cm 1 / 0 13 foils / pkt 7.03 black braided silk with 1 / 2 cir cd cutting needle 16 mm length 75 cm 3 / 0 ( 14 foils / pkt ) 7.04 disposable needles ( 26g x 1 / 2 ) , consumable 7.05 halothane ( 200ml ) , bottle 7.06 erythromycin ( as estolate ) powder for susp ( 125 mg / 5ml 40ml bottle ) , consumable 7.07 potassium chloride oral solution 500mg / 10ml 7.08 cefixime syrup 50mg / 5ml ( 30 ml bottle ) , syrup 7.09 ferric ammonium citrate 200mg, folic acid 0.5mg ( bottle ) , syrup 7.1 multivitamin 10ml ( amp inj ) , injection 7.11 vecuronium bromide inj 4mg / ml amp ( 4mg / ml amp ) , solution [ 987609 ] 7.12 iron sucrose ( 20 mg ) , injection 7.13 clofazimine ( 50 mg ) , capsule 7.14 b complex minerals with zinc ( capsule ) , capsule 7.15 antioxident ( cap ) , capsule 7.16 vaseline white / yellow ( 1 / 2 kg ) , consumable 7.17 silver sulphadiazine cream 500gm 7.18 hydroxypropyl methylcellulose ophthalmic solution 2% ( 5ml vial ) , consumable 7.19 atracurium besylate usp inj injection 7.2 diphenhydramine inj 50mg / ml ( 50mg / ml ) , injection 7.21 dextran 70 injectable sol inj 500ml ( solution ) 7.22 hydrocortisone sodium succinate inj. 200 mg / vial ( 200 mg / via ) , injection 7.23 ofloxacin inj 2mg / 1ml ( 100ml ) , injection 7.24 meropenam 500mg inj 7.25 inj. meropenam 125mg ( 125mg ) , injection 7.26 meropenem ( 1gm ) , injection 7.27 phenobarbitone inj. 100 mg / ml 7.28 inj. heamocoagulase 1cu 1ml 7.29 diclofenac sodium injection, 3ml ( ) , injection 7.3 inj. b complex 30ml 7.31 inj. l ornithine l aspartate ( 10ml ) , injection 7.32 inj. diclofenac 30ml 7.33 drop iron ( 15ml ) , consumable 7.34 neomycin sulphate+bacitracin zinc ( 5mg+500 iu / gm ointment ( 15gm tube ) ) , tube 7.35 beclomethasone dipropionate, clotrimazole, neomycine sulphate, chlorocresol ( 0.025% + 1% + 0.5% + 0.1% w / w ( 5gm tube ) ) , ointment or cream 7.36 diclofenac + menthol ( 30gm ) , tube 7.37 oint. gentamycin sulphate ( 15gm ) , ointment 7.38 nimesulide oint gel 20gm 7.39 heparin and benzyl nicotinate 20mg oint. 7.4 oxygen inhelation ( oxygen ip medical oxygen in steel or aluminium, cylinder ( 10 litres water cap ) ( 10 liters ) , consumable 7.41 powder protien +vitamins +corbohydrates & minerals 200gm ( 200gm ) , consumable 7.42 calcium syp 100ml syrup ( 240mg / 5 ml ) 7.43 multivitamin 200ml syrup 7.44 cetirizine ( 5mg / 5ml ( 60 ml bottle ) ) , syrup 7.45 magnesium hdroxide+aluminium hydroxide ( 625mg+312mg / 5ml ) [ 987646 ] 7.46 dicyclomine syrup [ 987647 ] 7.47 vitamin b complex nfi formula ( 100ml bottle ) , syrup 7.48 syp. ferric ammonium citrate 200mg +folic acid 0.5mg+vitamin b 125mcg+zinc 5ml syrup 7.49 antacid mint flavour ( 170ml ) , syrup 7.5 drop paracetamol 100mg / 15ml 7.51 norfloxacin + tinidazole ( ( 100 mg + 100 mg ) / 5 ml 30ml syrup ) , syrup 7.52 norfloxacin +metronidazole 30ml syrup 7.53 ibuprofen 10mg+paracetamol 125mg syrup 7.54 ampicilline 125mg / 30ml syrup 7.55 ibuprofen 100mg + paracetamol 125mg per 5 ml syrup ( 60 ml bottle ) , syrup 7.56 syp. cefodroxil 125mg / 30ml syrup 7.57 vitamin b complex nfi formula ( 200ml bottle ) , syrup 7.58 cyproheptadine hcl + tricholine citrate ( 2mg + 275 mg / 5 ml ( 200ml bottle ) ) , syrup 7.59 syp. cetirizine 5mg / 5ml 30ml syrup ( syp. cetirizine 5mg / 5ml 30ml syrup ) , syrup 7.6 calcium gluconate syrup ( 200ml ) , syrup 7.61 amoxicillin dispersible ( 125 mg ) , tablet 7.62 dicyclomine 20mg tab 7.63 clonidine tablet ( 100 mcg ) , tablet 7.64 diphenhydramine ( 25mg ) , capsule 7.65 dexamethasone ( 4 mg ) , tablet 7.66 vitamin c tab 500 mg tablet 7.67 mesalamine ( 5 aminosalicylic acid ) ( usp 400mg ) , tablet 7.68 isoxsuprine tablets i.p. 20 mg tablet 7.69 anticold ( paracetamol 300mg+cetirizine hcl 5mg tablet 7.7 pentoprazole 40mg, domperidone 10mg tab tablet 7.71 pentoprozole 40mg +domperidone 10mg tab 7.72 calcium citrate 500mg with vitamin d3 200mcg tablet 7.73 norfloxacine 400mg and tinidazole 600mg tab 7.74 losartan 50mg +hydroclorothiazide 12.5mg tablet 7.75 ethamsylate tablet ( 250mg ) , tablet 7.76 diclofenac 50mg +paracetamol 325mg+chlorzoxazone 500mg ( tab ) , tablet 7.77 ofloxacin 200mg +tinidazole 600mg ( tab ) , tablet 7.78 azythromycin 1 gm + fluconazole 150 mg, + secnidazole 2 g, tablet c tablet 7.79 amlodipine 5mg+atenolol ( 50mg ) , tablet 7.8 iron & folic acid entric coated 100mg, of elemental iron ( adult ) +fa 1.5mg tab. 7.81 aceclofenac 100mg+paracetamol 500mg tab 7.82 dicyclomine 20mg+paracetamol 325mg tab 7.83 norfloxacin + tinidazole 400mg tab 7.84 norfloxacin +tinidazole 400mg tab 7.85 roxithromycin 150mg tablet 7.86 domperidone +ranitidine 150mg tab 7.87 povidone iodine cream 250gm 7.88 amoxycillin and potassium clavulanate i.p. ( 1 gm + 0.2 gm / 10 ml vial ) , injection 7.89 dexamethasone + gentamycin eye drop 0.1%+0.3% 7.9 prostaglandin e2 gel 0.5mg ( 3gm tube ) , tube 7.91 who hemoglobin color scale ( starter kit ) components ( 1 ) colour scale 01 / kit ( 2 ) test strip 1000 / kit ( 3 ) printed literature for method of use / kit ( 4 ) lancet 1000 / kit 10x100 ( nabl / cap accrediated lab test certificate for the batch no. must be enclosed with each supply delivered ) , consumable [ mis145 ] 7.92 strip for albumin urine and suger 7.93 glass slide 75mm x 25mm 1.35 mm 7.94 cover slip 18 x 18 mm 10gm 7.95 variable auto pippets 10 to 100 micro litres ( 10, 25, 50, 100 ) each 7.96 tips for auto pippetes 10 to 100 micro litres 7.97 glucometer strip ( 1x50 ) , consumable 7.98 urea kit berthelot ( 100 test / kit ) , consumable 7.99 acetone detection kit ( 100 gm ) , powder 8 crp test kit ( latex / card ) ( 25 test / kit ) 8.01 cyanemeth solution for hb ( 5 litre ) , consumable 8.02 leishman stain ( 500 ml bottle ) , consumable 8.03 hcl n / 10 ( 500 ml bottle ) 8.04 semen dilution fluid ( 100 ml bottle ) , consumable 8.05 gram iodine ( gram stain ) 125 ml 8.06 sodium citrate 3.8% ( 500 ml bottle ) , consumable 8.07 edta solutions k3 ( 500 ml ) 8.08 disposable cup for urine sputum 30ml 80 to 90 mm diameter 100 / pkt 8.09 disposable pricking lancet 100 units consumable 8.1 paper adhesive plaster 1 x 9.0mts 8.11 barium chloride 10% ( 500 ml bottle ) , consumable 8.12 sulfur powder 8.13 alkaline citrate with k oral solution each 10 ml contains sodium citric 1 gram potassium citrate 0.65 gram citric acid 1 gram syrup ( 10 ml ) , syrup 8.14 alkaline citrate with k oral solution ( 100ml ) , syrup 8.15 total protein lysozyme 1x50 ml 8.16 b.b. silk 6 reels x 25 mts length 25 mts.black braided silk without needle in reels non absorbable surgical sutures usp , 2 0 ( 6 reels is per box rate should be quoted for 6 reels ) , surgical 8.17 b.b. silk 6 reels x 25 mts size:1 / 0 ( 6 reels is per box rate should be quoted for 6 reels ) , surgical material 8.18 bandage than ( 1mtrx20mtr ) , consumable 8.19 rolled bandage 15cm � 5 m 8.2 rolled bandage 10cm � 5m 8.21 rolled bandage 7.5cm � 5m 8.22 bandage clothes 01m � 20m consumable 8.23 cotton crape bandage 15cm x 4m ( box of 10 bandages ) ( no. ) , consumable 8.24 cotton crape bandage 10cm x 4m ( box of 10 bandages ) ( no. ) , consumable 8.25 rolled bandage 5cm � 5m 8.26 iv cannula ( two way ) ( size 24 ) , consumable 8.27 keratome 3.2 keratome round stock 3.2mm full handle knives e.t.o. sterile angled bevel up 45 deg ( ) , consumable 8.28 hub cutter non electric lockable safety portable box for disposal of hypodemic needles. consumable 8.29 hiv 1&2 test cards 8.3 urine albumin & suger 8.31 dengue card test 100 test kit 8.32 typhoid test card ( an immunochromatography assay for the rapid visual detection of typhoid antibody igg / igm in human serum / plasma ) ( 50 test per pack ) , consumable 8.33 hiv kit 100 test / kit 8.34 sodium hypo chloride 5 lit jar 8.35 disposable paper gloves size 7 inches consumable 8.36 disposable paper gloves size 7, 1 / 2 inches consumable 8.37 usg thermal paper 8.38 orthopaedic speciality gloves ( size 7 ) , consumable 8.39 disposable appron consumable 8.4 cannula fixer ( set ) , consumable [ 987748 ] 8.41 cotton delivery belt 8.42 gauze swab / pad 6 layer 20 � 20 8.43 disposable sterile gloves size 6 inches consumable 8.44 disposable sterile gloves size 61 / 2 inches consumable 8.45 disposable sterile gloves size 7, 1 / 2 inches consumable 8.46 c.p.d.blood bag 350 ml consumable 8.47 fixer powder ( bromex acid fixer with hardner ) ( 22.5 ltr / pkt ) 8.48 bilirubin kit ( colorimeter semi auto ) ( 4x60 ml 480 test / kit ) , consumable 8.49 cholesterol kit end point enzymatic kit ( 5x20ml 200 test / kit ) , consumable 8.5 hdl kit ppt ( 2x50ml 200 test / kit ) , consumable 8.51 triglyceride kit enzymetic ( 5x20ml 200test / kit ) , consumable 8.52 creatinine calorimeter for semi auto kinetic 4x60ml 480test / kit 8.53 alkaline phosphatase kit ( kinetic ) 10x2.2ml 44 test / kit consumable 8.54 ra factor 50 test kit qualicative 8.55 chromic with cd.rb needle absorbable surgical suture ( 12 foils / pkt ) ( 40 mm length 76 cm size:1 / 0 ) , surgical material 8.56 chromic with 1 / 2 cir rb needle 30 mm length 76cm, 2 0 usp, absorbable surgical suture surgical material ( 12 foils / box ) , surgical material 8.57 chromic with 1 / 2 cir rb needle 20 mm length 76 cm, 3 0 usp, absorbable surgical suture surgical material 12foils / box 8.58 chromic with 1 / 2 cir rb needle size:1 / 0, 30 mm length 76cm absorbable surgical suture surgical material 8.59 chromic with 1 / 2 cir rb needle 40 mm length 76 cm ( with needle ) ) absorbable surgical sutures usp, ( size 1, 12 foils / pkt ) , surgical material 8.6 chromic with cd rb needle 30 mm length 76 cm size:2 / 0 ( absorbable surgical suture surgical usp, 12 foils / boxmaterial ) , surgical material 8.61 chromic with cd cutting needle 12 mm length 70cm size:3 / 0 8.62 chromic catgut ( 12 foils / pkt ) ( size:1 / 0 length at least 150 cm ) , consumable 8.63 synthetic absorbable suture 3 / 0 with 1 / 2 cir cutting needle size:3 / 0 36mm length 70cm polyglycolic acid ( pga ) 8.64 b.b silk with 1 / 2 cir rb needle size:2 / 0 30 mm length 75 cm surgical material 8.65 poly propylene with 1 / 2 cir rb needle 16 mm length 70 cm size:4 / 0 ( 12 foils / pkt ) , consumable 8.66 poly propylene monofilament sterile precut with 1 / 2 cir rb needle 30mm length 70cm non absorbable surgical sutures usp size 2 / 0 ( size:2 / 0 ( 12 foils / pkt ) ) , consumable 8.67 disposable needles ( 22g consumable ) , consumable 8.68 polyamide with cd r cut extra penetrating needle ( 12 foils / pkt ) ( size 4 / 0 ) , consumable 8.69 needle hypodermic0insulin ( metallic non0sterile ) 8.7 suture needles curved 1 / 2 circle round bodyassorted size 1 5 8.71 suture needles curved 1 / 2 circle round bodyassorted size 11 15 8.72 suture needles curved 1 / 2 circle round bodyassorted size 16 20 8.73 spinal ( l.p. ) needle disposable ( 24g ) , consumable 8.74 spinal ( l.p. ) needle disposable 26g consumable 8.75 chromic catgut , round body needle no. 1.0 8.76 needle hypodermic size is ( 10654:2002 24g ) , consumable 8.77 catgut chromic with 1 / 2 cir rb needle 40 mm length 75cm no. 1 consumable 8.78 bleaching power gr ii ( 25kg ) bags consumable 8.79 bleaching powder gr ii is 1065 / 1989 with upto date amendment packed in 25 kg hdpe bags isi marked stable consumable 8.8 disposable suction catheter assorted covering ( all sizes 10, 12, 14, 16, 18 ) , consumable 8.81 foleys urinary catheter silkolatex 2 way sterile, non toxic size 10 8.82 ecg paper computerizesd triple channel 20m 8.83 infant feeding tube size: 6g 8.84 b.b silk with 1 / 2 cir rb needle size:1 / 0 20 mm length 75 cm non absorbable surgical sutures usp surgical material [ 987794 ] 8.85 gauze swab / pad 6 layer 10 � 10 8.86 endotracheal tube internal dia 2.5 mm to 5 mm 8.87 complete delivery kit 1plastic desposable gown ( non woven plastic laminated, leak proof ) 2 ( 4*4 ) , ( 2 ) .disposable goggles for protection of eyes 2 ( free size ) , ( 3 ) .face mask 2 free size, ( 4 ) .plastic disposable cap ( non woven plastic laminated, leak proof ) ( 1pair, ( 5 ) .long gloves elbow length 2pairs ( 6 1 / 2 and 7 ) , ( 6 ) disposable shoe covers, till calf ( plastic ) 2pair ( free size ) as per attached specification ) , consumable 8.88 malaria card ( antigen ) atleast 100 microbes / desi ltr. for both species 8.89 seman diluting fluid 100 ml. 8.9 n / 10 hcl 500ml 8.91 widal 2x2 sera slide kit 8.92 syphalis card igg+igm s / s above 99.5 % syrup 8.93 edta k3 vial each 8.94 crp latex slide per test 8.95 urine culture pot 30 ml. 8.96 rapid ra 25 test 8.97 cell pack, reagent pack for cell counter ( ( erma and mindrug ) complete set ) , consumable 8.98 capillary tube ( 100 pieces ) , consumable 8.99 crp kit 1x100 biolab qualitative ) 9 vdrl ( rpr ) 1x100 strip 9.01 widal 4x5 ml 9.02 anti abd grouping serum 3x10ml consumable 9.03 sgpt kit lyphozyme 5x20 ml 9.04 urea uv gloh 5x20ml 9.05 urea ( brethelot ) 3x100ml lyphozyme 2x10ml 9.06 creatinin kit 9.07 uric acid biosystem 9.08 sugar albumin strip 9.09 test tube 15x125 9.1 disposable syringes ( with needle cgs 2cc ) , consumable 9.11 disposable syringes ( with needle cgs 5cc ) , consumable 9.12 disposable syringes with needle ( cgs 10cc ) , consumable 9.13 insulin syringe ( 40 units / ml iso 8537:2007 ) , consumable 9.14 reuse prevention syringe sterile single use reuse prevention syringe with detachable needles compliance to iso 7886:4 type i and b, flow wrap / blister pkg using medical grade breathable paper, eto sterilized ( 3ml ) , consumable 9.15 disposable syringe with needle cgs 1cc with mark 0 1ml consumable ( ) , consumable 9.16 malaria pf / pv rapid test 9.17 malaria pf / pv antigen card 9.18 ryles tube ( pvc ) size ( children: 10 ) , consumable 9.19 ryles tube ( pvc ) size : adult: 16 ( each ) , consumable 9.2 infant feeding tube ( catheter ) size: 8g ( each ) , consumable 9.21 edta vail 9.22 edta vial with safty cap ( 2ml. ) capsule 9.23 plain vial with screw cap ( 12 x 75 ) , consumable 9.24 bed sheet white 60 x 90 consumable 9.25 basta cloth 44 x 44 ( 44x44 ) , consumable 9.26 draw sheet bleach 45 x 45 9.27 instrument wash 500ml with spray pump 9.28 liquid hand wash solution with dispenser consumable ( 500 ml ) , consumable 9.29 surgical blade isi marked, size 15 ( 100 per packet ) , surgical material 9.3 surgical blade isi marked, size 23 ( 100 / pkt ) , surgical material 9.31 suture mersilk 8 0 ( 12 foil ) [ 987841 ] 9.32 paper adhesive plaster 1 / 2 x 9.0mts 9.33 inj. primacort hydrocotisone ( 200 mg ) , injection 9.34 iv dextrose 40% 9.35 absorbent cotton roll 100 gm each consumable 9.36 acetic acid solution ( 3% 100 ml bottle ) , consumable 9.37 acetone solution ( 100 ml ) , bottle 9.38 antacid syrup , 170 ml ( dried alluminium hydroxide gel 200 mg, simethicon ( 25 mg / 5 ml ) , syrup 9.39 azithromycin + fluconazole +secnidazole ( 1 gm+150 mg+ 1 gm, tablet combipack ) , tablet 9.4 bandage cloth bleach consumable 9.41 beclomethasone dipropionate, neomycin sulphate, miconazole nitrate ( 0.025 % + 0.5 % + 2 % ( 5 gm tube ) ) , ointment 9.42 buppivacaine 5 mg, dextrose80 mg / ml ( 4 ml inj injection ) , injection 9.43 calcium carbonate 625 mg, vitamin d3 125 iu / 5 ml ( 100 ml syrup ) , syrup 9.44 cefixime 50 mg / 5ml, 30 ml, drop ( 30 ml ) , drop ] 9.45 chair cushion box type 18x18 9.46 neonatal hyperthermia prevention double layer pe bag with hood and velcro protection 9.47 chloramphenicol 0.5% ( 5ml ) , eye drop 9.48 chlorhexidine 0.5 % propanol 70 %, 100 ml hand rub ( 100 ml ) , consumable 9.49 chlorhexidine acetate 0.5 %, medicated gauze 9.5 chlorquine phosphate 64.5 mg / ml, 5 ml inj ( 5 ml ) , injection 9.51 cold cough drop , 15 ml ( phenyl ephrine 5 mg, chlorphenaramine 0.5 mg, paracetamol 125 mg / 5 ml ) , consumable 9.52 creatine calorimeter for semi auto kinetica 4x60ml 480 test kit 9.53 dengue duo serum plasma 10 test / kit ( sd ) 9.54 dexamethasone sodium ( 0.5 mg ) , tablet 9.55 dextrose 25 %, 25 ml inj 9.56 dextrose 50 %, ( 25 ml ) inj ( 50 % ) , injection 9.57 digestive drop ( digestive enzyme and multivitamin with l lysine ) ( 15 ml ) , drop 9.58 digital x ray film size 14 x 17 ( ( 100 sheet per packet ) ) , film 9.59 kellys pad disposable 9.6 dusting powder, 10 gm ( neomycin sulphate 5 mg, baccitracin 250 unit, sulphacetamide sodium 60 mg ) 9.61 enema 100 ml ( sodium acid phosphate 10 gm, sodium phosphate 8 gm / 100 ml ) 9.62 foleys urinary catheter 3 way size 22 9.63 frusemide 20mg + spironolactone 50mg ( tablet ) , tablet 9.64 g 6pd kinetic per ml 9.65 gauze clothes 90cmx20m 9.66 gauze swab / pad ( 4 layer 20x40 ) , consumable 9.67 gentian violet ( gram stain ) 100ml bottle 9.68 glass test tube 5 without edge 9.69 haemoccel ( electrolight na, k, ca, cl ) ( 500 ml inj ) , injection ] 9.7 haemocoagulase 1 nih unit / ml, 1 ml inj 9.71 hdl kit 50 test 9.72 hematology cell counter reagents as per requirement of cell counter cleaning solution 100 ml 9.73 hematology cell counter reagents dilutent ( 20 ltr ) 9.74 hematology cell counter reagents rinse solution ( 20 ltr ) 9.75 heparin sodium benzyl nicotinate oint 9.76 hiv 1+2 ( rapid ) per card j mitra 9.77 inj. sigmacrome ( obrochrome ) 10ml 9.78 iron syrup 200 ml ( elemental iron 40 mg, ammonium citrate 200 mg, cyanocobalamin 7.5 mg, folic acid 0.5 mg, zinc sulphate 7 mg / 5 ml ) , consumable 9.79 iv cannula size 26g ( ) , consumabl 9.8 labetalol 5 mg / ml, 2 ml inj ( 2 ml ) , injection 9.81 losartan potassium, hydrochlorthiazide ( 50 mg + 12.5 mg ) , tablet 9.82 medigard hand scrub 9.83 mehylcobalamine 1500 mcg, alpha lipoic acid 100 mg, folic acid 1.5 mcg, thiamine mononitrate 10 mg ( pyridoxine hcl 3 mg ) , capsule 9.84 metresses 3x6 with raxine cover 4 density 9.85 miconazole nitrate 2 % w / w 15 gm, oint 9.86 micropiptte 100 1000 9.87 ofloxacin + dexamethasone 10 ml eye drop ( 10 ml ) , drop 9.88 pantoprazole 40 mg, domperidone 10 mg ( tab ) , tablet 9.89 paracetamol 100 mg / ml, 150 ml drop ( 150 ml ) , consumable 9.9 paracetamol 75 mg / ml ( 10 ml inj ) , injection 9.91 phenobarbitine ( 20 mg / ml, 60 ml syrup ) , syrup 9.92 poly propylene mesh ( 7.5cmx15cm ) , consumable 9.93 sgpt test kit reagent 9.94 strip for malaria antigen, p vivex, p falciparum ( 50 tests ) 9.95 synethetic absorbable suture 1 / 0 with 1 / 2 cir rb needle size: 1 / 0 length 90cm 9.96 telmisartan, hydrochlorthiazide ( 40 mg + 12.5 mg ) , tablet 9.97 tuberculin diluted ppd 5 tu / 0.1 ml ( 5 ml ) , solution 9.98 uri stix 100 test 9.99 vitamin b complex syp 200 ml 10 white petrollium jelly 500 gm 10.01 widal 2x2 tube test kit 10.02 b.b silk with 1 / 2 cir rb / cutting needle 30 mm length 75 cm non absorbable ( size 2 0, 12 foils / pkt ) , consumable 10.03 collagen sheets 10 x 10 cm sheet 10.04 foleys catheter size 14 3 way 10.05 foleys catheter size 14 2 way 10.06 ryles tube ( pvc ) size : adult ( 18, each ) , tube 10.07 ryles tube ( pvc ) size ( children : 12 ) , tube 10.08 disposable suction catheter ( size 14 ) , consumable 10.09 disposable suction catheter ( size 12 ) , consumable 10.1 disposable scalp vein set ( size 20 no ) , consumable 10.11 disposable scalp vein set size 22 no ( each ) , consumable 10.12 paediatric drip set ( set ) , digonstic 10.13 measure volume ( drip set ) , each 10.14 cvp line complete set 10.15 triple lumen jugular catheter 12 x 16 10.16 oseltamivir h1 n1 antiviral syp 75 mg 10.17 swine flu vaccine ( vaccine ) , vaccine 10.18 paper adhesive plaster microporous surgical tape 1 inch x 9 m / roll ( 1 inch * 9 m / roll ( iso 13485:2016 ) ) , consumable 10.19 paper adhesive plaster microporous surgical tape ( 4 inch x 9 m / roll ( iso 13485:2016 ) ) , consumable 10.2 paper adhesive plaster microporous surgical tape ( 2 inch x 5m / roll ) , consumable 10.21 paper adhesive plaster microporous surgical tape ( 6 inch x 5m / roll ) , consumable 10.22 plaster of paris bandage 10 cm x 2.7 mtr / roll ( roll ) , bandage 10.23 vdrl kit ( strip ) ( 50 test / kit ) , consumable 10.24 disposable spinal needle ( 23 no ) , each 10.25 disposable spinal needle 18 no 10.26 disposable spinal needle ( 22 no ) , each 10.27 dj stent for ureter ( 8 fr ) , each 10.28 dj stent for ureter ( 6 fr ) , each 10.29 double lumen hoemodialysis catheter with pur ext ( tube ) , each 10.3 trucut biopsy needle ( 18 g length 15 cm ) , each 10.31 disposable ( 20 g no isi marked ) , needle 10.32 disposable syringe ( 50 ml ) , syrings 10.33 reuse prevention syringe ( 10 ml ) , syrings 10.34 glass test tube 12 x 100 ( medium size ) heavy quality 100 / pkt ( no. ) , tube 10.35 test tube 12 x 100 ( medicm size ) 100 / pkt 10.36 test tube 12 x 75 ( small size ) 100 / pkt ( 12 x 75 ( small size ) 100 / pkt ) , tube 10.37 tips for auto pipettes 2 to 100 micro litres 1000 / pkt ( 2 to 100 micro litres 1000 / pkt ) , each 10.38 tips for auto pipettes 200 to 1000 micro litres 500 / pkt ( 200 to 1000 micro litres 500 / pkt ) , each 10.39 abdominal drain ( set 32 no ) , each 10.4 abdominal drain set ( 28 no ) , each 10.41 icd bag 1000 ml 10.42 foleys urinary catheter 2 way size 8 10.43 endotracheal tubes size 9.5 cuffed should have low pressure high volume cuff and radio opaque blue line 10.44 wound suction catheter ( no 18 ) , each 10.45 foleys urinary catheter pediatrics ( size 10 ) , each 10.46 blood grouping anti sera a monoclonal : antisera should be transparent with more than one year shelf life at 2 6 c , it should give +++ agglutination at 1.256 dilution in 3 4 sec with a positive cells 10 ml 10.47 blood grouping anti sera b monoclonal : antisera should be transparent with more than one year shelf life at 2 6 c , it should give +++ agglutination at 1.256 dilution in 3 4 sec with b positive cells 10 ml 10.48 chikungunya card test 1 gg + 1 gm ( 25 test / kit ) 10.49 alpha beta arteether inj 75 mg / 2 ml 10.5 cefadroxil ( 500 mg ) , tablet 10.51 clotrimazole suspension i.p 50mg / 5ml ( 50mg / 5ml ) , suspension 10.52 olopatadine hydrochloride ophthalmic solution usp 01% w / v 5ml ( ) , eye drop [ 10.53 atorvastatin ( 20mg ) , tablet 10.54 soframycin ointment 30 mg tube ( ) , ointment 10.55 atorvastatin ( 10 mg ) , tablet 10.56 glass test tube 12 x 75 ( small size ) ( heavy quality 100 / pkt ) , tube 10.57 b.b. silk 6 reels x 25 mts length 25 mts. black braided silk without needle in reels non absorbable surgical sutures usp 3 0 ( 6 reels is per box rate should be quoted for 6 reels ) , consumable 10.58 chromic catgut no 1.0 round dody, 40 mm 12 foils / pkt 10.59 disposable sterile gloves b.i.s specification gloves, surgical rubber, made of hypoallergic latex 100%, electronically tested sterilized by gamma irradiation / eto is no : 13422 92, 6 inch / pair 10.6 disposable sterile gloves b.i.s specification gloves, surgical rubber, made of hypoallergic latex 100%, electronically tested sterilized by gamma irradiation / eto is no : 13422:1992 as amended upto, 6.5 inch / pair ( pair ) , consumable 10.61 disposable sterile gloves b.i.s specification gloves, surgical rubber, made of hypoallergic latex 100%, electronically tested sterilized by gamma irradiation / eto is no : 13422:1992 ( 7 inch / pair ) , consumable 10.62 disposable sterile gloves b.i.s specification gloves, surgical rubber, made of hypoallergic latex 100%, electronically tested sterilized by gamma irradiation / eto is no : 13422:1992, as amended upto, 7.5 inch / pair ( pair ) , consumable 10.63 disposable sterile gloves isi marked surgical rubber made of hypoallergic latex 100%, electronically tested sterilized by gamma irradiation / eto is no : 13422 92, powder free 6 inch / pair 10.64 disposable sterile gloves isi marked surgical rubber made of hypoallergic latex 100%, electronically tested sterilized by gamma irradiation / eto is no : 13422 92, powder free 6.5 inch / pair 10.65 disposable sterile gloves isi marked surgical rubber made of hypoallergic latex 100%, electronically tested sterilized by gamma irradiation / eto is no : 13422 92, powder free 7 inch / pair 10.66 disposable sterile gloves isi marked surgical rubber made of hypoallergic latex 100%, electronically tested sterilized by gamma irradiation / eto is no : 13422 92, powder free ( 7.5 inch / pair ) , consumable 10.67 diagnostic strips for urine sugar / albmin packing: 100 strip / pkt 10.68 disposable syringes is 10258:2002 with needle is 10654:2002 ( 10ml ) , syrings 10.69 i.v. cannula with injection valve ( 20g ) , consumable 10.7 needle hypodermic size is ( 10654:2002 23g ) , needle 10.71 sterile hypodermic syring with needle ( 5 ml ) , syrings [ 10.72 sterile hypodermic syring with needle 10 ml [ 10.73 sterile hypodermic syring with needle 20 ml 10.74 disposable needles ( 23 no ) , needle 10.75 i.v. cannula with injection valve ( size 24 g ) , consumable 10.76 triway cannula ( 3 way stop cock ) , consumable 10.77 three way stop ( cock ) , consumable 10.78 syrup 50ml bottle ( each 1 ml contains 20 mg elemental iron and 100 mcg folic acid syrup as per the standards provided with dropper ) , syrup 10.79 formaldehyde ( formalin ) 37% acq dilute 34 ml formaledehyde solution with water to produce 100ml ( 450 ml bottle ) ( 34 ml ) , bottle 10.8 irinotecan 100 mg inj ( 1 ml amp ) [ 10.81 azithromycin ( 100mg / 5ml ( 15 ml bottle ) ) , suspension 10.82 compound sodium lactate injection ip ( ringers lactate ) 0.24 % w / v of lactic acid ( eq. to 0.32% w / v of sodium lactate ) , 0.6 % w / v sodium chloride, 0.04 % w / v potassium chloride and 0.027 % w / v calcium chloride ( 500 ml bottle ) ( ) , solution 10.83 gram iodine ( gram stain ) ( 100ml bottle ) ( bottle ) , consumable 10.84 trisodium citrate 3.8% ( 500 ml bottle ) 10.85 basic carbol fuchsin for afb staining 25 gm / pkt 10.86 carbol fuchsin for zn stain ( 500ml bottle ) 10.87 fouchets reagent ( 100 ml bottle ) , consumable [ mis56 ] 10.88 kit for total protein ( including albumin and total protein ) 100ml bottle 10.89 methyl blue for ( z n ) ( 125 ml bottle ) , consumable 10.9 platelet dilution fluid ( 100 ml ) , consumable 10.91 safranine ( gram stain ) ( 500 ml bottle ) , consumable 10.92 papaniculau stain kit ( 125ml bottle ) 10.93 developer single bath liquid concentrated of consistent quality. it sould have favoutable contrast / fog ratio and good shelf life 2 lit can ( to make 9 liters working solution ) ( bromodex mp developer concentrate ) 9ltr packing 10.94 developer single bath liquid concentrated of consistent quality. it sould have favoutable contrast / fog ratio and good shelf life 3 lit can ( to make 13.5 liters working solution ) ( bromodex mp developer concentrate ) 13.5 ltr packing 10.95 developer single bath liquid concentrated of consistent quality. it sould have favoutable contrast / fog ratio and good shelf life ( 5 ltr can to make 22.5 liters working solution ) 10.96 echo jelly 250ml bottle ( bottle ) , jelly 10.97 surgical blade isi marked, size 22 ( 100 / pkt ) , surgical material 10.98 surgical blade isi marked, size 24 ( 100 / pkt ) , surgical material 10.99 developer powder ( 22.5 ltr ) 11 brain thromboplastin for prothrombin time ( pt reagent ) 5ml ( liquiplastin ) 11.01 blood grouping anti sera d monoclonal : antisera should be transparent with more than one year shelf life at 2 6 c, it should give +++ agglutination at 1.256 dilution in 3 4 sec with d antigen positive cells. 10ml vail ( eryclone anti d igm ) 11.02 hiv kit card ( 25 test / kit ) , kit 11.03 ra factor rapid kit ( 25 test / kit ) 1: ) should be based on latex agglutination slide test. 2: ) qualitative and semiquantitative testing facility possible. 3: ) test speed must be less than 2 minutes 11.04 typhoid card test kit ( for igg and igm antibody detection ) ( 25 test kit ) 11.05 auto pippets fixed volume ( 10 micro liters each ) , consumable [ mis11 ] 11.06 auto pippets fixed volume ( 20 micro liters each ) , consumable [ mis13 ] 11.07 auto pippets fixed volume ( 1000 micro liters each ) , consumable [ mis12 ] 11.08 central venous catheter kit ( single lumen ) , kit 11.09 desferioxamine injection 500mg ( 500mg ) , injection 11.1 octreotide lar ( 30mg ) , injection 11.11 vildagliptin + metformin ( 50mg + 500mg ) , tablet 11.12 levofloxacin 500 mg ( 100 ml ffs bottle ) , injection 11.13 imatinib ( 400 mg ) , tablet 11.14 imatinib 100 mg cap 11.15 calcium leucovorin ( 50 mg / vial inj ) , injection 11.16 tamoxifen ( 10 mg ) , tablet 11.17 paclitaxel nanoparticle / protein bound particles inj. ( 100mg vial ) , vial 11.18 amlodipine ( 2.5mg ) , tab 11.19 oseltamivir 12 mg / ml syrup ( 75ml bottle ) , syrup 11.2 sitagliptin ( 100 mg ) , tablet 11.21 methyl prednisolone sod. succinate ( 500 mg vial ) ( inj 40mg / ml , 12.5 ml vial ) , injection 11.22 hydrocortisone inj 100 mg / vial ( ) , injection 11.23 oseltamivir 30mg ( capsule ) , capsule 11.24 iron and folic acid enteric coated tab. dried ferrous sulphate ip equ. to ferrous iron 100 mg and folic acid ip 0.5 mg granules ( red tablet ) ( ) , tablet 11.25 a v blood lines with av pressure transducer protector for all machines types and dialysers ( acceptable for fitting to all standard dialysers ) , set 11.26 femoral catheters single lumen size adult ( set of 12 different sizes set ) , consumable 11.27 femoral catheters single lumen size size pediatrics ( ( set of 12 different sizes ) , set ) , consumable 11.28 femoral catheters double lumen kit curved double lumen catheter set ( 12 f ( curved ) adult ) , consumable 11.29 adult double lumen catheter ( set 11.5 f 12 fr, 13cm ( curved ) , kit ) , consumable 11.3 adult double lumen catheter set ( 11.5 f 12 fr, 13cm ( straight ) , set ) , consumable 11.31 paediatric double lumen catheter set 6.5 f 8.5 fr, 13cm ( curved ) , kit 11.32 paediatric double lumen catheter set 6.5 f 8.5 fr, 13cm ( straight ) , set 11.33 jugular catheters : double lumen kit ( curved ) , set [ 700233 ] 11.34 femoral guide wires : straight ( 0.325 mm size ) should meet the following standards : european ce, iso13485, sterile, fda, set 11.35 blood vessel introducers needles 16g, sterilized, set 11.36 dialysis starting kit disposable:a ) sterile tray with top ( disposable ) , size not less than 30x30cm b ) sterile drape size not less than 45x45 cm 1no c ) cotton ball 6 no d ) cotton gauze pieces 1 11.37 tourniquet with belt ( good quality pairs ) ( each ) , consumable 11.38 kores indelible ink marker pen 11.39 ecg paper ( chemical coated ) ( 50mm*20 mm roll ) , each 11.4 tmt graph paper a4 size, 100 piece / pkt 11.41 ecg roll three channel 20m 11.42 iv cannula size with inj.valve ( port ) ( 22g ) , consumable 11.43 1.3 / 1.4 adult dialyzer ( dialyzer multiple use hollow fiber size as given polysulphone or polyethersulfone ) ( 200ml bottle ) , consumable 11.44 1.5 / 1.6 adult dialyzer ( dialyzer multiple use hollow fiber size as given polysulphone or polyethersulfone ) 11.45 rpr rapid card test kit ( 50 test / pkt ) 11.46 disposable sharp collection containers ( 1.5 l ) , consumable 11.47 polybutylate coated with polyester braided ( green ) with 1 / 2 cir tap cut v 5 da needle 17mm, non abs surg suture usp 2 0 length 90cm ( 12 foils / pkt ) 11.48 mva kit ( mannual vaccum aspiration kit 11.49 fistula 16g, single sterilized eto single needle packing fistula 17g, single sterilized eto single needle packing 11.51 disinfectant renaclean cold sterilant ( 5 ltr can ) 11.52 disinfectant renasteril hot disinfectant ( 5 ltr can ) 11.53 hemodialysis fluid for bicarb made ( part a 10 ltr +part b 500gm 2 / pkt ) , consumable 11.54 intracath cannula for single use ( intravascular catheters ) bis ( gauze 22, length 25 ) , consumable 11.55 quincke bevel pediatric spinal needle, g 25, length 1.2 inch 11.56 exchange transfusion catheter with four way adaptor ( size 4 cm, l 40 cm ) , consumable [ mis52 ] 11.57 single umbilical catheter with luer lock stopcock fr 2, l 40 cm 11.58 single umbilical catheter with luer lock stopcock fr 3, l 40 cm ] 11.59 single umbilical catheter with luer lock stopcock ( fr 4, l 40 cm ) , consumable [ mis113 ] single umbilical catheter with luer lock stopcock ( fr 5, l 40 cm ) , consumable [ 11.61 short iv catheter with straight / j tip guidewire ( l 20, fr 2, g 22 ) , consumable [ mis108 ] 11.62 long line silicon catheter ( g 24, fr 2, l 30cm ) , consumable [ mis76 ] 11.63 short iv catheter with straight guidewire. l 20, fr 2, g 22 11.64 poly propylene monofilament sterile precut with 1 / 2 cir rb needle 30mm length 70cm size : 1 / 0 ( 12 foils / pkt ) , consumable [ 11.65 skin closure stapler ( 35 pins high quality medical grade plastic, cartridge with ss rectangular design pins with wire diameter 0.60 mm and size after closure ( 7.2 x 4.3 mm ) , consumable 11.66 triple lumen polyurethane cvp catheter, 7.5 fr, g 14x18x18, length 15cm 11.67 triple lumen polyurethane cvp catheter, 7.5 fr, g 14x18x18, length 20cm 11.68 double lumen polyurethane cvp catheter, 5 fr, g 17 x 20 ( length 8cm ) , consumable 11.69 double lumen polyurethane cvp catheter, 5 fr, g 17 x 20, ( length 15cm ) , consumable 11.7 spinal needle g 23 with metal stylet. 11.71 low profile titenium chemo port with cilicon catheter ( 9.6 fr, 6.6fr, 3.9fr, ) length 60cm, guide wire, peel away desilet, hubsite needle ( 22g*20mm ) ( 22g*20mm ) , needle 11.72 i.v cannula size with injection valve ( port ) ( 18g ) , consumable 11.73 xro catheter with ptfe material, i.v. safety cannula, with luer lock ( g 22 ) , consumable 11.74 xro catheter with ptfe material, i.v. safety cannula, with luer lock ( g 20 ) , consumable 11.75 xro catheter with ptfe material, i.v. safety cannula, with luer lock ( g 18 ) , consumable ] 11.76 ptfe material, i.v. safety cannula, with luer lock, g 16 ] 11.77 quincke pediatric spinal needles g 25, length 2.0 inch 11.78 central venous catheter kit single lumen ( 18 g ) , consumable 11.79 amoxicillin cloxacillin and lactic acid bacillus capsules 250mg ( 250mg ) , capsule 11.8 polyethylene high pressure extension tube, length 100cm 11.81 polyethylene high pressure extension tube ( length 150cm ) , consumable [ mis94 ] 11.82 polyethylene high pressure extension tube, length 200cm 11.83 a.v fistula needle 17 g 11.84 a.v fistula needle 16 no 11.85 guide wire 3mm 11.86 urosticks ( 50 / pkt ) , consumable 11.87 paper adhesive plaster microporous surgical tape 6 inch x 10 m / roll 11.88 adhesive roll 1 inch x 5 m / roll 11.89 light weight composite mesh : polypropylene and polyglycolic acid partially absorbable composite mesh with large pore size 6 x 11 cm 11.9 chromic catgut monofilament with 1 / 4 circle reverse cutting needle 6 0 ( 12 / pkt ) 11.91 a.v. blood line ( post haemodialysis tubing ) high quality 11.92 endotreheal tube size 3 cuffed piece, should have silicon tube with radio opaque blue line 11.93 endotreheal tube size 4 cuffed piece, should have silicon tube with radio opaque blue line 11.94 disposable sharp collection containers ( 5 ltr ) , consumable 11.95 ondansetron syrup 2mg / ml 11.96 insulin intermediate inj 11.97 doxorubicin ( lypholozed ) 10 mg / vial 11.98 doxorubicin ( lypholozed ) 50 mg / vial ( 50 mg / vial ) , injection 11.99 pemetrexed ( 100 mg vial ) , injection 12 bleomycin 15 units / vial 12.01 daunorubicin ( 20 mg / vial ) , injection 12.02 egc roll ( 66 mm x 15 mm ) , consumable 12.03 umbical cord clamps ( plastic material ) , consumable 12.04 nebulization mask kit ( pediatrics ) , consumable 12.05 1 / 2 ccs cut needle 48 mm stainless steel ( length 45 cm size 4 ) , needle [ mis03 ] 12.06 1 / 2 ccs cut needle 48 mm stainless steel length ( 45 cm size 5 ) , needle [ mis01 ] 12.07 1 / 2 ccs cut needle 48 mm stainless steel length ( 45 cm size 6 ) , needle 12.08 poly propylene monofilament sterile precut with 1 / 2 cir rb needle 40 mm length 70 cm size 1 ( 12 foils / pkt ) , needle 12.09 poly propylene mesh ( 15 x 15 cm ) , consumable [ 12.1 polymaide mono filament ( nylon ) with cd cut needle 20 mm length 70 cm size 2 / 0 ( 12 foils / pkt ) 1 ] 12.11 polyglactin 30 mm 1 / 2 circle round body 90 cm size 1 / 0 ( 12 foils / pkt ) , consumable [ 12.12 polyglactin 40 mm 1 / 2 circle round body 90 cm size 1 ( 12 foils / pkt ) , consumable 12.13 polyglecaprone with 1 / 2 cir oval / rb needle 26 mm length 70 cm size 3 / 0 ( 12 foils / pkt ) , consumable [ mis95 ] 12.14 poly propylene mono filament sterile precut with 1 / 2 cir rb d needle 16mm length 70 cm non absorbable surgical sutures usp size 5 / 0 ( 12foils / pkt ) , consumable 12.15 poly propylene mono filament sterile precut with 1 / 2 cir rb heavy needle 16 mm length 70 cm non absorbable surgical sutures usp 5 / 0 ( 12 foils / pkt ) 12.16 polyester braided coated with cd white dn 25mm ( curved rb ) 2 0 length 90cm ( 12 foils / pkt ) 12.17 polyester braided coated with 1 / 2 cir cd white dn 17 mm taped cut 90 cm 2 / 0 size ( 12 foils / pkt ) , consumable [ mis93 ] 12.18 polyester braided coated with cd white dn 17 mm ( curved rev cut ) cut 90 cm 2 / 0 ( 12 foils / pkt ) 12.19 polyester braided coated with cd white dn 17 mm curved rb 90cm 2 / 0 ( 12 foils / pkt ) 12.2 5 0 da polyglactin 910 coated with polyglactin 910 and calcium state mono with 1 / 4 circle spatulated needle ( 12 foils / pkt ) , consumable 12.21 whitacre pencil point spinal needle 25 g with introducer [ 12.22 lead letter 0 9 sets ( 100 clips / pkt ) 12.23 lead letter a to z set [ 12.24 cassette ( 12 x 15 ) , consumable 12.25 cassette ( 10 x 12 ) , consumable 12.26 gloves latex autoclavable ( 8 no ( pair ) made of natural latex micro rough finish for better grip ) , consumable [ mis59 ] 12.27 sulfamethoxazole and trimethoprim suspension 50ml ( ) , suspension [ 12.28 sargramostim ( recombinant human granulocyte macrophage colony stimulating factor ) ( 500 mcg / ml ) , injection 12.29 magnesium suplhate injection i.p.50 % w / v 10ml amp 12.3 gentamicin inj. 40 mg / ml, 2ml amp 12.31 white petrollium jelly 1kg 12.32 white petrollium jelly 20 kg 12.33 hypodermic syringe for single use ( 10ml bp / bis ( without needle ) ) , syrings 12.34 hypodermic syringe for single use 2ml bp / bis ( without needle ) , syrings 12.35 hypodermic syringe for single use 5ml bp / bis ( without needle ) , syrings [ 700356 ] 12.36 ptfe material, iv cannula ( with luer lock, g 18 ) , consumable [ 700357 ] 12.37 diclofenac gel 1% 10gm tube 12.38 schirmer strip for ophthalmic use 12.39 actinomycin d ( 0.5mg vial ) , injection [ 12.4 cytra.bine 100 mg vial 12.41 ifosphamide + mesna ( 1gm ) , injection [ 12.42 vincristin sulphate 1 mg vial ( ) , vial [ 12.43 azithromycin ( 500 mg / 5ml inj ) , vial 12.44 carboprost promithamin ( 1ml amp ) ( 250mcg / ml ) , injection 12.45 metformine 500mg + glibenclamide 5mg ( tab ) , tablet 12.46 ampicillin ( 250 mg ) , capsule [ 12.47 metronidazole 100mg / 5ml ( 30ml ) , syrup 12.48 prednisolone ( dt tablets also accepted ) ( 5mg ) , tablet 12.49 salmeterol 25 mcg + fluticasone 125 mcg ( 120mdi ) , inhaler 12.5 salmeterol 25 mcg + fluticasone 250 mcg inhaler ( 120mdi ) ( 250 mcg ) , inhaler 12.51 enoxaparin sodium 40mg ( 20mg / 0.2ml ) prefilled syringe inj ( syringe inj ) , syrings [ 12.52 meropenem ( 1000 mg ( vial ) ) , injection 12.53 ceftriaxone 1000mg + sulbactam 500mg ( vial ) , injection 12.54 paracetamol 1000mg i v infusion ( 100 ml ffs bottle ) , injection 12.55 vitamin d3 granules ( 60000 iu sachet ) , powder 12.56 risperidone ( 1mg ) , tablet 12.57 hcg ( human chorionic gonadotropin ) inj 5000 iu vial 12.58 azithromycin 1gm + cefixime 400mg ( ( 1 + 1 tab ) ) , tablet 12.59 vitamin a ( soft gelatin cap ) 50000 i.u 12.6 chlorpromazine ( 50 mg ) , tablet 12.61 surfactant bovine ( 135 mg phopholipid per 5 ml / 5ml vial ) , vial 12.62 sterlium 500 ml 12.63 glucometer strip ( 1x100 ) 12.64 aceborophylline ( 100 mg ) , capsule 12.65 sildenafil ( 50 mg ) , tablet 12.66 ursodeoxycholic acid ( 150 mg tab ) , tablet 12.67 ursodeoxy cholic acid 300 mg tab 12.68 vitamin e usp ( 400 mg ) , capsule 12.69 benzyl benzoate lotion 25% ( 100ml bottle ) , bottle 12.7 disposable needles is ( 10654:2002 26 g ) , needle 12.71 hypodermic syringe for single use 1ml, is : 10258 ( 10 ml vial ) , syrings 12.72 spinal needle g 22 l 120 mm*0.71 / piece 12.73 spinal needle g 27 l 120 mm*0.40 / piece 12.74 hypodermic needles for single use gauze 22 bis length, 25 +1 / 2 12.75 hypodermic needles for single use gauze 23 bis length, 25 +1 / 2 12.76 feeding tube ( catheter ) ( 10 g, each ) , consumable ] 12.77 amoxicillin trihydrate dispersible 125 mg tab ( 125 mg ) , tablet ] 12.78 iron and folic acid sugar coated tab dried ferrous sulphate ip eq. to 45 mg ferrous iron and 400 mcg folic acid ip ( pink colored tab ) wifs junior ifa tablets ( detail specification as per tender ) ( 400 mcg ) , tablet 12.79 phenytoin sodium 250 mg / 5 ml ( 5ml vial ) , injection 12.8 dextromethorphan hydrobromide syrup 13.5 mg / 5ml ( 30 ml bottle ) , syrup 12.81 diphtheria antitoxin 10000 iu ( 10ml vial ) , injection 12.82 glass slide with isi mark at least 75mm x 25 mm thickness at least 1.1mm, detail specifications i with smooth edges, without any scrathtches. ii glazed glass.iii no visual or chromatic abbretions ( 50 slides / packet ) , consumable 12.83 cover slip with isi marked size:18x18mm ( + / 1.00mm ) , thikness 0.13.. to 0.17mm ( pkt of 50 pieces ) , consumable 12.84 spinal needle ( 24 g ) , consumable 12.85 absorable surgical suture rb needle size no 1 0, 30 mm length 70 cm , 12 foils per packet , polyglycolic acid ( pga ) [ 12.86 catgut chromic with 1 / 2 cir rb needle 30 mm length 70cm no. 1 0, 12 foils per packet ( needle 30 mm length 70cm no. 1 0, 12 foils per packet ) , consumable [ 12.87 kellys pad ( rubber / each ) , consumable 12.88 disposable syringe with needle ( 3ml each ) , syrings 12.89 disposable syringe with needle ( 2ml each ) , syring ] 12.9 medical x ray film polyester based imaging film 30.5 cm x 30.5cm ( 12x12 ) size: 50 sheets in one packet 12.91 medical x ray film polyester based imaging film 35.6cm x 35.6cm ( 14x14 ) size: 50 sheets in one packet 12.92 medical x ray film polyester based imaging film 35.6 cm x 43.2cm ( 14x17 ) size: 50 sheets in one packet 12.93 syrup cefpodoxime ( 50 mg ) , syrup 12.94 a.v. blood line ( post haemodialysis tubing ) 12.95 non foldable iol sterile lens pc+14d ( 2 ) , pc+16d ( 3 ) , pc+18d ( 5 ) , pc+19d ( 5 ) , pc+19.5d ( 5 ) , pc+20d ( 15 ) , pc+20.5d ( 15 ) , pc+21d ( 13 ) , pc+21.5d ( 10 ) , pc+22d ( 10 ) , pc+22.5d ( 5 ) , pc+23d ( 5 ) , pc+24d ( 3 ) , pc+26d ( 2 ) , ac+19d ( 2 ) ( box ) , lens 12.96 total protein test kit ( 100 ml bottle ) , consumable 12.97 cervical collar / each soft, ( medium sized ) , consumable 12.98 baby diapers small ( 10 diaper per pkt ) , consumable 12.99 gauze sponge / each ( size 3 x 3 ) , consumable 13 chadar medical bleach ( name print ) ( 54 inch x 90 inch tana x bana ( 2 / 40 s x 20 s ) reed x pik ( 52 x 54 / inch ) ) 13.01 chadar medical bleach ( 60 inch x 90 inch tana x bana ( 2 / 40 s x 20 s ) reed x pik ( 52 x 54 / inch ) ) , 13.02 chadar medical bleach ( ( name print ) 60 inch x 90 inch tana x bana ( 2 / 40 s x 20 s ) reed x pik ( 52 x 54 / inch ) ) , 13.03 dr sheet bleach ( 45 inch x 54 inch tana x bana ( 2 / 40 s x 20 s ) reed x pik ( 52 x 54 / inch ) ) , 13.04 sheeting cloth bleach ( 1 m x 54 inch tana x bana ( 2 / 40 s x 20 s ) reed x pik ( 52 x 54 / inch ) ) , 13.05 pillow cover cloth bleach ( 1 m x 40 inch tana x bana ( 2 / 40 s x 20 s ) reed x pik ( 52 x 54 / inch ) ) , 13.06 chadar rangeen check ( 54 inch x 90 inch tana x bana ( 2 / 40 s x 20 s ) reed x pik ( 52 x 54 / inch ) ) , 13.07 chadar rangeen ( ( name print ) 54 inch x 90 inch tana x bana ( 2 / 40 s x 20 s ) reed x pik ( 52 x 54 / inch ) ) , 13.08 chadar rangeen ( 60 inch x 90 inch tana x bana ( 2 / 40 s x 20 s ) reed x pik ( 52 x 54 / inch ) ) , 13.09 chadar rangeen ( ( name print ) 60 inch x 90 inch tana x bana ( 2 / 40 s x 20 s ) reed x pik ( 52 x 54 / inch ) ) , 13.1 table cloth rangeen ( 54 inch x 48 inch tana x bana ( 2 / 40 s x 20 s ) reed x pik ( 52 x 54 / inch ) ) , 13.11 table cloth rangeen ( 72 inch x 48 inch tana x bana ( 2 / 40 s x 20 s ) reed x pik ( 52 x 54 / inch ) 13.12 curton cloth rangeen ( 1 m x 48 inch tana x bana ( 2 / 20 s x 10 s ) reed x pik ( 36 x 34 / inch ) ) 13.13 curton cloth rangeen design ( 1 m x 48 inch tana x bana ( 2 / 20 s x 10 s ) reed x pik ( 36 x 36 / inch ) ) , 13.14 honeycomb towel bleach ( 54 inch x 27 inch tana x bana ( 2 / 20 s x 10 s ) reed x pik ( 40 x 40 / inch ) ) , 13.15 napkin bleach ( 27 inch x 17 inch tana x bana ( 2 / 20 x 10 s ) reed x pik ( 40 x 40 / inch ) ) , 13.16 do suti bleach ( 1 m x 50 inch tana x bana ( 20 s x 14 s ) reed x pik ( 32 x 32 / inch ) ) 13.17 gaadi pot patta ( 1 m x 45 inch tana x bana ( 2 / 20 s 10 s ) reed x pik ( 36 x 32 / inch ) ) 13.18 basta cloth ( 36 inch x 36 inch tana x bana ( 10 s x 10 s ) reed x pik ( 28 x 26 / inch ) ) , 13.19 basta cloth ( 44 inch x 44 inch tana x bana ( 10 s x 10 s ) reed x pik ( 28 x 26 / inch ) ) , 13.2 patient cloth ( 1 m x 54 inch tana x bana ( 2 / 40 s x 20 s ) reed x pik ( 48 x 52 / inch ) ) 13.21 astar cloth ( 1 m x 54 inch tana x bana ( 2 / 40 s x 20 reed x pik ( 48 x 52 / inch ) ) 13.22 peticote / blauge cloth shuti bleach ( 1 m x 40 inch tana x bana ( 2 / 60 s x 2 / 60 s ) reed x pik ( 60 x 60 / inch ) ) , 13.23 peticote blauge cloth shuti rangeen ( 1 m x 40 inch tana x bana ( 2 / 60 s x 2 / 60 s ) reed x pik ( 60 x 60 / inch ) ) , 13.24 gray duster cloth ( 24 inch x 24 inch tana x bana ( 10 s x 10 s ) reed x pik ( 20 x 24 / inch ) ) , 13.25 gray duster cloth ( 28 inch x 28 inch tana x bana ( 10 s x 10 s ) reed x pik ( 20 x 24 / inch ) ) , 13.26 macchardaani kapda cotten ( 1 m x 53 inch tana x bana ( 2 / 40 s x 20 s ) reed x pik ( 40 x 40 / inch ) 13.27 chadar check rangeen ( 84 inch x 48 inch tana x bana ( 2 / 40 s x 20 s ) reed x pik ( 52 x 54 / inch ) ) , 13.28 chadar check rangeen naam print ( 84 inch x 48 inch tana x bana ( 2 / 40 s x 20 s ) reed x pik ( 52 x 54 / inch ) ) , 13.29 blauze cloth tericat rangeen ( 1 m x 40 inch tana x bana ( 83 / 34d x40 cott. ) reed x pik ( 72 x 72 / inch ) ) , 13.3 tericat shirting cloth ( 1 m x 36 inch tana x bana ( 2 / 60s x 60 p.v. ) reed x pik ( 68 x 64 / inch ) ) , 13.31 tericat shuting ( 1 m x 56 inch tana x bana ( 2 / 30p : vx2 / 30 p:v ) / 65:35 reed x pik ( 60 x 48 / inch ) ) , 13.32 gauze cloth bleach 91cm x 20m tana x bana ( 26 s 26 s ) reed x pik ( 17 x 14 / inch ) , 13.33 bandage cloth bleach 1 m x 20 m tana x bana ( 26 x 26 s ) reed x pik ( 34 x 24 / inch ) , 6 ] 13.34 blazer cloth ( woolen 1 m x 54 inch tana x bana ( 8 n.m. x 8 n.m. ) reed x pik ( 28 x 24 / inch ) ) , 13.35 cotten sharee safed / rangeen ( 46 inch x 5.50m tana x bana 2 / 120sx80s reed pik 80 x 70 72 / inch ) ) , 13.36 tericot sharee rangin ( 46 x 5.50m tana x bana ( 2 / 120sx83 / 34 poly reed x pik ( 72 x80 / inch ) ) , 13.37 razai cloth ( 1 mts x 54 inch tana x bana ( 2 / 40s x 20s ) reed x pik ( 44 x44 / inch ) ) , 13.38 tericot astar cloth ( 1 mts x 54 inch tana x bana ( 2 / 60pv x 155d. ) reed x pik ( 68 x64 / inch ) ) , 13.39 tericat macchardani gray cloth ( 1 mts x 53 inch tana x bana ( 2 / 60pv x 30 p.v. ) reed x pik ( 48 x46 / inch ) 13.4 roll bandage 15 cm x 05 m tana x bana ( 26s x 26s ) reed x pik ( 34x 24 ) , 13.41 roll bandage 10 cm x 05 m tana x bana ( 26s x 26s ) reed x pik ( 34x 24 ) , 13.42 roll bandage 7.5 cm x 05 m tana x bana ( 26s x 26s ) reed x pik ( 34x 24 ) , 13.43 roll bandage 05 cm x 05 m tana x bana ( 26s x 26s ) reed x pik ( 34x 24 ) , ] 13.44 chadar medical bleach ( 54 inch x 90 inch tana x bana ( 2 / 40 s x 20 s ) reed x pik ( 52 x 54 / inch ) ) , 13.45 sodium hypochlorite solution 100 ml bottle 13.46 lignocaine hydrochloride for spinal anaesthesia ( heavy ) ( 0.05 2 ml amp ) , injection 13.47 bupivacaine hcl for spinal anaesthesia ( 0.5% ( heavy ) ) , injection 13.48 medical oxygen steel / aluminium cylinder ( 10 water cap ) with gas specific pin system ( 10 liters ) , inhalation 13.49 flumazenil 0.1 mg / ml 5 ml multiple dose vial 13.5 carbamazepine ( 100 mg / 5 ml 100 ml bottle ) , 13.51 amoxicillin ( 250 mg / vial ) , injection 13.52 amoxicillin + clavulanic acid ( 125 mg + 25 mg ) , injection 13.53 cefixime 10 ml bottle ( 100 mg / 5 ml ) , suspension 13.54 cefpodoxime ( 50 mg ( dt tablet also acceptable ) ) , tablet 13.55 cephalexin dispersible ( 125 mg ) , tablet 13.56 chloramphenicol ( 500 mg ) , capsule 13.57 penicillin v 125 mg 13.58 penicillin v ( phenoxymethyl penicillin potassium ) ( 250 mg ) , tablet 13.59 tinidazole 150 mg / 5 ml ( 60 ml bottle ) , suspension 13.6 diethylcarbamazine ( 50 mg ) , tablet 13.61 epirubicin inj 100mg / vial vial ( each ) , injection 13.62 methotrexate tab ( 5 mg ) , tablet 13.63 levodopa + carbidopa 200 mg + 50 mg 13.64 dobutamine ( 12.5 mg / ml 20 ml vial ) , injection 13.65 fusidic acid 0.02 ( 15 gm ) , cream 13.66 metronidazole 1% ( 15 gm tube ) , ointment 13.67 salicylic acid ( 0.02 30 gm ) , ointment [ 13.68 chlorthalidone ( 50 mg ) , tablet 13.69 torasemide ( 20 mg / 2 ml vial ) , injection 13.7 dicyclomine hydrochloride oral solution 10 mg 30 ml bottle ( 10 mg ) , solution 13.71 doxylamine succinate ( 10 mg ) , tablet 13.72 ondansetron ( 2 mg ) , tablet 13.73 dydrogesterone ( 10 mg ) , tablet 13.74 micronised progestrone ( 200 mg ) , tablet 13.75 cabergoline ( 0.5 mg 4 tablets / strip ) , tablet 13.76 fluconazole eye drop 3 mg / ml ( 10 ml vial ) , eye [ 13.77 gentamycin + hydrocortisone 0.3% + 1% ( 5 ml vial ) , ear drops 13.78 fluconazole 0.3% eye / ear ( 5 ml ) , drop 13.79 cerumenolytic ( for ear wax ) each 10 ml contains paradichlorobenzene 2%benzocaine 2.7%chlorbutol 5%turpentine oil 15% ( 10 ml vial ) , ear drops 13.8 fluphenazine ( 2.5 mg ) , tablet 13.81 fluoxetine ( 10 mg ) , tablet or capsule 13.82 sertraline ( 50 mg ) , tablet 13.83 venlafaxine ( 75 mg ) , capsule 13.84 salbutamol sulphate ( 2 mg ) , tablet 13.85 formaldehyde ( formalin ) 34% acq 450 ml bottle 13.86 sodium hypochlorite ( 0.03 5 ltr ) , solution 13.87 albendazole 100 mg ( tab ) , tablet 13.88 albendazole tab ( 200 mg ) , tablet 13.89 alfacalcidiol capsule ( 0.25 mcg ( soft gelatin capsule also acceptable ) ) , capsule 13.9 amitryptiline tab ( 50 mg ) , tablet 13.91 amitryptiline ( 75 mg ) , tablet 13.92 atorvastatin ( 5 mg ) , tablet 13.93 benzoic acid + salicylic acid ( 6% + 3% ( 15 gm tube ) ) , ointment 13.94 benzoyl peroxide 2.5% 20 gm ( ointment / gel ) , tube 13.95 busulphan ( 2 mg ) , tablet 13.96 capreomycin 1000 mg / vial injection ( 10 ml ) , vial 13.97 chlorambucil ( 2 mg ) , tablet 13.98 ciprofloxacin 125 mg / 5 ml 60 ml bottle ( 125 mg / 5 ml 60 ml bottle ) , suspension 13.99 ciprofloxacin + tinidazole ( 250 mg + 300 mg ) , tablet 14 clindamycin ( 1% w / w 10 gm ) , gel 14.01 clobazam ( 5 mg ) , tablet [ 14.02 clobazam ( 10 mg ) , tablet 14.03 clonazepam 0.25 mg ( tablet ) , tablet 14.04 clonazepam ( 1 mg ) , tablet 14.05 cloxacillin cap ( 250 mg ) , capsule 14.06 cloxacillin ( 250 mg / vial ) , injection 14.07 cloxacillin ( 125 mg / 5 ml 40 ml bottle ) , syrup 14.08 colistin sulphate ( 12.5 mg / 5 ml 30 ml bottle ) , suspension 14.09 crystalline penicillin 5 lakh iu / vial ( vial ) , injection 14.1 cycloserine 250mg ( capsule ) , capsule 14.11 daunorubicin 50 mg / vial vial 14.12 didanosine 250 mg 14.13 didanosine ( 400 mg ) , capsule 14.14 dimercaprol 50 mg / ml ( 2 ml amp ) , injection 14.15 ephedrine 30 mg / ml ( 1 ml amp ) , injection 14.16 estradiol cypionate + medroxy progesterone acetate 5 mg + 25 mg / 0.5 ml 0.5 ml ( ) , injection 14.17 ethacridine lactate 1 mg / ml ( 50 ml ) , infusion 14.18 ethinyl estradiol 0.01 mg 10 tablets 14.19 ethinyl estradiol 0.05 mg 10 tablets 14.2 etoposide ( 50 mg ) , capsule 14.21 fluconazole ( 50 mg ) , tablet 14.22 fluconazole 100 mg [ 14.23 fluconazole ( 200 mg ) , tablet [ 14.24 flunarizine ( 10 mg tab ) , tablet 14.25 human chorionic gonadotropin 2000 iu / ml 1 ml amp 14.26 hydrochlorthiazide ( 12.5 mg ) , tablet 14.27 iron dextran 50 mg / ml ( 2 ml amp ) , injection ] 14.28 levamisole ( 50 mg ) , tablet 14.29 levocetirizine + monteleukast ( ( 2.5 mg + 4 mg ) / 5 ml, 30 ml bottle ) , syrup [ 14.3 lithium carbonate ( sr ) ( 450 mg ) , tablet 14.31 medroxy progesterone acetate ( 150mg / ml 1 ml amp ) , injection 14.32 mesalamine ( 5 aminosalicylic acid ) usp ( 800 mg ) , tablet 14.33 methotrexate ( 7.5 mg ) , tablet 14.34 methylcobalamin inj ( 500 mcg / ml ( 10 ml vial ) ) , injection 14.35 methylcobalamin / mecobalamin ( 500 mcg ) , tablet 14.36 metoclopramide syrup ( 5mg / 5ml ( 30 ml bottle ) ) , syrup 14.37 mirtazapine ( 7.5 mg ) , tablet 14.38 misoprostol 400 mcg ( 4 tablets / strip ) , tablet 14.39 ofloxacin + ornidazole ( 50 mg + 125 mg ) / 5ml 30 ml bottle ( 30 ml ) , suspension 14.4 olanzapine ( 2.5 mg ) , tablet [ 14.41 olanzapine ( 7.5 mg ) , tablet 14.42 omeprazole ( 10 mg ) , capsule 14.43 omeprazole capsule ( 40 mg ) , capsule 14.44 ornidazole tab ( 500 mg ) , tablet 14.45 oxcarbazepine 150 mg 14.46 oxcarbazepine ( 300 mg ) , tablet 14.47 oxcarbazepine ( 600 mg ) , tablet 14.48 pancuronium 2 mg / ml ( 2 ml amp ) , injection 14.49 procaine penicillin 4 lac iu / vial vial ( ) , injection 14.5 ribavirin ( 200 mg ) , tablet capsule 14.51 roxithromycin ( 50 mg / 5 ml 30 ml bottle ) , syrup 14.52 roxithromycin ( 300 mg ) , tablet [ 14.53 secnidazole ( 500 mg tab ) , tablet 14.54 sodium valproate + valproate ( 333 mg + 145 mg ) , tablet 14.55 venlafaxine er / pr ( 37.5 mg ) , tablet or capsule 14.56 venlafaxine ( 150 mg ) , tablet or capsule 14.57 acarbose ( 25 mg ) , tablet 14.58 atenolol ( 25 mg ) , tablet 14.59 cefadroxil 250 mg ( tab ) , tablet 14.6 cefepime ( 250 mg / vial ) , injection 14.61 cefpodoxime tablet 100 mg ( dt tablet also acceptable ) , tablet 14.62 dextrose, d 50 0.5 25 ml ( 25 ml ) , injection [ 14.63 dextrose, d 25 0.25 25 ml ( 25 ml ) , injection 14.64 aceclofenac + paracetamol + chlorzoxazone ( 100 mg + 500 mg + 500 mg ) , tablet 14.65 amisulpride ( 100 mg ) , tablet 14.66 amisulpride ( 50 mg ) , tablet 14.67 amisulpride ( 200 mg ) , tablet 14.68 amitriptyline ( 10 mg ) , tablet 14.69 amoxicillin 100 mg / ml ( 10 ml with dropper ) , drop 14.7 amoxicillin + clavulanic acid ( 200 mg + 28.5 mg ) , tablet 14.71 aripiprazole ( 10 mg ) , tablet 14.72 aripiprazole 15 mg ( tablet ) , tablet 14.73 aripiprazole ( 20 mg tab ) , tablet 14.74 aripiprazole ( 5 mg tab ) , tablet 14.75 atropine + dexamethasone + chloramphenicol 1% + 0.1% + 0.5% ( 5 ml ) , eye drop 14.76 benzathine penicillin ( 24 lac iu / vial vial ) , injection 14.77 bismuth iodoform paraffin paste ( 200 gm jar ) , ointment 14.78 butorphanol tartrate 1mg / ml ( 1 ml ) , injection 14.79 calcitriol cap ( 0.25 mcg ) , tablet 14.8 calcium acetate ( 667 mg ) , tablet 14.81 cefixime + azithromycin 200 mg + 250 mg ( tab ) , tablet 14.82 cefoperazone 1gm / vial vial 14.83 cefotaxime + sulbactam 1000 mg + 500 mg vial ( 1000 mg + 500 mg ) , injection 14.84 ceftriaxone tab ( 250 mg ) , tablet 14.85 cefuroxime 500 mg 10 x 10 ( 500 mg ) , tablet 14.86 cefuroxime 250 mg 10 x 10 ( 250 mg ) , tablet 14.87 cephalexin 100 mg / ml ( 10 ml with dropper ) , drop 14.88 cetrimide + choline salicylate 0.01% + 8% all w / v ( 10 gm tube ) , gel 14.89 chloramphenicol 1% w / w ( 50 / pack ) , eye applicap 14.9 chloraxozone + paracetamol ( 250 mg + 500 mg ) , tablet 14.91 chlordiazepoxide ( 20 mg ) , tablet 14.92 chlordiazepoxide ( 25 mg ) , tablet [ 14.93 chlordiazepoxide ( 10 mg ) , tablet 14.94 cholecalciferol ( 60000 iu ) , tablet 14.95 gel containing choline salicylate + benzalkonium chloride 9% + 0.02% ( 10 gm ) , gel [ 20200913 ] 14.96 clobetasol propionate 0.05% ( 15 gm tube ) , cream [ 14.97 clomiphene citrate ( 100 mg tab ) , tablet 14.98 clomipramine ( 75 mg ) , tablet 14.99 clomipramine 25 mg ( tablet ) , tablet 15 clomipramine ( 50 mg ) , tablet 15.01 clotrimazole ( 1% 100 gm ) , powder [ 15.02 clotrimazole 1% w / v ( 15ml ) , mouth paint 15.03 clotrimazole ( 1% 15 ml ) , lotion 15.04 clotrimazole ( 1% w / w 30 gm ) , powder 15.05 clozapine ( 100 mg ) , tablet 15.06 cyclobenzaprine ( 5 mg ) , tablet [ 15.07 cyclopentolate 1% w / v ( 5 ml ) , eye drop 15.08 cyclosporine 50 mg 15.09 cyclosporine 25 mg 15.1 des venlafaxine ( 50 mg ) , tablet 15.11 des venlafaxine ( 100 mg ) , tablet 15.12 diacerein + glucosamine ( 50 mg + 750 mg ) , capsule 15.13 diazepam ( 10 mg ) , tablet 15.14 diclofenac sodium + paracetamol +serratiopeptidase ( 50 mg +325 mg + 10 mg ) , tablet 15.15 diclofenac+paracetamol+chlorzoxazoe ( 50 mg + 325 mg + 250 mg ) , tablet 15.16 dicyclomine 20mg+paracetamol 325mg ( tab ) , tablet 15.17 disodium acid phosphate + sodium phosphate 10 gm + 8 gm / 100 ml 100 ml ( ) , enema 15.18 divalproex sodium ( 500 mg tab ) , tablet 15.19 divalproex sodium ( 750 mg ) , tablet 15.2 divalproex sodium ( 250 mg ) , tablet 15.21 domperidone ( 1 mg / ml 10 ml with dropper ) , drop 15.22 doxophylline ( 400 mg ) , tablet 15.23 duloxetine ( 40 mg ) , tablet 15.24 duloxetine ( 20 mg ) , tablet 15.25 elemental iron 50 mg / ml 15 ml with dropper ( 15 ml with dropper ) , drop 15.26 elemental iron ( 50 mg / 5 ml ) , syrup 15.27 eltrombopag ( 25 mg ) , tablet 15.28 eplerenone ( 25 mg ) , tablet 15.29 escitalopram ( 5 mg ) , tablet 15.3 escitalopram ( 20 mg ) , tablet 15.31 escitalopram + clonazepam ( 10 mg + 0.5 mg ) , tablet 15.32 esmolol 100 mg / vial ( vial ) , injection 15.33 estradiol 1 mg / gm ( 15 gm tube ) , cream 15.34 estradiol 10 mg / vial ( vial ) , injection 15.35 fluvoxamine ( 50 mg ) , tablet 15.36 fluvoxamine ( 100 mg ) , tablet 15.37 flurbiprofen sodium 0.03% ( 5 ml ) , eye drop 15.38 gabapentine ( 100 mg ) , tablet 15.39 gentamicin + betamethasone 0.3% w / v + 0.1% w / v 5 ml ( ) , eye drop 15.4 gentamycin 40 mg / ml 10 ml vial ( 10 ml vial ) , injection 15.41 glimepiride + metformin hydrocloride sr ( 1 mg + mg ) , tablet 15.42 glycerine + sodium chloride enema ( 15% + 15% 20 30 ml / pack ) , enema 15.43 glycerine suppository usp ( 3 gm bottle / 10 ) , suppository 15.44 glycerine + mag sulphate crystal 250 ml jar 15.45 granisetron 1 mg / ml ( 1 ml amp ) , injection 15.46 haemocoagulase 1 iu / ml 10 ml 15.47 heparin 25000 iu ( 5 ml ) , injection 15.48 homatropine 2% ( 1 ml vial ) , eye drop 15.49 hyaluronidase 1500 iu / 2 ml ( 2 ml amp / vial ) , injection 15.5 ibuprofen ( 200 mg ) , tablet 15.51 icthyol glycerine 1% 30 ml 15.52 intraocular irrigating solution sodium chloride 0.49 % w / v, potassium chloride 0.075 % w / v, calcium chloride 0.048 %, magnesium chloride 0.03 % w / v, sodium acetate 0.39 % w / v, sodium citrate 0.17 % w / v. 500 ml ffs ( ) , infusion 15.53 isoprenaline 2 mg / ml ( 1 ml ) , injection 15.54 lactobacillus 150 million spores ( 1 sachet ) , powder 15.55 lamotrigine dt tab ( 100 mg ) , tablet [ 15.56 lamotrigine dt ( 50 mg ) , tablet 15.57 levetiracetam 500 mg 15.58 levocetirizine + monteleukast ( 5 mg + 10 mg ) , tablet 15.59 magnesium hydroxide + aluminium hydroxide simethecon 250 mg + 250 mg + 50 mg / 5 ml 170 ml bottle ( syrup ) , syrup 15.6 mefenamic acid + dicyclomine tab ( 250 mg + 10 mg ) , tablet 15.61 mefenamic acid + drotaverine hcl ( 250 mg + 80 mg ) , tablet 15.62 metformin + glimepiride ( 500 mg + 2 mg tablet ( sr form also acceptable ) ) , tablet 15.63 methocarbamol 100 mg / ml ( 10ml ) , injection 15.64 methylcobalamin + alpha lipoic acid ( 1500 mcg + 100 mg ) , capsule 15.65 methylcobalamine ( vitamin b12 ) 500 mcg / ml 3 ml 15.66 metoprolol + amlodipin ( 25 mg + 2.5 mg ) , tablet ] 15.67 metoprolol + ramipril ( 25 mg + 2.5 mg ) , tablet 15.68 micronised progesterone ( 400 mg ) , capsule 15.69 micronised progestrone ( 50 mg / ml 4 ml amp ) , injection 15.7 mirtazapine 15 mg ( tablet ) , tablet 15.71 mometasone 0.10% ointment / cream ( mometasone furoate also acceptable ) , ointment [ 15.72 moxifloxacin 0.5% w / v ( 5 ml ) , eye drop 15.73 moxifloxacin + prednisolone 5 mg + 3 mg / 5 ml 5 ml ( ) , eye drop 15.74 moxifloxacine + dexamethasone 0.5% + 0.1% w / v 5 ml ( ) , eye drop 15.75 netilmycin 25 mg / ml 1 ml ( vial ) , injection 15.76 nicorandil ( 5 mg 10 x 10 ) , tablet 15.77 nicotine 2 mg ( 2 mg ) , gum 15.78 nicotine 4 mg ( 4 mg ) , gum 15.79 nicotine 14 mg ( 14 mg ) , transdermal patch 15.8 nicotine ( 2 mg ) , lozenges 15.81 nicotine transdermal patch ( 21 mg ) , transdermal patch 15.82 nicotine transdermal patch ( 7 mg ) , transdermal patch 15.83 nifedipine ( sublingual ) ( 10 mg ) , capsule 15.84 nimesulide +paracetamol ( 100 + 325 mg ) , tablet 15.85 nimesulide +paracetamol+serratiopetidase ( 100 + 325 + 10 mg ) , tablet 15.86 nitrazepam ( 5 mg ) , tablet 15.87 norethisterone enanthate 200 mg / ml ( 1 ml ) , injection 15.88 norfloxacin ( 200 mg ) , tablet [ 15.89 nortriptyline ( 10 mg ) , tablet 15.9 omeprazole + domperidone 20 mg + 10 mg ( capsule ) , capsule 15.91 paracetamol + chlorphenaramine+ phenylephrine ( 250 mg + 2.5 mg + 10 mg ) , tablet 15.92 paracetamol + phenylephrine + chlorpheniramine maleate ( 125mg+2.5 mg+1mg ) / ml ( 15 ml bottle with dropper ) , drop 15.93 paroxetine cr ( 25 mg ) , tablet 15.94 paroxetine cr ( 12.5 mg ) , tablet [ 15.95 petrollium jelly ip ( 500 gm ) , gel 15.96 phenylepherine hcl & tropicamide 5% + 1% 5 ml [ 120566 ] 15.97 piperacillin + tazobactam 2000 mg + 250 mg 20ml vial ( 2000 mg + 250 mg 20ml vial ) , injection 15.98 piperacillin + tazobactam 1000 mg + 125 mg vial 10 ml vial ( ) , injection 15.99 piracetam 200 mg / 15 ml ( 15 ml ) , injection [ 16 pregabalin + methylcobalamin ( 75 mg + 750 mcg ) , tablet or capsule [ 16.01 promethazine ( 50 mg ) , tablet 16.02 proparacaine 0.50% 5 ml / vial 16.03 propranolol ( tab 20 mg ) , tablet 16.04 povidone iodine + metronidazole ( 5 % + 1 % ) , ointment 16.05 providone iodine 1% ( 5 ml ) , eye drop 16.06 pyridostigmine ( 60 mg ) , tablet 16.07 quetiapine ( 200 mg ) , tablet 16.08 quetiapine ( 100 mg ) , tablet 16.09 quetiapine ( 50 mg ) , tablet 16.1 quinine dihydrochloride 150 mg / ml 2 ml ( amp ) , injection 16.11 rabeprazole ( 10 mg ) , capsule 16.12 ranitidine 15 mg / ml ( 100 ml bottle ) , syrup 16.13 risperidone + trihexiphenidyle ( 3 mg + 2 mg ) , tablet 16.14 risperidone + trihexiphenidyle ( 2 mg + 2 mg ) , tablet 16.15 risperidone + trihexiphenidyle ( 4 mg + 2 mg ) , tablet 16.16 rosuvastatin ( 10 mg ) , tablet 16.17 s adenosyl l methionine ( 400 mg ) , tablet 16.18 salbutamol 2.5 mg / 3 ml ( 3ml ) , injection 16.19 serratiopeptidase ( 10 mg ) , tablet 16.2 sertraline ( 100 mg ) , tablet 16.21 silver nitrate ( 500 ml each ) , liquid 16.22 sodium chloride ( ophthalmic ) 5% ( 10 ml ) , eye drop 16.23 sodium hyaluronate ( intraocular ) ( 10 mg / ml 2ml ) , injection 16.24 sodium valporate ( 300 mg ) , tablet 16.25 tamsulosin + dutasteride 0.4 mg + 0.5 mg ( tab ) , tablet 16.26 tannic acid with glycerine ( gum paint ) 80% + 20% 10 ml vial ( 10 ml ) , lotion 16.27 teicoplanin ( 200 mg / vial ) , injection 16.28 tetracycline eye ointment 1% 5 gm 16.29 thalidomide 100 mg 16.3 thiocholchecocide ( 8 mg ) , tablet 16.31 thiocholchecocide ( 4 mg ) , tablet 16.32 thyroxine sodium 25 mcg ( 100 per bottle ) , tablet 16.33 thyroxine sodium ( 75 mcg ) , tablet 16.34 tricholine citrate + sorbitol ( 550 mg + 7.15 g / 10 ml ) , syrup 16.35 trifluoperazine + trihexyphenidyle 5 mg + 2 mg ( tab ) , tablet 16.36 vitamin b12 500 mcg / ml 10 ml vial ( 10 ml vial ) , injection 16.37 vitamin d3 ( cholecalciferol ) ( 400 iu / ml ( 100 ml bottle ) ) , syrup 16.38 vitamin e 200 mg ( capsule 10 x 10 ) , capsule 16.39 vitamin e 50 iu / ml 10 ml ( bottle with dropper ) , drop 16.4 zinc sulphate / gluconate 10 mg elemental zinc / 5 ml ( 10 mg / 5 ml ) , syrup 16.41 zinc sulphate 10 mg elemental zinc / 5 ml ( 200 ml bottle ) , syrup 16.42 bleomycin ( 15 mg / vial vial ) , injection 16.43 hydroxypropyle methyle cellulose opthalmic solution ( 2% 2ml pfs ) , eye drop 16.44 diltiazem 5mg / 1ml ( 5 ml ) , injection 16.45 acamprosate ( 333 mg ) , tablet 16.46 agomelatine ( 25 mg ) , tablet 16.47 aripiprazole ( 30 mg ) , tablet 16.48 atomoxetine ( 10 mg ) , tablet 16.49 atomoxetine ( 25 mg ) , tablet 16.5 baclofen ( 20 mg ) , tablet 16.51 baclofen ( 30 mg tab ) , tablet 16.52 baclofen ( 40 mg tab ) , tablet 16.53 blonanserin ( 2 mg ) , tablet 16.54 blonanserin ( 4 mg ) , tablet 16.55 bupropion ( 150 mg ) , tablet 16.56 buspirone ( 10 mg ) , tablet 16.57 buspirone ( 5 mg ) , tablet 16.58 carbamazepine ( sr ) ( 100 mg ) , tablet 16.59 donepezil ( 10 mg ) , tablet 16.6 duloxetine ( 30 mg ) , tablet 16.61 fluoxetine ( 40 mg ) , capsule 16.62 flupenthixol ( 20 mg / ml 1 ml ) , injection 16.63 haloperidol ( 1.5 mg ) , tablet 16.64 imipramine ( 75 mg ) , tablet 16.65 lithium carbonate ( 400 mg ) , tablet 16.66 memantine ( 10 mg ) , tablet 16.67 methyl phenidate 10 mg ( tab ) , tablet 16.68 methyl phenidate ( 20 mg ) , tablet 16.69 mirtazapine ( 30 mg ) , tablet 16.7 modafinil ( 100 mg ) , tablet 16.71 naltrexone ( 50 mg ) , tablet 16.72 olanzapine ( 10 mg / vial vial ) , injection 16.73 paliperidone 1.5 mg ( tab ) , tablet 16.74 paliperidone ( 3 mg ) , tablet 16.75 procyclidine ( 5 mg ) , tablet 16.76 risperidone ( 4 mg ) , tablet 16.77 sodium valproate ( 100 mg / ml 5 ml ) , injection 16.78 tadalafil 10 mg 16.79 tianeptin 12.5 mg ( tab ) , tablet 16.8 topiramate 25 mg ( tab ) , tablet 16.81 topiramate 50 mg ( tab ) , tablet 16.82 topiramate 100 mg ( tab ) , tablet 16.83 trifluoperazine 5 mg 16.84 vitamin b1 ( thiamine ) 75 mg ( tab ) , tablet 16.85 zonisamide ( 50 mg ) , capsule 16.86 zonisamide 100 mg ( capsule ) , capsule 16.87 urine container 5ml disposable ( 50 per pkt ) 16.88 disposable syringe with needle ( 5ml each ) , needle 16.89 infant feeding tube ( catheter ) size: 3g ( no. ) , consumable 16.9 infant feeding tube ( catheter ) size: 4g 16.91 suction catheter assorted 9 no / each ( each ) , consumable 16.92 suction catheter assorted 10 no / each 16.93 dental x ray film size 31 x 41 mm ( 150 films / pkt ) ( size 31 x 41 mm ) , film 16.94 disposable syringe with needle ( 20ml each ) , needle 16.95 synthetic absorbable suture 3 / 0 with cd cutting needle size : 3 / 0 22mm length 45cm polyglycolic acid ( pga ) ( 12 foils per pkt ) ( needle circle size is 1 / circle ) , needle 16.96 infant feeding tube size: 5g 16.97 adhesive tape 7.5cm x10 ( mtr / roll ) , consumable 16.98 disposable plastic appron ( full size ) , consumable 16.99 hydralazine hydrochloride 20mg / ml injection ( 1 ml amp / vial ) [ 700449 ] 17 glycerine ip solution ( 100ml bottle ) , bottle 17.01 etiophylline +theophylline ( ( 46.5+14 ) mg / 5ml ( 100 ml bottle ) ) , syrup 17.02 disposable surgeon cap ( box of 100 caps ) , consumable 17.03 paediatric epidural set ( 19g needle, metal stylet, 22g catheter, 0.22micron epidural catheter lor syringe ) ( ) , consumable 17.04 oxygen nasal canula ( neonatal ) 7 white colour tubing and threaded nut ( 25 pcs / pkt ) , consumable 17.05 catgut chromic with 1 / 2 cir cutting needle 12mm ( length 70cm no.3 0, 12 foils per pakt ) , consumable 17.06 electrolyte e ( multiple electrolytes and dextrose inj type v ip ) i / v fluid ( each 100ml contains inj dextrose 5g, sod.acetate 0.64g, sod.chloride 0.50g, sodium citrate 0.075g, kcl 0.075g, ccl 0.035g, magnesium chloride 0.031g ) , infusion 17.07 electrolyte g ( multi electrolyte with 5% dextrose iv injection type iv ip ) intravenous fluid ( each 100ml contains: anhydrous dextrose 5 gm, sod.chloride 0.37g, potassium chloride 0.13g, ammonium chloride 0.37g ) , infusion 17.08 cetrimide 15% w / v + chlorhexidine 1.5% w / v ( 1 liter bottle ) , bottle 17.09 human albumin solution i.p. 20%w / v ( 100 ml ffs bottle / glass bottle ) , bottle 17.1 k3 blood vaccutainer ( edta 100 tubes / pkt ) , consumable 17.11 synthetic absorbable suture 2 / 0 with 1 / 2 cir rb needle size:2 / 0 30mm length 90cm polyglycolic acid ( pga ) 12 foils / pkt ( 12 foils per pkt ) , needle 17.12 synthetic absorbable suture 4 / 0 with 1 / 2 cir rb needle size:4 / 0 20mm length 70cm poly glycolic acid ( pga ) ( 12 foils / pkt ) ( size:4 / 0 20mm length 70cm poly glycolic acid ( pga ) ( 12 foils / pkt ) ) , needle 17.13 synthetic absorbable suture 3 / 0 with 1 / 2 cir cutting needle ( size:3 / 0 36mm length 70cm polyglycolic acid ( pga ) 12 foils / pkt ) , needle 17.14 b.b silk with 1 / 2 cir rb needle size:4 / 0 20 mm ( length at least 75 cm, 12 foils per packet ) , needle 17.15 prolene 1 0 rb 1 / 2 circle 30 mm, l 70 cm ( 12 foils / pkt ) , needle 17.16 prolene mesh ( 7.5 x 15 cm ) , needle 17.17 dengue ns 1 elisa ( antigen ) kit ( pack of 96 / as per attached specification in tender ) , consumable 17.18 blood bag 100ml 17.19 blood bag 350ml 17.2 insulin syringe / each ( graduation upto 100 units ) 30 g needle, 40 units / ml ( 30 g needle, 40 units / ml ) , syrings 17.21 silk no 1 cutting needle 1x12 ( 1x12 ) , consumable 17.22 neomycin and sulfacetamide sprinkling powder 5 gm ( each ) , consumable 17.23 distilled water 5 litre ( each ) , consumable 17.24 meropenem 250 mg / vial ( 250mg / vial ) , injection 17.25 ambu bag adult ( silicon ) ( each ) , consumable 17.26 ambu bag child ( silicon ) ( each ) , consumable 17.27 multivitamin with protein 200 ml ( 200 ml ) , syrup 17.28 aprin polyster ( std size ) , consumable 17.29 bed sheet white ( 60 inch x 90 inch ) , consumable 17.3 bed sheet cloured 50 inch x 80 inch 17.31 basta cloth ( 36 inch x 36 inch ) , consumable 17.32 compounder coat / lab tec / xry tec ( std size ) , consumable 17.33 curtain green redymade ( 45 inch x 60 inch ) , consumable 17.34 chair cushion box type ( 18 inch x 18 inch ) , consumable 17.35 chair cushion cover ( 19 inch x 19 inch ) , consumable 17.36 front aprin ( std size ) , consumable 17.37 livirise set female saree white polyster green / blue border [ saree + peticot + blouse ] 5 meter 17.38 livirise set male [ pent and shirt ] std size 17.39 mattress 5kg cotton ( 3 ft x 6 ft ) , consumable 17.4 napkin sup. quality std size 17.41 new born baby kit ( [ 4 piece set ] ) , consumable 17.42 whole sheet 35 inch x 35 inch 17.43 patient suit for male / female ( std size ) , consumable 17.44 pillow cover sup. quality ( 17 inch x 27 inch ) , consumable 17.45 pillow with 2kg cotton ( 16 inch x 26 inch ) , consumable 17.46 turkish towel sup. 25 inch x 50 inch 17.47 wollen saluka / coat for 4th class std size 17.48 chloramphenicol eye ointment 1% ( 4 gram ) , tube 17.49 ketoconazole tab 200mg ( ) , tablet 17.5 bupivacaine hydrochloride 0.25% ( 20 ml vial ) , injection 17.51 ondansetron inj ( 2 mg / ml ) , injection 17.52 vitamin b complex injection ( nfi formula 30ml / vial ) , injection 17.53 norfloxacin + metronidazole suspension 100mg+100mg / 5ml ( 30 ml bottle ) , bottle 17.54 temephos ( 50 % ec 5 litre pack ) , consumable 17.55 paper adhesive microporous surgical tape 3 inch m / roll ( 10 roll / pkt ) ( 3 inch x 5 m / roll ( 10 roll / pkt ) ) , consumable 17.56 hydroxypropyl methylcellulose eye drops ( 2% 5 ml vial ) , eye drop 17.57 alpha beta arteether inj 75 mg / ml 1ml 1ml amp ( ) , injection 17.58 metformin 500mg + gliclazide 80mg tablet ( 10x10 ) , tablet 17.59 aceclofenac 100mg+paracetamol 325mg + serratiopeptidase 10mg tab ( 10x10 ) , tablet 17.6 micronised progesterone ( 100 mg ) , tablet 17.61 disodium hydrogen citrate 1.25gm / 5ml 100 ml ( 100 ml ) , syrup 17.62 cefuroxime 750mg powder for solution for injection ( 750mg ) , injection powder for 17.63 gluteraldehyde solution 2% ( 5 litre can ) , solution 17.64 chlorhexidine gluconate mouthwash 0.2% w / v solution ( 50ml bottle ) , solution 17.65 milk of magnesia + liquid paraffin ( 11.25ml+3.75ml ) / 15ml ( 200 ml bottle ) , syrup 17.66 catgut chromic with 1 / 2 cir rb needle 40 mm length 75cm no. 2 consumable ( each ) , consumable 17.67 multivitamine 100ml syrup ( 100 ml ) , syrup 17.68 multivitamin with zinc drop 15ml ( 15 ml ) , drop 17.69 drotaverine ( 80 mg ) , tablet 17.7 isotonic 18 ltr ( each ) , consumable 17.71 hemolynac 3n 2340 500ml ( each ) , consumable 17.72 split septum transparent closed needles connector with two 10 cm pur extension and one non return valve, consumable 17.73 pe arterial catheter with visualization chamber and anti kinking color 20 g, 8 cm length, consumable 17.74 electrolyte solution a 250ml ( 250ml ) , consumable 17.75 tiotropium 9 mcg + formoterol 6 mcg + ciclesonide 200 mcg pack of 200mdi, inhaler ( 200mdi ) , inhaler 17.76 spinal needle 26 g ( each ) , needle 17.77 cotton khadi dari 3x6 feet 1.4kg per piece 17.78 cotton khadi dari, 4x7 feet, 2.0 kg, per piece 17.79 cotton khadi dari, 4x7 feet, 4.0kg, per piece 17.8 cotton khadi dari, 9x10 feet, 5.0kg, per piece 17.81 cotton khadi dari, 9x12 feet, 6.0kg, per piece 17.82 cotton khadi dari, 10x1.5 feet, 1.2kg, per piece 17.83 cotton khadi dari floor mota per sq. ft 17.84 cotton khadi yoga dari , 2x6 feet, 800gm, per piece 17.85 cotton khadi asana dari, 24x24 inch, per piece 17.86 cotton khadi white bedsheet, 54x90 inch, 500gm, per piece [ kha010 ] 17.87 cotton khadi printed bedsheet, 54x90 inch, 500gm, per piece 17.88 cotton khadi printed bedsheet tiger print, 54x90 inch, 500gm, per piece 17.89 cotton khadi pillow cover, 16x26 inch, per piece 17.9 cotton khadi blanket cover, 54x90 inch, per piece 17.91 cotton khadi pillow, 15x24 inch, 1.0kg, per piece 17.92 cotton khadi matress, 3x6 feet, 5.0kg, per piece 17.93 cotton khadi matress, 3x6 feet, 10.0kg, per piece 17.94 cotton khadi curtain, 2.30mt, per piece 17.95 cotton khadi curtain, 1.75mt, per piece 17.96 cotton khadi bag, 36x36 inch, per piece 17.97 cotton khadi bag, 48x48 inch, per piece 17.98 polyvastra kapda coating, 28 inch, 2 suti, per meter 17.99 polyvastra kapda shirting, 36 inch, 1.5 suti, per meter 18 polyvastra uniform ( pent / shirt / topi ) , 2 suti, per set 18.01 polyvastra uniform ( kurta / payjama / topi ) , 1.5 suti, per set 18.02 polyvastra white sari, 5.50mtr, 1 suti, per piece [ kha026 ] 18.03 polyvastra plane sari colored , 5.50mtr, 1 suti, per piece 18.04 polyvastra blouse, 1.00mtr, 1.5 suti, per piece 18.05 polyvastra peticote, 2.00mtr, 1.5 suti, per piece 18.06 blanket jammu woolen plane, 54x90 inch, 2.200 kg, per piece 18.07 woolen shawl meriono ladies, 40x80 inch, per piece 18.08 woolen coating, 28 inch, per meter 18.09 woolen coating, 54 inch, per meter 18.1 woolen coat, per piece as per measurment 18.11 shoes uniform , per pair as per measurment 18.12 amunation boot, per pair as per measurment 18.13 ankle boot, per pair as per measurment 18.14 ladies sleeper, per pair as per measurment 18.15 leather belt without backaal, per piece as per measurment 18.16 leather belt with backaal , per piece as per measurment 18.17 cream sumag ( ) , cream 18.18 aceclofenac 100mg+paracetamol 325mg tab ( ) , tablet 18.19 h2so4 ( sulphuric acid ) ( 25% 500 ml bottle ) , consumable 18.2 plain vial ( 12 x 75 with screw cap each ) , consumable 18.21 abdominal belt ( 32 inch each ) , consumable 18.22 ecg paper ( chemical coated ) ( 80mmx 20 mtr each ) , consumable 18.23 x ray film fixer ( powder to make 13.5 liters pkt ) , consumable 18.24 x ray film fixer ( powder to make 9 liters pkt ) , consumable 18.25 potassium chloride syrup 200ml ( each ) , syrup 18.26 hematology cell counter reagents lysis solution 500ml ( each ) , solution 18.27 e z cleaner 100ml ( each ) , solution 18.28 rifampicin cap ( 300 mg ) , capsule 18.29 rifampicin cap ( 450 mg ) , capsule 18.3 rifampicin cap ( 600 mg ) , capsule 18.31 diproex er tablet 500mg ( 500mg ) , tablet 18.32 hyoscine butyl bromind 1 mg ( amp ) , injection 18.33 bone wax sterilised ( 2 gm / packet ) , consumable 18.34 i v cannula with inj.valve ( port ) ( size 26g each ) , consumable 18.35 surface and fogging disinfectant stabilised h202, 10 11%w / v with diluted silver nitrate sol. 0.01%w / v ( 5 litre can ) , each 18.36 liquid paraffin 50ml ( bottle ) , consumable 18.37 troponin 1 kit ( 10 test per pack ) , consumable 18.38 serum t3 kit, elisa ( 96 test kit each ) , consumable 18.39 serum t4 kit, elisa ( 96 test kit each ) , consumable 18.4 serum tsh kit, elisa ( 96 / pkt ) , consumable 18.41 silver sulphadiazine cream usp 1% ( 500 gm jar ) , cream 18.42 cannula fixer set ( piece ) , each 18.43 latex examination gloves ( large ) ( 100 / pkt ) ( packet ) , consumable 18.44 latex examination gloves ( medium ) ( 100 / pkt ) ( packet ) , consumable 18.45 latex examination gloves ( small ) ( 100 / pkt ) ( packet ) , consumable 18.46 chromic size 1, 12 foils / pkt ( 1 / 2 cir rb needle 45 mm, length 100 cm ) , needle 18.47 polyamide size 2 / 0, 12 foils / pkt ( 3 / 8 r cutting needle 45 mm, length 70 cm ) , needle 18.48 polyamide size 8 / 0, 12 foils / pkt ( 3 / 8 cir micro point spatulated 6 mm, length 38 cm ) , consumable 18.49 chromic ( 12 foils / pkt ) ( 3 / 8 rb needle 30 mm, length 76 cm, size 2 / 0 ) , needle 18.5 polyglycolic acid absorbable surgical suture ( 12 foils / pkt ) ( 1 / 2 cir rb needle 40 mm, length 90 cm size 2 / 0 ) , needle 18.51 polyglycolic acid absorbable surgical suture ( 12 foils / pkt ) ( 1 / 2 cir rb needle 20 mm, length 70 cm size 3 / 0 ) , needle 18.52 tracheostomy tube ( pvc ) sterile single use ( adult ) ( size 7 each piece soft flexible flange at for each fixation 15 mm connector at terminal end which can be rotated in 360 degree direction nonirritant, each ) , tube 18.53 tracheostomy tube ( pvc ) sterile single use ( adult ) ( size 8 each piece soft flexible flange at for each fixation 15 mm connector at terminal end which can be rotated in 360 degree direction nonirritant, each ) , tube 18.54 tracheostomy tube ( pvc ) sterile single use ( adult ) ( size 4 each piece soft flexible flange at for each fixation 15 mm connector at terminal end which can be rotated in 360 degree direction nonirritant ) , tube 18.55 tracheostomy tube ( pvc ) sterile single use ( adult ) ( size 5 each piece soft flexible flange at for each fixation 15 mm connector at terminal end which can be rotated in 360 degree direction nonirritant ) , tube 18.56 urinary drainage bag ( paediatric ) ( 100 ml / pc, each ) , consumable 18.57 close wound drainage device under negative pressure ( closed wound suction unit ) size 200 ml ( catheter size 16, each ) , consumable 18.58 close wound drainage device under negative pressure ( closed wound suction unit ) size 200 ml ( catheter size 18, each ) , consumable18.59 polyamide size 1 / 0, 12 foils / pkt ( 3 / 8 r cutting needle 45 mm, length 70 cm ) , needle 18.6 polypropylene size 1, ( 12 foils / pkt ) ( 1 / 2 cir rb needle 45 mm, length 90 cm ) , needle 18.61 chromic size 1 / 0 ( 12 foils / pkt ) ( 3 / 8 cir rb needle 40 mm, suture length 76 cm ) , needle 18.62 chromic size 1, ( 12 foils / pkt ) ( 1 / 2 cir rb needle 40 mm, length 76 cm ) , needle 18.63 human albumin 20% ( 50 ml vial ffs glass bottle ) , bottle 18.64 temozolomide ( 20 mg ) , capsule 18.65 ambu bag / resuscitator silicon 200 250 ml infant size each, with oxygen connecting tube , should be supplied with a carry pouch , ambu bag should be complete with required autoclavable valves and other accessories, ( should have silicon rubber bellow to withstand autoclave at 134 deg.c ) should be multiple times autoclavable ) , consumable 18.66 ldh kit pack ( 50 ml bottle ) , consumable 18.67 neubauers chamber ( each ) , consumable 18.68 biomedical waste collection plastic bag ( yellow ) ( as per attached detail specifications ) ( 450x450 mm 55 micron 100 / pkt ) , consumable 18.69 aso kit ( 25 test / packet ) , consumable 18.7 ambu bag ( silicon type ) paediatrics each 1400 1700 ml with oxygen connecting tube , should be supplied with a carry pouch , ambu bag should be complete with required autoclavable valves and other accessories, ( should have silicon rubber bellow to withstand autoclave at 134 deg.c ) , consumable 18.71 ambu bag / adult each 1700ml, with oxygen connecting tube , should be supplied with a carry pouch , ambu bag should be complete with required autoclavable valves and other accessories, ( should have silicon rubber bellow to withstand autoclave at 134 deg.c ) , consumable 18.72 draw sheet ( each ) , consumable 18.73 urine ( multi stripe ) , consumable 18.74 voglibose ( 0.3mg ( mouth dissolving tablet also acceptable ) ) , tablet 18.75 clotrimazole + lignocaine ear drop 1% ( 5ml vial ) , drop 18.76 diphenhydramine syrup ( 12.5mg / 5ml ( 100 ml bottle ) ) , syrup 18.77 ondansetron ( drops ) syrup ( 2mg / 5ml ( 10 ml bottle ) ) , syrup 18.78 paracetamol oral drops ( 100 mg / ml ( 15 ml bottle with dropper ) ) , drop 18.79 gentamicin inj ( 80 mg / ml ( 2 ml amp ) ) , injection 18.8 multivitamin syrup 60 ml ( each 5ml contains vitamin a ( palmitate ) ip 1600 iu+vitamin d3 ip 200 iu ( +vitamin b2 ip 1.00mg+vitamin b6 ip 0.50mg+niacinamide ip 15.00mg+d panthenol ip 1.00mg ( 20% variability in strength or with additional contents acceptable ) ) , syrup 18.81 diclofenac + seratopeptidase ( 50mg + 10mg ) , tablet 18.82 vitamin d3 drop 10ml ( cholecalciferol 400 iu ) ( 10 ml drop ) , drop 18.83 aceclofenac 100mg+paracetamol 325mg+chlorzoxazone 250mg tab ( 250mg ) , tablet 18.84 glutaraldehyde solution 2% in 5 litre can ( 2 strips / vials per each can ) ( 5 litre can ) , consumable 18.85 acyclovir 5% ( 5gm ) , ointment or cream 18.86 biomedical waste collection plstic bag ( black 750 x 900 mm 55 micron 100 / pkt ) , bag 18.87 biomedical waste collection plstic bag ( black 900 x 900 mm 55 micron 100 / pkt ) , bag 18.88 biomedical waste collection plstic bag ( blue 750 x 900 mm 55 micron 100 / pkt ) , bag 18.89 biomedical waste collection plstic bag ( blue 900 x 900 mm 55 micron 100 / pkt ) , bag 18.9 biomedical waste collection plstic bag ( red 750 x 900 mm 55 micron 100 / pkt ) , bag 18.91 biomedical waste collection plstic bag ( red 900 x 900 mm 55 micron 100 / pkt ) , bag 18.92 biomedical waste collection plstic bag ( yellow 750 x 900 mm 55 micron 100 / pkt ) , bag 18.93 biomedical waste collection plstic bag ( yellow 900 x 900 mm 55 micron 100 / pkt ) , bag 18.94 glucometer strips 1 should be able to use capillary blood samples 2 should have expiry as printed on the label of the supplied box ( 3 all strips should have at least one year expiry date from the date of supply 1 glucometer free with each 1 thousand strips rate should be quoted for 50 strip / packet ) , consumable 18.95 endotracheal tubes size 5 cuffed should have low pressure high volume cuff and radio opaque blue ( 25 each ) , consumable 18.96 endotracheal tubes size 5.5 cuffed should have low pressure high volume cuff and radio opaque blue ( 25 each ) , combi blister pack 18.97 endotracheal tubes size 6 cuffed should have low pressure high volume cuff and radio opaque blue ( 25 each ) , consumable 18.98 endotracheal tubes size 6.5 cuffed should have low pressure high volume cuff and radio opaque blue ( 25 each ) , consumable 18.99 endotracheal tubes size 7 cuffed should have low pressure high volume cuff and radio opaque blue ( 25 each ) , consumable 19 endotracheal tubes size 7.5 cuffed should have low pressure high volume cuff and radio opaque blue ( 25 each ) , consumable 19.01 endotracheal tubes size 8 cuffed should have low pressure high volume cuff and radio opaque blue ( 25 each ) , consumable 19.02 endotracheal tubes size 8.5 cuffed should have low pressure high volume cuff and radio opaque blue ( 25 each ) , consumable [ 700627 ] 19.03 endotracheal tubes size 9 cuffed should have low pressure high volume cuff and radio opaque blue ( 25 each ) , consumable 19.04 foleys catheter size 12 2 way ( 10 each ) , consumable 19.05 foleys catheter size 16 2 way ( 11 each ) , consumable 19.06 foleys catheter size 20 2 way ( 12 each ) , consumable 19.07 foleys catheter size 22 2 way ( 13 each ) , consumable 19.08 foleys catheter size 24 2 way ( 14 each ) , consumable [ 700633 ] 19.09 post operative bag with window size 70 mm ( 1 each ) , consumable [ 700634 ] 19.1 post operative bag with window size 100 mm ( 1 each ) , consumable 19.11 cresent knife ( 1 each ) , consumable 19.12 lenstip ( 1 each ) , consumable 19.13 sodium chloride 0.3% iv 100ml ( 1 each ) , injection 19.14 imipenem 250mg+cilastatin 250mg powder for solution ( 1 each ) , injection powder for 19.15 terlipressine inj. 1mg / 10ml vial ( 1 each ) , injection 19.16 clindamycin 300 mg / ml inj ( 1 each ) , injection 19.17 anti h sera 10 ml vial ( each ) , consumable 19.18 anti d sera igg+igm 10ml vial ( each ) , consumable 19.19 anti ab sera igm 5 ml vial ( each ) , consumable 19.2 anti a1 lection sera5 ml vial ( each ) , consumable 19.21 albumin 100 ml bottle ( each ) , consumable 19.22 coombs reagent 5 ml bottle ( each ) , consumable 19.23 hba ag elisa 96 kit 1x96 ( each ) , consumable 19.24 hba ag rapid card test ( each ) , consumable 19.25 microtips ( 2 200 ul ) 1x1000 ( each ) , consumable 19.26 test tube medium ( 12x100 ) 100eack / pkt ( each ) , consumable 19.27 dionised water 5 ltr cane ( each ) , consumable19.28 double blood bag 450 ml cpda ( each ) , consumable 19.29 quadraple blood bag 450 ml sagm ( each ) , consumable 19.3 triple blood bag 450 ml ( cpda ) ( each ) , consumable 19.31 transfer bag ( each ) , consumable 19.32 tissue paper roll ( each ) , consumable 19.33 plain disposable vial 3ml ( each ) , consumable 19.34 edta vaccutainer 3 ml + needle ( each ) , consumable 19.35 v.p shunt high pressure ( venticular peritonial shunt, ( venticular catheter 15cm length, 1 distilled catheter 75 l, struit stylet ) ( each ) , consumable 19.36 v.p shunt medium pressure ( venticular peritonial shunt, ( venticular catheter 15cm length, 1 distilled catheter 75 l, struit stylet ) ( each ) , consumable 19.37 balanced salt solution 500 ml bottle ( each ) , consumable 19.38 hydroethyl starch 6% solution with sodium chloride 0.9% 500 ml bottle ( each ) , consumable 19.39 pyrazinamide 750mg tablet ( 10x10 ) , tablet 19.4 folic acid tab ( 400 mcg ) , tablet 19.41 ofloxacin infusion ( 2mg / 1ml ( 100ml ffs bottle ) ) , bottle 19.42 ketamine hydrochloride ( 50mg / ml ( 10 ml vial ) ) , injection 19.43 chromic catgut suture ( 12 foils / pkt ) ( 3 / 8 cir r cutting needle 19 mm needle, suture length 76 cm size 4 / 0 ) , needle 19.44 endotracheal tube, soft cuff towards the distal end kink resistant inflation tube murphy eye at distal end with polished smoothness standard 15 mm connector sterile, single use curved shaped blister pack suiting the shape of product ( size 4 , each ) , tube 19.45 endotracheal tube, soft cuff towards the distal end kink resistant inflation tube murphy eye at distal end with polished smoothness standard 15 mm connector sterile, single use curved shaped blister pack suiting the shape of product ( size 3 ) , tube 19.46 b.b silk size 3 / 0 ( 12 foils / pkt ) ( 3 / 8cir rcut needle 26mm length 76 cm ) , needle 19.47 polypropylene size 2 / 0 ( 12 foils / pkt ) ( 1 / 2 cir rb needle 25mm, length 45 cm ) , needle 19.48 ampicillin syrup ( 125 mg / 5 ml 30 ml bottle ) , syrup 19.49 cefadroxil syrup ( 125 mg / 5 ml 30 ml bottle ) , syrup 19.5 methyline blue ( 100 ml ) , solution 19.51 pop bandage ( 6 inch ) , consumable 19.52 pop bandage ( 4 inch ) , consumable 19.53 x ray cassets ( 6.5x8.5 ) , consumable 19.54 x ray cassets ( 8x10 ) , consumable 19.55 x ray hangers ( 6.5x8.5 ) , consumable 19.56 x ray hangers ( 8x10 ) , consumable 19.57 x ray hangers ( 10x12 ) , consumable 19.58 x ray hangers ( 12x15 ) , consumable 19.59 blood bag with acd / cpd solution ( disposable sterilised ) with needle ( 100 ml ) , bag 19.6 blood bag with acd / cpd solution ( disposable sterilised ) with needle ( 350 ml ) , bag 19.61 foldable iol sterile lens pc+14d ( lens 2 ) , pc+16d ( lens 3 ) , pc+18d ( lens 5 ) , pc+19d ( lens 5 ) , pc+19.5d ( lens 5 ) , pc+20d ( lens 15 ) , pc+20.5 ( lens 15 ) , pc+21d ( lens 13 ) , pc+21.5d ( lens 10 ) , pc+22d ( lens 10 ) , pc+22.5d ( lens 5 ) , pc+23d ( lens 5 ) , pc+24d ( lens 3 ) , pc+26d ( lens 2 ) ( ( one box should contain 100 pieces as per specification of power given ) , lens ( attached specification ( 100 lens per box ) ) , consumable 19.62 erythromycin ( as estolate ) ( 125mg / 5ml, 60ml bottle ) , suspension 19.63 abdominal belt ( 36 inch each ) , consumable 19.64 abdominal belt ( 38 inch each ) , consumable 19.65 abdominal belt ( 34 inch each ) , consumable 19.66 dengu card antigen ( 25 card / pkt ) , consumable 19.67 povidone iodine solution 5% ( 500 ml ) , bottle 19.68 total parenteral nutrition ( including carbohydrate + proteins + fats solution 2000 ml ) , infusion 19.69 pregnancy test card ( 10 card pack ) , consumable 19.7 glucose pouch ( 100 gram pack ( mfg bhandari products ) ) , consumable 19.71 brain thromboplastin ( 5ml bottle ) , consumable 19.72 swab stick with tube sterile ( 70 80 mm length 10 15 mm diameter ) , unit 1 ( 100 / pkt , packet ) , consumable 19.73 blood grouping anti sera a monoclonal ( 10 ml vial ) , consumable 19.74 blood grouping anti sera b monoclonal ( 10 ml vial ) , consumable 19.75 blood grouping anti sera d monoclonal ( 10 ml vial ( mfg tulip diagnostics ) ) , consumable 19.76 safranine ( gram stain ) ( 500 ml bottle ( mfgsunlabs ) ) , consumable 19.77 anti a sera igm ( 10 vial ) , consumable 19.78 anti b sera igm ( 10 vial ) , consumable 19.79 bovine albumin ( each ) , consumable 19.8 coombs ahg sera 5ml ( each ) , consumable 19.81 flow regulator ( dial flow ) ( each ) , consumable 19.82 l alanyl l glutamine solution for infusion ( 20%w / v ) ( each ) , consumable 19.83 disinfectant with stabilizer by 0.01%w / v agn03 and h2p04 ( each ) , consumable 19.84 insulin syringe ( each ) , consumable 19.85 disposable sterile hypodermic syringe 10ml ( each ) , consumable 19.86 iv mannitol ( 100 ml ) , injection 19.87 human normal immunoglobin ( 5gm / 100ml ) , injection 19.88 iv cannula with inj valve ( 20g ) , consumable 19.89 iv cannula with inj valve ( 18g ) , consumable 19.9 sevoflurane 20cc ( each ) , consumable 19.91 patch buprenorphine ( 10mcg ) , consumable 19.92 patch buprenorphine ( 20mcg ) , consumable 19.93 propofol 1% ( 10ml / 5ml 20ml ) , injection 19.94 intravenous immuglobin ( ivig ) ( each ) , injection 19.95 sodium thiopentone ( 500mg ) , injection powder for 19.96 ranibizumab inj ( 10ml / mg ) , injection 19.97 trastuzumav inj ( 440mg ) , injection 19.98 ibandronic acid inj ( 6mg ) , injection 19.99 everolimus tab 10mg ( 4x7 ) , tablet 20 cell pack for 5 part hematology analyser ( model : sysmex xs 800i ( japan ) ) ( pack size 20000 ml ) , consumable 20.01 stromatolyser 4dl for 5 part hematology analyser ( model : sysmex xs 800i ( japan ) ) ( pack size 5000 ml ) , consumable 20.02 sstromatolyser 4ds for 5 part hematology analyser ( model : sysmex xs 800i ( japan ) ) ( pack size 126 ml ) , consumable 20.03 sulfolyser for 5 part hematology analyser ( model : sysmex xs 800i ( japan ) ) ( pack size 5000 ml ) , consumable 20.04 cell clean for 5 part hematology analyser ( model : sysmex xs 800i ( japan ) ) ( pack size 50 ml ) , consumable 20.05 isotonac 3000 pack size 18 l ( cell counter ( model no mek 6420p japan ) ) , consumable 20.06 hemolynac 3n 2340 pack size 500 ml ( cell counter ( model no mek 6420p japan ) ) , consumable 20.07 cleanac 4000 pack size 5l ( cell counter ( model no mek 6420p japan ) ) , consumable 20.08 cleanac 3 4000 pack size 5l ( cell counter ( model no mek 6420p japan ) ) , consumable 20.09 albumin ( mfg pathogyme diagnostics ) ( 200 ml ( 4 x 50 ml ) ) , consumable 20.1 barium chloride 10% ( mfg precious life care pvt ltd ) ( 500 ml bottle ) , consumable 20.11 basic carbol fuchsin for afb staining ( mfg precious life care pvt ltd ) ( 25 gram / packet ) , consumable 20.12 crp test kit ( latex / card ) , kit of 25 tests ( 25 test / kit ) , consumable 20.13 field stain a ( mfg precious life care pvt ltd ) ( 500 ml bottle ) , consumable 20.14 field stain b ( mfg precious life care pvt ltd ) ( 500 ml bottle ) , consumable 20.15 fouchets reagent ( mfg precious life care pvt ltd ) ( 100 ml bottle ) , consumable 20.16 g6pd deficiency test kit ( mfg pathogyme diagnostics ) ( 10 test / kit ) , consumable 20.17 gram iodine ( gram stain ) ( mfg precious life care pvt ltd ) ( 100 ml bottle ) , consumable 20.18 leishman stain ( mfg precious life care pvt ltd ) ( 500 ml bottle ) , consumable [ 700732 ] 20.19 methyl blue for ( z n ) ( mfg precious life care pvt ltd ) ( 125 ml bottle ) , consumable 20.2 platelet dilution fluid ( mfg precious life care pvt ltd ) ( 100 ml ) , consumable 20.21 rbc dialuation fluid ( 500 ml bottle ) , consumable [ mis98 ] 20.22 serum creatinine ( 100 ml bottle ( 2 x 50 ml ) ) ( consumable ) , consumable 20.23 sgot ( 25 ml ) , consumable 20.24 sodium citrate 3.8% ( mfg precious life care pvt ltd ) ( 500 ml bottle ) , consumable 20.25 trisodium citrate 3.8% ( mfg precious life care pvt ltd ) ( 500 ml bottle ) , consumable 20.26 uric acid ( mfg pathogyme diagnostics ) ( 50 ml ( 2 x 25 ml ) ) , consumable [ 700739 ] 20.27 usg gel ( 250 ml bottle ) , consumable 20.28 wbc dialuation fluid ( mfg precious life care pvt ltd ) ( 500 ml bottle ) , consumable 20.29 foleys urinary catheter 2 way ( size 22 each ) , consumable 20.3 suction catheter, sterile ( size fg 20 ( disposable, sterile each ) ) , consumable 20.31 suction catheter, sterile ( size fg 22 ( disposable, sterile each ) ) , consumable 20.32 suction catheter, sterile ( size fg 6 ( disposable, sterile each ) ) , consumable 20.33 corrugated drainage sheet, sterile, multichannel, single use ( 2 inch x 6 inch ( pvc ) piece ) , consumable 20.34 infant feeding tube ( 10 g each piece, each ) , consumable 20.35 infant feeding tube ( 7g each piece, each ) , consumable 20.36 ryles tube ( size 14 each piece ) , consumable 20.37 cyanemeth solution for hb ( mfg by beacon diagnostic ) ( 5 lit can ) , consumable 20.38 edta solutions k3 ( 500 ml bottle ) ( bottle ) , consumable 20.39 total protein ( mfg by beacon diagnostic ) ( 100 ml ) , consumable 20.4 vdrl kit ( strip ) ( mfg by alere ) ( 50 test / kit ) , consumable 20.41 serum amylase ( 100 ml ) , consumable 20.42 ra factor rapid kit 1 ) should be based on latex agglutination slide test 2 ) qualitative and semi quantative testing facility possible 3 ) test speed must be less than 2 minutes ( 25 test / kit ) , consumable 20.43 leuprolide depot inj ( 3.75mg ) , injection 20.44 linazolid ( 300ml ) , injection 20.45 moxifloxacin ( 100ml ) , injection 20.46 ofloxacin+ metronidazole ( 30ml ) , syrup 20.47 amphotericin b inj ip ( 50 mg ) , injection 20.48 colistinethate sodium inj bp ( 1 million iu ) , injection 20.49 permethrin 5% ( 30 gm ) , cream 20.5 n s 3% hypotonic ( 100ml ) , injection 20.51 pilocarpine nitrate inj. ip 0.5 % w / v ( 1 ml ) , injection 20.52 carboxymethyl cellulose 0.5% eye drop ( 5 ml ) , eye drop 20.53 hydroxyethylstarch 3% ( 500 ml ) , injection 20.54 dialysis starting kit disposable:a ) sterile tray with top ( disposable ) , size not less than 30x30cm b ) sterile drape size not less than 45x45 cm 1no c ) cotton ball 6 no d ) ( d ) cotton gauze pieces 1, e ) artery forceps 1 no ( disposable ) ) , consumable 20.55 tourniquet with belt ( mfg by precious life care pvt ltd ) ( good quality pairs ) , consumable 20.56 medical nitrous oxide gas in jambo size cylinder ( d type ) , miscellaneous 20.57 medical nitrous oxide gas in medium size cylinder ( b type ) , miscellaneous 20.58 medical nitrous oxide gas in small size cylinder ( a type ) , miscellaneous 20.59 medical oxygen gas ip in jambo size cylinder ( d type ) , consumable 20.6 medical oxygen gas ip in medium size cylinder ( b type ) , miscellaneous 20.61 medical oxygen gas ip in small size cylinder ( a type ) , miscellaneous 20.62 carbondioxide gas in medium size cylinder ( b type ) , miscellaneous 20.63 carbondioxide gas in small size cylinder ( a type ) , miscellaneous 20.64 amlodipine ( 10mg ) , tablet 20.65 erythomycin stearate ( 250mg ) , tablet 20.66 intravenous fat emulsion 20% w / v ( 20% w / v ) , bottle 20.67 sevoflurane usp inhalation anesthetic 250 ml ( 250 ml ) , bottle 20.68 dexmedetomidine hydrochloride injection 1ml amp ( 1 ml amp ) , ampule 20.69 co trimoxazole oral suspension ip ( 5 ml each trimethoprim 40 mg sulphamethoxazole 200 mg ) , bottle 20.7 fistula sterilized twin needle ( 16 g ( two needle pack ) ) , consumable 20.71 a v fistula sterilized twin needle ( 17 g ( two needle pack ) ) , consumable 20.72 a v blood lines with av pressure transducer ( acceptable for fitting to all standard dialyzers ) with side tubing ( for heparinization and av pressure monitoring ) ce and iso certificate essential with protector for all machines types and dialysers ( post pump tubing sets options medical grade clear tubing guarded access ports for reduced infection risks parts of superior quality, each ) , consumable 20.73 protien ( total ) mfg by ba 400 biosystems diagnostics pvt ltd ( 600 ml ) , consumable 20.74 protien ( urine ) ba 400 biosystems diagnostics pvt ltd ( 240 ml ) , consumable 20.75 creatinine mfg by ba 400 biosystems diagnostics pvt ltd ( 600 ml ) , consumable 20.76 protein ( total ) 600 ml ( model ba 400 system ( mfg bybio system ) ) , consumable 20.77 creatinine 600 ml ( model ba 400 system ( mfg bybio system ) ) , consumable 20.78 glucose 600 ml ( model ba 400 system ( mfg bybio system ) ) , consumable 20.79 cholesterol 600 ml ( model ba 400 system ( mfg bybio system ) ) , consumable 20.8 bilirubin ( total ) 600 ml ( model ba 400 system ( mfg bybio system ) ) , consumable 20.81 urea / bun � uv 600 ml ( model ba 400 system ( mfg bybio system ) ) , consumable 20.82 uric acid 600 ml ( model ba 400 system ( mfg bybio system ) ) , consumable 20.83 triglyceride 600 ml ( model ba 400 system ( mfg bybio system ) ) , consumable 20.84 ast / got 600 ml ( model ba 400 system ( mfg bybio system ) ) , consumable 20.85 alt / gpt 600 ml ( model ba 400 system ( mfg bybio system ) ) , consumable 20.86 albumin 600 ml ( model ba 400 system ( mfg bybio system ) ) , consumable 20.87 calcium arsenazo 600 ml ( model ba 400 system ( mfg bybio system ) ) , consumable 20.88 cholesterol hdl direct 160 ml ( model ba 400 system ( mfg bybio system ) ) , consumable 20.89 alkaline phosphatase ( alp ) dea 300 ml ( model ba 400 system ( mfg bybio system ) ) , consumable 20.9 bilirubin ( direct ) as 300 ml ( model ba 400 system ( mfg bybio system ) ) , consumable 20.91 conc washing solution 500 ml ( model ba 400 system ( mfg bybio system ) ) , consumable 20.92 reaction rotor 10 pc ( model ba 400 system ( mfg bybio system ) ) , consumable 20.93 bilirubin standard 1x5 ml ( model ba 400 system ( mfg bybio system ) ) , consumable 20.94 biochemistry calibrator 5x5 ml ( model ba 400 system ( mfg bybio system ) ) , consumable 20.95 hdl / ldl standard 1x1 ml ( model ba 400 system ( mfg bybio system ) ) , consumable 20.96 biochemistry control serum l1 5x5 ml ( model ba 400 system ( mfg bybio system ) ) , consumable 20.97 biochemistry control serum l2 5x5 ml ( model ba 400 system ( mfg bybio system ) ) , consumable 20.98 sodium chloride 0.45% + dextrose 5% ( 500 ml ffs bottle ) , injection 20.99 femoral catheters single lumen set adult ( size 6f to 8f, length 13 cm to 15 cm, each ) , consumable 21 femoral catheters single lumen set pediatric ( size 3f to 4f, length 13 cm to 15 cm or less ) , consumable 21.01 calcium phosphate ( 2 : 1 ratio ( 100 ml bottle ) ) , syrup ( each 5 ml contains : calcium 82 mg + vitamin d3 ( cholecalciferol ) 200 iu + vitamin b12 ( cynocobalamin ) 2.5 mcg ) , syrup 21.02 imatinib cap / tab ( 100 mg ) , tablet or capsule 21.03 tamsulosin ( 0.4mg ) , tablet 21.04 sterilant cold disinfectant for dialysis containing peracetic acid hydrogen peroxide acetic acid ( 5 ltr can ) , consumable 21.05 sterilant hot disinfectant for dialysis containing 21% ( approx ) citric acid, malic acid, lactic acid ( 5 ltr can ) , consumable 21.06 hemodialysis powder for bicarb made ( part a powder to make 10 ltr + part b 500gm 2 / pkt ) , consumable 21.07 adult double lumen catheter set ( size: 11.5 fr 12 fr, 13cm to 15cm ( straight ) ) , consumable 21.08 adult double lumen catheter set ( size: 11.5 fr 12 fr, 13cm to 15cm ( curved ) ) , consumable 21.09 femoral guide wires : straight / j tip ( ( 0.325 mm size ) sterile: ce / iso13485 marked ) , consumable 21.1 electrolyte m ( multi electrolyte with 5% dextrose injection type iii ip ) i / v fluid each 100ml contains: ( anhydrous dextrose 5g; sodium acetate trihydrate ) ( 500 ml ffs bottle ) , injection 21.11 disposable pricking lancet ( mfg by precious life care ) ( pkt of 200 units ) , consumable 21.12 echo jelly 250 ml ( mfg by precious life care ) , bottle 21.13 hub cutter non electric lockable safety portable box for disposal of hypodermic needles ( cuts the needle from the hub of machine ) , each 21.14 disposable sharp collection containers ( 1.5 l mfg by precious life care ) , each 21.15 disposable sharp collection containers ( 5 l ( mfg by precious life care ) ) , each 21.16 ecg jelly 250 gms bottle ( mfg by precious life care ) , bottle 21.17 umbical cord clamps plastic material ( box of 100 clamps ) ( mfg by precious life care ) , consumable 21.18 rib belt large ( each ) , each 21.19 rib belt medium ( each ) , each 21.2 rib belt small ( each ) , each 21.21 diagnostic strips for urine sugar / albmin packing: amber colored, 100 strips / pkt ( packet ) , consumable 21.22 nitrofruantoin ( 100mg ) , tablet capsule 21.23 biphasic isophane insulin ( 30 / 70 100iu / ml ( 10 ml vial ) ) , injection 21.24 surface disinfectant 10 minute aldehyde free disinfectant containing potassium mono per sulphate powder ( 5 kg packet ( mfg by zenith chemicals allied industries ) ) , consumable 21.25 iron ferrous sulphate folic acid 100ml ( each 5ml contains ferrous sulphate i.p equivalent to elementary iron 100mg folic acid i.p 0.5mg ) , syrup 21.26 hypodermic needles for single use bis gauze ( 23 length, 25 mm + 1 ) , needle 21.27 bcg ( 1 ml each ) , syrings 21.28 disposable ( 24 g each ) , needle 21.29 reuse prevention syringe sterile single use reuse prevention syringe with fixed / detachable needles complaint to iso 7886:4 type i and b, flow wrap / blister pkg using medical grade breathable paper, eto sterilized. ( 10 ml ) , syrings 21.3 disposable needles is 10654:2002 ( 23g ) , needle 21.31 short iv catheter with straight / j tip guidewire ( l 4, fr 2, g 22 ) , consumable [ mis109 ] 21.32 disposable syringe ( for vitamin k inj ) ( 1ml with needle 26g ) , consumable 21.33 reuse prevention syringe sterile single use reuse prevention syringe with fixed / detachable needles complaint to iso 7886:4 type i, b, flow wrap / blister pack using medical grade breathable paper, eto sterilized ( 5ml ) , syrings [ 700846 ] 21.34 reuse prevention syringe sterile single use reuse prevention syringe with fixed / detachable needles complaint to iso 7886:4 type i, b, flow wrap / blister pack using medical grade breathable paper, eto sterilized ( 3ml ) , syrings 21.35 reuse prevention syringe sterile single use reuse prevention syringe with fixed / detachable needles complaint to iso 7886:4 type i, b, flow wrap / blister pack using medical grade breathable paper, eto sterilized ( 2ml ) , syrings 21.36 latex based baloon capacity ( 30 50ml ) foleys catheter ( size 14 2 way each ) , consumable 21.37 latex based baloon capacity ( 30 50ml ) foleys catheter ( size 18 2 way, each ) , consumable 21.38 latex based baloon capacity ( 30 50ml ) foleys catheter ( size 16 2 way each ) , consumable 21.39 latex based baloon capacity ( 3ml ) foleys urinary catheter peadiatrics ( 2 way size 8, each ) , consumable 21.4 latex based baloon capacity ( 3ml ) foleys urinary catheter peadiatrics ( size 10 , each ) , consumable 21.41 sgpt100 ml ( 4 x 25 ) , consumable 21.42 alkaline phosphate ( 100 ml ( 5 x 20 ) ) , consumable 21.43 reagent for hdl cholestrol test ( 100 ml ( 4 x 25 ) ) , consumable 21.44 1.5 / 1.6 dialyzers multiple use made of polysulphone or polyethersulfone low / middle flux, hi performance dialyser performance enhanced technology with hi biocompatibility housed in medical grade polycarbonate openable ends for easy cleaning caps ( for dialysate inlet utlet for safer storage openable caps ( red and blue ) hi quality sterilisation procedure using gamma radiation and should meetings standards of european ce / iso13485:2003sterlised ) , consumable 21.45 clopidogrel + aspirin ( 75 mg + 150 mg ) , capsule 21.46 alphacypermetherin 5% wdp ( as per attached specifications in rc ( confirming to is 15603 standards to be supplied in in 25kg or 20kg pack . 1 metric ton ) ) , consumable 21.47 chromic catgut suture ( 3 / 8 cir rcutting needle 16 mm, suture length 76 cm ( 5 / 0 12 foils / pkt ) ) , sutures 21.48 testcha ( 23 ) , ampoule 21.49 black braided silk with 1 / 2 cir cutting needle 30mm length 75 cm ( 1 / 0 12 foils / pkt ) , consumable [ mis18 ] disposable syringes is 10258:2002 with needle is 10654:2002, mfg by ph health care pvt ltd ( 10ml ) , consumable 21.51 sterile hypodermic syring with needle, mfg by ph health care pvt ltd ( 10ml ) , consumable 21.52 sterile hypodermic syringe with needle, mfg by ph health care pvt ltd ( 20 ml ) , consumable [ 700863 ] 21.53 double lumen polyurethane cvp catheter 5 fr ( length 13 to 15 cm ) , consumable [ 700864 ] 21.54 double lumen polyurethane cvp catheter 4 to 5 fr ( length 8 to 13 cm, sample to be submitted by firm latest by 10 days from the date of bid opening , each ) , consumable [ 700865 ] 21.55 triple lumen polyurethane cvp catheter 7 to 7.5 fr ( g 14 16x18x18x18, length 15 16cm, each ) , consumable 21.56 triple lumen polyurethane cvp catheter 7 to 7.5fr ( g 14 16x18x18, length 16 20 cm, each ) , consumable 21.57 spinal needle ( g 22 l 120 mm ) , consumable 21.58 triple lumen jugular catheter kit, ( size 12f, 16+ / 1cm, kit ) , consumable 21.59 nylon suture spatulated micropoint reverse cutting needle, double armed suture size 9 0 ( 12 foils / pkt ) , sutures nylon suture, macrofilment spatulated, micropoint double armed size 10 0 ( 12 foils / pkt ) , sutures 21.61 endotracheal tube internal with radioopaque line ( dia 2.5 mm to 5 mm, each ) , consumable 21.62 endotracheal tubes size 9.5 cuffed should have low pressure high volume cuff and radio opaque line ( size 9.5 , each ) , consumable 21.63 latex based baloon ( capacity 30 50 ml ) foleys urinary catheter ( 3 way size 20 ) , consumable 21.64 spinal needle with metal stylet, ( g 23 ) , needle [ 700875 ] 21.65 urinary drainage bag cap with non return valve ( eo sterile ) ( 2 litre, each ) , consumable 21.66 disposable spinal needle, mfg by alpha medicare & devices pvt. ltd. ( 18 no ) , needle 21.67 disposable spinal needle, mfg by alpha medicare and devices pvt. ltd. ( 22 no ) , needle 21.68 disposable spinal needle, mfg by alpha medicare and devices pvt. ltd. ( 23 no ) , needle 21.69 ecg paper ( chemical coated ) , mfg by life o line technologist ( 50mm x 20 mtr roll ) , consumable 21.7 ecg paper ( chemical coated ) , mfg by life o line technologist ( 50mm x 30 mtr. roll ) , consumable 21.71 ecg paper ( wax coated ) ( 50mm x 30 mtr, roll ) , consumable 21.72 ecg roll three channel mfg by life o line technologist ( 50 mm x 20 mtr ) , consumable 21.73 egc roll, mfg by life o line technologist ( 66 mm x 15 mm roll ) , consumable 21.74 icd bag, mfg by life o line technologist ( 1000 ml ) , bag 21.75 nebulization mask kit, mfg by life o line technologist ( pediatrics ) , consumable 21.76 cloth based surgical adhesive tape roll ( 1 inch x 5 mtr / roll ) , consumable 21.77 mva kit ( mannual vaccum aspiration kit ) ( as per attached specification ) , consumable 21.78 latex based baloon capacity ( 30 50ml ) foleys catheter ( size 14 3 way ) , consumable 21.79 latex based baloon capacity ( 3 ml ) foleys catheter ( way, size 12 ) , consumable 21.8 scalp vein set ( size 24g, disposable , each ) , consumable 21.81 paracetamol + chlorpheniramine ( 100 ml syrup ) , syrup 21.82 calcium carbonate + vitamin d3 + zinc ( 200 ml syrup ) , syrup 21.83 size of film 14 inch x 17 inch ( dihl ) , consumable 21.84 size of film 10 inch x 12 inch ( dihl ) , consumable 21.85 size of film 8 inch x 10 inch ( dihl ) , consumable 21.86 size of cassette ( 14 inch x 17 inch ) , consumable 21.87 size of cassette ( 10 inch x 12 inch ) , consumable 21.88 size of cassette ( 8 inch x 10 inch ) , consumable 21.89 hiv elisa kit ( hiv micro elisa ag+ab 4th generation ) ( 96 test kit ) , consumable 21.9 hcv elisatest kit pack size: 96 well per kit ( rate should be quoted for 1 kit containing 96 wells ) , consumable 21.91 triple blood bag ( sagm ) ( 450 ml ) , consumable 21.92 size of film 10 inch x 12 inch digital x ray film ( dihl ( pack of 150 ) ) , film 21.93 size of film 14 inch x 17 inch digital x ray film ( dihl ( pack of 100 ) ) , film 21.94 size of film 8 inch x 10 inch digital x ray film ( dihl ( pack of 150 ) ) , film 21.95 mindray bc 5300, auto hematology analyzer part 5 ( m 53 diluent ) , consumable 21.96 mindray bc 5300, auto hematology analyzer part 5 ( m 53 lh lyes ) , consumable 21.97 mindray bc 5300, auto hematology analyzer part 5 ( m 53 leo ( i ) lyes ) , consumable 21.98 mindray bc 5300, auto hematology analyzer part 5 ( m 53 leo ( ii ) lyes ) , consumable 21.99 mindray bc 5300, auto hematology analyzer part 5 ( m 53 cleaner ) , consumable 22 mindray bc 5300, auto hematology analyzer part 5 ( m 53 probe cleaner ) , consumable 22.01 mindray bc 5300, auto hematology analyzer part 5 ( quality control ) , consumable 22.02 mindray bc 2800, auto hematology analyzer ( m 18 diluent ) , consumable 22.03 mindray bc 2800, auto hematology analyzer ( m 18 cfl lyes ) , consumable 22.04 mindray bc 2800, auto hematology analyzer ( m 18 rinse ) , consumable 22.05 mindray bc 2800, auto hematology analyzer ( m 18 cleanzer ) , consumable 22.06 mindray bc 2800, auto hematology analyzer ( m 18 probe cleanzer ) , consumable 22.07 mindray bc 2800, auto hematology analyzer ( paper roll ) , consumable 22.08 mindray bc 2800, auto hematology analyzer ( quality control ) , consumable 22.09 stago diagnostica stago s.g.s, model sta satellite fully automated coagulation machine ( pt � sta neoplastin cl + 5 ) , consumable 22.1 stago diagnostica stago s.g.s, model sta satellite fully automated coagulation machine ( aptt sta cepha screen 4 ) , consumable 22.11 stago diagnostica stago s.g.s, model sta satellite fully automated coagulation machine ( aptt sta cepha screen 4 ) , consumable [ 700045 ] 22.12 stago diagnostica stago s.g.s, model sta satellite fully automated coagulation machine ( sta cacl2 ) , consumable 22.13 stago diagnostica stago s.g.s, model sta satellite fully automated coagulation machine ( stadesorb u ) , consumable 22.14 stago diagnostica stago s.g.s, model sta satellite fully automated coagulation machine ( stacoagcontrol n+p ) , consumable 22.15 stago diagnostica stago s.g.s, model sta satellite fully automated coagulation machine ( stasatellite cuvette ) , consumable 22.16 stago diagnostica stago s.g.s, model sta satellite fully automated coagulation machine ( stacleaner solution ) , consumable 22.17 stago diagnostica stago s.g.s, model sta satellite fully automated coagulation machine ( white stirrer for pt test ) , consumable 22.18 carelyte 503 ( calibrator 1&2 ) , consumable 22.19 carelyte 503 ( enzyme cleaning solution ) , consumable 22.2 carelyte 503 ( thermal printer roll ) , consumable 22.21 carelyte 503 ( sodium electrode ) , consumable 22.22 carelyte 503 ( pottasium electrode ) , consumable 22.23 carelyte 503 ( refernce electrode ) , consumable 22.24 carelyte 503 ( pump tubing ) , consumable 22.25 carelyte 503 ( complete tubing set ) , consumable 22.26 blood gluose ( god / pod ) semi auto end point ( 1000 ml ) , consumable 22.27 blood urea ( bun ) uv ( 1000 ml ) , consumable 22.28 s direct billirubin ( 1000 ml ) , consumable 22.29 hba 1 c ( glycosylated hb ) ( 100 tests ) , consumable 22.3 microalbumin urine ( 100 tests ) , consumable 22.31 apo a ( 100 tests ) , consumable 22.32 apo b ( 100 tests ) , consumable 22.33 crp ( hs ) ( 100 tests ) , consumable 22.34 s. transferin ( 100 tests ) , consumable 22.35 s. tibc kit ( 100 tests ) , consumable 22.36 s. b12 ( 100 tests ) , consumable 22.37 s. folate ( 100 tests ) , consumable 22.38 s.vitamin d3 ( 100 tests ) , consumable 22.39 s. iron ( ferrozine ) ( 100 tests ) , consumable 22.4 hdl ( each ) , consumable 22.41 s. ferritin ( each ) , consumable 22.42 s.calcium ( each ) , consumable 22.43 s. phosphorus ( each ) , consumable 22.44 s. total protein ( each ) , consumable 22.45 s.albumin ( each ) , consumable 22.46 s.lipase ( each ) , consumable 22.47 pt kit ( time ) ( ist 1.00 1.20 ) ( 2x4 ml ) , consumable 22.48 apit ( 2x4 ml ) , consumable 22.49 fdp kit ( 4 ml ) , consumable 22.5 d dimer ( 10x3 ml ) , consumable 22.51 thrombin time kit ( 10x3 ml ) , consumable 22.52 factor vii deficient plasma ( less than 1% ) ( 10x30 ml ) , consumable 22.53 factor ix deficient plasma ( less than 1% ) ( 10x1 ml ) , consumable 22.54 staining kit reticulin ( 100 test ) , consumable 22.55 staining kits ( 100 test ) , consumable 22.56 ptah staining kits ( 100 test ) , consumable 22.57 masson trichrome staining kits ( 100 test ) , consumable 22.58 quick diff staining kits for pap smear ( 100 test ) , consumable 22.59 troponin t ( ctn t ) card test ( 50 test ) , consumable 22.6 coombs serum ( anti human globulin ) ( polyvalent ) ( 1x5=5 ml ) , consumable 22.61 bovine albumin ( 22% w / v ) ( 1x5=5 ml ) , consumable 22.62 anti d ( polyvalent ) ( 1x10 ml ) , consumable 22.63 benedicts qualitative reagent ( 1x5 lit ) , consumable 22.64 absolute alcohol ( ethanol ) ( 1x500 ml = 500 ml ) , consumable 22.65 isopropyl alcohol ( propanol ) ( 1 x 2.5 lit ) , consumable 22.66 xylene ( sulphur free ) ( 1 x 2.5 lit ) , consumable 22.67 clotrimazole 1%w / v +lignocaine 2%w / v ( 10ml ) , eye drop 22.68 aztreonam inj ( 500 mg ) , injection 22.69 glycopyrolate 0.5 mg + neostigmine 2.5 mg ( 5ml ) , injection 22.7 dexmedetomidine hydrochloride injection ( 100mg ) , injection 22.71 dextran iv 40% ( 500ml ) , injection 22.72 ampicilline + cloxacilline ( 250 mg + 250 mg ) , injection per vial 22.73 losartan ( 25 mg ) , tablet 22.74 hydroxyethyl starch 6% ( each ) , suspension 22.75 antacid ( 250mg ) , syrup 22.76 dinoprostone gel ( 0.5 mg ) , gel 22.77 insulin biphasic / premix 50:50 ( 40 iu / ml ( 10 ml vial ) ) , injection 22.78 insulin biphasic lispro 25:75 100 iu / ml ( 3 ml cartridge ) ( firm has to supply compatible pen along with cartridges as and when required without any extra cost ) , cartridges [ 120713 ] 22.79 dpx ( 1 x 250 lit ) , consumable 22.8 ea 50 ( modified ) ( for cytology ) ( 1x125 ml ) , consumable 22.81 og6 ( for cytology ) ( 1x125 ml ) , consumable 22.82 paraffin wax histology ( 58 60 ) ( 1x1 kg = 1 kg ) , consumable 22.83 polytaxine powder ( 1x5 gm ) , consumable 22.84 haematoxyline solution ( harris ) ( 1x125 ml ) , consumable 22.85 formaldehyde 40% ( conc. formaline ) ( 1 x 30 lit ) , consumable [ 710021 ] 22.86 filter paper sheet ( ( whatmann no 01 ) sheets ) , consumable 22.87 ( ss ) powder ( 1x25 gm = 25 gm ) , consumable 22.88 eosin 2% solution ( 1x250 ml ) , consumable 22.89 reticulocyte kit ( 100 tests ) , consumable 22.9 leishmann stain sol with buffer tablet ph ( 1x5 lit ) , consumable 22.91 giemsa stain ( merck / span ) ( 125 ml ) , consumable 22.92 stain ( 1x25 gm = 25 gm ) , consumable 22.93 cytochrome stain with buffer ( 500 ml ) , consumable 22.94 methanol ( acetone free ) for leishman staining ( 1x2.5 lit ) , consumable 22.95 fauchets reagents ( 125 ml ) , consumable 22.96 esbachs reagent ( 125 ml ) , consumable 22.97 sodium nitroprusside ( 100 gm ) , consumable 22.98 occult blood test kit ( haem test kit ) ( 1 x 100 strips ) , consumable 22.99 hydrogen peroxide ( conc. ) h2o2 ( 500 ml ) , consumable 23 ehrilichs aidehyde reagen ( 2x250 ml ) , consumable 23.01 conc hcl ( 1x500 ml = 500 ml ) , consumable 23.02 con. ( hno3 ) nitric acid ( 2.5 liter ) , consumable 23.03 glacial acetic acid ( 2.5 liter ) , consumable 23.04 liquor ammonia ( 500 ml ) , consumable 23.05 pandys reagent csf ( 125 ml ) , consumable 23.06 ammonium sulphate ( analar ( gr / ar ) ( 1x500 gm = 500gm ) , consumable 23.07 sodium metabisuiphite ( na2s2o3 ) ( analar ( gr / ar ) ( 1x500 gm = 500gm ) , consumable 23.08 sodium hydroxide ( naoh ) ( analar / gr / ar ) ( 1x500 gm = 500gm ) , consumable 23.09 citric acid analar / gr / ar ( 1x500 gm = 500gm ) , consumable 23.1 trisodium citrate analar / gr / ar ( 1x500 gm = 500gm ) , consumable 23.11 nah2 po4 ( anhydrous ) analar / gr / ar ( 1x500 gm = 500gm ) , consumable 23.12 poly l lysine sol ( for immunochisto chemistry ) ( 1x100 ml ) , consumable 23.13 poly l lysine coated slides ( 50 lidess x 1 ) , consumable 23.14 indicator sol, for ph ( litmus sol ) ( 1x500 ml = 500 ml ) , consumable 23.15 sodium chloride nacl analar / gr / ar ( 1x500 gm = 500gm ) , consumable 23.16 iron alum a ) ferric amino sulphate ( 1x500 ml = 500 ml ) , consumable 23.17 aluminium potassim sulphate ( each ) , consumable 23.18 mercuric oxide ( 25 gm ) , consumable 23.19 gold chloride ( 1x1 gm ) , consumable 23.2 sliver nitrate ( 1x25 gm = 25 gm ) , consumable 23.21 drabkin solution for hb ( 1x5 lit ) , consumable 23.22 distilled water ( 1x5 lit ) , consumable 23.23 centchroman ip ( 30 mg ) , tablet 23.24 non ionic contrast media ( 350 mg , 100ml ) , consumable 23.25 protein ( total ) ( 600 ml ) , consumable 23.26 hdl / ldl standard ( 1x1 ml ) , consumable 23.27 biochemistry control serum l1 ( 5x5 ml ) , consumable 23.28 biochemistry control serum l2 ( 5x5 ml ) , consumable 23.29 dexamethasone sodium inj 4mg / 2ml ( 2ml vial ) , injection 23.3 tablet domeperidone ( 10mg ) , tablet 23.31 pantaprazole ( 40mg ) , injection 23.32 ceftriaxone ( 1g ) , injection 23.33 human insulin regular / soluble ( 40iu / ml ( 10ml vial ) ) , injection 23.34 human insulin regular / soluble ( 100iu / ml ( 10ml vial ) ) , injection 23.35 basal insulin glargin ( 100iu / ml ( 10ml vial ) ) , injection 23.36 ultravist 300mg ( 50 ml / vial ) , injection 23.37 tab amitryptyline ( 25 mg ) , tablet 23.38 tab citalopram ( 20 mg ) , tablet 23.39 sics blade cresent ( 15 degree ) , consumable 23.4 sics blade sideport ( sideport entry knife ) , consumable 23.41 eye drape disposable towel ( size 70*70cm area 08*08 ) , consumable 23.42 id wrist band ( identification for mother / child specific colour ) ( wrist band / no ) , consumable 23.43 balance salt solution for irrigation 500 ml ffs bottle ( 500ml bottle ) , eye applicap 23.44 trypan blue dye ( 1ml ) , consumable 23.45 x ray developer powder ( 13.5 liter ) , consumable 23.46 surgical spirit ( 100ml ) , bottle 23.47 hemotocyto meter ( meter ) , consumable 23.48 haemoglobin tube ( tube ) , consumable 23.49 multivitamin without iron syrup ( 100ml ) , syrup 23.5 haemoglobi pippate ( pippate ) , consumable 23.51 bloting paper ( paper ) , consumable 23.52 blood cell counter key ( key ) , consumable 23.53 barium chloride powder ( powder ) , consumable ] 23.54 edta powder ( 250 gm ) , consumable [ ] 23.55 insulin biphasic / premix 50:50 ( 100 iu / ml ( 10 ml vial ) ) , injection 23.56 montex test 2tu ( 1 vial ) , consumable 23.57 stainic rack ( each ) , consumable 23.58 intra camral saline ( r.l ) sep ( eto sterelied, specialy ( manufactured for intra camral ) , consumable [ 23.59 plastic bottle ( 300ml ) , consumable 23.6 plastic bottle ( 500 ml ) , consumable 23.61 sics blade ( disposable ) cresent nife 2.8 ( specialy long matel handle, micro sharp edge, isi / iso ( manufaturer, eto stereliged ) , consumable 23.62 suter ( 8 / 0 ( 01 box ) ) , consumable 23.63 pistol grip curvedcoagulating shears ergonomic handle with att shaft lenght 36cm can seal blood vessel upto and inclding ( 5mm in diameter ) , consumable [ 23.64 advanced rfenergy hand instrument of 5mm shaft diameter for open procedure with shaft length 14cm and should be both hand and ( foot activated ) , consumable ] 23.65 scissor grip curved coagulating shears with curved tapered tip for precise dissection and with 240 degree activation triggers that support multiple hand positions in the following shaft ( lengths 9cm can seal blood vessels upto and including 5 mm in diameter ) , each [ 710092 ] 23.66 advanced rfenergy hand instrument of 5mm shaft diameter for open procedure with shaft length 25cm and should be both hand and ( foot activated ) , consumable [ 710095 ] 23.67 scissor grip curved coagulating shears with curved tapered tip for precise dissection and with 240 degree activation triggers that support multiple hand positions in the following shaft ( lengths 17 cm can seal blood vessels upto and including 5 mm in 23.68 advanced rfenergy hand instrument of 5mm shaft diameter for laparoscopic procedure with shaft length 35cm with 55degree articulation and should be both hand ( foot activated ) , consumable 23.69 advanced rfenergy hand instrument of 5mm shaft diameter for open procedure with shaft length 35cm and should be both hand and ( foot activated ) , consumable [ 710096 ] 23.7 pistol grip curved coagulating shears with ergonomic handle in the ( folloeing shaft lengths 36 cm can seal blood vessels upto and including 5 mm in diameter ) , consumable [ 710099 ] 23.71 advanced rfenergy hand instrument of 5mm shaft diameter for laparoscopic procedure with shaft length 35cm with 55degree articulation and should be both hand ( foot activated with curved tip ) , consumable 23.72 advanced rfenergy hand instrument of 5mm shaft diameter for laparoscopic procedure with shaft length 45cm and should be both hand ( foot activated with curved tip ) , consumable 23.73 pistol grip curved coagulating shears with ergonomic handle shaft ( langths 36 cm can seal blood vessels upto and including 5 mm in diameter att ) , each 23.74 complete absorbable mesh fixation device with minimum strap length 7mm2point fixation to hold the mesh and device should be of ( 25 absorbable straps ) , consumable 23.75 handpiece ( transducer ) , each 23.76 handpiece ( blue ) , consumable 23.77 fistula and wound management system ( size 104 159 mm ) , consumable 23.78 fistula and wound management system ( size 156 228 mm ) , consumable 23.79 fistula and wound management system ( size 208 297 mm ) , consumable 23.8 oxidized regenerated cellulose based topical absorbable hemostat, structured non woven material, with bactericidal property. ease of use in both open and minimally invasive procedures ( size 1x2 approved by us fda ) , consumable 23.81 oxidized regenerated cellulose based topical absorbable hemostat, structured non woven material, with bactericidal property. ease of use in both open and minimally invasive procedures ( size 2 x 4 approved by us fda ) , consumable 23.82 oxidized regenerated cellulose based topical absorbable hemostat, structured non woven material, with bactericidal property. ease of use in both open and minimally invasive procedures ( size 4 ) , consumable 23.83 v.p.shunt ( medium pressur ) , consumable 23.84 v.p.shunt ( low pressur ) , consumable 23.85 pistol grip curved coagulating shears with ergonomic handle in the following shaft lengths 23 cm. can seal blood vessels upto and including ( 5mm in diameter ) , consumable 23.86 pistol grip curved coagulating shears with ergonomic handle shaft lengths 45 cm. can seal blood vessels upto and including ( 5mm in diameter ) , consumable [ 720016 ] 23.87 dissecting hook having telescoping shaft ( 10cm 14cm with integrated hand activation control buttons ) , consumable 23.88 curved blade having telescoping shaft ( 10cm 14cm with integrated hand activation control buttons ) , consumable 23.89 5mm lap dissecting hook ( 32 cm long ) , consumable 23.9 blood culture media aerobic for adult ( bact / alert fa plus ) , each 23.91 blood culture media aerobic for pediatric ( bact / alert pf plus ) , each 23.92 advanced rf energy hand instruments of 5mm shaft diameter for open procedures with shaft ( lengths 14cm and should be both hand & foot activated with curved tip ) , consumable 23.93 blood culture media anaerobic for pediatric ( bact / alert pf plus ) , each 23.94 blood culture media anaerobic for adult ( bact / alert fa plus ) , each 23.95 blood culture media fungus bottles per year, fungus can be tested by all quoted bottles. in the same bottle bacteria and fungus can be tested.; fungus can be tested by all quoted bottles. in the same bottle bacteria and fungus can be tested. ( ) , consumable 23.96 blood culture media mycobacterium spp ( bact / alert mp ( plastic ) ) , each 23.97 individual identification panel for aerobic gram positive organism ( gpid ) , each 23.98 individual identification panel for aerobic gram negative organism ( gnid ) , each 23.99 individual ast panel for gram positive organism ( gp p628 ) , each 24 advanced rf energy hand instruments of ( 5mm shaft diameter for open procedures with shaft lengths 25cm and should be both hand & foot activated with curved tip ) , consumable 24.01 individual ast panel for gram negative organism ( gn n280 ) , each 24.02 advanced rf energy hand instruments of 5mm shaft diameter for laparoscopic procedures with shaft lengths ( 35cm and should be both hand & foot activated with curved tip ) , consumable 24.03 individual identification panel for anaerobic gram negative organism ( anc ) , each 24.04 individual identification panel for anaerobic gram positive organism ( anc ) , each 24.05 individual identification panel for fungus ( yst ) , each 24.06 individual ast panel for fungus ( ast ys07 ) , each 24.07 advanced rf energy hand instruments of 5mm shaft diameter for laparoscopic procedures with shaft lengths ( 45cm and should be both hand & foot activated ) , consumable 24.08 advanced rf energy hand instruments of 12mm shaft diameter for open procedures with shaft lengths ( 22cm and should be both hand & foot activated ) , consumable [ 720039 ] 24.09 diltiazem tablet ( 60 mg ) , tablet 24.1 altracurium ( 10mg / ml, 2.5ml vial ) , injection 24.11 heamoglobin colour scale book with special strip complete ( 1 x 200 ) , consumable 24.12 paracetamol 150 mg / ml ( 15 ml bottle with dropper ) , drop 24.13 ofloxacin + dexamethosone ( 0.3%+ 0.1% ( 10 ml ) ) , eye drop 24.14 vitamin b1 10mg, b2 10mg, b6 3mg, b12 15mcg, niacinamide 75mg, calcium panthenol 50mg ( folic acid 1.5mg, vitamin c 150mg, biotin 100mcg or more ) , tablet 24.15 spectra optia collection set, model : 10110 / 10120 ( packing size : 6 kits ) , consumable 24.16 spectra optia exchange set, model : 10220 ( packing size : 6 kits ) , consumable 24.17 optia granulocyte depletion set, model : 10300 ( packing size : 6 kits ) , consumable 24.18 spectra optia platelet kit, model : 10400 ( packing size : 6 kits ) , consumable 24.19 acd a solution 500ml, model : pb 1ac500j8b ( packing size : 2 bags / foil or 12 foils / box ) , consumable 24.2 hpmed solution consumable ( pack size: 16 bottles of 50 ml ) , make polti s.p.a. ; model sani system ( country of origin italy; ) , consumable 24.21 laser fiber for dental laser , make faith inovation ; model fd10b ; ( country of origin india ) , consumable 24.22 sterigen c electrolyte solution one pack of 10 ltr. for sterigen 400 daf , make faith inovation; model sterigen sg 400 daf ; ( country of origin india ) , consumable 24.23 tri iodothyronine ( t3 ) , consumable 24.24 thyroxine ( t4 ) , consumable 24.25 rhyroid stimulating hormone ( tsh ) , consumable 24.26 auto lyser solution for cbc machine ( 500ml ) , consumable 24.27 auto cleanser for cbc machine ( 2 liter ) , consumable 24.28 auto dill solution for cbc machine ( 20 liter ) , consumable 24.29 tranexamic acid ( 5ml ) , injection 24.3 tranexamic amp / vial ( 500mg ) , injection 24.31 serum electrolite na+ k+ kit analizer ( 50 test per kit ) , consumable 24.32 milkiwhite gel based sanitizer 1.ethinol ( cas 64 17 5 ) 58 62% 2. benzoil coline chloride 0.52% 1 % 3. ( ph neutral contact time 15 se 4. pack size 100 ml & 100 ml with dispensor ) , consumable 24.33 milkiwhite gel based sanitizer 1.ethinol ( cas 64 17 5 ) 58 62% 2. benzoil coline chloride 0.52% 1 % 3. ph neutral contact time 15 sec 4. ( pack size l& 500 ml with dispensor ) , consumable 24.34 aminoacid ( essential ) infusion ( 10% 100ml glass ffs ) , bottle ] 24.35 curved scissors laparoscopic 5mm size, 360 degree rotating with insulated shaft, non ratchet , plastic grip ( 36 cms length, monopolar pin provision for usage with electro surgical unit, independently moving jaws ) , consumable [ 720066 ] 24.36 maryland dissector laparoscopic 5mm curved maryland dissector with tapering end, 360 degree rotating with insulated shaft, non ratchet , plastic grip ( 36 cms length, monopolar pin provision for usage with electro surgical unit, independently moving ) , consumable 24.37 grasper laparoscopic 5mm straight 360 degree rotating with insulated shaft, toothed a traumatic grasper with ratchet mechanism, plastic grip ( 36 cms length, independently moving jaws ) , consumable [ 24.38 babcock laparoscopic 5mm a traumatic babcock, straight 360 degree rotating with insulated shaft, a traumatic jaws with ratchet mechanism, plastic grip ( 36 cms length, independently moving jaws ) , consumable 24.39 babcock laparoscopic 10mm a traumatic babcock, straight 360 degree rotating with insulated shaft, a traumatic jaws with ratchet mechanism, plastic grip ( 36 cms length, independently moving jaws ) , consumable ] 24.4 sutureless dural graft substitute ( 1x3 ) , cons 24.41 sutureless dural graft substitute ( 2x2 ) , consumable ] 24.42 sutureless dural graft substitute ( 3x3 ) , consumable 24.43 sutureless dural graft substitute ( 4x5 ) , consumable 24.44 1%w / v available iodine in a non oxynol with soluble iodine suractant base with sodium iodide ( less than 1% w / v and surfactant less than 5% w / v 500 ml ) , consumable 24.45 sanitary napkins ( as per attached specification / pack of 6 pads ) , consumable [ mis106 ] 24.46 methyl prednisolone ( 8mg ) , tablet 24.47 gentamycin sulphate 0.1% ( 15gm tube ) , ointment or cream [ 120143 ] 24.48 bss solution for opthalmic use ( 500ml ) , sol 24.49 fat emulsion 20% 0.2 ( 250ml ) , injection 24.5 ivf glutamine dipeptide ( 100ml ) , injection 24.51 rangeen baag print kapda ( 60x115 tanaxbana 2 / 20sx10s reedxpeek 36x36 ) , 24.52 rangeen design weft stripe kapda ( 60x115 tanaxbana 2 / 40x 20s, 2 / 6s reedxpeek 52x52 / inch ) , 24.53 rangeen design towel beev kapda ( 1mtrx56 tanaxbana 2 / 20sx10s reedxpeek 36x40 ) , 24.54 baag print kapda fine ( 94x115 tanaxbana 2 / 40x x 2 / 20s reedxpeek 52x40 ) , 24.55 baag print kapda fine 64x115 tanaxbana 2 / 40x x 2 / 20s reedxpeek 52x40 ( ) , 24.56 rangeen baag print kapda 60x115 tanaxbana 2 / 40x x 2 / 20s reedxpeek 52x52 ( ) , 24.57 tericat shirting cloth ( 1 m x 40 inch tana x bana ( 2 / 60s x 2 / 60 p.v.65:35 ) reed x pik ( 68 x 64 / inch ) ) , 24.58 levosalbutamol ( 1.25mg ) , ipratropium ( 500mcg ) respule ( 2.5ml ) , ampule 24.59 formoterol 6mcg + budesonide 200mcg ( 30 cap x 6 pack with 1 dispensing device ) , rotacaps 24.6 salmeterol 50mcg +fluticasone 250 mcg ( 30 cap x 6 pack with 1 dispensing device ) , rotacaps 24.61 formoterol 6mcg + budesonide 400mcg ( 30 cap x 6 pack with 1 dispensing device ) , rotacaps 24.62 salmeterol 50mcg +fluticasone 500 mcg ( 30 cap x 6 pack with 1 dispensing device ) , rotacaps [ 120781 ] 24.63 blood urea ( arba ) , consumable 24.64 alkaline phosphate kinetic 2*25 ml ( semi auto end point ) , consumable 24.65 bilirubin caoillary heparinised vitrex ( one packet contain 100 capillary ) , consumable 24.66 clarithromycin ( 500mg ) , injection 24.67 i / v polysacchride or conjugate pneumococcal ( 0.5 ml ) , vaccine 24.68 imipenem 500 mg with cilastatin 500mg ( vial / amp ) , injection 24.69 ivf ( l alanine + l glutamine ) ( 50 ml ) , injection 24.7 surgical spirit ( 450 ml ( isopropyl rubbing alcohol ) ) , consumable 24.71 anti oxidant lycopen 200 ml syrup ( vitamins multi minerals ) , syrup 24.72 bupivacaine hcl for spinal ( inj 0.5%+8.25% dextrose ) , ampule 24.73 griseofulvin ( tablet 250 mg ) , tablet 24.74 budesonide ( inhalation 200 mcg per dose ) , inhaler 24.75 salbutamol nebulizing solution ( 5 mg / 2.5 ml ) , ampule 24.76 dextran 40 i / v 10% ( 500 ml ffs bottle ) , bottle 24.77 aluminium hydroxide+magnesium aluminium silicate+magnesium hydroxide+simethecon ( tab 300 mg+50mg + 25 mg+25 mg ) , tablet 24.78 phenylephrin eye drop 2.5 % ( 5 ml vial ) , drop 24.79 calcium with vitamin d3 calcium equivalent to ( 500 mg ) , tablet 24.8 titenium chemo port with silicon catheter ( 8 9.6 fr ) length 60cm 80cm, guide wire, peel away desilet, hubsite needle ( 22 g * 20 25.4mm ) , consumable [ mis137 ] 24.81 single umbilical catheter with leur lock ( fr 3 to fr 3.5 , l 40 cm ) , consumable [ mis112 ] 24.82 alcohal based hand sanitizer ( 500ml bottle with dispenser ) , consumable 24.83 oxidized regenerated cellulose, thicker weave, can be sutured through, with bactericidal property. size 1x1 ( approved by us fda ) , consumable 24.84 oxidized regenerated cellulose, thicker weave, can be sutured through, with bactericidal property. size 1x3.5 ( approved by us fda ) , consumable 24.85 oxidized regenerated cellulose, thicker weave, can be sutured through, with bactericidal property. size 3x 4 ( approved by us fda ) , consumable 24.86 oxidized regenerated cellulose, thicker weave, can be sutured through, with bactericidal property. size 6x 9 ( approved by us fda ) , consumable 24.87 oxidized regenerated cellulose based topical absorbable hemostat, structured non woven material, with bactericidal property. ease of use in both open and minimally invasive procedures size 1x2 ( approved by us fda ) , consumable 24.88 oxidized regenerated cellulose based topical absorbable hemostat, structured non woven material, with bactericidal property. ease of use in both open and minimally invasive procedures size 2x4 ( approved by us fda ) , consumable 24.89 sutureless dural graft substitute ( 2x2 ) , consumable 24.9 sutureless dural graft substitute ( 3x3 ) , consumable 24.91 clip applier laparoscopic 10 mm reusable ligaclip medium / large size applier with clip retention grooves in the jaw with single arm movement ( 36cm metal shaft ) , consumable 24.92 clip applier laparoscopic 10 / 12 mm reusable ligaclip large size applier with clip retention grooves in the jaw with single arm movement ( 36cm metal shaft ) , consumable 24.93 needle holder laparoscopic 5mm straight reusable needle holder with ratchet mechanism with high quality tungsten plated jaws for enhanced needle grip ( 36 cms metal shaft ) , consumable 24.94 all human ( bovine aprotinin free ) fibrin sealant ( 1 ml ) , consumable 24.95 all human ( bovine aprotinin free ) fibrin sealant ( 2 ml ) , consumable 24.96 polyamide with cd cut needle ( 16 mm length 70 cm â� � 3 / 0 ) , consumable 24.97 polyamide with cd cut r cut extra penetrating needle ( 16 mm length 70cm â� � 4 / 0 ) , consumable 24.98 polyamide with cd reverse 5 / 0 cut needle ( 12 mm length 70cm â� � 5 / 0 ) , consumable 24.99 poly propylene with 1 / 2 circle rbd needle ( 13 mm length 60 cm â� � 5 / 0 ) , consumable 25 poly propylene with rbd needle ( 8 mm length 60 cm â� � 7 / 0 ) , consumable 25.01 poly propylene with 1 / 2 cir cc double needle ( 13 mm ( dential guage needle and suture ) length 75 cm 4 / 0 ) , consumable 25.02 poly propylene with 1 / 2 cir cc double needle ( indentical guage needle and suture ) ( 13 mm length 60 cm 5 / 0 ) , consumable 25.03 polybutylate coated with polyster braided ( green ) with 1 / 2 cir taper cut v 5 double armed needle ( 25 mm length 90 cm 2 / 0 ) , consumable 25.04 1 / 2 cir ccs cut needle ( 48 mm stainless steel length 45 cm 4 ) , consumable 25.05 1 / 2 cir ccs cut needle ( 48 mm stainless steel length 45 cm 6 ) , consumable 25.06 1 / 2 cir ccs cut needle ( 48 mm stainless steel length 45 cm 5 ) , consumable 25.07 polyglecaprone with 1 / 2 cir oval rb contrast needle ( 26 mm length 70 cm 3 / 0 ) , consumable 25.08 sterile raney scalp clips ( ) , consumable 25.09 raney scalp clip forceps ( ) , consumable 25.1 polyglecaprone with curved 5 / 0 reverse cutting needle ( 16 mm ) , consumable 25.11 polydioxanone irgacare mp coated ( 122cm , 1 loop sgle armed , 65mm ) , consumable 25.12 patient drapes ( ) , nasal drop 25.13 bio membrane ( ) , consumable 25.14 polydioxanone with 1 / 2 cir reverse cutting orthopaedic surgery ( os ) nededle ( 40 mm length 90 cm 1 ) , consumable 25.15 collagen dry ( 6x6 cm ) , sheet 25.16 collagen dry ( 15 x 30 cm ) , sheet 25.17 polydioxanone with 1 / 2 cir round body heavy needle ( 40 mm length 90 cm 1 ) , consumable 25.18 collagen dry ( 20 x 40 cm ) , sheet 25.19 collagen wet ( 6x6 cm ) , sheet 25.2 collagen wet ( 10 x 10 cm ) , sheet 25.21 collagen wet ( 15 x 30 cm ) , sheet 25.22 collagen wet ( 20 x 40 cm ) , sheet 25.23 collagen granules ( ) , consumable 25.24 coated polyster braided with cd white d needle ( 25 mm ( curved reverse cutting round body or taper cut ) length 90 cm 2 / 0 ) , consumable 25.25 polybutylate coated with polyster braided ( green ) with 1 / 2 cir taper cut v 5 double armed needle ( 17 mm length 90 cm 25.26 polyglecaprone with 1 / 2 cir oval rb jb needle ( 26 mm length 70 cm 2 / 0 ) , consumable 25.27 polydioxanone with 3 / 8 cir round body needle ( 11 mm length 45 cm 6 / 0 ) , consumable 25.28 coated braided fast absorbing polyglactin 910 sut. ) with 3 / 8 cir cutting needle ( 16 mm length 45 cm size 4 / 0 undyed ) , consumable 25.29 coated braided fast absorbing polyglactin 910 sut. ) with 1 / 2 cir round body and 1 / 2 cir reverse cutting double needle ( 36 mm length 140 cm size 2 / 0 undyed ) , consumable 25.3 coated braided fast absorbing polyglactin 910 sut. ) with 1 / 2 cir taper cut needle ( 36 mm length 100 cm size 2 / 0 undyed ) , consumable 25.31 coated braided polyglactin 910 with triclosan coating sut. ) with 1 / 2 cir rb needle ( 20 mm length 75 cm size 3 / 0 ) , consumable 25.32 coated braided polyglactin 910 with triclosan coating sut. ) with 1 / 2 cir rb needle ( 30 mm length 100 cm size 2 / 0 ) , consumable 25.33 coated braided polyglactin 910 with triclosan coating sut. ) with 1 / 2 cir rb needle ( 30 mm length 100 cm size 1 / 0 ) , consumable 25.34 coated braided polyglactin 910 with triclosan coating sut. ) with 1 / 2 cir rb needle ( 40 mm length 100 cm size 1 ) , consumable 25.35 sabourauds dextrose agar powder ( 100gms ) , consumable [ mis104 ] 25.36 nutrient agar ( 500 grm ) , consumable [ mis88 ] 25.37 coated braided polyglactin 910 with triclosan coating sut. ) with 1 / 2 cir rb needle ( 36 mm length 90 cm size 3 / 0 ) , consumable 25.38 coated braided polyglactin 910 with triclosan coating sut. ) with 1 / 2 cir rb needle ( 20 mm length 70 cm size 4 / 0 ) , consumable 25.39 coated braided polyglactin 910 with triclosan coating sut. ) with 1 / 2 cir rb needle ( 40 mm length 90 cm size 2 / 0 ) , consumable 25.4 coated braided polyglactin 910 with triclosan coating sut. ) with 1 / 2 cir rb needle ( 40 mm length 100 cm size 1 / 0 ) , consumable 25.41 coated braided polyglactin 910 with triclosan coating sut. ) with cd cutting needle ( 22 mm length 45 cm size 3 / 0 ) , consumable 25.42 coated braided polyglactin 910 with triclosan coating sut. ) with 1 / 2 circle reverse cutting needle ( 36 mm length 90 cm size 1 / 0 ) , consumable 25.43 coated braided polyglactin 910 with triclosan coating sut. ) with 1 / 2 circle reverse cutting needle ( 40 mm length 100 cm size 1 ) , consumable 25.44 coated braided polyglactin 910 with triclosan coating sut. ) with 1 / 2 circle reverse cutting needle ( 23 mm length 35 cm size 1 ) , consumable 25.45 coated braided polyglactin 910 with triclosan coating sut. ) with 1 / 2 circle round body taper point needle ( 36.4 mm length 90 cm undyed size 2 / 0 ) , consumable 25.46 coated braided polyglactin 910 with triclosan coating sut. ) with 1 / 2 circle round body taper point needle ( 36.4 mm length 90 cm undyed size 1 / 0 ) , consumable 25.47 coated braided polyglactin 910 with triclosan coating sut. ) with 1 / 2 circle round body taper point needle ( 36.4 mm length 90 cm undyed size 1 ) , consumable 25.48 polypropylene and polyglecaprone 25 composite partialy absorbable monofilament mesh of ( size 15 x 15 cm ) , consumable 25.49 polypropylene and polyglecaprone 25 composite partialy absorbable monofilament mesh of ( size 10x 15 cm ) , consumable 25.5 polypropylene and polyglecaprone 25 composite partialy absorbable monofilament mesh of ( size 6 x 11 cm ) , consumable 25.51 polypropylene and polyglecaprone 25 composite partialy absorbable monofilament mesh of ( size 7.6 x 15 cm ) , consumable 25.52 disposable intraluminal stapler curved circular stapler ( 21 mm with controlled tissue compression ) , consumable 25.53 curved circular stapler ( 25 mm with controlled tissue compression ) , cons ] 25.54 curved circular stapler ( 29 mm with controlled tissue compression ) , consumable [ ] 25.55 curved circular stapler ( 33 mm with controlled tissue compression ) , consumable [ 25.56 hemmorhoidal circular stapler 33mm with controlled tissue compression ( leg length of 4mm ) , consumable [ 7 ] 25.57 linear cutter ( of 55 mm with inbuilt selectable staple height ) , consumable 25.58 universal black reload compatible with the ( 55mm linear cutter with inbuilt selectable staple height ) , consumable 25.59 linear cutter of ( 75 mm with inbuilt selectable staple height ) , consumable 25.6 universal black reload compatible with the ( 75mm linear cutter with inbuilt selectable staple height ) , consumable 25.61 5 mm optic view bladeless trocar ( with bilateral tissue separator ) , consumable 25.62 optic view bladeless trocar with bilateral tissue separator ( 11 mm ) , consumable 25.63 optic view bladeless trocar with bilateral tissue separator ( 12 mm ) , consumable 25.64 optic view bladeless trocar with bilateral tissue separator ( 15 mm ) , consumable 25.65 polyglactin 910 with triclosan coating 2 0, 1 / 2 circle round body ( 30 mm, 100 cm ) , consumable 25.66 polyglactin 910 with triclosan coating 1 0, 1 / 2 circle round body ( 40 mm, 100cm ) , consumable 25.67 polyglactin 910 with triclosan coating 1, 1 / 2 circle round body ( 40 mm, 100 cm ) , consumabl 25.68 polyglactin 910 with triclosan coating 1, 1 / 2 circle reverse cutting o.s ( 40 mm, 100cm ) , consumable 25.69 polyglactin 910 with triclosan coating 1 0, 1 / 2 circle reverse cutting o.s ( 40 mm, 100 cm ) , consumable 25.7 polydioxanone irgacare mp coated ( 122cm , 1 loop sgle armed , 65mm ) , consumable 25.71 polydioxanone irgacare mp 90cm m4 usp1 sgle armed ctx, i / 2 circle ( 48 mm ) , consumable 25.72 polydioxanone irgacare mp 70cm m3 usp2 / 0 sgle armed ( sh, 1 / 2 circle , round body, 26mm ) , consumable 25.73 polydioxanoneirgacare mp 70cm m2 usp3 / 0 sgle armed ( rb 1, 1 / 2 circle , round 25.74 polydioxanoneirgacare mp coated ( 150cm usp1 0 rb ctx, i / 2 circle, 48mm ) , consumable 25.75 suture copolymer of glycolide and ecaprolactone ( 3 0, 30cm, 3 / 8 circle rc 24mm needle, 20 anchors / inch unidirectional ) , consumable 25.76 suture dyed polyester poly ( p dioxanone ) ( 2 0, 30cm, 1 / 2 circle 36mm rb, 20 anchors / inch unidirctional ) , consumable [ 7400080 ] 25.77 suture dyed polyester poly ( p dioxanone ) ( 1, 36x36 cm, 1 / 2 circle cutting 40mm, 20 anchors / inch biderctional ) , consumable [ 7400081 ] 25.78 polyglactin 910 with triclosan coating ( 4 0, 1 / 2 circle round body, 20 mm, 70 cm ) , consumable [ 7400082 ] 25.79 polypropylene and polyglecaprone 25 composite partialy absorbable monofilament mesh ( size 15 x 15 cm ) , consumable [ 7400083 ] 25.8 polypropylene and polyglecaprone 25 composite partialy absorbable monofilament mesh of ( size 10 x 15 cm ) , consumable 25.81 polypropylene and polyglecaprone 25 composite partialy absorbable monofilament mesh of ( size 6 x 11 cm ) , consumable 25.82 polypropylene and polyglecaprone 25 composite partialy absorbable monofilament mesh of ( size 7.6 15 cm ) , consumable ] 25.83 2 octyl cynoacrylate propen, topical skin adhesive ( 0.5ml ) , consumable 25.84 non absorbable ( 10 0 ) monofilament polymide black 6mm 3 / 8 circle spatulated micro point doublw arm ( 38 cm ) , consumable 25.85 absorbable ( 6 0 ) braided coated polyglactin aw violet 8mm 1 / 2 circle spatulated micro point doublw arm ( 45 cm ) , consumable 25.86 non absorbable braided silk black 10mm 3 / 8 circle reverse cutting micro point ( 38 cm ) , consumable 25.87 absorbable surgical suture braided polyglycolic acid 3 / 8 circle reverse cuttingg ( 12mm 45 cm spatulated needle ) , consumable 25.88 non absorbable braided silk black ( 12 mm 3 / 8 circle reverse cutting micropoint 38 cm ) , consumable 25.89 suture copolymer of glycolide and ecaprolactone ( 3 0, 30cm, 3 / 8 circle rc 24mm needle, 20 anchors / inch unidirectional ) , consumable 25.9 suture copolymer of glycolide and ecaprolactone ( 2 0, , 20cm, 26mm, 20 anchors / inch unidirectional ) , consumable 25.91 suture dyed polyester poly ( p dioxanone ) ( 2 0, 30cm, 1 / 2 circle 36mm rb, 20 anchors / inch unidirctional ) , consumable [ 7400095 ] 25.92 suture dyed polyester poly ( p dioxanone ) ( 1, 36x36 cm, 1 / 2 circle cutting 40mm, 20 anchors / inch biderctional ) , consumable [ 7400096 ] 25.93 composite mesh polypropylene and polyglactine 910 ( 6x11 cm ) , consumable 25.94 composite mesh polypropylene and polyglactine 910 ( 10x15 cm ) , consumable 25.95 blood agar powder ( 500 grm ) , consumable [ mis19 ] 25.96 composite mesh polypropylene and polyglactine 910 ( 15x15 cm ) , consumable 25.97 suture dyed polyester poly ( p dioxxanone ) ( 1 0, 24x4 cm, 1 / 2 circle 36mm rb, 20 anchors / inch bidirctional ) , consumable 25.98 suture dyed polyester poly ( p dioxxanone ) ( 1 0, 14x4 cm, 1 / 2 circle 36mm rb, 20 anchors / inch bidirctional ) , consumable 25.99 macro porous tissue separating multi layered partially absorbable mesh with oxidized regenerated cellulose, polydioxanone and soft polypropylene mesh ( size 15 cm x 15 cm ) , consumable 26 macro porous tissue separating multi layered partially absorbable mesh with oxidized regenerated cellulose, polydioxanone and soft polypropylene mesh ( size 15 cm x 20 cm ) , consumable [ 26.01 polyglactin 910 with triclosan ( irgacre mp ) coating 2 0, 1 / 2 circle round body ( 30 mm 90 cm ) , consumable 26.02 polyglactin 910 with triclosan ( irgacre mp ) coating 1 0, 1 / 2 circle round body ( 40 mm 90 cm ) , consumable 26.03 polyglactin 910 with triclosan ( irgacre mp ) coating 1, 1 / 2 circle round body ( 40 mm 90 cm ) , consumable 26.04 polyglactin 910 with triclosan ( irgacre mp ) coating 1, 1 / 2 circle reserve cutting o.s ( 40 mm 90 cm ) , consumable 26.05 polyglactin 910 with triclosan ( irgacre mp ) coating 3 0, 1 / 2 circle round body ( 20 mm 90 cm ) , consumable 26.06 polyglactin 910 with triclosan ( irgacre mp ) coating 1 0, 1 / 2 circle reserve cutting o.s ( 40 mm 90 cm ) , consumable 26.07 polyglactin 910 with triclosan ( irgacre mp ) coating 3 0, 3 / 8 circle reserve cutting ( 26 mm 70 cm ) , consumable 26.08 8 0 double arm nylon monofilament with ( 3 / 8circle taper point needle ) , consumable 26.09 polypropylene monofilament sterile precut cd reverse ( cutting needle 6 0 ) , consumable [ 7410013 ] 26.1 polyglactin 8mm 1 / 4 , circle spatulated micro point double needle ( length 45 cm size 6 0 ) , consumable 26.11 10 0 double arm nylon monofilament with ( 3 / 8 circle taper point needle ) , consumable 26.12 opsite dressing ( 15x28 ) , consumable 26.13 collagen dry sheet ( 10x10 cm sheet ) , consumable 26.14 collagen dry sheet ( 15x30 cm sheet ) , consumable 26.15 collagen dry sheet ( 20x40 cm sheet ) , consumable 26.16 oxidised cellulose absorbable hemostate ( 2x3 ) , consumable 26.17 oxidised cellulose absorbable hemostate ( 4x8 ) , consumable 26.18 oxidised cellulose absorbable hemostate ( 2x14 ) , consumable 26.19 oxidised cellulose absorbable hemostate ( 2x14 ) , consumable 26.2 oxidised regenerated cellulose absorbable hemostate ( 1x2 ) , consumable 26.21 oxidised regenerated cellulose absorbable hemostate ( 2x4 ) , consumable 26.22 oxidised regenerated cellulose absorbable hemostate ( 4*4 ) , consumable 26.23 dura patch ( g.patch ) ( 8x10 ) , consumable 26.24 dura patch ( g.patch ) ( 10x12 ) , consumable 26.25 incise drape mini ( 10x10 cm ) , consumable 26.26 opsite dressing ( 30x28 ) , consumable 26.27 tube ex changer and insertion aid in one size ( 2.5, 6.0 ) , consumable 26.28 soft and gentle adhesive for sealing area around stoma ( 60 gm ) , consumable 26.29 absorbent powder for covering excoriated / damaged skin around stoma ( size 25 gm ) , consumable 26.3 1 pc self adhesive drainable stoma bag for colostomy & illeostomy swiss roll self adhesive with flex patern, transparent drainable stoma bag with built in filter and velcro outlet ( size 75mm ) , consumable 26.31 1 pc self adhesive drainable stoma bag for colostomy & illeostomy double layered self adhesive with flex patern, transparent drainable stoma bag with built in filter and velcro outlet ( size 76 mm ) , consumable 26.32 1 pc self adhesive drainable stoma bag for urostomy with no return valve and easy flexible outlet ( 15 45mm ) , consumable 26.33 2 pc base plate / flange for colostomy / illeostomy / urostomy, self adhesive base plate custom cut with belt tabs, double layer of adhesive ( 40 mm ) , consumable 26.34 2 pc base plate / flange for colostomy / illeostomy / urostomy, self adhesive base plate custom cut with belt tabs, double layer of adhesive ( 50 mm ) , consumable 26.35 2 pc base plate / flange for colostomy / illeostomy / urostomy, self adhesive base plate custom cut with belt tabs, double layer of adhesive ( 60 mm ) , consumable [ 7410038 ] 26.36 2 pc base plate / flange for colostomy / illeostomy / urostomy, self adhesive base plate custom cut with belt tabs, double layer of adhesive ( 70 mm ) , consumable 26.37 2 pc pouches with free rotating lockring mechanism with filter and velcro clamp integrated in the bag ( 40 mm ) , consumable 26.38 2 pc pouches with free rotating lockring mechanism with filter and velcro clamp integrated in the bag ( 50 mm ) , consumable 26.39 2 pc pouches with free rotating lockring mechanism with filter and velcro clamp integrated in the bag ( 60 mm ) , consumable 26.4 tooke corneal knife ( num ) , consumable 26.41 2 pc pouches with free rotating lockring mechanism with filter and velcro clamp integrated in the bag ( 70mm ) , consumable 26.42 flexible self adhesive protective sheet to prevent excoriation ( 20x20 cm ) , consumable 26.43 polydioxanone irgacare mp coated ( 122cm , 1 loop sgle armed , 65mm ) , consumable 26.44 e.d.t.a. vacunater with needle ( 3 ml ) , consumable 26.45 plain vial with screw cap ( 12x75 ) , consumable 26.46 barraquer wire speculum, large ( num ) , consumable 26.47 disposable cresent knife ( 2.2mm ) , consumable 26.48 disposable keratom knife ( 2.8mm ) , consumable [ mis40 ] 26.49 disposable keratom knife ( 3.2mm ) , consumable [ mis41 ] 26.5 disposable sideport knife ( num ) , consumable 26.51 k wire ( length 375mm size:1.6mm roll ) , consumable 26.52 k wire ( length 375mm size:1.8mm roll ) , consumable 26.53 simcoe i / a cannula, direct, ( num ) , consumable [ mis110 ] 26.54 blood urea reagent kit ( 200ml ( 2x100ml ) ) , consumable [ mis20 ] 26.55 malaria bivalent antigen detecting rapid diagonstic tests ( rdts ) for p.f and pv ( 10 card, 10 apillary, 1 buffer solution, 10 alcohol swab, 10 sterile lancet for pricking, ( as per attached specification ) ) ( pack of 10 test.total tests:1cr, rate shall be quoted for pack of 10 ) , consumable [ 7004051 ] 26.56 rpr test kit ( 100 test ) , kit [ mis103 ] 26.57 set of phaco tip and test chamber ( phacoemulsification machine ) , consumable 26.58 test chamber sleeves ( 1 set consist of 2 pieces ) ( phacoemulsification machine ) , consumable 26.59 sets of i a system ( phacoemulsification machine ) , consumable 26.6 disposable cassette ( phacoemulsification machine ) , consumable 26.61 hb electrophoresis ( 200 test ) , consumable 26.62 protein electrophorosis in blood ( serum ) , urine , csf ( 200 test ) , consumable 26.63 conventional medical x ray film polyster based imaging film 35.6cmx43.2cm ( 14x17 ) ( size 50 sheet in one packet ) , consumable 26.64 conventional medical x ray film polyster based imaging film 35.6cmx35.6cm ( 14x14 ) ( size 50 sheet in one packet ) , consumable 26.65 conventional medical x ray film polyster based imaging film 30.5cmx30.5cm ( 12x12 ) ( size 50 sheet in one packet ) , consumable [ 7004063 ] 26.66 conventional x ray film 12x15 ( 50 sheet / pack ) , consumable 26.67 conventional x ray film 10x12 ( 50 sheet / pack ) , consumable 26.68 conventional x ray film 8x10 ( 50 sheet / pack ) , consumable [ 7004066 ] 26.69 urine container size of the container shall be 30ml disposable ( 50 per pkt ) , consumable 26.7 anastrozole tablet ( 1 mg ) , tablet 26.71 ppe kit ( as per attached specification ) , consumable 26.72 chewable antacid containing magnesium hydroxide minimum 250mg to 500mg+aluminimum hydroxide minimum 250mg to 500mg +simethecon / dimethicon minimum 25mg to 50mg tab ( additional component will also be accept ) , tablet 26.73 etanercept 25mg / vial ( pack of 2 vials ) , injection 26.74 dextromethorphan 10mg / 5ml ( 100ml bottle ) , syrup 26.75 oxygen cylinder with instrument set for oxygen delivery b type, make everest kanto cylinder limited; ( model everest;country of origin india ) , consumable 26.76 oxygen cylinder with instrument set for oxygen delivery d type, make everest kanto cylinder limited; ( model everest;country of origin india ) , consumable 26.77 m 30 d diluent ( 20ltr ) , consumable 26.78 m 30 r rinse ( 20ltr ) , consumable 26.79 filter for complete pulmonary function testing ( including dlco ) with body box ( 100 filters per pack, make medisoft sa ) , consumable 26.8 needle no 2 ( 1.5 ) , consumable 26.81 ophthalmic needles ( ) , consumable 26.82 silk suture ( 9 0 ( spatulated micropoint reverse cutting needle double armed suture ) ) , consumable 26.83 silk suture ( 10 0 ( spatulated micropoint reverse cutting needle double armed suture ) ) , consumable 26.84 chloranphenicol + dexamethasone ( 5ml ) , ointment 26.85 chloranphenicol 1% + dexamethasone 0.1% ( 5ml vial ) , eye drop 26.86 prednisolone acetate ( 1% 5ml / 10ml ) , eye drop 26.87 nepafenac ( 1mg / ml ) , eye drop 26.88 artificial tear ( 5ml ) , eye drop 26.89 sprit ( 450ml ) , solution 26.9 sensoracaine injection 0.25% ( 30ml ) , injection 26.91 hylase inj ( 1500iu ) , consumable 26.92 hpmc ( hydroxy propylmetty cellulose ) ( 5ml ) , injection 26.93 sinskey ii lens manipulating hook ( angled ) , consumable 26.94 nightingale capsule polisher ( posterior ) , consumable 26.95 castroviejo caliper ( straight ) , consumable 26.96 colibri forceps 1x2 teeth ( 0.12 mm ) , consumable 26.97 mc pherson tying forceps ( long handle ) , consumable 26.98 mc pherson forceps ( 11 mm angled ) , consumable 26.99 vannas capsulotomy scissors ( angled forward 11 mm blade ) , consumable 27 bard parker handle ( handle ) , consumable 27.01 anterior chamber washout cannula ( 16 g ) , consumable 27.02 pearce hydrosdissection cannula ( 35 inc ang 25 g ) , consumable 27.03 kellan hydrodelineation ( curved bevel tip 25g ) , consumable [ 750018 ] 27.04 jensen capsule polisher ( sand blast olive tip 23g ) , consumable 27.05 knolle pearce irrigating vectis ( ) , consumable 27.06 sterlization box with two sillicon mats ( ) , consumable 27.07 kratz barraquer wire speculum ( big ) , consumable 27.08 castoviejo cyclodialysis spatula ( 0.50 mm wide ) , consumable [ 750023 ] 27.09 utrata capsulorhexis forceps ( flat handle ) , consumable 27.1 eye scissors straight ( 4 1 / 2 lenth ) , consumable 27.11 kramer corneal fixation forceps ( ) , consumable 27.12 air injection canula ( 27g ) , consumable 27.13 desmarres lid retractor ( size 0 ) , consumable [ 750028 ] 27.14 ranibizumab 10mg / ml injection ( intenvitral 0.25ml ) , injection 27.15 prochlorperazine tab ( 5mg ) , tablet 27.16 bed sheet colored 60x90 ( 60x90 ) , consumable 27.17 blanket cover 54x90 ( for cover of above size blanket ) , consumable 27.18 blanket cover 60x90 ( for cover of above size blanket ) , consumable 27.19 mattress cover 3x6 ( for cover of above size mattress ) , consumable 27.2 livery set pants and shirt without stitching ( 3 meter cloth ) , consumable 27.21 ladies livery set saree white polyester green / blue border with blouse ( 6.50 mtr ) , consumable 27.22 surgeon gown ( std size ) , consumable 27.23 micro pipette tips 5 300ul ( 100 per pack ) , consumable 27.24 collection tube polystrene ( 100 per pack ) , consumable 27.25 baby suit plain phalalane suit ( 5 peace ) , consumable 27.26 gram staining kit ( crystal ) ( 125ml x 4 ) , consumable 27.27 acid fast staining kit ( carbol ) ( 125ml x 3 ) , consumable 27.28 widal slide test ( 4x5ml with control ) , consumable 27.29 hbv elisa test kit pack size : 96 wells per kit ( rate should be quoted for 1kit containing 96 27.3 hbv rapid test kit quantity is in no. of test card only ( and rate should be quoted for one test card ) , consumable 27.31 torsemide ( 20mg ) , tablet 27.32 temephose 50% ec ( 5 litre ) , chemical 27.33 bti 5% as ( biolarvicide ) , consumable 27.34 diflubenzuron 25% wp ( chemical larvicide ) , consumable 27.35 cyphenothrin 5% ec ( spray ) , consumable 27.36 technical malathion ( spray ) , consumable 27.37 triple sugar iron agar ( 100gm pack ) , consumable 27.38 selenite f broth ( 100gm pack ) , consumable 27.39 nutrient broth ( 500 gm ) , consumable 27.4 muller hinton agar ( 500 gm ) , consumable 27.41 sabroud dextrose agar with chlorophenicol ( 100 gm ) , consumable 27.42 simmons citrate agar ( 100 gm ) , consumable 27.43 brain heart infusion broth ( 500 gm ) , consumable 27.44 columbia blood agar base ( 500 gm ) , consumable 27.45 cled agar ( 500 gm ) , consumable 27.46 glucose phosphate broth ( 100 gm ) , consumable 27.47 cristensens urea agar base ( 100 gm ) , consumable 27.48 salmonella shigella agar ( 100 gm ) , consumable 27.49 cary blair medium base ( 100 gm ) , consumable 27.5 tcbs agar ( 100 gm ) , consumable 27.51 bile salt agar ( 100 gm ) , consumable 27.52 bile esculin agar ( 100 gm ) , consumable 27.53 cetrimide agar ( 100 gm ) , consumable 27.54 cedar wood oil ( 125 ml ) , consumable 27.55 amikacin 30 mcg ( 1 packet of 5 vial ( each vial of 100 disc ) ) , consumable 27.56 imipenem 10 mcg ( 1 packet of 5 vial ( each vial of 100 disc ) ) , consumable 27.57 co trimoxazole ( sulpha / trimethoprim ) 25 mcg ( 23.75 / 1.25 ) ( 1 packet of 5 vial ( each vial of 100 disc ) ) , consumable 27.58 nitrofurantion 300 mcg ( 1 packet of 5 vial ( each vial of 100 disc ) ) , consumable 27.59 nalidixic acid 30 mcg ( 1 packet of 5 vial ( each vial of 100 disc ) ) , consumable 27.6 amoxyclav ( amoxycillin / clavulanic acid ) 20 / 10 mcg ( 1 packet of 5 vial ( each vial of 100 disc ) ) , consumable 27.61 gentamicin 10 mcg ( 1 packet of 5 vial ( each vial of 100 disc ) ) , consumable 27.62 ciprofloxacin 5mcg ( 1 packet of 5 vial ( each vial of 100 disc ) ) , consumable 27.63 ceftriaxone 30 mcg ( 1 packet of 5 vial ( each vial of 100 disc ) ) , consumable 27.64 cefuroxime 30 mcg ( 1 packet of 5 vial ( each vial of 100 disc ) ) , consumable 27.65 teicoplanin 30 mcg ( 1 packet of 5 vial ( each vial of 100 disc ) ) , consumable 27.66 piperacillin 100 mcg ( 1 packet of 5 vial ( each vial of 100 disc ) ) , consumable 27.67 norfloxacin 10 mcg ( 1 packet of 5 vial ( each vial of 100 disc ) ) , consumable 27.68 colistin 10 mcg ( 1 packet of 5 vial ( each vial of 100 disc ) ) , consumable 27.69 cefoperazone 75 mcg ( 1 packet of 5 vial ( each vial of 100 disc ) ) , consumable 27.7 piperacillin / tazobactam 100 / 10 mcg ( 1 packet of 5 vial ( each vial of 100 disc ) ) , consumable 27.71 ceftazidime 30 mcg ( 1 packet of 5 vial ( each vial of 100 disc ) ) , consumable 27.72 cefazoline 30 mcg ( 1 packet of 5 vial ( each vial of 100 disc ) ) , consumable 27.73 ampicillin 10 mcg ( 1 packet of 5 vial ( each vial of 100 disc ) ) , consumable 27.74 tobramycin 10 mcg ( 1 packet of 5 vial ( each vial of 100 disc ) ) , consumable 27.75 polymyxin b ( 1 packet of 5 vial ( each vial of 100 disc ) ) , consumable 27.76 doxycycline hydrochloride 30 mcg ( 1 packet of 5 vial ( each vial of 100 disc ) ) , consumable 27.77 chloramphenicol 30 mcg ( 1 packet of 5 vial ( each vial of 100 disc ) ) , consumable 27.78 tetracycline 30 mcg ( 1 packet of 5 vial ( each vial of 100 disc ) ) , consumable 27.79 azithromycin 15 mcg ( 1 packet of 5 vial ( each vial of 100 disc ) ) , consumable 27.8 levofloxacin 5 mcg ( 1 packet of 5 vial ( each vial of 100 disc ) ) , consumable 27.81 erythromycin 15 mcg ( 1 packet of 5 vial ( each vial of 100 disc ) ) , consumable 27.82 clindamycin 2 mcg ( 1 packet of 5 vial ( each vial of 100 disc ) ) , consumable [ 121051 ] 27.83 penicillin 10 units ( 50 100 disc per pack ) , consumable 27.84 vancomycin 30 mcg ( 50 100 disc per pack ) , consumable 27.85 cisplatin 0.5 mg / ml injection ( 20 ml vial ) , injection 27.86 clonidine 150 mcg / ml ( injection 1 ml amp ) , injection 27.87 clonidine hydrochloride ( 500 mcg injection vial / amp ) , injection 27.88 dextrose d 50 0.5 infusion ( 500 ml ffs bottle ) , infusion 27.89 dicyclomine hydrochloride 10 mg / ml ( injection 2 ml vial ) , injection 27.9 electrolyte e ( multiple electrolytes and dextrose injection type v ip ) type v ip infusion ( 500 ml ffs bottle ) , infusion 27.91 electrolyte g ( multi electrolyte with 5% dextrose iv injection type iv ip ) type iv ip infusion ( 500 ml ffs bottle ) , infusion 27.92 etophylline + theophylline ( 46.5 + 40 ) ( mg / 5 ml syrup 100 ml bottle ) , syrup 27.93 heparin 25000 iu injection ( 5 ml ) , injection 27.94 formoterol + fluticasone 250 mg + 500 mg rotacaps ( 30 capsul pack with rothelar ) , rotahaler 27.95 heparin sodium + benzyl nicotinate 50 iu + 2 mg ( ointment 20 gm ) , ointment 27.96 homatropine 2 % ( eye drops 5 ml ) , eye drop 27.97 hydroxyethylstarch 6% solution with sodium chloride 0.9% iv infusion i / v hydroxyethylstarch 6% solution with sodium chloride 0.9% ( infusion 500 ml ffs bottle ) , infusion 27.98 iron & folic acid 20 mg / ml + 100 mcg / ml syrup ( 50 ml with dropper ) , syrup 27.99 ivf hydroxy ethyl starch 3% injection ( 500 ml ) , injection 28 levobupivacaine 0.01 injection ( vial ) , injection 28.01 levosalbutamol + ipratropium 100 mcg + 40mcg rotacaps ( 30 capsul pack with rothelar ) , rotahaler 28.02 levosalbutamol 1 mg / 5 ml ( syrup 100 ml ) , syrup [ 121081 ] 28.03 levosalbutamol 100 mcg rotacaps ( 30 capsul pack with rothelar ) , rotahaler 28.04 lignocaine spray 0.1 spray ( 100 ml ) , miscellaneous 28.05 lignocaine spray 2 % spray ( 30 ml ) , spray 28.06 linazolid 200 mg / 100 ml infusion ( 300 ml ) , infusion 28.07 liposomal doxorubicin ( 20 mg injection vial ) , injection 28.08 liquid fluoxetine ( 20 mg / 5 ml liquid 30 ml ) , liquid 28.09 liquid risperidone ( 1 mg / ml liquid 60 ml ) , liquid 28.1 morphine sulphate ( 30 mg ) , tablet 28.11 afatinib ( 40 mg ) , tablet 28.12 albendazole + ivermectin ( 400mg + 6mg ) , tablet 28.13 chymotrypsin + trypsin ( 20000 iu + 100000 iu ) , tablet 28.14 artesunate + sulphadoxine + pyrimethamine ( age group 9 to 14 years ) ( 50 mg ( 3 tab ) � � � � � � + 500 mg ( 2 tab ) + 25 mg ( 2 tab ) tablet 1 combi pack ) , tablet 28.15 artesunate + sulphadoxine + pyrimethamine ( age group of less than 1year ) ( 25 mg ( 3 tab ) + 250 mg ( 1 tab ) + 12.5 mg ( 1 tab ) tablet 1 combi pack ) , tablet 28.16 rifampicin + ethambutol + isoniazid pyrazinamide ( 150 mg + 225 mg + 400 mg + 750 mg ) , tablet [ 120801 ] 28.17 lactic acid bacillus ( 5 mg ) , tablet [ 120805 ] 28.18 chloramphenicol + dexamethasne ( 1% + 0.1% ) ( 5 ml ) , eye ointment [ 120682 ] 28.19 chlorpheniramine melate + phenylephrine ( 5 mg + 2 mg each 5ml infusion 100 ml bottle ) , infusion 28.2 isoniazid ( 100mg ( as per attached specification ) ) , tablet 28.21 isoniazid ( 300 mg ( as per attached specification ) ) , tablet 28.22 adenosine ( 2 ml amp ) ( 3 mg / ml ) , injection 28.23 disposable needle 20 g no ( isi marked needle ) , consumable 28.24 polyester braided coated with cd white dn 17 mm taped cut 90 cm 2 / 0 ( 12 foils / pkt ) ( surgical suture ) , consumable 28.25 gauge than ( 91cm x 20 mtr ) , consumable 28.26 chlorhexidine gluconate ( antiseptic ) ( 0.004 solution 500 ml bottle ) , solution 28.27 lmwh low molecular weight heparin inj ( 4000iu / ml. injection 4000iu / ml injection solution for ) , injection solution for 28.28 lmwh low molecular weight heparin inj. 6000 x 000d iu / ml, injection ( injection solution for 6000 x 000d iu / ml ) , injection solution for 28.29 lysol ip ( cresol with soap solution ) 5ltr jar ( medicine 5ltr jar ) , liquid 28.3 lysol ( cresol with soap solution ) 53% + 47% ( solution 5 ltr ) , liquid 28.31 magnesium hydroxide ( syrup 400 ml ) , syrup 28.32 meropenem + sulbactum ( 1 gm + 500 mg ) ( 1.5 gm injection vial ) , injection 28.33 micronised progestrone 50 mg / ml ( injection 2 ml amp ) , injection 28.34 milk of magnesia + liquid paraffin + phenolphthalein ( cremaffin pink formula ) ( ( 11.25 ml + 3.75 ml + 50 mg ) / 15 ml syrup 170 ml bottle ) , syrup 28.35 multi vitamin each ml containvit a 3000 iu vit b1 1mg riboflavin phosphate sodium 2mg, panthenol 2.5mg niacinamide 10mg pyridoxin 1 mg cynacobalamine 1mcg lysine 10 mg ( 15ml oral drop 15ml ( with dropper, which should be able to screw & cap the bottle ) in unit carton ) , drop 28.36 neomycin + bacitracin zinc + sulphacetamide sodium ( 5 mg + 250 unit + 60 mg powder 10 gm ) , powder 28.37 neomycin + polymyxin b sulphate + zinc bacitracin ( neosperine ) ( ( 3400 iu ) + ( 5000 iu ) + ( 400 iu ) powder 10 gm ) , powder 28.38 neomycin + polymyxin b sulphate + zinc bacitracin ( neosperine ) ( ( 3400 iu ) + ( 5000 iu ) + ( 400 iu ) ointment 28.3 gm ) , ointment 28.39 neomycin sulphate + bacitracin zinc ( 5 mg + 500 iu / gm ointment 15 gm ) , ointment 28.4 nicotinamide + folic acid + cyanocobalamin 200 mg + 15 mg + 500 mcg ( injection 10 ml ) , injection 28.41 nicotine 14 mg transdermal patch ( strip ) , transdermal patch 28.42 nicotine 2 mg gum ( strip ) , gum 28.43 nicotine 2 mg lozenges ( strip ) , lozenges 28.44 nicotine 4 mg gum ( strip ) , gum 28.45 nitroglycerine ( glyceryl tri nitrate ) 25 mg / 5 ml injection ( 5 ml amp ) , injection 28.46 paracetamol for iv 10 mg / ml infusion ( 100 ml ffs bottle ) , infusion 28.47 pilocarpine 0.02 eye drops ( 5 ml vial ) , eye drop 28.48 cyproheptadine hcl ( 200ml syrup ) , syrup 28.49 bisacodyl ( 10 mg ) , suppository 28.5 basal insulin glargin ( 40 iu / ml vial / cartridge ) , injection 28.51 basal insulin glargin 300 iu injection penfill 300 iu with free permanent pens one pen for ( each five cartridge and 10 needles per pen ) , injection 28.52 biphasic isophane insulin injection 30 / 70 ( 30% soluble insulin 70% isophane insulin ) ( 40 iu / ml 10ml vial ) , injection 28.53 bethanechol ( 25mg ) , tablet [ 120806 ] 28.54 ciprofloxacin 0.003 ( 3 / 3.5 gm ) , eye ointment 28.55 alkaline citrate with potassium ( sodium citrate 1gm + potassium citrate 0.65gm +citric acid 1gm ) / ) ( 10ml oral solution 100ml bottle ) , solution 28.56 benzyl nicotinate topical + heparin topical ( 2mg + 50iu ( 20gm ) ) , ointment 28.57 calcium dobusulate calcium dobesilate + lignocaine + hydrocortisone + zinc oxide ( 0.25% + 3% + 0.25% + 5% w / w ( 30 gm ) ) , cream 28.58 calcium dobusulate ( 500 mg ) , capsule 28.59 folic acid + l glutamic acid + pyridoxin + thiamine ( 1.5mg + 45mg + 5mg + 5mg ) , tablet 28.6 iron and folic acid sugar coated pink ( as per nipi guidelines ) ( 45mg + 0.4mg ) , tablet 28.61 surgical suture ( ) , consumable 28.62 premixed insulin biphasic analogue 30 / 70 in penfill 300iu permanent pens ( one pen per five cartridges and ten needles per pen 300iu injection vial / amp ) , injection 28.63 povidone iodine vaginal ( 200 mg ) , pessary 28.64 salbutamol nebuliser solution bp sabutamol sulphate eq. to salbutamol 1mg per ml ( 2.5 ml amp ) , suspension 28.65 salmetrol + fluticasone 250 mcg rotacaps ( 30 capsul pack with rothelar ) , rotahaler 28.66 salmetrol + fluticasone 500 mcg rotacaps ( 30 capsul pack with rothelar ) , rotahaler 28.67 terbutaline suplhate 0.5 mg / ml ( injection 1 ml amp ) , injection 28.68 tiotropium 9 mcg rotacaps ( 30 capsul pack with rothelar ) , rotahaler 28.69 torasemide 10 mg / ( vial injection vial ) , injection 28.7 vitamin k 1 mg / 1 ml injection ( 1ml amp ) , injection 28.71 acetaminophen + tramadol hydrocloride 325 mg + 37.5 mg ( tablet 10 x 10 ) , tablet 28.72 frusemide + amiloride 40 mg + 5 mg ( tablet 10 x 10 ) , tablet 28.73 potassium chloride 175 mg tablet ( strip ) , tablet 28.74 prazosin 1 mg ( tablet 10 x 10 ) , tablet 28.75 rifampicin + isoniazid 450 mg + 300 mg capsule ( 750 mg ) , capsule 28.76 theophylline + etophylline ( 35mg ) + ( 115mg ) ( 150mg tablet strip ) , tablet 28.77 dextrose, d 50 0.5 infusion ( 100 ml ffs bottle ) , infusion 28.78 dextrose, d 50 50% injection ( 10 ml amp ) , injection 28.79 isoxsuprine hcl 40 mg injection ( vial / amp ) , injection 28.8 liquid piracetam 500 mg / 5 ml ( liquid 100 ml ) , liquid 28.81 nacl drip 3 % infusion ( 100 ml ffs bottle ) , infusion 28.82 saline ( nacl ) 0.9 % nasal drops ( 10 ml ) , nasal drop 28.83 theophylline + etophylline ( 25.3mg ) + ( 84.7mg ) injection ( 2 ml ) , injection 28.84 synthetic pyrethrum ( 5% ) , solution 28.85 temephos ( 5% ) , solution 28.86 dextran 40 0.4 injection ( 500 ml ) , injection 28.87 dextran 70 0.06 infusion ( 500 ml ffs bottle ) , infusion 28.88 tinidazole i.v. 2 mg / 1ml infusion ( 400 ml ) , infusion 28.89 ambu bag / adult each 1000 1700ml, with oxygen connecting tube , should be supplied with a carry pouch , ambu bag should be complete with required autoclavable valves and other accessories, ( ( should have silicon rubber bellow to withstand autoclave at 134 degree c ) should be multiple times autoclavable ) , consumable 28.9 tranexamic acid 500 mg / 5ml injection ( 5 ml amp ) , injection [ 121094 ] 28.91 blood bag double 350ml ( as per attached specification ) , each [ 121210a ] 28.92 blood bag triple 350ml as per attached specification ( each ) , bag 28.93 blood bag triple sagam 450ml ( as per attached specification ) , each 28.94 blood bag triple sagam 350ml ( each ) , bag [ 121212 ] 28.95 single blood bag ( as per attached specification ) , each 28.96 i.v cannula for single use ( intravascular catheters ) bis ( gauze 22, length 25 ) consumable ( each ) , consumable 28.97 i.v cannula ( two way ) size ( 16 nos ) , consumable 28.98 i.v cannula size with inj. valve ( port ) ( 22g ) , consumable 28.99 quadruple blood bags as per attached specification ( each ) , consumable 29 placenta extracts ( 0.1gm vial / amp ) , injection 29.01 ambu bag ( silicon type ) paediatrics each 300 500 ml with oxygen connecting tube, should be supplied with a carry pouch, ambu bag should be complete with required autoclavable valves and other accessories ( ( should have silicon rubber bellow to withstand autoclave at 134 degree c, should be multiple times autoclavable ) , consumable 29.02 b.b silk ( 12 foils / pkt ) ( 3 / 8rcut needle 45mm length 76cm, size 2 / 0 ) ( consumable ) , consumable 29.03 disposable sterile gloves isi marked surgical rubber made of hypoallergic latex 100% , electronically tested sterilized by gamma irradiation / eto is no:13422:1992 as amended upto, powder free 6 inch / pair ( pair ) , consumable 29.04 disposable sterile gloves isi marked surgical rubber made of hypoallergic latex 100% , electronically tested sterilized by gamma irradiation / eto is no:13422:1992 as amended upto, powder free 6.5 inch / pair ( pair ) , consumable [ 13002 ] 29.05 polyamide mono filament ( nylon ) with cd cut needle 20 / 16 mm length 70 cm size 2 / 0 ( 12 foils / pkt ) , consumable [ 121206 ] 29.06 disposable sterile gloves isi marked surgical rubber made of hypoallergic latex 100% , electronically tested sterilized by gamma irradiation / eto is no:13422:1992 as amended upto, powder free 7 inch / pair ( pair ) , consumable [ 13003 ] 29.07 disposable sterile gloves isi marked surgical rubber made of hypoallergic latex 100% , electronically tested sterilized by gamma irradiation / eto is no:13422:1992 as amended upto, powder free 7.5 inch / pair ( pair ) , consumable [ 13004 ] 29.08 black braided silk with 1 / 2 cir cutting needle 16mm length 75cm size 3 / 0 ( 12 foils / pkt ) , consumable [ 121207 ] 29.09 draw sheet ( each ) one side linen and one side autoclavable water proof sheet size 58x36 ( each ) , consumable [ 13005 ] 29.1 insulin syringe { auto disabled ( ad ) / reuse prevantion ( rup ) syringe } with 31g needle ( single unit pack ) is marked, 40 iu ( each ) , consumable [ 13006 ] 29.11 insulin syringe with 31g needle ( single unit pack ) is marked, 100iu, { auto disabled ( ad ) / re use prevantion ( rup ) syringe ( each ) , consumable 29.12 insulin syringe { auto disabled ( ad ) / reuse prevantion ( rup ) syringe } / each ( graduation upto 100 units ) 30g needle, 40 units / ml ( 30 g needle, 40units / ml ) syringe ( each ) , consumable 29.13 mackintosh ( as per attached specification ) , quantity amended as 300000 meter i.e 15000 roll of 20 meter roll, rate should be quoted for 20 meter, is 8164 1976 or conforming to is 8164 1976 ( roll ) , consumable 29.14 vial 5ml, vial test tube, leak proof, ungraduated, polypropylene / polyethylene capacity 5ml each ( each ) , consumable 29.15 solubility test kit ( for sickle cell ) , 50 test / kit, as per attached specification, control sample is not mandatory acessories required 1. dropper 2.test tube ( standard size ) / vial 3. reading stand 4.micropipette with tip / capillary tube 5.lancet ( 6.alcohol swab , kit ) , kit 29.16 nestroft test kit ( for thalasemia traits ) , 50 test / kit, as per attached specification ( kit ) , kit 29.17 screw cap vial with o ring ( 2ml ) , screw cap, leak proof self standing / flat bottom with o ring, un graduated, polypropylene / polyethylene, 2ml capacity each ( each ) , consumable 29.18 steralised and autoclavable culture tube flat bottom, 5ml ( plastic ) ( each ) , consumable 29.19 recombiant fviii ( 1000 iu / vial ) , vial 29.2 bone wax sterilised ( 2.5 gm / packet ) ( consumable ) , consumable 29.21 formaline 37% ( 500 ml bottle ) , consumable 29.22 iv cannula with inj.valve ( port ) ( size 26g each consumable ) , consumable 29.23 radio opaque catheter with ptfe / polyurethine / fep / volex material ( iv safety cannula with luer lock ( g 18 ) ) , consumable 29.24 radio opaque catheter with ptfe / polyurethine / fep / volex material ( iv safety cannula with luer lock ( g 20 ) ) , consumable 29.25 radio opague catheter with ptfe / polyurethine / fep / volex material ( iv safety cannula with luer lock ( g 22 ) ) , consumable 29.26 safe delivery kit 1 plastic desposable gown ( non woven plastic laminated, leak proof ) 2 ( 4*4 ) , ( 2 ) disposable goggles for protection of eyes 2 ( free size ) , ( 3 ) face mask 2 free size ( 4 ) plastic disposable cap ( non woven plastic laminated, leak proof ) ( ( 1pair, ( 5 ) long gloves elbow length 2pairs ( 6 1 / 2 and 7 ) ( 6 ) disposable shoe covers till calf ( plastic ) 2pair umbical cord clamps plastic material ( 1pair ) ( free size ) ( as per attached specification ) ) ) , consumable 29.27 potassium free, hemodialysis fluid for bicarb made ( ( part a 10 ltr +part b 500gm2 / pkt ) ) , consumable 29.28 potassium free, hemodialysis powder for bicarb made ( ( part a powder to make 10 ltr +part b 500gm 2 / pkt ) ) , consumable 29.29 uric acid ( 50 ml ( 2 x 25 ml ) , consumable 29.3 disposable syringe { auto disabled ( ad ) / re use prevantion ( rup ) syringe } ( ( for vitamin k inj ) ( 1ml with needle 26g ) ) , consumable 29.31 albumin reagent kit, 200ml ( 4*50 ml ) , consumable 29.32 electric cautery lead / each disposable electro surgical pencil 4cm ( each ) , each 29.33 glycrine i.p. ( 400 gm ) , solution 29.34 glycrine i.p. ( 50 gm ) , solution 29.35 polybutester with polytribolate coating 7 0 60 cm, blue 8 mm 3 / 8 circle ( taper point double arm ) , surgical material 29.36 long term absorbable polyglyconate knotless wound closure device with unidirectional & dual angled cut barbs geometry 0, 30 cm ( green 37 mm 1 / 2 circle taper point ) , sutures 29.37 monofilament glycomer 1 , 90 cm ( violet 40mm 1 / 2 circle taper point ) , sutures 29.38 hemorrhoid stapler 33 mm diameter with detachable anvil ( staple height 3.5 mm ) , sutures 29.39 reusable gastro intestinal anastomotic stapler 60 mm with dual firing knob ( inbuilt knife in every cartridge ) , sutures 29.4 reusable gastro intestinal anastomotic stapler 80 mm with dual firing knob ( inbuilt knife in every cartridge ) , sutures 29.41 medium wound protector ( 5 9 cm ) , sutures 29.42 3 dimensional polyester mesh with micro porosity ( x stich macro porosicty and multidirectional elasticity with optimesed atello collagen 1 absorbable anti adhesive barrier 15 cm circular with nylon prefixed sutures ) , consumable 29.43 polyester self gripping mesh with poly lactic acid for open incisional hernia repair ( size 15 x 15 cm ) , consumable 29.44 titanium non absorbable 5 mm ( helical tacker for mesh fixation with 30 tacks ) , consumable 29.45 ag ion impregnated central venous triple lumen polyurethane catheter ( 7.5 fr, g 14x18x18 length 16 cm ) , consumable 29.46 therma coal box ( box ) , consumable 29.47 potassium di chromate ( chornicals formula:k2cr207, formula wt:294.2, minimum assay 99.5% 1kg ) , consumable 29.48 phenolic compounds containing disinfectants ( houschold disinfectant, containing ohcnolic compounds such as monochlorophenol, coal tar acid, oils and mulsifiers etc.the approx content of phenolic compounds should be at least 40% 5 ltrs ) , consumable 29.49 basie fuchsin chemical name:pararosaniline hydrochloride, chemical structure c20h20cin3 mol wt:337.86 dye content: approx 85% 88% dye content must be mentioned color: metalic green ( 25 gms glass bottle ) , consumable 29.5 sulphuric acid ( chemicals name sulphuric acid formula wt:98.08, specific gravity 1.84 minimum assay 98% 500ml ) , consumable 29.51 malachit green ( malachit green hydro chloride, chemical structure:c23h25ctn2 molecular wt 364.9 colour green dye co ) , consumable 29.52 methylene blue ( methylene thionine chloride, chemical structure:c23h25cin3s molecular wt:319.9 dye content:approx 82% ( dye content must be mentioned ) ) , consumable 29.53 hydrochloric acid ( concentrated hydro chloric acid molecular wt;36 46 specific gravity 1.18 1ltr ) , consumable 29.54 porassium permanganate ( kmno4 formula wt;158 500gms ) , consumable 29.55 auramine ( c17h22cin3 mol wt:303.84 25 gms ) , consumable 29.56 liquid paraffin ( heavy grade ) ( refractive index of 1.48 it should be colourless odurless transparent free from fluorescene in day light with relative density of 0.5 50 ml ) , consumable 29.57 sodium citrate ( trisodium citrate dihydrate, ar grade chemical structure na3c6h5o7.2ho molecular wt ( fw ) 294.10purity 500 gms ) , consumable 29.58 potassium phosphate ( potassium di hydrogen ortho phosphate kh2po4 molecular wt:136.1 minimum assay 99% 1kg ) , consumable 29.59 magnesium sulphate ( mgso4 7h2o;mol wt 246.48;purity 99.5% 1kg ) , consumable 29.6 magnesium citrate ( tribasic; c12h10mg3o14.9 h2o mol wt:613.28 500 gms ) , consumable 29.61 l asparagine monohydrate ( c4h8n23.h2o mol wt: 150.14 25 gms ) , consumable 29.62 glycerol ( ch2ohchohch2oh mol wt:92.1 purity 99.5% 1 ltr ) , consumable 29.63 sodium hydroxide pellets ( naoh formula wt:40 minimum assay:98% 500gm ) , consumable 29.64 cetyl pyridinium chloride ( chemical structure: c21h38cin.h2o / 358 500gms ) , consumable 29.65 sodium chloride ( chemical structure: nac1 molecular weight:58.44 minimum assay:99.9% 1 kg ) , consumable 29.66 dihydrostreptomycin sedquisulphate ( sigma d 7253 25 gms ) , consumable 29.67 isonicotinic acid hydarazide ( sigma i 3377 25 gms ) , consumable 29.68 rifampicin ( sigma r 3501 25 gms ) , consumable 29.69 ethambutol dlhydrochloride ( sigma e 4630 25 gms ) , consumable 29.7 pnb ( para nitro benzonic acid formula wt: 167.12 min assay 99% c6h4coohno2 100 gms ) , consumable 29.71 cyanogen bromide ( cnbr cisco research lab:mol wt:105.9 100 gms ) , consumable 29.72 o tolidine a.r ( dimethyl benzidine: c14h16n2 from wt 212.3 ) , consumable 29.73 hydrogen peroxide ( ar or gr grade assay 29 32% solution fw 34.01 1 ltr ) , consumable 29.74 tween 80 ( polyoxyethylenesorbitanmoonooleate ar or gr grade density 1.06 1.09g / ml 500 ml ) , consumable 29.75 oxalic acid ( pure ) ( coohcooh.2h2 mol wt:126.07 purity 99.8% 500gms ) , consumable 29.76 absolute alcohol ( ethanol 1 ltr ) , consumable 29.77 liquor ammonia ( lr / gr grade 1ltr ) , consumable 29.78 sodium carbonate ( na2co3 wt: 106 minimum asay 99% 500 gms ) , consumable 29.79 n n dimethyl formamide ( hcon ( ch3 ) 2 mol wt:73.09 500 ml ) , consumable 29.8 formaldehyde ( hcho mol wt 30.03 wt per ml at 20oc 1.075 1.095g; methanol contant 10 15% assay ( acidimetric ) as hcho 37 11% 1 ltr ) , consumable 29.81 spare caps for universal containers ( spare caps with liner for universal containers 28 ml wide neck pack of 100 nos ) , consumable 29.82 diamond marker pencil ( 6 holder with artificial diamond ( hard stone ) embedded at one end with screw cap to mark on microscope glass slides 6 nos ) , consumable 29.83 grease marking pencil ( mps, blue or red coloured, length to write on glass ware / metal surfaces 8 nos ) , consumable 29.84 cotten ( absorbent, each roll of 0.5 kg 10 rolls ) , consumable 29.85 filter paper ( filter paper no 1, 12.5 cms diameter for filtering carbot fuchsin using a small funnel of 10cm maximum diameter smooth on one 120 packs ) , consumable 29.86 brown paper for packing ( 115 cm.x 75 cm size sheets 75 sheets ) , consumable 29.87 non absorbent cotton ( non absorbent cotten rolls of 1 / 2 kg cach surgical grade 4kg ) , consumable 29.88 lens paper ( soft microsope lens cleaning tissue, 4x6 booklet each booklet containning 100 sheets 50 booklets ) , consumable 29.89 slides ( glass microscope slides 76mm x 26mm x 1.3mm, plain one pack of 50 slides 50 packs ) , consumable [ 121178 ] 29.9 test tubes ( glass autoclavable and heat resistant standerd rimless 150 x 16mm with screw caps 1 ) , consumable 29.91 loop wire ( nichrome wire 24 standard wire gauge ( swg ) or 0.002 inches or 0.559 mm thickness swg 10 metres ) , consumable 29.92 glass beads ( acid washed 3mm diameter round transpatent for dispersing the clumps of microorganisms by vortexing or blending 500 29.93 bijou bottles ( borosilicate or corning glass of 5 ml capacity witj screw caps of aluminium with rubber liners suitable for bijou bottles, leak proof 250 ) , consumable 29.94 spare caps for bijou bottles ( screw caps of aluminium with rubber liners suitable for bijou bottles 500 ) , consumable 29.95 alcohol ( 500ml ) , consumable 29.96 basie fuchsin ( 25 gm glass bottle ) , consumable 29.97 carbolic acid phenol ( 500ml ) , consumable 29.98 falcon tube ( conical bottom ) ( 50ml each plastic containers with air tight screw cap printed graduation ) , consumable 29.99 artificial immersion oil refractive index of 1.48 it should be colorless, odorless, transparent and free from fluorescence in day light eith relative density of 0.827 to 0.890, viscosity of 110 to 230 m pa s; specific gravity of 0.76 0.78 at 15.5 c ( 50 ml bottle ) , consumable 30 methylated spirit ( 500 ml bottle ) , consumable 30.01 phenolic compound / phenol crystal chemical name: phenol, chemical structure: c6h5oh, molecular wt: 94.11, melting point:40 c+2 purity: 99.5% ( 500 gm glass bottle ) , consumable 30.02 sputum container ( 100 per box ) , consumable 30.03 sulphuric acid ( 500ml glass bottle ) , consumable 30.04 ice pack ( pack ) , consumable 30.05 para film sealing film ( film ) , consumable 30.06 therma coal box ( box ) , consumable 30.07 hydroxy propyl methyl cellulose injection 2% ( 3ml prefilled syringe ) , syrings 30.08 diflubenzuron 25% wp ( 1kg ) , consumable 30.09 cepodoxamine 200 mg + clavulanic acid 125mg tab ( 200mg + 125 mg ) , tablet 30.1 hiv ( rapid ) ( whole blood finger prick test kit ) , consumable 30.11 pre & pro biotic sachet each sachet ( 0.5 gm ) contain: streptococcus faecalis t 110 30 million clostridium butyricum toa 2million bacillus mesentericus to a 1 million lactic acid bacillus 50 million ( lactobacillus sporogenes ) ( 0.5 gm sachet ) , sachet 30.12 disposable under pad dimention of sheet 60*90 cm ( inside ) ( weight 80 gm unit ) , consumable 30.13 tetrastarch 6% infusion ( 500 ml bottle ) , infusion 30.14 milk of magnesia+liquid paraffin 11.25ml+3.75ml ) 15ml ) , syrup ( 200ml bottle ) , syrup 30.15 clindamycin 300mg capsule / tab ( 10x10 ) , tablet capsule 30.16 amoxycillin 250 mg + cloxacillin 250 mg cap ( 10x10 ) , capsule 30.17 each uncoated chewable tablet contains dride aluminium hydroxide i.p 240 mg magnesium ( hydroxide i.p 100mg activated dimethicone i.p 25mg light magnesium carbonate ip 60mg ) , tablet 30.18 promethazine 25 mg / ml ( 1ml amp ) , ampule 30.19 heamocoagulase 1 iu / ml ( 1ml amp ) , ampule 30.2 vancomycine eye drop 2.5% , 5ml ( 2.5% , 5ml ) , drop 30.21 chloranphenicol eye ointment 0.5% ( 0.5% ) , ointment 30.22 chloranphenicol + polymycin b eye drop, 4mg / ml, 5ml ( 4mg / ml, 5ml ) , eye drop 30.23 gancyclovir eye ointment 0.15%, 3gm tube ( 0.15%, 3gm tube ) , ointment 30.24 amphotericin b ointment 2.5%, 5gm ( 2.5%, 5gm ) , ointment 30.25 variconazole eye drop ( power form soulation ) 1%, 5gm ( ( power form soulation ) 1%, 5gm ) , eye drop 30.26 fluoro metholone 0.1%, 5ml ( 0.1%, 5ml ) , ampule 30.27 dexamethalone 0.1%, 5ml ( 0.1%, 5ml ) , ampule 30.28 betamethasone 0.1%, 5ml ( 5ml ) , drop 30.29 surgical blade 15 no ( 100 / pkt ) , surgical material 30.3 defluprednate eye drop, 5ml ( 5ml ) , drop 30.31 lotepredrrelol eye drop, 5ml ( 5ml ) , eye drop 30.32 indomethacin eye drop 0.5%& 1% ( 5ml ) , eye drop 30.33 ketorolac eye drop 0.4% ( 5ml ) , eye drop 30.34 diclofenac eye drop 0.1% ( 5ml ) , eye drop 30.35 tropicamide eye drop 0.5% ( 5ml ) , eye drop 30.36 tropicamide + phenylephirne eye drop 1% ( 5ml ) , eye drop 30.37 cmc + sodiumhyaluronate eye drop ( 5ml ) , eye drop 30.38 carboxymethye cellulose 1% eye drop ( 5ml ) , eye drop 30.39 phenylephrine eye drop 5% ( 5ml ) , eye drop 30.4 phenylephrine eye drop 10% ( 5ml ) , eye drop 30.41 timolol eye drop 0.25% ( 5ml ) , eye drop 30.42 betaxolol eye drop 0.25% ( 5ml ) , eye drop 30.43 betaxolol eye drop 0.5% ( 5ml ) , eye drop 30.44 dipverfrine eye drop 0.1% ( 5ml ) , eye drop 30.45 brimonidine eye drop 0.1% and 0.15% ( 5ml ) , eye drop 30.46 lantanoprost eye drop 0.005% ( 2.5ml ) , eye drop 30.47 bimatoprost eye drop 0.1% ( 5ml ) , eye drop 30.48 dorzolamide eye drop 2% ( 5ml ) , eye drop 30.49 bronlolamide eye drop, 0.2% ( 5ml ) , eye drop 30.5 xycocain preservative free 2% injection ( 2% ) , injection 30.51 xylocain injection 2%, 20mg / ml ( 30ml ) , injection 30.52 ophthalmic needles ( round body ) , needle 30.53 ophthalmic needles ( cutting ) , needle 30.54 keratom knife ( 2.8 mm ) , blade 30.55 vicryl 60 suture micropoint sparalated reverse cutting double armed ( reverse cutting double armed ) , blade 30.56 nvr blade ( 20 g ) , blade 30.57 wills hospital utility forceps ( na ) , sutures 30.58 castroviejo suturing forceps 0.12 mm ( 1x2 teeth ) , sutures 30.59 dastoor superior rectus forceps ( 1x2 teeth ) , sutures 30.6 hartman mosquito forceps, straight ( na ) , surgical material 30.61 hartman mosquito forceps, curved ( na ) , surgical material 30.62 baby jones towel clamp ( na ) , consumable 30.63 barraquer iris scissors ( na ) , surgical material 30.64 westcott tenotomy scissors ( na ) , surgical material 30.65 iris scissors, straight ( na ) , surgical material 30.66 kalt needle holder, straight ( na ) , surgical material 30.67 barraquer n holder, shirt model, m. jaws, curved jaws, w / o lock ( na ) , surgical material 30.68 barraquer n holder, standard jaws, curved jaws, w / o lock ( na ) , surgical material 30.69 rycroft air injection cannula, ( 23 g ) , consumable 30.7 lewicky anterior chamber maintainer cannula ( na ) , consumable 30.71 infusion cannula ( size 25.mm ) , consumable 30.72 keener arlt lens loop ( na ) , consumable 30.73 agarwal s phaco chopper ( 1mm fully cutting edge ) , consumable 30.74 beer cilia forceps ( na ) , consumable 30.75 harms traveculotomy probe, right ( na ) , consumable 30.76 harms traveculotomy probe, left ( na ) , consumable 30.77 castroviejo corneal trephine ( size 7.5mm dia ) , consumable 30.78 dastoor corneal graft holding forceps ( na ) , consumable 30.79 osher neumann radial marker ( 8 blades ) , consumable 30.8 tudor thomas corneal graft stand ( na ) , consumable 30.81 lieberman teflon block ( na ) , consumable 30.82 sterilization box ( na ) , consumable 30.83 barraquer solid wire speculum ( large ) , consumable 30.84 hoffer optic zone marker ( 3mm dia ) , consumable 30.85 osher neumann radial marker ( 4 blades ) , consumable 30.86 osher neumann radial marker ( 6 blades ) , blade 30.87 grene visual axis marker ( na ) , consumable 30.88 thornton fixation ring ( na ) , consumable 30.89 bores corneal fixation forceps, ( straight ) , consumable 30.9 bores incision spreading forceps ( na ) , consumable 30.91 lancaster eye speculum ( na ) , consumable 30.92 jaeger lid plate ( na ) , consumable 30.93 graefe muscle hook ( size 3 ) , consumable 30.94 berke ptosis forceps ( 20 mm ) , consumable 30.95 snellen entropium forceps, ( left small ) , consumable 30.96 snellen entropium forceps, ( right small ) , consumable 30.97 ayer chalazion forceps ( na ) , consumable 30.98 lambert chalazion forceps ( na ) , consumable 30.99 stevens tenotomy scissors, curved ( na ) , consumable 31 meyerhoefer chalazion curette ( size 1, 1.75 mm dia ) , consumable 31.01 jameson muscle hook, ( large ) , consumable 31.02 jameson muscle forceps, left, ( child 4 teeth ) , consumable 31.03 jameson muscle forceps, right, ( child 4 teeth ) , consumable [ 201269 ] 31.04 charles flute needle ( na ) , consumable 31.05 infusion cannula, ( size 2.5mm ) , consumable 31.06 schepens forked orbital retractor ( na ) , consumable 31.07 cefixime 200 mg + clavulanic acid 125 mg ( tab ) , tablet 31.08 natamycin eye drop 5%, ( 5ml ) , eye drop 31.09 hpmc ( hydroxy propylmetty cellulose ) eye drop, ( 5ml ) , eye drop 31.1 sodium hyaluronate injection ( pfs ) ( na ) , injection 31.11 45 diaptor irrigating contact lens ( 45 deg ) , consumable 31.12 90 diaptor irrgating contact lens ( 90 deg ) , consumable 31.13 scleral plugs ( sets of 3 ) , consumable 31.14 vitreous forceps, ( 20 g smooth jaws, straight ) , consumable 31.15 buprenorphine 20 mg patch ( each patch ) , each 31.16 vinorelbine ( 50mg inj ) , injection 31.17 linagliptin ( 5mg tab ) , tablet 31.18 tenecteplase ( 40mg ) , injection 31.19 levocetirizine 5mg ( mouth dissolving tablet also acceptable ) , tablet 31.2 cefixime + ofloxacin ( 200 mg + 200 mg ) , tablet 31.21 endotracheal tube no 5.5 ( uncuffed ) , each 31.22 endotracheal tube no 6.0 ( uncuffed ) , each 31.23 pressure monitor ( line ) , each 31.24 follyscathetor 8 no ( pediatrics ) , consumable 31.25 follyscathetor 10 no ( pediatrics ) , consumable 31.26 diclofenec sodium 75mg / ml injection, surfactant & transcutol p free. iv bolus ( 75mg / ml, amp of 1 ml ) , ampule 31.27 disposable eye dressing with adhesive pad ( each unit ) , consumable [ 201391 ] 31.28 vecuronium bromide injection ( 10mg / vial ) , injection 31.29 liposomal doxorubicin 20 mg or pegylated liposomal doxorubicin ( 2 mg / ml 10ml vial ) , injection 31.3 cefpodoxamine ( 200 mg tab ) , tablet 31.31 blood transfusion set ( each ) , consumable 31.32 insulin biphasic aspart 30:70 100 iu / ml ( firm has to supply compatible pen along with cartridges as and when required without any extra cost ) ( 3ml cartridge ) , cartridges 31.33 surgical spirit ip ( 500 ml ) , bottle 31.34 flurbinprofen eye drop 0.03% ( 5 ml vial ) , eye drop 31.35 tropicamide + phenylephime eye drop 0.8% and 5% ( 5 ml vial ) , eye drop 31.36 amoxicillin + cloxacillin ( 250mg + 250mg ) , capsule 31.37 amoxicillin + cloxacilline ( 500 mg+500 mg cap ) , capsule 31.38 carboxymethyl cellulose ( 1% eye drop, 5ml ) , eye drop 31.39 cephalexine cap ( 125mg ) , capsule 31.4 chloramphenicol ( 250mg ) , capsule 31.41 clindamycin ( 150 mg ) , capsule 31.42 clindamycin ( 300 mg ) , capsule 31.43 clomipramine ( 25 mg ) , capsule 31.44 halothane ( ) , inhalation 31.45 medical oxygen ( ) , inhalation 31.46 iron sucrose ( 50mg ) , injection 31.47 alcohol ( absolute ) ( 500 ml ) , consumable 31.48 ulinastatin ( 1 lac iu ) , vial 31.49 cefuroxime ( 1.5 gm ) , injection 31.5 sitagliptin + metformin ( 50mg + 500mg ) , tablet 31.51 teneligliptin ( 20mg ) , tablet 31.52 telmisatran ( 80mg ) , tablet 31.53 ammonium chloride+diphenhydramine+sodium citrate+menthol ( 138mg+14.08mg+57.03mg+2.5mg each 5ml cough syrup ) , syrup 31.54 vildagliptin + metformin ( 50mg + 1000mg ) , tablet 31.55 etoricoxib ( 90mg ) , tablet 31.56 saxagliptin ( 5 mg ) , tablet 31.57 saxagliptin ( 2.5mg ) , tablet 31.58 ticagrelor ( 90mg ) , tablet 31.59 mycophenolate ( 360mg ) , tablet 31.6 sodium valporate + valproic acid cr ( 300mg ) , tablet 31.61 poc kit for syphilis ( as per attached specification ) ( 10 test per pack ) , consumable 31.62 sterlize single use lancing device ( penitration depth 1.5 and 28 guage ) , each 31.63 glargine 100 iu / ml, 3ml cartridge inj. ( firm has to supply one compatible pen with every 20 cartridges as and when required without any extra cost ) ( 100 iu / ml ) , cartridges 31.64 disposable bed sheet ( each ) , consumable [ mis1002 ] 31.65 sterile disposable bed sheet ( each ) , consumable 31.66 viral transport media with swabs ( vtm detail specifications ) : vtm ( 3ml vial with 2 regular swabs i.e. one nasal swab and one throat swab ) 1.viral transport medium ( vtm ) with swab with complete directions for collection, storage, transport and carrying. 2.sterile dacron, polyester or rayon sterile swabs with plastic shafts for sa ) , consumable 31.67 anticold ( drop ) , drop 31.68 sevelamer carbonate ( 800mg ) , tablet 31.69 iron & folic acid with vitamin b12 capsules ( time released ) each timed release capsule contains: ( ferrous fumarate ( in sr form ) ip 200mg eq. to 64mg elemental iron cyanocobalamine ip 15mcg folic acid ip 1.5mg ) , capsule 31.7 degludec 100 iu / ml ( 3ml cartridge with pen inj. ) , injection 31.71 lactobacillus tab ( 60 million spores ) , tablet 31.72 phenytoin sodium ( 250 mg / 5 ml inj ) , injection 31.73 elemental calcium 150mg cap ( ( in the form of calcium hydroxide & calcium oxide pretreated with heated algae ) termed as lonic calcium ) , capsule 31.74 each 5ml contains aluminium hydroxide paste equilvalent to dired alluminium hydroxide i.p. 250mg magnesium hydroxide i.p. 250mg activated dimethicone i.p. 50mg sorbitol solution ( 70% ) ip.. 1.25mg ( non cristallising 170 ml bottle ) , bottle 31.75 sodium dichloroisocynaurate 35 mg tablet ( turnover criteria amended as average annual turnover 2cr. only gmp certified companies also eligible for this consumable item ) , tablet [ 121002a ] 31.76 febuxostat ( 40 mg tab ) , tablet 31.77 glimepride 2 mg + metformin 1000 mg ( tab ) , tablet 31.78 fluocinolone acetonide ip ( 0.1% w / w 30 gm cream ) , tube 31.79 darbepoetin ( 25mcg ) , injection 31.8 darbepoetin ( 40mcg ) , injection 31.81 racecadotril ( 100mg ) , capsule 31.82 methyl prednisolone ( 500mg ) , injection 31.83 reuse prevention syringe sterile single use reuse prevention syringe with detachable needles compliance to iso 7886:4 type i, b, flow wrap / blister pack using medical grade breathable paper, eto sterilized ( 2ml ) , consumable 31.84 reuse prevention syringe sterile single use reuse prevention syringe with detachable needles compliance to iso 7886:4 type i and b, flow wrap / blister pkg using medical grade breathable paper, eto sterilized ( 10ml ) , consumable 31.85 garam coat / woolan saluka sup.quality ( std.size ) , consumable 31.86 duster ( 39x39 ) , consumable 31.87 ladies livirise set redymade saree whote polyster green / blue border ( saree + blouse + peticot ) ( std.size ) , consumable 31.88 pillow 1 kg. cotton ( 14x21 ) , consumable 31.89 mattress 10 kg. cotton ( 3x6 ) , consumable 31.9 dohar redymade ( 54x90 ) , consumable 31.91 table cloth ( 45x60 ) , consumable 31.92 hole sheet ( 39x39 ) , consumable 31.93 gents livirise set redymade ( pent + shirt + topi ) ( std.size ) , consumable 31.94 airway, nasopharyngeal, sterile, single use, set with 6.5mm external diameter ( make medisafe international, model:msi 1220 6.5 ) , consumable [ 20200835 ] 31.95 airway, nasopharyngeal, sterile, single use, set with 7.5 mm external diameter ( make medisafe international, model:msi 1220 7 ) , consumable 31.96 atorvastatin + asprin ( 10mg + 75mg ) , tablet or capsule 31.97 intravenous set with airway and needle ( children ) ( surgical material ) , consumable 31.98 ice pack ( 8 length x 6 widgth ) ( 200gm ) , consumable 31.99 serum electrolyte kit ( 50test per kit ) , consumable 32 filter paper ( 12.5 cm, 0.1 micron, 50 / pkt ) , consumable 32.01 spectacles for school children: durable non allergic plastic ( frame with english lenses in case ) , consumable 32.02 spectacles for old person: durable non allergic plastic ( frame with english lenses in case ( as per tender specification ) ) , consumable 32.03 cotton khadi dari pattil ( 10x1.5 feet, 800gram per piece ) , consumable 32.04 cotton khadi dari pattil ( 10x1.5 feet, 1kg per piece ) , consumable 32.05 cotton khadi white bedsheet ( 54x90 inch per piece ( by weaving the name of the concerned department ) ) , consumable 32.06 cotton khadi white bedsheet ( 54x90 inch per piece ( by printing the short name of the concerned department ) ) , consumable 32.07 polyvastra cloth coating white ( 36 inch per meter ) , consumable 32.08 polyvastra cloth shirting colour ( 36 inch per meter ) , consumable 32.09 polyvastra uniform colour ( pent / shirt / topi ) ( per set ( accourding to measure ) ) , consumable 32.1 polyvastra uniform ( kurta / payjama / topi ) ( per set ( accourding to measure ) ) , consumable 32.11 woolen coatin mix ( 54 inch per meter ) , consumable [ kha058 ] 32.12 woolen shawl mix ladies standard ( per piece ) , consumable [ kha059 ] 32.13 ammunition boot ( according to measure ) , consumable 32.14 ackle boot ( according to measure ) , consumable 32.15 alcohol based hand sanitizer liquid spray ( 500 ml bottle ) , consumable 32.16 alcohol based hand sanitizer ( 50 ml bottle ) , consumable 32.17 plastic gloves ( large size ) , consumable 32.18 alcohol based hand sanitizer ( 1 ltr. bottle ) , consumable 32.19 sodium hypochlorite solution 5% ( 500 ml bottle ) , consumable 32.2 alcohol based hand sanitizer ( 500 ml bottle ) , consumable 32.21 codeine opiod analgesic 15 mg tab ( 15 mg ) , tablet 32.22 pancreatin 170 mg+oxbile extract 50 mg + ginger oleoresin 2 mg+activated charcoal 50 mg ( tab ) ( tablet ( with additional content acceptable ) ) , tablet each 5ml contain potassium citrate i.p. 1100 mgmagnesium citrate u.s.p. 375 mg pyridoxine hydrochloride i.p 20 mg colour caramel ( each contains approx.l meq, magnesium ion, 2meq. potassium ion, 3meq. citrate ion and 4mg of pyridoxine hydrochloride ) , bottle 32.24 afatinib ( 20 mg ) , tablet 32.25 alteplase ( 50 mg ) , injection 32.26 probiotic capsule each capusle contains lactobacillus ( rhamunousus gr 1 & lactobacillus reuteri rc 14 1 billion ) , capsule 32.27 doxketoprofen trometamol ( equivalent to dexketoprofen 25mg + paracitamol 325 mg ) , tablet 32.28 brimonidine eye drop 0.2% ( 5ml ) , vial 32.29 golimumab ( r dna origin ) solution for injection in prefilled syringe for single use 50 mg / 0.5 ml50mg / 0.5ml ( pre filled syringe in autoinjector ) , syrings 32.3 calcitriol 0.25 mcg + calcium 500mg+ mecobalamin 1500mcg+ omega 3 acid ethyl esters 60 bp+ folic acid 400mcg + elemental boron 1.5mg ( capsule / soft gelatin capsule ) , capsule 32.31 pembrolizumab inj ( 100mg / 4ml ( 25mg / mi ) solution in single dose ) , vial 32.32 peptonised iron 176.5 mg ( equivalent to 30 mg of elemental iron, protein ( as peptone ) 100 mg, folic acid 200 mcg, vitamin b12 2.5 mcg 100ml ) , bottle 32.33 feracrylum 1% gel ( 15gm ) , tube 32.34 disodium hydrogen citrate ( 1.4gm / 5ml ) ( 200ml ) , syrup 32.35 cost of reagent per test ( for blood cell counter 3 part ) ( blood cell counter 3 part ) , consumable 32.36 blood cell counter 3 part ( mek6510k ) ( blood cell counter 3 part ) , consumable 32.37 electrolyte solution for disinfectant generation system ( 10 lt. per pack ) , consumable 32.38 canagliflozin ( 100 mg ) , tablet 32.39 gabapantin300 mg + methylcobalamin 500 mcg ( 300 mg + 500 mcg ) , tablet 32.4 minicap ( capd ) with povidon iodine ( each ) , consumable [ 202106004 ] 32.41 serum amylase ( 2x25 ml ) , consumable 32.42 mackintosh ( as per attached specification ) , quantity amended as 136940 meter i.e. 6847 roll of 20 meter roll, rate should be quoted for 20 meter ( is 8164 1976 or conforming to is 8164 1976 ) , consumable 32.43 chromic with 1 / 2 cir rb needle absorbable surgical suture ( 12 foils / pkt ) ( 40 mm length 76 cm size:1 / 0 , surgical material ) , consumable 32.44 aceclofenac +thiocolchicoside ( 100mg+8mg ) , tablet 32.45 beclomethasone 0.025 % + fusidic acid 2.0 % cream ( 10 gm ) , tube 32.46 deflazacort ( 6mg ) , tablet 32.47 etizolam ( 0.25mg ) , tablet 32.48 etizolam ( 0.5mg ) , tablet 32.49 etoricoxib ( 60mg ) , tablet 32.5 febuxostat ( 80mg ) , tablet 32.51 itraconazole ( 200mg ) , capsule 32.52 levocetrizine ( 10mg ) , tablet 32.53 cefopodoxime 50 mg / 5 ml suspension ( 30ml ) , bottle 32.54 chlorpheniramine 2mg+ dextromethorphan 10mg / 5ml ( 100ml ) , syrup 32.55 trypsin chymotrypsin ( 1 lac iu ) , tablet 32.56 cisplatin ( 10 mg ) , injection 32.57 clindamycin 600mg ( 150mg / ml ) , injection 32.58 nebivolol ( 2.5mg ) , tablet 32.59 octriotide ( 50 mcg / ml ) , injection 32.6 rabeprazole + levosulpiride ( 20mg +75mg ) , tablet or capsule 32.61 rifaximin ( 400mg ) , tablet 32.62 rosuvastatin ( 20 mg ) , tablet 32.63 vitamin d3 ( 800iu / ml ) , drop 32.64 diclofenac sodium 75mg intended to use iv aqueous formulation ( 1ml amp ) , injection 32.65 gabapentin ( 300mg ) , tablet 32.66 fexofenadine + montelukast ( 120mg / 10 mg ) , tablet 32.67 fluticasone 50mcg / spray ( 70 120 meter dose nasal ) , spray 32.68 cr system film ( size 8x10 ) , consumable 32.69 cr system film ( size 10x12 ) , consumable 32.7 cr system film ( size 14x17 ) , consumable 32.71 films of size 14x17 inches compatible films to dr system ( 14x17 inches ) , film 32.72 films of size 11x14 inches compatible films to dr system ( 11x14 inches ) , film 32.73 films of size 10x12 inches compatible films to dr system ( 10x12 inches ) , film 32.74 films of size 8x10 inches compatible films to dr system ( 8x10 inches ) , film 32.75 alfacalcidol 0.25mcg, calcium 200mg ( 0.25mcg+200mg ) , capsule levetiracetam 100mg / ml syrup / solution ( 100ml bottle ) , syrup 32.77 paracetamol 500mg + chlorpheniramine 2mg+ phenylephrine 10mg ( 500mg+2mg+10mg ) , tablet 32.78 acenocoumarol ( 1 mg ) , tablet 32.79 alendronate ( 70 mg ) , tablet 32.8 methylcobalamin 1500mcg + pregabalin 75mg ( 1500mcg+75mg ) , tablet 32.81 alfuzosin ( 10mg ) , tablet capsule 32.82 amantadine ( 100mg ) , tablet 32.83 bosentan ( 62.5 mg ) , tablet 32.84 bisoprolol ( 5 mg ) , tablet 32.85 levetiracetam ( 100mg / ml ) , injection 32.86 sucralfate 500mg + oxetacaine 10 mg / 5ml syrup / suspension, 200ml bottle ( 500mg+10 / 5ml ) , bottle 32.87 pregabalin 75 mg + nortriptyline 10 mg ( 75mg+10mg ) , tab 32.88 adapalene ( 0.1%w / w ) , gel 32.89 oxymetazoline hydrochloride 0.05% w / v nasal spray, 10ml bottle ( 0.05% w / v ) , spray 32.9 disposable surgeon cap with cable tie ( each ) , consumable 32.91 weith machine mini ( 1gm to 5kg ) 32.92 heating mantle 32.93 inj multivitamine 32.94 onit eberconazole cream 1% w / w 32.95 cassette ( 10 x 12 ) , consumable fujji 32.96 cassette ( 8 x 10 ) , consumable fujji 32.97 cassette ( 14 x17 ) , consumable fujji 32.98 centrifuse machine 32.99 blood presure machine digital 33 codon set 33.01 acyclovir tab. ip 200mg ( dt tablets also acceptable ) , tablet 33.02 albendazole ip ( 400mg ) , tablet 33.03 alprazolam ( tab 0.25mg ) , tablet 33.04 amiodarone 50mg / ml ( 3ml vial / amp ) , injection 33.05 amiodarone ( 100mg tab ) , tablet 33.06 amlodipin tab ( 5mg ) , tablet 33.07 amoxycillin +clavulanic acid ( ( amoxycillin 500 + clavulanic acid 100 mg ) / vial ) , injection 33.08 amoxicillin ( 125 mg / 5ml ( 30 ml bottle ) ) , suspension [ 110074 ] 33.09 amoxicillin and clavulanic acid i.p. ( 200+28.5mg ( 30 ml bottle ) ) , syrup 33.1 amoxycilline ( 500mg ) , capsule 33.11 ampicillin ( 500 mg / vial ) , injection 33.12 ampicillin trihydrate capsules ( 500mg 33.13 anti d immunoglobulin for iv / im use ( monoclonal ) ( 150mcg ( 1ml vial ) ) , injection 33.14 anti snake venom polyvalent inj 10ml ( lyophilized ) ( 10 ml vial ) , injection 33.15 artemether + lumefantrine ( 20mg+120mg ) , tablet 33.16 artesunate ( 60 mg / vial ) , injection 33.17 artesunate 200 mg ( 3tab ) + sulphadoxine 750 mg + pyrimethamine 37.5 mg ip ( 2 tab ) ( age group 15 or above ) , combi blister pack 33.18 aspirin low dose ( 75mg tab ) , tablet 33.19 atenolol ( 50mg tab ) , tablet 33.2 atenolol ( 100mg ) , tablet 33.21 atorvastatin ( ip 10 mg ) , tablet 33.22 atracurium ( 10mg / ml ( 2.5ml vial / amp ) ) , injection 33.23 atropine sulphate 1% ( 5 ml vial ) , eye drop 33.24 atropine sulphate eye ointment ( 1% ) , ointment 33.25 atropine sulphate 0.6 mg / ml sc / im / iv ( 2ml amp ) , injection 33.26 azithromycin ( 500mg tab ) , tablet 33.27 azithromycin ( 200mg / 5ml ( 15 ml bottle ) ) , syrup 33.28 azithromycin ( 250mg ) , tablet 33.29 betahistine ( 8 mg tab ) , tablet 33.3 betamethasone sodium phosphate ( ml contain betamethasone sodium phosphate equal to 4mg of betamethasone ( 1ml amp ) ) , injection 33.31 biphasic isophane insulin ( 30 / 70 40iu / ml ( 10 ml vial ) ) , injection 33.32 bisacodyl ( 5 mg ) , suppository 33.33 bisacodyl ( 5mg tab ) , tablet 33.34 bromhexine hydrochloride ( 4mg / 5ml syrup ( 50ml bottle ) ) , syrup 33.35 bupivacaine hydrochloride ( 0.5% ( 20 ml vial ) ) , injection 33.36 calcium gluconate ( 10% ( 10 ml vial ) ) , injection 33.37 calcium gluconate 10% ( 10ml amp ) , injection 33.38 calcium with vitamin d tablets usp calcium carbonate 1.25g eq. to elemental ( calcium 500mg and cholecalciferol ip 250 iu ) , tablet 33.39 carbamazepine ( 200 mg ) , tablet 33.4 carboplatin ( 450mg 45ml multidose vial ) , injection 33.41 carboxymethylcellulose sodium eye drop 0.5% ( 10ml ) , eye drop 33.42 cefixime ( 200 mg tab ( dt tablet also acceptable ) ) , tablet 33.43 cefotaxime sodium ( 250 mg vial ) , injection 33.44 cefotaxime sodium ( 1 gm vial ) , injection 33.45 ceftazidime 1gm / vial inj ( 1 gm / vial ) , injection 33.46 ceftrioxone usp ( 1gm / vial ) , injection 33.47 ceftriaxone ( 250mg vial ) , injection 33.48 ceftriaxone ( 500mg vial ) , injection 33.49 cephalexine ( each 5ml contains 125mg ( 30ml bottle ) ) , syrup 33.5 cetirizine ( 10 mg ) , tablet 33.51 chloroquine phosphate suspension equivalent to chloroquine ( 50mg / 5ml ( 60 ml bottle ) ) , suspension 33.52 chloroquine phosphate tab. ( 250mg ) , tablet 33.53 chlorpheniramine maleate ( 10mg / ml inj 10 ml ) , 33.54 ciprofloxacin eye ointment 0.3% ( 3gm tube ) 33.55 ciprofloxacin ( 500mg ) , tablet 33.56 clomiphene citrate ( 50 mg tab ) , tablet 33.57 clonazepam ( 0.5mg ) , tablet 33.58 clopidogrel ( 75 mg ) , tablet 33.59 clotrimazole i.p. 2%w / w ( 15gm tube ) , cream or 33.6 deferasirox dispersible ( 250mg ) , tablet 33.61 deferasirox dispersible ( 500mg ) , tablet 33.62 dexamethasone sodium phosphate ( 8mg / 2ml ( 2ml vial ) ) , injection 33.63 dextromethorphan 10mg / 5ml ( 100ml bottle ) , syrup 33.64 dextrose 25% ( 500ml ffs bottle ) , injection 33.65 dextrose 5% ( 500ml ffs bottle ) , injection 33.66 dextrose with saline ( 5% + 0.9% ( 500ml ffs bottle ) ) , injection 33.67 diazepam ( 5 mg / ml ( 2 ml amp ) ) , injection 33.68 diclofenac ( 1% ) , gel 33.69 diclofenac sodium 25 mg / ml ( 3ml amp ) , injection 33.7 diclofenac sodium ( 50 mg ) , tablet 33.71 dicyclomine ( 10mg / ml ( 2 ml amp ) ) , injection 33.72 dicyclomine tab. 10mg 33.73 diethylcarbamazine tab ( 100mg ) , tablet 33.74 digoxin tab ( 0.25mg ) , tablet 33.75 zinc dispersible ( 20mg ) , tablet 33.76 docetaxel ( 120mg vial ) , injection 33.77 domperidone suspension 1mg / ml ( 30ml bottle ) , suspension 33.78 domperidone ( 10mg ) , tablet 33.79 dopamine hcl 40 mg / ml ( 5ml amp ) , injection 33.8 doxorubicin ( lypholozed ) ( 50mg vial ) , injection 33.81 doxycycline ( 100 mg ) , capsule 33.82 drotaverine ( 40mg / 2ml ( 2ml amp ) ) , injection 33.83 enoxaparin ( 40mg equivalent to 4000 iu vial / pfs ) , injection 33.84 erythropoietin ( 10000iu inj ) , injection 33.85 escitalopram 10 mg tab ( 10 mg ) , tablet 33.86 etophylline ( 77 mg ) + theophylline ( 23 mg ) tab ( tablet ) , tablet 33.87 etiophylline and theophylline ( 220 mg / 2ml ) , injection 33.88 fentanyl citrate inj 50 mcg / ml ( 2ml ampoule ) , ampule 33.89 fluconazole ( 150 mg ) , tablet 33.9 flunarizine ( 5 mg ) , tablet 33.91 fluoxetine cap ( 20 mg ) , capsule 33.92 folic acid ip ( 5 mg ) , tablet 33.93 framycetin sulphate 1% cream ( 30 gm tube ) , cream 33.94 frusemide ( 10 mg / ml ( 2 ml amp ) ) , injection 33.95 furosemide tab ( 40mg ) , tablet [ 110265 ] 33.96 furazolidone ( 100mg ) , tablet 33.97 gamma benzene hexachloride solution / lotion 1% ( ( 100 ml ) ) , bottle 33.98 gentamicin inj ( 40 mg / ml 2 ml amp ) , injection 33.99 gentamicin 0.3% eye / ear drops ( 5ml ffs squeeze vial ) , eye drop 34 glibenclamide ( 5 mg ) , tablet 34.01 gliclazide ( 80 mg ) , tablet 34.02 glimepiride ( 1 mg ) , tablet 34.03 nitroglycerine ( glyceryl trinitrate ) ( sublingual tab mg ) , tablet 34.04 glycopyrrolate inj. 0.2 mg / ml ( 1 ml amp ) , injection 34.05 haloperidol inj ( 5mg / ml ( 1 ml amp ) ) , injection 34.06 haloperidol ( 5mg ) , tablet 34.07 halothane bp 250ml 34.08 heparin ( 1000iu / ml 5ml vial ) , injection 34.09 hepatitis b immunoglobulin ( 100 iu / vial ) , vial 34.1 human anti d. immunoglobulin ( monoclonal ) ( 300mcg / vial ) , injection 34.11 hydrochlorothiazide tab ( 25 mg ) , tablet 34.12 hydrocortisone sodium succinate ( 100 mg / vial ) , injection 34.13 hydrogen peroxide 6% solution ( who gmp certification exempted for this item ) ( 400 ml ) , bottle 34.14 hydroxy urea ( 500mg ) , capsule 34.15 hyoscine butylbromide 20mg / ml ( 1ml vial / amp ) , injection 34.16 ibuprofen ( 400mg ) , tablet 34.17 insulin soluble inj. 40 iu / ml 34.18 ipratropium bromide inhaler 20mcg per puff ( 200 metered dose container ) , inhaler 34.19 iron folic acid sugar coated ( blue tablet ) ferrous sulphate ip equivalent to 60 mg elemental iron 500 mcg folic acid ip ( 60 mg + 500 mcg ) , tablet 34.2 isosorbide dinitrate tab ip ( 5mg ) , tablet 34.21 isoxsuprine ( 10mg ) , tablet [ 34.22 ketamine hydrochloride ( 10mg / ml ( 10ml vial ) ) , injection 34.23 labetalol ( 100 mg ) , tablet 34.24 levofloxacin ( 500mg ) , tablet 34.25 lignocaine hydrochloride ( 2% w / v ( 30 gm tube ) ) , gel 34.26 lignocaine 2 % ( 21.3 mg / ml ( 30 ml vial ) ) , injection 34.27 lignocaine 2% + adrenaline 5 mcg / ml ( 30 ml ) , vial 34.28 mannitol ( 20% 100 ml ffs bottle ) , injection 34.29 mephentermine inj 30mg / ml ( 10 ml vial ) , injection 34.3 metformin ( 500 mg ) , tablet 34.31 methyl ergometrine inj meleate ( 0.2 mg / ml ( 1ml amp ) ) , injection 34.32 methyl ergometrine maleate tab ( 0.125mg ) , tablet 34.33 methyl prednisolone sodium succinate inj.1000mg vial ( 1000mg vial ) , injection solution for 34.34 methyl prednisolone tab ( 16 mg ) , tablet 34.35 methyl prednisolone ( 4mg ) , tablet 34.36 methyldopa tab. 250mg 34.37 metoclopramide 5mg / ml ( 2 ml amp ) , injection 34.38 metoclopramide ( 10mg ) , 34.39 metoprolol ( 50mg ) , tablet 34.4 metronidazole tab ( 400mg ) , tablet 34.41 midazolam ( 1mg / ml ( 10ml vial ) ) , inje 34.42 midazolam ( 1mg / ml ( 5ml amp ) ) , injection 34.43 mifepristone ( 200 mg ) , tablet 34.44 misoprostol ( 200mcg ) , tablet 34.45 morphine sulphate inj. ip 10mg / ml ( 1ml ampoule ) , injection 34.46 naloxone inj. 0.4 mg / ml ( 1ml ampoule ) , injection solution for 34.47 neostigmine ( 0.5mg / ml ( 1ml amp ) ) , injection 34.48 nifedipine capsule ( 5mg cap ) , capsule 34.49 nifedipine ( 10mg tab ) , tablet 34.5 nitroglycerine inj. 25 mg / 5ml ( 5ml ) , ampule 34.51 norfloxacin tab. 400mg 34.52 ofloxacin tab 200mg 34.53 olanzapine ( 10mg tab ) , tablet 34.54 ondansetron ( 2 mg / ml ( 2 ml amp ) ) , injection 34.55 ondansetron ( 2mg / 5ml 30ml bottle ) , syrup or solution 34.56 ondansetron tab 4 mg 34.57 ors who powder glucose anhydrous 13.5g / l, sodium chloride 2.6g / l, potassium chloride 1.5g / l, trisodium citrate 2.9g / l ( as per attached pack specification ) , powder 34.58 oxaliplatin ( 100mg ) , injection 34.59 paracetamol inj ( 150mg / ml 2ml amp ( 2ml amp ) ) , injection 34.6 paracetamol syrup / suspension 125 mg / 5ml ( 60ml bottle ) ( syrup ) , syrup 34.61 paracetamol ( 500mg ) , tablet 34.62 pemetrexed ( 500mg ) , injection 34.63 pentaprazole inj vial ( 40 mg ) , injection 34.64 pentazocine lactate ( 30mg / ml ( 1 ml amp ) ) , injection 34.65 pheniramine maleate ( 22.75 mg / ml ( 2 ml amp ) ) , injection 34.66 phenobarbitone ( 200 mg / ml ) , injection [ 34.67 phenobarbitone ( 30 mg ) , tablet 34.68 phenobarbitone ( 60 mg tab ) , tablet [ 34.69 phenytoin sodium ( 50 mg / ml ( 2ml amp ) ) , injection [ 34.7 phenytoin sodium ( 100mg ) , tablet [ 34.71 pioglitazone ( 15 mg ) , tablet 34.72 piperacillin + tazobactum ( 4.5 g ) , injection 34.73 potassium chloride oral solution 100mg / ml ( 200ml bottle ) , bottle 34.74 povidone iodine ointment 5% ( 15gm tube ) , tube 34.75 povidone iodine ( 5% 100 ml ) , solution 34.76 povidone iodine vaginal ( 200 mg ) , pessary 34.77 pralidoxime ( pam ) inj ( 25 mg / ml ) , injection 34.78 primaquin ( 2.5mg ) , tablet 34.79 primaquine ( 15mg ) , tablet 34.8 primaquin ( 7.5mg ) , tablet 34.81 promethazine 5 mg / 5ml ( 60 ml bottle ) , syrup 34.82 pyridoxine tab 10mg 34.83 quinine dihydrochloride ( 300mg / ml ( 2ml amp ) ) , injection 34.84 quinine sulphate ( 300mg ) , tablet 34.85 rabeprazole ( 20 mg ) , tablet 34.86 ramipril ( 2.5 mg ) , tablet 34.87 ranitidine ( 50mg / 2ml , 2ml amp ) , injection 34.88 ranitidine ( 150mg ) , tablet 34.89 recombiant fviia ( 1mg / vial ) , vial 34.9 ringer lactate ip i / v 0.24 % w / v of lactic acid ( eq. to 0.32% w / v of sodium lactate ) , 0.6 % w / v sodium chloride, 0.04 % w / v potassium chloride and 0.027 % w / v calcium chloride ( 500ml ffs bottle ) , infusion 34.91 rituximab ( 500mg ) , injection 34.92 salbutamol inhalation ip 100mcg / dose ( 200 metered dose container ) , inhaler 34.93 salbutamol sulphate ( 4mg ) , 34.94 silver sulphadiazine cream ( usp 1% w / w 25gm ) , tube 34.95 sodium bicarbonate inj. 7.5% w / v ( 10ml ) , ampoule 34.96 sodium thiopentone 0.5 gm powder / vial ( 20ml vial ) , injection 34.97 succinyl choline ( 50mg / ml ( 10 ml vial ) ) , injection 34.98 sulfamethoxazole and trimethoprim ( 400mg + 80mg ) , tablet 34.99 sulfamethoxazole and trimethoprim ( 800mg + 160mg ) , tablet 35 tamoxifen tab. ( 10 mg ) , tablet 35.01 telmisartan ( 40 mg ) , tablet 35.02 tetanus immunoglobulin ( usp / ip 250 iu / vial ) , injection 35.03 tramadol ( 50mg / ml ( 2ml amp ) ) , injection 35.04 tranexamic acid injection bp / ip ( 100mg / ml ( 5ml amp ) ) , injection 35.05 tropicamide ( 1% 5ml vial ) , eye drop 35.06 vancomycin hydrochloride ( 1000mg vial ) , injection 35.07 vancomycin hydrochloride ( 500mg ) , injection 35.08 vitamin a syrup ( 100000 iu / ml with market spoon for 1ml and 2 ml ( 100 ml bottle ) ) , syrup or solution 35.09 xylometazoline nasal ( 0.1%w / v ( 10 ml vial ) ) , drop 35.1 iron sucrose usp ( 100 mg / 5 ml ( 5 ml amp ) ) , injection 35.11 acyclovir ( 800mg ) , tablet 35.12 tramadol ( 50mg ) , tablet 35.13 amoxicillin cap. 250 mg. 35.14 amoxycillin and clavulanic acid i.p. ( 500mg + 125mg ) , tablet 35.15 ciprofloxacin ( 250mg ) , tablet 35.16 ethamsylate tab ( 250 mg ) , tablet 35.17 permethrin lotion 5% w / v ( 60 ml bottle ) , lotion 35.18 streptokinase inj 15 lac iu ( vial / amp ) , injection 35.19 zoledronic acid ( 4mg vial ) , injection 35.2 benzathine penicillin ( 6 lakh iu / vial ) , vial 35.21 dextrose ( 10% inj 500 ml ffs btl ) , injection 35.22 trihexyphenidyl ( 2mg ) , tablet 35.23 dicyclomine hydrochloride ( 20 mg ) , tablet 35.24 levofloxacin ( 250mg ) , tablet 35.25 cephalexine ( 250mg ) , capsule 35.26 caffeine citrate inj. 20mg / ml ( 3 ml vial ) ( 20mg / ml 3 ml vial ) , injection 35.27 ibuprofen syrup 100mg / 5ml ( 60 ml bottle ) ( 60 ml bottle ) , syrup 35.28 calcium carbonate ( 500 mg ) , tablet 35.29 diazepam ( 5 mg ) , tablet 35.3 glimepiride ( 2 mg ) , tablet 35.31 tranexamic acid ( 500 mg tab ) , tablet 35.32 miconazole cream i.p. 2% w / w ( 15 gm tube ) , cream or ointment ] 35.33 timolol maleate eye drop i.p. 0.5 %w / v ( 5 ml vial ) ( 5 ml ) , solution 35.34 clotrimazole ( vaginal tab ) 500 mg ( with applicator ) , tablet 35.35 cefotaxime sodium ( 500 mg / vial ) , injection [ 35.36 dextrose ( 25% 100 ml ffs bottle ) , injection 35.37 mannitol inj. 20% 350ml ffs bottle 35.38 sodium chloride n / 2 injection ip ( 0.45% ) ( 500ml ffs bottle ) , injection 35.39 sodium chloride normal saline ( 100ml ffs bottle ) , infusion 35.4 capecitabine ( 500mg ) , tablet 35.41 sorafenib ( 200mg ) , tablet 35.42 artesunate 50 mg ( 3 tab ) + sulphadoxine 500 mg + pyrimethamine 25 mg ( 1 tab ) ( age group between 1 4 year ) , combi blister pack 35.43 sitagliptin ( 50 mg ) , tablet 35.44 cloxacillin ( 500mg ) , capsule 35.45 vincristine sulphate ( 1mg / ml ( cytocristin inj ) 1 ml vial ) , injection 35.46 irinotecan hydrochloride ( 100 mg ) , injection 35.47 bicalutamide ( 50mg ) , tablet 35.48 gemcitabine ( 1.4 gm vial ) , injection 35.49 artesunate 150mg ( 3tab ) + sulphadoxine 500mg + pyrimethamine 25mg ( 2 tab ) ( age group 9 to 14 years combi ) , tablet combi red colour blister pack 35.5 letrozole ( 2.5 mg ) , tablet 35.51 mupirocin ( 2% w / w ( 5 gm tube ) ) , ointment 35.52 normal saline ( 0.9% ( 500ml ffs bottle ) ) , infusion 35.53 ofloxacin tab 400 mg ( ofloxacin tab 400 mg ) , tablet 35.54 betamethasone dipropionate ( 0.05% ( 15gm ) tube ) , ointment or cream 35.55 dextromethorphan syrup ( 60ml bottle ) ( 10mg / 5ml ) , syr 35.56 vecuronium bromide inj 2mg / ml ( 2ml amp ) 35.57 dobutamine hcl 50 mg / ml ( 5ml amp ) , injection 35.58 chloroquine phosphate ( 40mg / ml ( 5 ml amp ) ) , injection 35.59 tinidazole ( 300 mg ) , tablet 35.6 betamethasone ( 0.5 mg ) , tablet 35.61 labetalol ( 20 mg / 4 ml ( 4ml amp ) ) , injection 35.62 cefpodoxime ( 200 mg ( dispersible tab also accepted ) ) , tablet 35.63 rh erythropoetin ( 2000 i.u ) , injection 35.64 isoflurane ( ) , inhalation 35.65 prednisolone tab 20 mg ( dispersible tablet also acceptable ) , tablet 35.66 charcoal activated ( powder ) ( 100 gm box / pouch ) , oral powder 35.67 sodium valproate oral solution ( 200 mg / 5 ml ) , solution 35.68 cefixime ( 50 mg dt ) , tablet 35.69 meropenem ( 500 mg / vial ) , injection 35.7 benzathine penicilline 12 lac iu / vial ( vial ) , injection 35.71 sulfamethoxazole +trimethoprim tab ( 200 mg + 40 mg ) , tablet 35.72 metronidazole oral suspension ( 200 mg / 5ml ( 60 ml bottle ) ) , suspension 35.73 itraconazole cap ( 100 mg ) , capsule 35.74 imatinib ( 400 mg tab ) , tablet 35.75 warfarin sodium ( 5 mg ) , tablet 35.76 propranolol tab ( 10 mg ) , tablet 35.77 drotaverine ( 40 mg ) , tablet [ 35.78 lithium carbonate ( 300 mg ) , tablet 35.79 risperidone ( 2 mg ) , tablet 35.8 imipramine ( 25 mg ) , tablet 35.81 lorazepam 2 mg / ml 1 ml vial 35.82 cinnarizine ( 25 mg ) , tablet 35.83 water for injection ip ( 2 ml amp ) , injection 35.84 water for injection 5 ml amp 35.85 carbimazole ( 10 mg ) , tablet 35.86 fluphenazine 1 ml amp ( 25 mg / ml ) , injection 35.87 sodium valproate ( 500 mg ) , tablet [ 35.88 clozapine ( 25 mg ) , tablet 35.89 clozapine ( 50 mg ) , tablet [ 35.9 medroxy progesterone acetate ( 10 mg ) , tablet 35.91 olanzapine ( 5 mg ) , tab 35.92 vitamin b1 ( thiamine 100 mg ) , tablet 35.93 misoprostol ( 100 mcg 4 tables / pack ) , tablet 35.94 disulfiram ( 250 mg ) , tablet 35.95 donepezil ( 5 mg ) , tablet [ 35.96 levetiracetam ( 250 mg ) , tablet [ 35.97 lorazepam ( 1 mg ) , tablet [ 35.98 lorazepam ( 2 mg / ml 2 ml vial ) , injection 35.99 zolpidem 10 mg ( tablet ) , tablet 36 vitamin k1 ( 1mg / 0.5ml ( 0.5 ml amp ) ) , injection 36.01 chlorpromazine ( 100 mg ) , tablet [ 36.02 rabies immunoglobulin inj 300 iu ( ( 2ml vial pfs ) ) , injection 36.03 ferrous ascorbate 100mg ( elemental iron ) +folic acid 1.5mg ( tablet ) , tablet 36.04 noraderanaline bitartrate ( 2 mg base / 2ml ( 2ml amp ) ) , injection 36.05 salbutamol sulphate ( 2mg / 5ml 60ml ) ( 60ml bottle ) , syrup 36.06 promethazine 25 mg / ml ( 2 ml amp ) , injection 36.07 etophylline + theophylline sr tablet 231mg + 69mg ( ) , tablet 36.08 oxytocin inj ( 5 iu / ml ( 1ml amp ) ) , injectio 36.09 cetirizine syrup ( 5mg / 5ml 30 ml bottle ) ( 30ml bottle ) , syrup 36.1 verapamil ( 40 mg ip ) , tablet 36.11 fusidic acid cream / sodium fusidic ointment 2% 5gm tube ( 5 gm ) , tube 36.12 metronidazole 500mg / 100 ml ( 100 ml ffs bottle ) , injection 36.13 isosorbide 5 mononitrate ( tab.20 mg ) , tablet 36.14 dexamethasone ( 0.5mg ) , tablet 36.15 iv human immunoglobin 5% iv ig ( 5gm / 100ml each ) , infusion 36.16 cefixime oral suspension ( 100 mg / 5 ml ( 30 ml bottle ) ) , suspension 36.17 paracetamol tab ( 650 mg ) , tablet 36.18 linezolid tab ( 600 mg ) , tablet 36.19 albendazole suspension 200mg / 5ml ( 10 ml bottle ) , syrup 36.2 electrolyte p ( multi electrolytes and dextrose injection type i ip ) i / v fluid ( each 100ml contains: anhydrous dextrose 5gm potassium chloride 0.13gm, sodium acetate 0.32gm, dibasic potassium phosphate 0.026gm ) ( 500 ml ffs bottle ) , injection 36.21 iron folic acid syrup, each ml containing 20mg elemental iron&100mcgfolic acid with suitable antioxidant, antimicrobial agent and food grade flavouring agent.the bottle should have 6 fragmented markings at equal intervals ( if an artificial sweetening is used it should be highlighted on the label. warning should be put on label medication should be kept out of reach of children. ( as per attached specification ) ( 50ml bottle with auto dispenser ) ) , syrup 36.22 carboprost ( 250 mcg ( 1 ml amp / vial ) ) , injection 36.23 lactulose ( 10gm / 15ml ( 100 ml bottle ) ) , solution 36.24 zinc sulphate dispersible ( 10mg ) , tab 36.25 atorvastatin ( 40mg ) , tablet 36.26 ambroxol hcl 15mg+terbutaline sulphate 1.25mg+guaiphenesin 50mg 5ml ( ( additional composition of menthol also acceptable ) 100ml bottle ) , syrup 36.27 deferiprone ( 500 mg ) , capsule 36.28 spironolactone ( 25mg ) , tablet 36.29 budesonide nebulising suspension containing budesonide ( 0.5 mg / 2 ml, 2ml amp ) , suspension 36.3 ferric carboxymaltose 50mg / ml ( 10ml vial ) , injection 36.31 paclitaxel 260mg ( 43.34ml vial ) , injection 36.32 mifepristone 200mg ( 1 tab ) +misoprostol 200mcg ( 4 tab ) ( combipack ) , tablet 36.33 morphine sulphate ( 10 mg ) , tablet 36.34 erlotinib ( 150 mg ) , tablet 36.35 diltiazem ( 30 mg ) , tablet [ 110217 ] 36.36 noradrenaline bitartrate 2 mg base / 2 ml amp injection ( 2 ml amp ) , inj 36.37 amlodipine ( 10 mg ) , tablet 36.38 pyridoxine ( 100 mg ) , tablet 36.39 sulfamethoxazole +trimethoprim suspension ( 200 mg + 40 mg ) / 5 ml suspension ( 50 ml bottle ) , suspension 36.4 trastuzumab 440 mg injection ( vial ) , injection 36.41 glucose pouch ( 75 gm ) ( powder ( product copp exempted for this item ) ) , powder 36.42 multivitamin sugar coated tab nfi formula multivitamin sugar ( item with additional vitamin will also be considered ) , tablet 36.43 levocetirizine + monteleukast 2.5 mg + 4 mg / 5 ml ( 60 ml bottle, suspension ) , suspension 36.44 empagliflozin ( 25mg tab ) , tablet 36.45 amphotericin b inj ip 50 mg ( liposomal amphotericin b also acceptable ) , injection 36.46 lenalidomide ( 25mg ) , capsule 36.47 tiotropium 18mcg ( 30cap. x 6 pack with 1 dispensing device ) , rotacaps 36.48 tiotropium 9mcg 180 doses inhaler ( 180 or more doses acceptable ) , inhaler 36.49 ciprofloxacin inj 200 mg / 100 ml ( 100 ml ffs bottle ) , infusion 36.5 lantanoprost eye drop 0.005% ( 5ml ) , eye drop 36.51 dexamethasone eye drop ( 0.1%, 5ml ) , eye drop 36.52 urokinase ( 5 lac iu ) , vial 36.53 metoprolol ( 25mg, sustained release ) , tablet or capsule 36.54 metformin ( 1000mg ) , sr tablet 36.55 allopurinol ( 100mg ) , tablet 36.56 paracetamol ( 125 mg / ml ) , drop 36.57 vitamin. b complex nfi ( prophylactic ) ( b12 mg, b22mg, b6 0.5 mg, niacinamide 25 mg, calcium pantothenate 1 mg ) , tablet 36.58 levothyroxine ( 100 mcg ) , tablet 36.59 levothyroxine ( 50 mcg ) , tablet 36.6 pilocarpine eye drops 2% ( 5ml ) , vial 36.61 cisplatin ( 50 mg ) , injection 36.62 sodium valproate oral solution ( 200 mg / 5 ml ) , solution 36.63 xylometazoline 0.05% nasal 10ml ( 0.05% 10ml ) , drop 36.64 glycopyrolate ( inj 0.2 mg / ml 1 ml vial ) , injection 36.65 promethazine ( injection 10 mg / ml 2ml vial ) , injection 36.66 propofal ( injection 10 mg / ml 1 ml / vial ) , injection 36.67 acetylsalicylic acid ( tablet 150 mg ) , tablet 36.68 acetylsalicylic acid ( aspirin ) * ( tablet 25 mg ) , tablet 36.69 allopurinol ( tablet 300 mg ) , tablet 36.7 pregabalin ( tablet 150 mg ) , tab 36.71 tapentadol ( tablet 100 mg ) , tablet 36.72 chlorpheniramine ( oral liquid 2 mg / 5 ml 30 ml bottel ) , liquid 36.73 hydrocortisone ( ointment 0.5% 15 gm ) , ointment or cream 36.74 hydrocortisone ( ointment 1% 15 gm ) , ointment or cream 36.75 hydroxyzine ( tablet 25 mg ) , tablet 36.76 diphenylhydantoin ( tab 30 mg 10x10 ) , tablet 36.77 abacavir ( tablet 300 mg ) , tablet 36.78 artesunate ( powder for injection 120 mg vial of 1 powder injection with appropriate diluents ) , injection powder for 36.79 ceftazidime ( powder for injection 250 mg vial of 1 powder injection with appropriate diluents ) , injection 36.8 ceftriaxone ( inj 1 gm / vial vial of 1 inection ) , inj 36.81 clarithromycin ( tablet 250 mg ) , tablet 36.82 clindamycin ( capsule 150 mg ) , capsule 36.83 cloxacillin ( capsule 125 mg ) , capsule 36.84 cycloserine ( capsule 125 mg ) , capsule 36.85 clofazimine ( tablet 50 mg 4 ) , tablet 36.86 diethylcarbamazine ( oral liquid 120 mg / 5 ml 100 ml bottel ) , liquid 36.87 diloxanide furoate ( tablet 500 mg ) , tablet 36.88 doxycycline ( dry syrup 50 mg / 5 ml ) , syrup 36.89 ivermectin ( tab 12 mg ) , tablet 36.9 norfloxacin ( dispersible tablet 100 mg ) , tablet 36.91 sodium aminosalicylate granules ( 10 gm bottel of 100 gm ) , powder 36.92 fulvestrant ( inj 500 mg vial of 10 ml ) , injection 36.93 fulvestrant ( inj 500 mg vial of 10 ml ) , injection 36.94 pomalidomide ( cap 2 mg ) , capsule 36.95 topotecan ( inj 4 mg 4 ml vial ) , injection 36.96 levodopa ( a ) + carbidopa ( b ) ( tablet 100 mg ( a ) + 10 mg ( b ) cr ) , tablet 36.97 levodopa ( a ) + carbidopa ( b ) ( tablet 100 mg ( a ) + 25 mg ( b ) cr ) , tablet 36.98 levodopa ( a ) + carbidopa ( b ) ( tablet 250 mg ( a ) + 25 mg ( b ) ) , tablet 36.99 chlorthalidone ( 12.5mg ) , tablet 37 chlorthalidone ( 25mg ) , tablet 37.01 diltiazem ( sr tablet 90 mg 10x10 ) , tablet 37.02 enalapril maleate ( tab 10 mg ) , tablet 37.03 finofibrate ( tablet 160 mg ) , tablet 37.04 finofibrate ( tablet 40 mg ) , tablet 37.05 labetalol ( injection 5 mg / ml 4ml ampl ) , injection 37.06 protamine ( injection 50 mg / 5 ml 5 ml vial ) , injection 37.07 verapamil ( injection 5 mg / 2 ml 2 ml vial ) , injection 37.08 gum paint ( tannic acid ) ( 2% w / v 15 ml bottle ) , bottle 37.09 povidine iodine germicide ( gargle 20% w / v 100 ml bottel ) , bottle 37.1 benzoyl peroxide ( gel 5% 15 gm tube ) , tube 37.11 glycerin ( oral liquid 30 ml bottel ) , liquid 37.12 intraperitoneal dialysis solution ( 0.015 1.5% 500 ml ) , solution 37.13 intraperitoneal dialysis solution ( 0.025 2.5% 500 ml ) , solution 37.14 boro spirit ear drops ( 0.183 gm boric acid in 2.08 ml of alcohol 10 ml vial ) , drop 37.15 normal saline ( nasal drops: sodium chloride drops 0.05% w / v 10 ml vial ) , drop 37.16 wax solvent ear drops: benzocaine ( 2.7% w / v 10 ml bottel drop ) , drop 37.17 wax solvent ear drops:paradichlorobenzene ( 2 % w / v 10 ml bottel ) , drop 37.18 tab mebeverine ( tab 200 mg 10 x 15 ) , tablet 37.19 losartan ( 10 mg tablet ) , tablet 37.2 sucralfate ( 20 mg tablet 10 x 10 ) , tablet 37.21 ethinylestradiol ( tablet 0.05 mg 10x10 ) , tablet 37.22 ethinylestradiol ( tablet 0.01 mg ) , tablet 37.23 ethinylestradiol ( a ) + levonorgestrel ( b ) ( tablet 0.03 mg ( a ) + 0.15 mg ( b ) 10x10 ) , tablet 37.24 human chorionic gonadotropin ( injection 10000 iu vial of 1 ml injection ) , injection 37.25 human chorionic gonadotropin ( injection 5000 iu vial of 2 ml injection ) , injection 37.26 medroxyprogesterone acetate ( injection 150 mg 1 ml / vial ) , injection 37.27 ormeloxifene ( tablet 30 mg 10x10 ) , tablet 37.28 premix insulin ( 30:70 injection ( regular: nph ) 2 vial of 100 ml ) , injection 37.29 iv human immunoglobin 5% iv ig ( ( 5mg / 100ml each ) , injection 100ml injection ) , injection 37.3 rabies vaccine human ( tissue culture ) id / im ( inj 2.5 iu / ml 1 vial with 1 ml diluents ) , injection 37.31 levosulbutamol ( 100 mcg 30 capsule in 6 pack with 1 dispecing device ) , capsule 37.32 levosalbutamol ( 50mcg / dose 30 capsule in 6 pack with 1 dispecing device ) , capsule 37.33 montelukast ( tablet 5 mg 10 x 10 ) , tablet 37.34 human albumin solution ( 0.05 bottel 250 ml ) , injection 37.35 dispersable tablet hydroxyurea ( 100 mg 10x10 ) , tablet 37.36 rh erythropoietin ( injection 2000 iu / ml prefilled syringe of 1 ml injection ) , injection 37.37 warfarin ( tablet 1 mg 10x10 ) , tablet 37.38 warfarin ( tablet 2 mg 10x10 ) , tablet 37.39 surfactant suspension ( inj 25 mg / ml ) , injection [ 37.4 fluconazole ( eye drop 3 mg / ml ( 10 ml vial ) , eye drop 5 ml eye drop ) , drop 37.41 prednisolone ( drops 1% eye 5 ml drop ) , drop 37.42 codeine ( oral solution 15 mg / 5 ml 60 ml bottle ) , solution 37.43 morphine ( injection 15 mg / ml 1 ml ampule ) , injection 37.44 risperidone ( 50 mg injection vial of 2 ml ) , injection 37.45 hydroxyethyl ( 6% saline solution for infusion ) ( starch 6%ip 500 ml bottel ) , infusion 37.46 nicotinamide ( tablet 50 mg ) , tablet 37.47 pyridoxine ( tablet 40 mg 10 x 10 ) , tab 37.48 riboflavin ( tablet 5 mg 10 x 10 ) , tablet 37.49 thiamine ( injection 100 mg / ml 1 ml / vial ) , injection ] 37.5 boot no 8, 9, 10. 37.51 sleeper no 6, 7, 8, 9, 10 37.52 weith machine mini ( 1gm to 5kg ) 37.53 heating mantle 37.54 inj multivitamine 37.55 onit eberconazlole cream 1% w / w 37.56 cassette ( 10 x 12 ) , consumable fujji 37.57 cassette ( 8 x 10 ) , consumable fujji 37.58 cassette ( 14 x17 ) , consumable fujji 37.59 centrifuse machine 37.6 blood presure machine digital 37.61 cassette ( 10 x 12 ) , consumable cr system 37.62 cassette ( 8 x 10 ) , consumable fujji cr sysyem 37.63 cassette ( 14 x17 ) , consumable cr system 37.64 lectolose 37.65 inj multivitamine 10ml 37.66 inj insulin 40 iu 37.67 inj capnea 37.68 inj fluorouracil 5 37.69 coden set...

Department of Higher Education - Madhya Pradesh

34965557 bids are invited for sl. no. item title item description 1 1 containers 2 2 sauce pan with lid 3 3 fry pan 4 4 tava roti/ tava dosa 5 5 parrat 6 6 grater(multipurpose) 7 7 patila with lid 8 8 kadchhi 9 9 knife all types 10 10 peeler/ chamcha/ chimta/jhara/ masala dabba 11 11 cutlery set 12 12 chakla belan 13 13 kadahi with lid 14 14 dinner set (steel) 15 15 bucket/ dustbin/ tub 16 16 pressure cooker 17 17 lighter 18 18 tray 19 19 crockeries (tea set borosil glasses) 20 20 namak daniset 21 21 stiching material—needle box 22 22 gas chula with cylinder/ chimini 23 23 indection 24 24 paper napkins/ cloth napkin/ table mat 25 25 model parts of flower/ kidney/brain/heart/human eye& ear 26 26 weighting machine digital 27 27 sonometer sccale 28 28 scale electronice 29 29 weight sclae 6kg 30 30 calcium oxide 31 31 clycerol 32 32 iodine solution 33 33 phenol 34 34 glacial acetic acid 35 35 safferemine 36 36 potassium mydroxide 37 37 canada balson 38 38 fehling solution 39 39 calcium chloride 40 40 acid accumulator 41 41 cylender noggel/ regulator/rubber set 42 42 bottele opener 43 43 sweing machine 44 44 washing machine 45 45 fabric colour set 46 46 bad sheet 47 47 soffa set cover 48 48 dinning table cover 49 49 vacume cleaner 50 50 hair cap/ aprin 51 51 microwave 52 52 phillips otg 53 53 toster 54 54 grill sandwich maker 55 55 hand grinder 56 56 steel bartan set 57 57 coffe maker 58 58 mixer /grider/ juicer 59 59 all types seaser 60 60 water coler 20 l 61 61 aquagurd 62 62 modular kitchen 63 63 autoclave portable 21l 64 64 autoclave portable50l 65 65 dissecting microscope 66 66 binocular microscope 67 67 deep freezer 68 68 compoundmicroscope 69 69 high defination microscope 70 70 microscopic eye pic 71 71 triangular microscope 72 72 ganong respirometer 73 73 hot air oven 14x14x14 74 74 magnetic stirrer with hot plate 75 75 maximum minimum thermometer 76 76 micro pipette variable 1 5ml 77 77 uv chromatographic chamber 78 78 ph meter ( digital ) with elctrodes 79 79 thin layer chromatography apparatus 80 80 water bath double wall ( 12 holes) ss 81 81 bod incubator 82 82 digital colony counter 83 83 digital tds meter 84 84 flame photometer 85 85 interactive led panel 86 86 digital thermometer 87 87 projection microscope 88 88 betological incubator stainless steel 89 89 laminar air flow horizontal 90 90 hair dryer 91 91 homogenizer 92 92 distillation apparatus doubledistillation 93 93 micro kjeldahl & distillation apparatus 94 94 soxhlet extraction unit 95 95 vortex shaker 96 96 auxanometer 97 97 computer system with licenced operating system internet facility 98 98 farmer potometer / ganog potometer 99 99 water and soil analysis testing kit (digital ) 100 100 tissue culture rack ( caster rack ) 101 101 blackman apparatus 102 102 gel electrophoresis unit with power supply 103 103 heating mantle with regulator cap 1 litre 104 104 occular micrometer/ stage micrometer 105 105 stem borer 106 106 cod analyzer multi parameter beanch 107 107 oxygen electrode 108 108 rotatory microtome 109 109 specimen 20pices 110 110 botany/zoology/physics/chemistry/home science map 111 111 digital spectrophotometer 112 112 blood pressure machine 113 113 plant collection net 114 114 centrifuge machine 115 115 glucometer 116 116 inverter 117 117 laboratory stirrer 118 118 insect collection net 119 119 chemical blance digital 0.01 to 600gm 120 120 chemical cabinet storage 121 121 rotary vane vaccume pump 122 122 oil free vacuum pump 123 123 muffle furnace 124 124 refrigerator 125 125 digital melting pint apparatus 126 126 karl fisher titrator 127 127 student polarimeter 128 128 digital conductivity meter 129 129 digital photo colorimeter 130 130 dissolved oxygen meter 131 131 flask shaker ( wrist action type ) 132 132 screw guage/ vernier calipers 133 133 ammeter dc/ac 134 134 stop watch digital / stop clock 135 135 analog multimeter /digital multi meter 136 136 voltmeter dc/ac / galvanometer 137 137 spectrometer prism ( crown/ flint glass) 138 138 thermometer different range 139 139 analog to digital converter power supply 140 140 rheostat ( various length ) 141 141 battery eliminator 142 142 apparatus to study specific resistance energy gap 143 143 apparatus to study characteristics tunnel 144 144 apparatus to study characteristics of zener diode 145 145 anderson/schering/hay/kelvin/maxwell 146 146 apparatus to study rc coupled amplifier power supply 147 147 audio frequency generator 148 148 laclanche cell 149 149 function generator 1 hz to 10 mhz 150 150 battery charger 2 to 12 volt 151 151 apparatus to study response curve for lcr 152 152 apparatus to draw b h curve of ferromagnetic 153 153 complete apparatus to determine the heating 154 154 potentiometer 155 155 mos fet/ fet characteristics apparatus 156 156 half adder /full adder/half subtractor 157 157 half wave and full wave rectifier apparatus 158 158 zener regulated power supply 159 159 8085/8086 microprocessor kit 160 160 photo diode characteristics apparatus 161 161 digital to analog converter with built in power 162 162 travelling microscope 163 163 series and parallel resonance circuit 164 164 solar cell characteristics apparatus 165 165 encoder and decoder circuit with built in power 166 166 cro dual trace 30/40 mhz 167 167 plancks constant using solar cell apparatus 168 168 function generator 0 3 to 30 mhz 169 169 vibration magnetometer 170 170 single stage and double stage r c couple 171 171 power amplifier ( trainer board) 172 172 variable regulated dc power supply 0 30v range 173 173 scr / ujt characteristics apparatus 174 174 horizontal torsion apparatus 175 175 multiplexers and demultiplexers with built in 176 176 stefan constant apparatus 177 177 regulated power supply trainer board 178 178 dielectric constant apparatus 179 179 thermistor characteristic apparatus 180 180 drill machine with all size bits (hammer) 181 181 bread board (trainer kit) 182 182 study of amplitude modulation and demodulation 183 183 digital ic trainer kit 184 184 study of crystal oscillator 185 185 four probe method 186 186 induction hot plate with induction ports 187 187 op amp as voltage follower trainer board 188 188 youngs modulus apparatus 189 189 frank hartz experiment setup using argon gas 190 190 thyratron characteristics apparatus 191 191 transistorized push pull amplifier 192 192 michelson interferometer apparatus 193 193 study of frequency modulation and demodulation 194 194 op amp as voltage to frequency/frequency to 195 195 study of active and passive filters 196 196 zeeman effect experiment 197 197 fresnel biprism diffraction apparatus 198 198 study of tdm pcm reciever/ transmitter 199 199 study of smps ...

Directorate Of Health Services - Madhya Pradesh

34817214 supply of surgical materials , alkaline phosphatase ( alp ) dea 300 ml ( model ba 400 system ( mfg bybio system ) ) , consumable , alkaline phosphatase kit ( kinetic ) 10x2.2ml 44 test / kit consumable , anti abd grouping serum 3x10ml consumable , anti a sera igm ( 10 vial ) , consumable , anti b sera igm ( 10 vial ) , consumable , anti d sera igg+igm 10ml vial ( each ) , consumable , anti d ( polyvalent ) ( 1x10 ml ) , consumable , anti h sera , auto pippets fixed volume 10 micro liters each , auto pippets fixed volume 1000 micro liters each , auto pippets fixed volume 20 micro liters each , benedicts qualitative reagent ( 1x5 lit ) , consumable , bilirubin ( direct ) as 300 ml ( model ba 400 system ( mfg bybio system ) ) , consumable , bilirubin ( total ) 600 ml ( model ba 400 system ( mfg bybio system ) ) , consumable , bilirubin caoillary heparinised vitrex ( one packet contain 100 capillary ) , consumable , bilirubin kit ( colorimeter semi auto ) 4x60 ml 480 test / kit consumable , bilirubin standard 1x5 ml ( model ba 400 system ( mfg bybio system ) ) , consumable , blood agar powder ( 500 grm ) , consumable , blood bag 100ml , blood bag 350ml , blood gluose ( god / pod ) semi auto end point ( 1000 ml ) , consumable , blood grouping anti sera a monoclonal : antisera should be transparent with more than one year shelf life at 2 6 c , it should give +++ agglutination at 1.256 dilution in 3 4 sec with a positive cells 10 ml , blood grouping anti sera a monoclonal ( 10 ml vial ( mfg tulip diagnostics ) ) , consumable , blood grouping anti sera b monoclonal : antisera should be transparent with more than one year shelf life at 2 6 c , it should give +++ agglutination at 1.256 dilution in 3 4 sec with b positive cells 10 ml , blood grouping anti sera b monoclonal ( 10 ml vial ( mfg tulip diagnostics ) ) , consumable , blood grouping anti sera d monoclonal : antisera should be transparent with more than one year shelf life at 2 6 c, it should give +++ agglutination at 1.256 dilution in 3 4 sec with d antigen positive cells. 10ml vail ( eryclone anti d igm ) , blood grouping anti sera d monoclonal ( 10 ml vial ( mfg tulip diagnostics ) ) , consumable , blood urea ( bun ) uv ( 1000 ml ) , consumable , blood urea reagent kit ( 200ml ( 2x100ml ) ) , consumable , blood urea ( arba ) , consumable , capillary tube 100 pieces consumable , cholesterol hdl direct 160 ml ( model ba 400 system ( mfg bybio system ) ) , consumable , cholesterol kit end point enzymatic kit 50 test / kit , cholesterol kit end point enzymatic kit 5x20ml 200 test / kit , conc hcl ( 1x500 ml = 500 ml ) , consumable , cover slip 18 x 18 mm 10gm , cover slip with isi marked size:18x18mm ( + / 1.00mm ) , thikness 0.13.. to 0.17mm ( pkt of 50 pieces ) , consumable , creatine calorimeter for semi auto kinetica 4x60ml 480 test kit , creatinin kit , crp kit 1x100 biolab qualitative ) , crp test kit ( latex / card ) ( 25 test / kit ) , crp test kit ( latex / card ) , kit of 25 tests ( mfg pathogyme diagnostics ) ( 25 test / kit ) , consumable , dengu card antigen ( 25 card / pkt ) , consumable , dengue card test 100 test kit , developer powder ( 22.5 ltr ) , diagnostic strips for urine sugar / albmin packing: 100 strip / pkt , dialysis starting kit disposable:a ) sterile tray with top ( disposable ) , size not less than 30x30cm b ) sterile drape size not less than 45x45 cm 1no c ) cotton ball 6 no d ) cotton gauze pieces 1 , digital x ray film 10x12 ( 150 films / pkt ) , digital x ray film 11x14 ( 150 films / pkt ) , digital x ray film 8x10 ( 150 films / pkt ) , echo jelly 20ml bottle , echo jelly 250 ml ( mfg by precious life care ) , bottle , edta k3 vial each , edta solutions k3 ( 500 ml ) , edta solutions k3 ( mfg by himedia ) ( 500 ml bottle ) , consumable , field stain a 500ml , field stain b 500ml , filter paper sheet ( ( whatmann no 01 ) sheets ) , consumable , fixer: it shall be powder fixer to produce clean radiographs available in pack size size: 13.5 ltr , fixer: it shall be powder fixer to produce clean radiographs available in pack size size: 9 ltr , formaldehyde 40% ( conc. formaline ) ( 1 x 30 lit ) , consumable , crp latex slide per test , gel matrix group card , gel matrix cross match card , g6pd deficiency test kit ( mfg pathogyme diagnostics ) ( 10 test / kit ) , consumable , glacial acetic acid ( 2.5 liter ) , consumable , glass slide 75mm x 25mm 1.1 mm , glass slide 75mm x 25mm 1.35 mm , glass slide with isi mark at least 75mm x 25 mm thickness at least 1.1mm, detail specifications i with smooth edges, without any scrathtches. ii glazed glass.iii no visual or chromatic abbretions ( 50 slides / packet ) , consumable , glass test tube 12 x 100 ( medium size ) heavy quality 100 / pkt , glass test tube 12 x 75 ( small size ) heavy quality 100 / pkt , glass test tube 5 without edge , glucometer strip ( 1x100 ) , glucose kit ( god / pod ) ( 350ml ) , digonstic , h2so4 ( sulphuric acid ) ( 25% 500 ml bottle ) , consumable , hba ag elisa 96 kit 1x96 ( each ) , consumable , hba ag rapid card test ( each ) , consumable , hbs antigeng kit card ( pack of 10 card test with 10 dropper, 1 buffer solution, 10 pricking lancet and 10 alcohol swab ) , digonstic , hcl n / 10 ( 500 ml bottle ) , hcv elisa ( 96 test kit ) , consumable , hcv kit card test ( 25 test / kit ) , digonstic , heamoglobin colour scale book with special strip complete ( 1 x 200 ) , consumable , hematology cell counter reagents as per requirement of cell counter cleaning solution 100 ml , hemoglobin color scale ( starter kit ) components ( 1 ) color scale 01 / kit ( 2 ) test strip 1000 / kit ( 3 ) printed literature for method of use / kit ( 4 ) lancet 1000 / kit , hiv elisa kit ( hiv micro elisa ag+ab 4th generation ) ( 96 test kit ) , consumable , hiv kit card ( 25 test / kit ) , hydrogen peroxide ( conc. ) h2o2 ( 500 ml ) , consumable , k3 blood vaccutainer edta 100 tubes / pkt , leishman stain 500 ml , malaria antigen card pf / pv card ( as per nvbdcp guidelines ) ( 10 card, 10 dropper, 1 buffer solution ) , malaria antigen, p vivax, p falciparum rapid diagnostics bivalentt test card ( as per gio nvbdcp specification ) pack of 10 card test with 10 dropper, 1 buffer solution, 10 pricking lancet, and 10 alcohol swab , malaria card ( antigen ) atleast 100 microbes / desi ltr. for both species , malaria pf / pv antigen card , malaria pf / pv rapid test , methyline blue ( 100 ml ) , solution , micro pipet 1000 fix and variable each , micropiptte 100 1000 , microtips ( 2 200 ul ) 1x1000 ( each ) , consumable , n / 10 hcl 500ml , nebulization mask kit ( pediatrics ) , nebulization mask kit, mfg by life o line technologist ( pediatrics ) , consumable , nebulization mask kit ( adult ) , new born baby kit [ 4 piece set ] , pregnancy test card ( 10 card pack ( mfg oscar medicare pvt ltd ) ) , consumable , ra factor 50 test kit qualicative , ra factor rapid kit ( 25 test / kit ) 1: ) should be based on latex agglutination slide test. 2: ) qualitative and semiquantitative testing facility possible. 3: ) test speed must be less than 2 minutes , test tube 12 x 100 ( medicm size ) 100 / pkt , test tube 12 x 75 ( small size ) 100 / pkt ( 12 x 75 ( small size ) 100 / pkt ) , tube , test tube 15x125 , tips for auto pipettes 2 to 100 micro litres 1000 / pkt ( 2 to 100 micro litres 1000 / pkt ) , each , tips for auto pipettes 200 to 1000 micro litres 500 / pkt ( 200 to 1000 micro litres 500 / pkt ) , each , tips for auto pippetes 10 to 100 micro litres , tissue paper roll ( each ) , consumable , tourniquet with belt ( good quality pairs ) , pairs , tourniquet with belt ( mfg by precious life care pvt ltd ) ( good quality pairs ) , consumable , typhoid card test kit ( for igg and igm antibody detection ) ( 25 test kit ) , typhoid test card. , umbical cord clamps plastic material ( box of 100 clamps ) ( mfg by precious life care ) , consumable , umbical cord clamps plastic material ( box of 100 clamps ) , consumable , urine albumin & suger , usg gel ( mfg precious life care pvt ltd ) ( 250 ml bottle ) , consumable , usg thermal paper , vdrl ( rpr ) 1x100 sd strip , vdrl kit ( strip ) ( mfg by alere ) ( 50 test / kit ) , consumable , vdrl kit ( strip ) ( 50 test / kit ) , consumable , widal 2x2 sera slide kit , widal 2x2 tube test kit , widal 4x5 ml , slide blue star , sputum cup with sticker , paraffin strip roll , zipper polybag , alluminium foil roll , hand wash liquid , falcon tube , thermacol box , gel pack , bamboo stick , tape roll , spirit lamp , adhesive plasters usp 7.5 cm x 10 mts / roll , adhesive plasters usp 7.5 cm x 5 mts / roll , adhesive roll 1 inch x 5 m / roll , baby oxygen mask set of all sizes , blood bag with acd / cpd solution ( disposable sterilised ) with needle ( 100 ml ) , bag , blood bag with acd / cpd solution ( disposable sterilised ) with needle ( 350 ml ) , bag , disposable appron , disposable cap , disposable examination gloves made of natural rubber latex, pre powdered, non streile medium , disposable examination gloves made of natural rubber latex, pre powdered, non streile small , disposable examination gloves made of natural rubber latex, pre powdered, non streile, conforming to is 15354:2003 and amendment thereof. size: large , disposable needles 22g consumable , disposable needles is 10654:2002 22g , disposable needles is 10654:2002 24g , disposable needles is 10654:2002 26 g ( ) , needle , disposable paper gloves size 7 inches consumable , disposable paper gloves size 7, 1 / 2 inches consumable , disposable plastic appron ( full size ) , disposable pricking lancet ( pkt of 200 units ) , disposable pricking lancet 100 units consumable , disposable scalp vein set size 20 no , disposable scalp vein set size 22 no , disposable sharp collection containers 1.5 l , disposable sharp collection containers 5 ltr , disposable sideport knife ( num ) , consumable , disposable sterile gloves size 6 inches consumable , disposable sterile gloves size 6, 1 / 2 inches consumable , disposable sterile gloves size 7 inches consumable , disposable sterile gloves size 7, 1 / 2 inches consumable , disposable sterile hypodermic syringe 10ml ( each ) , consumable , disposable suction catheter assorted covering all sizes 10, 12, 14, 16, 18 consumable , disposable suction catheter ( size 12 ) , consumable , disposable suction catheter ( size 14 ) , consumable , disposable surgeon cap ( box of 100 caps ) , disposable syringe ( for vitamin k inj ) ( 1ml with needle 26g ) , consumable , disposable syringe with needle ( 2ml each ) , syrings , disposable syringe with needle ( 3ml each ) , syrings , disposable syringe with needle ( 5ml each ) , needle , hub cutter non electric lockable safety portable box for disposal of hypodemic needles. consumable , kellys pad disposable , n 95 mask ( as per attached specification ) , consumable , oxygen mask adult ( standard size ) , oxygen mask paediatric ( standard size ) , plain disposable vial 3ml ( each ) , consumable , scalp vein set ( size 24g, disposable ) , consumable , three layer surgical mask , urine container 5ml disposable ( 50 per pkt ) , urine container size of the container shall be 30ml disposable ( 50 per pkt ) , consumable , x ray film 10 x 12 50 sheets / pack , x ray film 12 x 12 50 sheets / pack , x ray film 12 x 15 50 sheets / pack , b.b silk ( 12 foils / pkt ) ( 3 / 8 rcut needle 45 mm length 76 cm, size 2 / 0 ) ) , consumable , b.b silk size 3 / 0 ( 12 foils / pkt ) ( 3 / 8cir rcut needle 26mm length 76 cm ) , needle , b.b silk with 1 / 2 cir rb needle 20 mm length 75 cm non absorbable surgical suture usp size 3 0, ( 12foils / pkt ) , needle , b.b silk with 1 / 2 cir rb needle size:1 / 0 20 mm length 75 cm non absorbable surgical sutures usp surgical material , b.b. silk 6 reels x 25 mts size:1 / 0 ( 6 reels is per box rate should be quoted for 6 reels ) , surgical material , black braided silk with 1 / 2 cir cd cutting needle 16 mm length 75 cm 3 / 0 ( 14 foils / pkt ) , black braided silk with 1 / 2 cir cutting needle 30mm length 75 cm ( 1 / 0 12 foils / pkt ) , consumable , black braided silk with 1 / 2 cir rb needle 20 mm length 75 cm 1 / 0 13 foils / pkt , black braided silk with 1 / 2 cir rb needle 30 mm length 75 cm 2 / 0 12 foils / pkt , catgut chromic size:2 / 0 length 150 cm , catgut chromic with 1 / 2 cir rb needle 30 mm length 70cm no. 1 0, 12 foils per packet , catgut chromic with 1 / 2 cir rb needle 40 mm length 75cm no. 1 consumable , catgut chromic with 1 / 2 cir rb needle 40 mm length 75cm no. 2 consumable ( each ) , consumable , chromic catgut ( 12 foils / pkt ) ( size:1 / 0 length 150 cm ) , consumable , chromic catgut , round body needle no. 1.0 , chromic catgut monofilament with 1 / 4 circle reverse cutting needle 6 0 ( 12 / pkt ) , chromic catgut no 1.0 round dody, 40 mm 12 foils / pkt , chromic catgut suture ( 12 foils / pkt ) ( 3 / 8 cir r cutting needle 19 mm needle, suture length 76 cm size 4 / 0 ) , needle , foleys urinary catheter silkolatex 2 way sterile, non toxic size 10 , foleys urinary catheter silkolatex 2 way sterile, non toxic size 10 , non absorbable braided silk black 10mm 3 / 8 circle reverse cutting micro point ( 38 cm ) , consumable , non absorbable braided silk black ( 12 mm 3 / 8 circle reverse cutting micropoint 38 cm ) , consumable , silk no 1 cutting needle 1x12 ( 1x12 ) , consumable , suture mersilk 8 0 ( 12 foil ) , silver nitrate solution 1 ltr. , urine bag 2 ltr. , plaster of paris 410x5mtr , plaster of paris 6 15x 5mtr , cumb sera , albumin , laryngo scope bulb , auto clave quil , idetification tag , peadiatric drip set , dresing pad , endotracheal tube no. 6 , endotracheal tube no. 2.5 to 5 ml. , dynaplast 10 cm. , sicklewive test kit , autoclave indicator , absorbent cotton roll 100 gm each consumable , absorbent cotton wool ip 500 grms ( each ) , consumable , cotton crape bandage 10cm x 4m ( box of 10 bandages ) , cotton crape bandage 15cm x 4m ( box of 10 bandages ) , cotton delivery belt , adhesive tape 7.5cm x10 ( mtr / roll ) , consumable , cloth based surgical adhesive tape roll ( 1 inch x 5 mtr / roll ) , consumable , paper adhesive microporous surgical tape 3 inch x 5 m / roll ( 10 roll / pkt ) ( 3 inch x 5 m / roll ( 10 roll / pkt ) ) , consumable , paper adhesive plaster microporous surgical tape 1 inch x 9 m / roll , paper adhesive plaster microporous surgical tape 2 inch x 5m / roll , paper adhesive plaster microporous surgical tape 4 inch x 9 m / roll , paper adhesive plaster microporous surgical tape 6 inch x 10 m / roll , paper adhesive plaster microporous surgical tape 6 inch x 5m / roll , umblical cotton tape length 75cm. , disposable suction catheter ( size 12 ) , consumable , disposable suction catheter ( size 14 ) , consumable , feeding tube ( catheter ) 10g , foleys catheter size 12 2 way ( 10 each ) , consumable , foleys catheter size 14 2 way , foleys catheter size 14 3 way , foleys catheter size 16 2 way ( 11 each ) , consumable , foleys catheter size 18 2 way , foleys catheter size 20 2 way ( 12 each ) , consumable , foleys catheter size 22 2 way ( 13 each ) , consumable , foleys catheter size 24 2 way ( 14 each ) , consumable , foleys urinary catheter 2 way size 8 , infant feeding tube ( catheter ) size: 3g , infant feeding tube ( catheter ) size: 4g , infant feeding tube ( catheter ) size: 5g , infant feeding tube ( catheter ) size: 6g , surgical blade isi marked, size 15 ( 100 per packet ) , surgical material , surgical blade isi marked, size 22 ( 100 / pkt ) , surgical material , surgical blade isi marked, size 23 ( 100 / pkt ) , surgical material , surgical blade isi marked, size 24 ( 100 / pkt ) , surgical material , surgical blade isi marked, size 25 ( 100 / pkt ) , surgical material , surgical blade, size 11 , ecg jelly 250 gms , ecg paper ( chemical coated ) ( 80mmx 20 mtr each ) , consumable , ecg paper computerizesd triple channel 20m , ecg paper ( chemical coated ) 50mm x 20mm roll , ecg paper ( chemical coated ) 50mm x 30 mtr. roll , ecg paper ( wax coated ) heavy quality 50mm x 30 mtr / roll , ecg paper ( wax coated ) mfg by life o line technologist ( 50mm x 30 mtr, roll ) , consumable , ecg roll three channel 20m , ecg roll three channel mfg by life o line technologist ( 50 mm x 20 mtr ) , consumable , absorable surgical suture rb needle size no 1 0, 30 mm length 70 cm , 12 foils per packet , polyglycolic acid ( pga ) , absorable surgical suture rb needle size no 1 , 30 mm length 70 cm , 12 foils per packet , polyglycolic acid ( pga ) , absorbable surgical suture braided polyglycolic acid 3 / 8 circle reverse cuttingg ( 12mm 45 cm spatulated needle ) , consumable , blood vessel introducers needles 16g, sterilized, set , chromic ( 12 foils / pkt ) ( 3 / 8 rb needle 30 mm, length 76 cm, size 2 / 0 ) , needle , chromic size 1, ( 12 foils / pkt ) ( 1 / 2 cir rb needle 40 mm, length 76 cm ) , needle , chromic size 1, 12 foils / pkt ( 1 / 2 cir rb needle 45 mm, length 100 cm ) , needle , insulin syringe / each ( graduation upto 100 units ) 30 g needle, 40 units / ml ( 30 g needle, 40 units / ml ) , syrings , intravenous set with airway and needle ( ( adult ) ) , surgical material , intravenous set with airway and needle ( children ) , surgical material , spinal needle no. 23 , sterile hypodermic syring with needle 10 ml , sterile hypodermic syring with needle 20 ml , sterile hypodermic syring with needle ( 5 ml ) , syrings , sterile hypodermic syringe with needle, mfg by ph health care pvt ltd ( 20 ml ) , consumable , vicryl no. 1 rb , vicryl no. 2.0 rb , cannula fixer set consumable , i.v cannula with injection valve size : 18g , i.v. cannula with injection valve 20g , iv cannula ( two way ) size 20 , iv cannula ( two way ) size 22 , iv cannula ( two way ) size 24 , iv cannula size 26g ( ) , consumable , biomedical waste collection plastic bag small ( all colours ) , biomedical waste collection plastic bag medium ( all colours ) , biomedical waste collection plastic bag large ( all colours ) , mattress 5kg cotton 3 ft x 6 ft , pillow with 2kg cotton , tericot sharee , compunder dress ( male ) , bed sheet single bed ( white ) , bedsheet double bed ( white ) , bed sheet single bed ( coloured ) , bedsheet double bed ( coloured ) , baby diapers small ( 10 diaper per pkt ) , chair cushion box type , chair cushion box type , chair cushion cover , compounder coat / lab tec / xry tec std size , curtain green redymade , curton cloth rangeen , curton cloth rangeen design , dionised water 5 ltr cane ( each ) , front aprin , metresses 3x6 with raxine cover 4 density , napkin sup. quality std size ( white ) , napkin sup. quality std size ( coloured ) , peticote blauge cloth shuti rangeen , peticote / blauge cloth shuti bleach , pillow cover cloth bleach , rangeen baag print kapda , rangeen baag print kapda , rangeen design towel beev kapda , rangeen design weft stripe kapda , table cloth rangeen ( small ) , table cloth rangeen ( large ) , biomedical waste collection plastic dustbin small ( all colours ) , biomedical waste collection plastic dustbin medium ( all colours ) , biomedical waste collection plastic dustbin large ( all colours ) ...

Directorate Of Medical Education - Madhya Pradesh

34429793 tender for supply of chemical and reagent for mdru department third call , mdru kits and reagents , ammonium chloride 500gm , potassium bi carbonate 500gm , sodium chloride 500gm , tris hcl 500gm , sds 500gm , saturated phenol 500ml , chloroform 500ml , sodium acetate 250gm , isoamyl alcohol 500ml / 1ltr , glacial acetic acid 500ml / 1ltr , molecular biology grade agarose powder 250gm , bromophenol blue dye 2ml*5=1pack , ethidium bromide 10ml , molecular weight ( dna ladder ) 100bp & 1kb 1 vial , molecular weight ( dna ladder ) 50bp 1 vial , molecular weight ( dna ladder ) 25bp 1 vial , taq polymerase 500units / vial , amplitaq gold dna polymerase master mix 500units / vial , mgcl2 5ml , dntp mix 1ml , dnase 1000 unit , rnase 1000 unit , proteinase k 1000 unit , tris edta 500 gm , edta 250gm / 500gm , boric acid 250gm / 500gm , teepol5 liter , xylene cynol 10 gm , dmso 50 ml , tips i. 0.2 20 ?l tips , tips ii. 20 200 ?l tips , tips iii. 200 1000 ?l tips , superscript ii rnase reverse transcriptase / episcript™ rnase h reverse transcriptase ( episcript rt ) 400 / 500 reaction pack. , power sybrgreen pcr master mix 5 ml , power sybrgreen rt pcr reagent kit 5 ml , oligo ( dt ) 12 18 primer25ug ( 0.5ug / ul ) , absolute ethanol 500ml , pcr plates ( light cycler 480 compatible ) pack of 50 / pack of 100 , sealing foil ( rt pcr / qpcr grade ) ( light cycler 480 compatible ) pack of 50 / pack of 100 , filter tips each pack contains 1000 psc. , i. 0.2 20 ?l filter barrier tips , ii. 20 200 ?l filter barrier tips , iii. 200 1000 ?l filter barrier tips , mct variable tubes each pack contains 1000 psc. , i. 20 200?l tubes , ii. 200 600 ?l tubes , iii. 500 2000 ?l tubes , nitrile autodextorous gloves each pack contains 1000 psc. , mctstands for variable tubes sizes each pack contains 10 psc. , i. 20 200?l tubes stand , ii. 200 600 ?l tubes stand , iii. 500 2000 ?l tubes stand , filter tip boxes each pack contains 10 psc. , i. 0.2 20 ?l filter barrier tip box , ii. 20 200 ?l filter barrier tip box , iii. 200 1000 ?l filter barrier tip box , rt pcr grade water pack size of 20ml ( 20 ml * 5 ) , tip discard box ( 1 2 liter capacity ) each , graduated measuring cylinders 50, 100, 500, 1000 ml each , graduated beakers 50, 100, 500, 1000 ml each , flat bottom tube 5ml ( with screw cap ) pack size of 500 psc. , tube stand ( 15ml falcon, 5ml, 2ml, 0.5ml, 0.2ml mct ) pack size of 10 psc. , graduated conical flask 50, 100, 500, 1000ml pack size of 5 psc. , edta blood collection tube 5ml each pack contains 100 psc. , plain vial ( for clot activator ) each pack contains 100 psc. , fluoride vial each pack contains 100 psc. , test tube 5, 10 ml each pack contains 100 psc. , slide+cover slips ( 25mm*75mm ) each pack contains 100 psc. , tissue paper roll pack size of 12 psc. , fine tissue cloth roll pack size of 12 psc. , cotton pack size of 10 psc. , wash bottle / dropping bottle, 200ml, 500ml, 1ltr each , funnels variable range each , plastic bottle, 200, 500, 1000ml each , syringe + needle 2 ml, 5 ml pack size of 100 psc. each , nitrile gloves; medium and large size box pack size of 1000 psc. , dna isolation kit { blood } per kit , rna isolation kit per kit , phenol 500 ml , hno3 ( nitric acid ) 500 ml , propionaldehyde pure ( 97% ) 500 ml , phthalic anhydride 500 ml , glacialacetic acid ar 500 ml , hydrochloric acid ar 500 ml , sulfuric acid ar 500 ml , 2 amino ethanol 500 ml , pyridine ar 500 ml , ammonia solution ar 500 ml , ammonia chloride ar 500 ml , acetyl salicylic acid 500 ml , acetone ar 500 ml , anthranilic acid ar 500 ml , activated charcoal 500 ml , silica gel g 500 ml , benzoicacid ar 500 ml , sds 500 gm , colin ( cleaning detergent solution ) 500 ml , sterilium ( hand sanitizer ) 100 ml * 5 , dettol / lifeboy alcohol based hand sanitizer 100 ml * 5 , hypo 4% 5 l , floor cleaner phenyl 1 l * 5 , serum separator vial 3.5 ml ( vacutainer tube, 3.5ml, 13 x 75mm, plastic, additive: clot activator / polymer gel, gold hemogard closure, paper label ) pack size of 100 psc. each , labolene 1 l / 5 l , cleaning mop per psc , broom per psc , microwave gloves per pair , brown paper for autoclaving per roll , liquid nitrogen 10 / 25 ltr. , phosphate buffer saline ( 10x; ph 7.4; rnase free ) 500 ml , formalin ( formaldehyde aqueous solution; lab grade ) 500 ml , paraffin wax ( 58 600c for histology ) 500 gm , xylene ( molecular lab grade ) 500 ml , glycerol500 ml , ammonia ( nh4oh; extra pure ) 250 ml / 500 ml , methanol ( methyl alcohol, ch3oh ) 500 ml , acrylamide / bis ar 500 ml , 10x tbe buffer 500 ml , urea ( ultra pure; mol bio grade ) 500 gm / 1kg , ammonium persulfate 100 gm , temed ( ultra pure; mol bio grade ) 100 ml / 250 ml , 4’, 6 diamidino 2 phenylindole 50 ml , diethyl pyrocarbonate 5 gm / 25 gm , tae buffer , sybr gold 100ul , restriction enzyme – mnl i250 / 300 / 500 units , restriction enzyme – bcli1000 / 1500 / 2500 / 3000 units , restriction enzyme – hpych4v100 / 500 units , restriction enzyme – hpych4iii200 / 250 / 1000 / 1250 units , restriction enzyme – sau96i 1000 units , restriction enzyme – sfci200 / 1000 units , restriction enzyme – bcci1000 units , restriction enzyme – scrfi500 / 1000 / 2500 units , restriction enzyme – afliii250 / 1250 units , restriction enzyme – scai500 / 1000 / 1250 units , restriction enzyme – avai1000 / 2000 units , restriction enzyme – bsmi200 / 500 / 1000 / 2500 units , restriction enzyme – tspri ( also share cleavage site withtscai ) 1000 units , restriction enzyme – mboii250 / 300 / 1250 / 1500 units , restriction enzyme – bsh1236i500 / 1000 / 2500 units , restriction enzyme – banii1000 / 1500 / 2000 units , restriction enzyme – mph1103i1000 / 5000 units , restriction enzyme – dde i200 / 500 / 1000 / 2500 units , restriction enzyme – bsmb i ( also share cleavage site withesp3i ) 200 / 400 / 1000 units , restriction enzyme – afa i ( also share cleavage site withrsa i ) 1000 / 5000 units , restriction enzyme – bal i ( also share cleavage site withmlu ni ) 50 / 100 / 200 / 250 units , restriction enzyme – fspi ( also share cleavage site withnsbi ) 400 / 500 / 1000 / 2500 units , restriction enzyme – hpa ii ( also share cleavage site withmspi ) 1000 / 2000 / 4000 / 5000 / 10000 units , restriction enzyme hinf i , restriction enzyme hpych4 , restriction enzyme mboii , restriction enzyme bstui , restriction enzyme mvai , primers , fmr1 set 1 –f5 tcaggcgctcagctccgtttcggtttca 3 r5 5 aagcgccattggagccccgcacttcc 3 , mecp2 exon 1 set 1 f5 gttatgtctttagtctttgg–3´ r5 tgtgtttatcttcaaaatgt–3´ , exon 2set 1 f5 cctgcctctgctcacttgtt–3´ r5 ggggtcatcatacatgggtc–3´ , exon 2set 2 f5 agcccgtgcagccatcagcc–3´ r5 gttccccccgaccccaccct–3´ , exon 3 set 1 –f5 tttgtcagagcgttgtcacc–3´ r5 cttcccaggacttttctcca–3´ , exon 3 set 2 f5 aaccacctaagaagcccaaa–3´ r5 ctgcacagatcggatagaagac–3´ , exon 3 set 3 f5 ggcaggaagcgaaaagctgag–3´, r5 tgagtggtggtgatggtggtgg–3´ , exon 3 set 4 – f5 5´–tggtgaagcccctgctggt–3´ r5 ctccctcccctcggtgtttg–3´ , exon 3 set 5 f5ggagaagatgcccagaggag–3´ r5 cggtaagaaaaacatccccaa–3´ , exon3 ( l100v ) f5 aaccacctaagaagcccaaa 3 r5 gcttaagcttccgtgtccagccttcaggta 3 , putative promoter and exon 1. f5 gggtgcaatgaaacgctta 3 r5 tttaccacagccctctctcc 3 , mc4r rs17782313 f 5 aagttctacctaccatgttcttgg 3 r 5 ttccccctgaagcttttcttgtcattttgat 3 fto rs9939609 f 5 aactggctcttgaatgaaataggattcaga 3 r5 agagtaacagagactatccaagtgcagtac 3 , adipoqrs2241766 – f5 tgtgtgtgtggggtctgtct 3 r 5 tgtgatgaaagaggccagaa 3 , rs1501299 f5 ctacactgatataaactatatggag 3 r5 ccccaaatcacttcaggttg 3 , pcsk1 rs155971 – f5’tatatgcagccaccaatcca 3’ r5’aaaatgaagggagaagcacaaa3’ , pomcrs6232 f5 ttgtgcccttcatctgaaca 3 r5 tgtagcaactttggcatgga 3 , rs155971 f5tatatgcagccaccaatcca 3 r5 aaaatgaagggagaagcacaaa 3 , ppar g ( pro12ala ) f5gcc aat tcaagc cca gtc 3r5gat atgttt gca gac agt gta tca gtg aaggaa tcg ctttcc g 3 , kcnj11 ( rs5219 ) f5 gactctgcagtgaggcccta 3’ r5 acgttgcagttgcctttctt 3’ , capn10 ( rs3792267 ) f5 cacgcttgctgtgaagtaatgc 3’r5 tgattcc catggtctgtagcac 3’pik3ca set 1 forward 5’ ggagtatttcatgaaacaaatgaatgatgcg 3’ reverse 5’ gagctttcattttctcagttatctt 3’ , bat 25 set 1 f 5’ tcgcctccaagaatgtaagt 3’r 5’ tctgcattttaactatggctc 3’bat 26 set 1 f5’ tgactacttttgacttcagcc 3’r5’ aaccattcaacatttttaaccc 3’ , d2s123 set 1 f5’ aaacaggatgcctgccttta 3’ r5’ ggactttccacctatgggac 3’ , d5s346 set 1 f 5’ actcactctagtgataaatcggg 3’ r5 agcagataagacagtattactagtt 3 , d17s250 – set 1 f5’ ggaagaatcaaatagacaat 3’ r5’ gctggccatatatatatttaaacc 3’ , impdh2 set 1 f5 gtttctgcggtatcccaatc 3 r5 cgagcaagtccagcctat 3 bmp6 rs73719353 f5’ gctcctttgcacttcgctgt 3’ , r5’ aggctctgctg agctcctac 3’ , bmp6 rs73719341 f 5’tgaacttcccattcccctct 3’ r5’ataaaattagcattgatcca 3’ , bmp6 rs73719318 f5’caggtgctgtgcaacttctt 3’ r 5’agagggcaccatggttgcct 3’ , bmp6 rs73381662 f 5’ ctgagattcaattaggccca 3’ r 5’taaagaacagcaaaagtctg 3’ , bmp6 rs73381650 f 5’cacataaagattgctgcatt 3’ r 5’tagtaatcctaaaaatggga 3’ , anxa2 rs7170178 f 5’ ttcacagcagttcaaaatac 3’ r 5’ ctgggtttccagagatggaa 3’ , anxa2 rs73435133 f 5’ gagtgcaaggtgctgaggat 3’ r 5’ gatttcagacagcccttgca 3’ , anxa2 rs73418020 f 5’ tctgagagtgaaaggtgcac 3’ r 5’ tcccatcccctgaatccctg 3’ , anxa2 rs72746635 f 5’ cctgactcattgtcacatca 3’ r 5’ aagtggctttccactgccc 3’ , anxa2 rs73418025 f 5’ cttctcatcttactttt 3’ r 5’ agggaaggatacagaggaga 3’ , hsp 70 primer sequence5 agcgt aacac cacca ttcc 3 ( forward ) 5 tggct cccac cctat ctc 3 ( reverse ) , the gapdh sequence forward primer 5 agc cac atc gct gag aca c 3, reverse primer 5 gcc caa tac gaccaa atcc 3. , mthfr f:5 tgtggtctcttcatccctcgc 3;r: 5 ccttttggtgatgcttgttggc 3. , dpyd f:5 actcaatatctttactctttcatcaggac 3. r: 5 acattcaccaacttatgccaattct 3. , tyms f:5’ ggtacaatccgcatccaactatta 3’ r:5’ ctgataggtcacggacagattt 3’ , imp3 forward:5’atgactcctccctacccg3’ reverse:5’gaaagctgcttgatgtgc3’ , cxcl1forward: 5’ccagacccgcctgctg 3’and reverse:5’cctcctcccttctggtcagtt 3’ , cox 2 forward: 5 cagccatacagcaaatcc 3; reverse: 5 tcgcacttatactggtcaa 3 , hmlh1f 5 ttt tga tgt aga tgt ttt att agg gtt gt 3r 5 acc acc tcatcataa cta ccc aca 3 , ppar g ( pro12ala ) , f5gcc aat tcaagc cca gtc 3 , r5gat atgttt gca gac agt gta tca gtg aaggaa tcg ctt tcc g 3 , methylated ( hmlh1 ) f 5 acg tagacg ttt tat tag ggt cgc 3 r 5 cct catcgtaac tac ccg cg 3 , hmsh2 f 5 ggt tgt tgt ggt tgg atg ttg ttt 3 r 5 caa cta caa cat ctc ctt caa cta cac ca 3 , methylated ( hmsh2 ) f 5 tcg tgg tcg gac gtc gtt c 3 r 5 caa cgt ctc ctt cga cta cac cg 3 , ? actin: forward: 5’ ctacgtcgccctggacttcgagc 3’ ß actin: reverse: 5’ gatggagccgccgatccacacgg 3’ , kras forward: 5 gactgaatataaacttgtggtagttggacct 3.reverse: 5 ctattgttggatcatattcgtcc 3. , braf forward: 5 tcataatgcttgctgatagga 3. reverse: 5 ggccaaaaatttaatcagtgga 3. , mthfr ( c677t ) ‘‘5 gcacttgaaggagaaggtgtc 3” and reverse primer ‘‘5 aggacggtgcggtgagagtg 3” , mthfr ( a1298c ) forward ‘‘5 ctt tgg gga gct gaa gga cta cta c 3” and reverse ‘‘5 cac ttt gtg acc att ccg gtt tg 3” primers. , total rna isolation mini kit ( from human skin tissue ) / rneasy fibrous tissue mini kit ( for rna extraction from human skin tissue ) ( qiagen ) per kit ( each kit pack is for 50 reactions ) , purospin™ fibrous tissue rna purification kit ( luna nanotech ) ( for rna extraction from human skin tissue ) per kit ( each kit pack is for 250 reactions ) , aurum™ total rna fatty and fibrous tissue kit ( biorad ) / mp biomedicals fastrna pro green kitper kit ( each kit pack is for 50 reactions ) , human leptin elisa kit per kit ( each kit pack is for 96 reactions ) , human adiponectin elisa kit per kit ( each kit pack is for 96 reactions ) , human adipsin elisa kit per kit ( each kit pack is for 96 reactions ) , human resistin elisa kit per kit ( each kit pack is for 96 reactions ) , human iron elisa kit ( serum iron ) per kit ( each kit pack is for 96 reactions ) , human ferritin elisa kit ( serum / ferritin ) per kit ( each kit pack is for 96 reactions ) , gdf15 human elisa kit per kit ( each kit pack is for 96 reactions ) , spexin human elisa kit per kit ( each kit pack is for 96 reactions ) , human pai 1 elisa kit per kit ( each kit pack is for 96 reactions ) , thyroid estimation kit per kit ( each kit pack is for 96 reactions ) , ice maker machine for laboratory purpose 1 unit , microwave gloves each packet contains one pair of gloves. , pcr mini cooler / coolcube microplate and pcr tube cooler each , pipette 0.5 10ul, 02 20ul, 10 100ul, 20 200ul and 100 1000ul. each , horizontal gel apparatus: 18 – 20 cm ( length ) x 25 – 30 ( breadth ) x 5 7.5 cm ( height ) , 40 60 samples, multichannel pipette compatible combs and gel caste each , mini horizontal gel apparatus: 9 cm w x 11 cm l with grooves ( 8.7 cm l x 1.2 cm h ) on the side for gripping the gel tray. it should have two comb slots on the same tray area. buffer capacity should be 600 ml for the buffer tanks and optimum gel runs with a fill line indicator for buffer levels along the unit side each , multi size forceps lab set each packet containsmulti size forceps lab set , liquid nitrogen sample storage tanks each , liquid nitrogen sample handling gloves each packet contains one pair of gloves. , slide tray / rack each , l mold each , tissue cassette steel each , electric tissue float bath ( thermostate ) each , coupling jar each pack contains 2 psc. , staining rack each , whatman filter paper grade 1 & 2 each packet contains 50 psc.. , harri’s hematoxylin powder 25 / 50 / 100 / 250 / 500 gm , yellow eosin powder 25 / 50 / 100 / 250 / 500 gm , coverslip 18x18 ( microscopic ) each packet contains 100 psc.. , dpx mount 100 ml / 250 ml , hot plate each , mx35 premier microtome blade ( 34 / 80mm ) 50 blades each box contains 50 psc.. , diamond point marker pen ( histopathology use ) each , embedding mold and embedding ring each , qiamp dna ffpe tissue kit ( 50 rxns ) , genomic dna purification kit ( promega ) , rna extraction kit from tissue , cdna synthesis kit , superscript ii rnase reverse transcriptase , sybr green pcr master mix , sodium bisulphite , page loading dye , formamide , n’n’ methylene bisacrylamide , ammonium persulfate , temed , polyacrylamide , wizard dna clean up system ( promega ) , 2 mercaptoethanol , silver stain , hydroquinone , urea , blotting paper , dna ladder 10 bp , pas stain , histopathology plastic cassettes , poly – l – lysine coated slides , deep well mortar and pestle homogenizers ( medium size ) , deep well mortar and pestle ( small size ) , rneasy minielute cleanup kit , phase – lock gel heavy5 prime phase – lock gel heavy5 prime , qiazol lysis reagent , rneasy minielute cleanup kit , cryo vial 1 pkt contains 50 psc. , deep well mortar and pestle ( small size ) ...

Directorate Of Medical Education - Madhya Pradesh

34145016 supply of medicine / surgical / iv fluid / surgical suture / surgical stapler / chemical kits aceborophylline 100 mg amantadine 100mg capsule apripitant capsule 125mg & 80mg calcitrol 0.25 mg cap calcitrol 0.5mg capsule calcitrol calcium carbonate and zinc capsule chloramphenicol 250mg capsule chloramphenicol 500mg capsule crizotinib 250mg capsule cyclosporine 100 mg cyclosporine 50 mg deferiprone 500 mg cap. imatinib mesylate 100 mg oseltamivir ( 45mg ) , capsule palbociclib 100 mg cap palbociclib 75 mg cap sildenafil 20mg tetracycline capsules 250 mg tetracycline capsules 500 mg ulipristal acetate capsules 5mg acyclovir 3% ear drop beclomethasone ( 0.025% ) + clotrimazole 1% +neomycin sulphate 0.5% 5 ml ear drop fluromethanol eye drop gentamycin eye drop homatropine hydrobromide eye drop ip 5ml sterile lignocaine hcl 4% eye drop natamycin eye drop polyethelene glycol 400 & propylene glycol ophthalmic solution 10ml polyvinyl alcohol 1.4% 5 ml prednisolone eye / drop. proparacaine hydrochloride 0.5% eye drops 5ml sodium chloride opthalmic solution 5% eye drop acyclovir 3% eye oint.5 gm tube atropine eye oint. 3gm tube chloramphenicol eye ointment 5 gm tube ciprofloxacin eye ointment 5 gm tube hydroxypropylmethylcellulose 2% w / v ophthalmic solution ocular lubricant 5gm ointment tobramycin eye oint.3gm tube benzocain gel chlorhexadine gel choline salicyclic gel triamadone accetate gel sterile collogen granules nephro steril ( alanine 6.3 gm+l arginine 4.9 gm+l histidine 4.3 gm+l isoleucine 5.1 mg+l leucine 10.3 mg+l lysine 10.01 gm+l phenylalanine 3.8 gm+l threonine 4.8 gm+l valine 6.2 gm+methionine 2.8 gm+n acetylcarnosine 0.5 gm+proline 4.3 gm+serine 4.5 gm+tryptophan 1.9 gm ) 250ml infusion normal saline 1.6% 500 ml bottle parenteral nutrition two chamber bags without lipid ornidazole iv infusion 100ml bottle ringer lactate i / v 0.24 % v / v of lactic acid ( eq. to0.32% w / v of sodium lactate ) , 0.6 % w / v sodium chloride, 0.04 %w / v potassium chloride and 0.027 % w / v calcium chloride 500 ml ffs bottle ringer lactate i / v 0.24 % v / v of lactic acid ( eq. to0.32% w / v of sodium lactate ) , 0.6 % w / v sodium chloride, 0.04 %w / v potassium chloride and 0.027 % w / v calcium chloride 500 ml glass bottle sodium chloride hyper tonic n / 2 ( 0.45% ) 500 ml ffs bottle sodium chloride ( 1 / 2 n ) + dextrose 0.45% + 5% 500 ml ffs bottle desflurane 240ml bottle solution usp inhalation anaesthetic adalimumab 20mg / 0.4ml inj adalimumab 40mg / 0.8ml inj adenosine 3 mg / ml 2 ml amp ado trastuzumab emtansine 100 mg inj alteplase 50mg inj amidotrizoate meglumine; sodium amidotrizoate ( 76% ) dye 50 ml bottle aminophylline 25 mg / ml 10 ml vial ampicillin+sulbactum 1.5 mg inj anti d. immunoglobulin ( monoclonal ) ( 150mcg / vial ) human anti d, anti d. immunoglobulin ( monoclonal ) ( 300mcg / vial ) , human anti d anti human thymocyte immunoglobulin 25 mg anti scorpion venom inj <120mg total protein and >150 ld50 [ mouse ] neutralizing units / vial benfothiamine + folic acid + mecobalamin + pregabalin + vit b6 inj benzathine penicilline 12 lac iu / vial betamethasone sodium phosphate 4 mg / ml 1 ml amp biphasic insulin aspart ip penfill 100 iu inj 3 ml cartridge bortezomib 3 .5 mg / vial botalinin 100iu inj botalinin 200iu inj botulinum toxin type a injection buprenorphine hydrochloride 0.3mg base / ml 1ml amp inj butorphanol 1mg / ml 1ml amp carboprost tromethamin 250 mcg / ml 1ml amp cefuroxime 1.5gm inj cefuroxime 500mg inj cetuximab 100mg 2mg / ml vial cetuximab 200mg 2mg / ml vial cetuximab 50mg 2mg / ml vial chloramphenicol 500mg inj chlorpromazine ip 25mg vial cholecalciferol 600000 iu / ml injection cis atracurium 2mg / ml vail cladribine 10 mg / 10ml inj clonidine hydrochloride 100 mcg / ml 10 ml vial contrast urograffin inj cytarabine 1000 mg iv cytarabine 100mg injection cytarabine 1gm inj daunorubicin 50 mg / vial dexamethasone sodium phosphate ( 8mg / 2ml ( 2ml vial ) dextron 40 inj diatrizoate meglumine & diatrizoate sodium ( 37% ) vial diatrizoic acid 60% amp diatrizoic acid 65% amp diatrizoic acid 76% ( urographin dye ) injection diazepam 5 mg / ml 2 ml amp dicyclomine 10mg / ml 2 ml vial digoxin i.p. 0.5mg / 2 ml amp diltiazem 25mg / 5ml vial diphtheria antitoxin 1000 iu vial doxorubicin 500mg injection doxycyclin 100 mg injection edaravone 60 mg inj enalapril maleate inj 1.25 mg per ml 2ml vial ephedrine 30mg / ml 1ml inj esmolol / 40mg / ml 5 ml vial etanercept 25mg inj etanercept 50mg inj etomidate 2 mg / ml emulsion with mct 10ml vial fentanyl 100 microgran 2 ml amp fentanyl 50 microgran 2 ml amp fluorescein 20% 5 ml amp flupentixol 20 mg inj flupentixol 25 mg inj fluphenazine 25 mg / ml 1 ml amp ganciclovir 500 mg vial gas gangrene antitoxin 10, 000 iu / ml 40000 iu 4ml amp gatifloxacin vial gentamycin 80mg / 2ml amp glutathion 600mg inj granulocyte colony stimulating factor ( gcsf ) inj haemocoagulase 1 iu inj haemophilus influenzae type b vaccine hepatitis b vaccine / 1ml hyaluronidase 1500 iu / 2ml amp ifosfamide + mesna 1gm inj infliximab 100mg inj insulin glargine injection iohexol ( non ionic contrast medium in sterile aqueous solution ) 300 mg iodine / ml 100 ml bottle isobaric levobupivacaine 0.5% inj isoprenalin inj 1ml amp isoxsuprine hcl 5mg / ml 2ml amp ketamine hydrochloride 50 mg / ml 10 ml ketoprolac tromethamine 30 mg inj l aspiraginase 10000iu inj leuprolide 6.25mg inj levobupivacaine hyperbaric 0.5% lidocaine 4%, 5 ml vial lignocaine ( preservative free ) 2% 50 ml vial lignocaine 10% injection lignocaine 4% 30 ml vial lignocaine for spinal anaesthesia lignocaine 5% + destrose 7.5% 2 ml amp heavy lorazepam 2 mg / ml, 1 ml vial low molecular weight dextran 40000 vial mannicoccal acwy 0.5 ml inj meningococcal polysaccharide vaccine groupe a, c, y and w 135 combined vial mephentermine 30 mg / ml 10 ml mesna 200mg injection methacarbamol 100 mg. / 10ml vial methotrexate 500mg injection metoprolol 5mg / ml 5ml vial micafungin 100 mg micronised progesterone 50mg / ml 2ml amp micronized progesterone 100mg / ml 2ml amp milrinone 1mg / ml solution for injection / infusion mitomycin c 40mg inj mitoxantrone 15 mg inj morphine sulphate 10mg / ml 1ml amp naloxone 0.4 mg / ml, 1 ml nikethamide amp nimodipine 10mg / 50ml injection nitrofurantoin injection olanzapine 10 mg inj olanzapine depot inj panitumumab 100mg / 5ml inj pembrolizumab 100mg / 4ml ( 25mg / ml ) penicillin v 125 mg inj pentoxiphylline 20 mg / ml pertuzumab 30mg / ml ( 420mg / 14ml ) phenobarbitone 100mg / ml 1ml amp. phenobarbitone 200mg / ml 1ml amp. pilocarpine 0.5 % / 1ml amp piperacillin 2 gm+tazobactam 250 mg placenta extract 2 ml injection pneumococcal vaccine 10 ml vial pregabalin inj progesterone b.p.100mg vial promethazine 2 ml / 2.5% vial protamine sulphate 1%, 10mg / 5ml amp quinine sulphate 300 mg / ml, 2 ml amp romiplostim 250 mg injection romiplostim 500 mg injection ropivacaine 0.5% 20 ml vial ropivacaine 0.75% 4ml amp ropivacaine 10mg / ml 2.5ml vial ropivacaine hydrochloride 0.2% 40mg / 20ml vial ( 2mg / ml ) ropivacaine hydrochloride 0.75% 150 mg / 20 ml vial ( 7.5mg / ml ) sargramostim 500 mg inj soluble insulin penfill 3 ml injection surfactant ( porcine lung surfectant extract 80mg / ml ) terbutaline 0.5mg / ml aml amp teriparatide 600mcg 3 ml amp tetanus immunoglobulin usp 500 iu / vial thiamine 400mg inj thiamine hydrochloride inj.100mg / ml 2ml vial multiple dose ( vit.b1 ) thiopentone sodium 0.5gm powder / vial, 20 ml vial tobramycine 80 mg vial tocilizumab 400 mg inj torsemide inj 2ml amp trypan blue opthalmic solution 0.06% pre filled syringe ulinastatin 100000iu injection urokinase 500000 iu vial vasopressine 40 iu / ml amp verapamil hydrochloride 2.5 mg / ml 2ml amp vinblastine 10 mg / 10 ml amp vinorolbine 50mg inj vit d3 injection vit. cynocobalamin 500mcg +folic acid 15mg+niacinamide 200 mg + ascorbic acid inj vit. cynocobalamin 500mcg +folic acid 15mg+niacinamide 200 mg inj vit. methylcobalamin 1500 mcg +folic acid 0.7mg+ niacinamide 12 mg inj water for injection 10 ml amp zuclopenthixol acuphase 50 mg inj zuclopenthixol decanoate 200 mg inj acetic acid solution 3% 100ml acetone detection kit ada kit ae 1 / ae 3 aluminium ammonium sulphate powder 500gm amacr ana test kit anti a lactin 05ml anti ab sera 10ml anti d igg+ igm 10ml anti d igm 10ml anti h lactin 05ml anti her / erbb2 monoclonal anti human globulin ( ahg ) 05ml anti a sera 10 ml anti b sera 10 ml banded use in blood bank barium chloride 10 % 500 ml bcl 2 benedict reagent 5 lit cane bismark brown stain 100 gm blood culture media aerobic for adult ( bac t / alert pf plus blood culture media anaerobic for pediatric ( bac t / alert pf plus ) blotting paper 50 / pkt bovine albumin 22% 05ml buffer solution for hiv 50ml ca 125 calcium chloride 05ml / vail capillary tube cd34 combined spinal epidural ( cse ) kit couplin jar cover slips size 18x18mm cover slips size 22x22mm cox 2 csf protein kit cyclin d 1 cyto fix spray desmin disposable microtome blade ( 50 blades in one ) dpx mount 250ml ehlrich aldehyde reagent 125 ema estrogen receptor epi monoclonal filter paper 12.5 cm 0.1 micron ( 50 per pkt ) fouchet reagent 250ml glacial acetic acid 100 ml glial fibrillary acidic protein ( gfap ) h2so4 25 % 500 ml bottle haematoxylene 5gm haemoglobin strip hbv elisa test kit 4th generation 96 test hbv rapid test kit hpr polymerr kit with dab chromogen hydro chloride acid about 36.46% i.d. microtyping abd card i.d. microtyping gel card ahg immersion oil iso propyl alcohol ki67 / mib 1 06 ml antibody kit leishman stain 500 ml leucoreductionfilter ( bed side ) light green stain 100 gm liquid ammonia 500 ml liss diluent for gel card malaria parasite elisa test kit massons trichrome stain mercuri oxide 25gm methanol 2.5lit mgg 480ml multi parameter urine strips ( 100 in 1 box ) myogenin n / 10 hcl 500ml nfp nitric acid 500 ml nkx 3 1 p 53 pandys reagent 125ml pap pen papanicalou ea 125ml pea 030 papanicalou og 6 125ml pea 010 paraffin wax 58 60c pas stain pasture pipette poly l ltsin solution p8920 polythene gloves pricking lancet progestron receptor monoclonal retic stain 125ml s 100 sharp collection containers disposable 5 ltrs sharp collection containers disposable 1.5 ltrs single donor platelet kit make haemonotics / terumo penpol ( close system ) slide tray sma sodium chloride for analysis steel cassets for tissue processing sulpgar powder 500 gm sulpho salicylic acid 500ml synaptophysin tips for auto pippets ( 2 to 100 micron yellow 1000 / pkt ) tips for auto pippets ( 200 to 1000 micron blue 500 / pkt ) tissue paper roll titriplexiii pure ( edta ) tris buffer gr tween 20 for synthesis vdrl elisa test kit vimentin wafers cutting blade for tube welders xylene chlorhexidine mouthwash 0.2% 50 ml sterile haemocoagulase solution topical solution 0.2 cu nasal drop saline nasal gel 15 gm tube budesonide nasal spray 32mcg / spray methylcobalamin nasal spray 250 mcg saline nasal wash 3gm kit sodium chloride nasal wash betamethasone 0.5mg, gentamicin 1mg betamethasone valerate cream 0.05% 15gm betamethasone valerate ointment 0.1%, 15 gm tube centella asiatica extract based skin moisturization and antiscar gel 30gm clindamycin ointment 10gm fluconazole ointment 20 gm tube fusidic acid 2%, 15 gm heparin 20gm oint human placental extract ointment ketoconazole cream lidocaine zinc oxide ointment luliconazole cream la magnesium sulphate, sulphacetamide, urea, proflavin ( in glycerine base ) ointment75 gm neomycin sulphate 5 mg + bacitracin zinc 500 iu / gm, 15 gm papain urea and silk protein based debriding ointment and cream 100 gm papain urea and silk protein based debriding ointment and cream 25 gm papain urea and silk protein based debriding ointment and cream 50 gm papain urea 15 gm tube povidone iodine ointment 7.5%, 500 gm salicylic acid 2%, 30 gm silk protein based antimicrobial wound healing ointment loaded with asiaticoside and silver 100 gm silk protein based antimicrobial wound healing ointment loaded with asiaticoside and silver 25 gm silk protein based antimicrobial wound healing ointment loaded with asiaticoside and silver 250 gm silk protein based antimicrobial wound healing ointment loaded with asiaticoside and silver 50 gm silver sulphadiazine cream usp 1% w / w 250gm clotrimazole+beclomethasone oral paint triamcinolone oromucosal paste bp 0.1% ketocanazole oral paste triamcinolone acetonide dental paste usp 0.1% barium sulphate powder 250 gm clotrimazole powder neomycin sulphate+polymycin b powder polyethylene glycol + electrolyte powder protein powder silk protein and antimicrobial nano silver based surgical particle wound dressing 5ml vial n acetylcysteine solution for inhalation respules tiotropium ( 18 mcg ) + formoterol ( 12 mcg ) fostomycin sachet 3gm orodispersible probiotic sachet acyclovir lotion beclomethasone lotion citric acid 500 ml bottle compound benzointincture, benzoin, aloe, storax, tolu balsam and enough alcohol to make a tincture ( 74 80% alcohol ) , 100 ml feracrylum solution 1% 100 ml gention violet l / a glycerine 15% and sodium chloride 15% enema 20ml sodium hypochloride solution 5% 5 ltr topical heparin solution 5ml vial benzocaine +cetramide spray lignocaine spray 10% absorbable 2 0 endo suture cartridge 48 length advance rf energy hand instrument of 5 mm shaft diameter for laproscopic procedures with shaft length 35 cm and should be both hand and foot activated. compatible with ultrasonic vessel sealing dissector system installed in myh advance rf energy hand instrument of 5 mm shaft diameter for open procedures with shaft length 14 cm and should be both hand and foot activated. compatible with ultrasonic vessel sealing dissector system installed in myh circular stapler for end to end anastomosis with 31 mm diameter having varied staple height of 3.5 4 4.5mm circular stapler for end to end anastomosis with 31 mm diameter having varied staple height of 4 4.5 5mm circular stapler for end to end anastomosis with 33 mm diameter having varied staple height of 3.5 4 4.5mm circular stapler for end to end anastomosis with 33 mm diameter having varied staple height of 4 4.5 5mm disposable circular stapler 31mm diameter disposable circular stapler – 32mm diameter disposable circular stapler 33mm diameter disposable circular stapler iii rows disposable circular stapler 25 / 26mm diameter disposable circular stapler 28 / 29mm diameter disposable clip applier medium 10mm with 20 clips disposable clip applier medium 5mm with 16 clips disposable curved cutter stapler disposable hemorrhoidal stapler iiirows disposable hemorrhoidal stapler with detachable anvil. disposable linear stapler with fixed staple height 75mm 90mm size disposable linear stapler with fixed staple height 55mm 60mm size disposable trocar 05mm disposable trocar 10mm disposable trocar 12mm disposable trocar 15mm distal tip closure titanium ligation clip large size distal tip closure titanium ligation clip medium size distal tip closure titanium ligation clip small size endoscopic cutter & stapler 60mm long length endoscopic cutter & stapler 60mm regular length endosuturing device 10mm with toggle lever handpiece ( blue ) compatible with ultrasonic vessel sealing dissector system installed in myh handpiece ( transducer ) compatible with ultrasonic vessel sealing dissector installed in myh hemorrhoid stapler 33.5 mm diameter with detachable anvil, bridged anoscope, housing of 20 cc locking clip cartridge medium / large mesh fixation device with non absorbable titatinum tacks 20 multifire clip applier long size 15 clip multifire clip applier small size 20 clip non absorbable 2 0 endo suture cartridge 48 length open clip applicator 100 20cm length open clip applicator 200 20cm length open clip applicator 300 open clip applicator 400 open disposable clip applier for medium clip size 9.75 having 20 clips open linear cutter reload with 3 rows of staple line having varied satple height of 3.5 4 4.5 mm in reload having 60mm length open linear cutter reload with 3 rows of staple line having varied satple height of 4 4.5 5 mm in reload having 60mm length open linear cutter stapler compatible with 3 rows of staple line having varied satple height of 3.5 4 4.5 mm in reload having 60mm length open linear cutter stapler compatible with 3 rows of staple line having varied satple height of 4 4.5 5 mm in reload having 60mm length plastic locking clip applicator medium / large polycearbonte bladeless trocar with reducer seal 10mm polycearbonte bladeless trocar with reducer seal 12mm polycearbonte bladeless trocar with reducer seal 5mm polyproplene with polyglecaprone 25 partially absorbable mesh 7.6cm x 15cm polyproplene with polyglecaprone 25 partially absorbable mesh 10cm x 15cm reload 55 60mm for medium thick tissue blue compatible with linear cutter. reload 55 60mm for thin / vascular tissue white compatible with linear cutter. reload 75 80mm for medium thick tissue blue compatible with linear cutter. reload 75 80mm for thick tissue green compatible with linear cutter. reload compatible with curved cutter reload endoscopic cutter & stapler 45mm purple reload endoscopic cutter & stapler 60mm purple reload endoscopic cutter & staplter 45mm blue reload endoscopic cutter & staplter 45mm green reload endoscopic cutter & staplter 60mm / black reload endoscopic cutter & staplter 60mm blue reload endoscopic cutter & staplter 60mm gold reload endoscopic cutter & staplter 60mm green reload endoscopic cutter & staplter 60mm white reload for linear stapler with fixed staple height 35mm 45mm size blue reload for linear stapler with fixed staple height 35mm 45mm size green reload for linear stapler with fixed staple height 55mm 60mm size blue reload for linear stapler with fixed staple height 55mm 60mm size green reusable laparoscopic clip applicator for large titanium clips with 15cm 20cm length reusable laparoscopic clip applicator for large titanium clips with non detachable jaw assembly reusable laparoscopic clip applicator for large titanium clips. reusable laparoscopic clip applicator for medium large titanium clips with 28cm 30 cm length reusable laparoscopic clip applicator for medium large titanium clips with non detachable jaw assembly reusable linear cutter 55 60mm with 200 firing reusable linear cutter 75 80mm with 200 firing single use clip applier with 16 clips, 5mm diameter having display counter instrument u shaped clip suture locking autolock titanium clip 100 titanium clip 400 universal reload cartridge for 55 mm / 75mm new linear cutter for tissue thickness ranging from 1 mm to 2 mm with 6 rows of staples 3 on either side of cut line, 440 grade stainless steel knife integrated in the cartridge , 88 titanium staples / 118 titanium staples. universal stapler 55mm / 75mm new linear cutter along with staple height selector and 3d staple technology with ambidextrous firing with 6 rows of stapler height range of 1.5 mm to 2.00 m. paracetamol suppository abdominal drain no 8 abdominal drain bag accessory spikes amorphous hydrogel with colloidal silver antimicrobial , liquid parafin based silver sulphate antiseptic tulle 10cmx12cm antimicrobial incise drape 3 meter antimicrobial, liquid paraffin based chlorhexidien antiseptic tulle 10cmx12cm arterial pressure bag 1000ml arterial pressure bag 500ml ash brace m size barium sulphate liquid 1 liter bionet connector biopsy forceps type with / without spike / hot biopsy, length : 110cm / 160 cm / 210 cm, sterile for single use only, diameter – 1.8 mm / 2.5 mm as ordered bipolar forceps cable bis monitor electrode black monofilament 2 / 0 rc loop black thread ( stitching ) big bleaching powder gr ii 25 kg bag blood bag double 350 ml cpd solu blood bag double 350 ml with sagam blood bag quadruple 350 ml top bottom with cpd sagam solu blood bag quadruple 450 ml top bottom with cpd sagam solu blood bag single 350 ml blood bag transfer 350 ml blood bag triple 350 ml blood bag triple 350 ml sagam blood culture bottles bone marrow aspiration needles ( 14 ) bone marrow aspiration needles ( 15 ) bone marrow aspiration needles ( 16 ) bone marrow aspiration needles 13 g bone marrow biopsy needle bp cuff adult & pediatric carbolic acid 500 ml cardiovascular angiographic catheter 100cm, 4fr ( 1.35mm ) catheter single lumen 6.6 no catheter single lumen 7.7 no cautery patient plate disposable central venous line 4f cerebral catheter reservoir 12mm dia chamber cerebral catheter reservoir 18mm dia chamber cervical soft collar chlorhexidine gluconate dressing material chlorinated lime with boric acid solution 400ml cling drape 15x500cm closed suction trachostomy suction tube with pro s collegen patch collogen sheet 10x10 collogen sheet 15x15 colostomy kit condom catheter small, meadium, large conjugated drain craniotomy cutter blade cresol with soap solution 5ltr jar cvp manometer cylinder connection nut dermatome blade disposable haemorrhoidal circular stapler with dual safety with transparent housing size 34 dj stent 6 / 26 double monitoring pressure transducer dry collagen patch , non adhesive absorbalbe porus lyophilized fish origin collogen 10x10cm. dry collagen patch , non adhesive absorbalbe porus lyophilized fish origin collogen 30x30cm. dura guide for neuro surgery ecg paper 80mmx20 mtr roll ecg paper computerized triple channel 20m elastomeric pump for post operative analgesia endo stich lap suturing device 10 mm endotracheal tube with secondary lumen for surfactant therapy, size 2, 2.5, 3, 3.5, 4, 4.5 exchange transfusion catheter with four way adaptor size 4cm, l 40 cm extra ventricular drain ( evd ) fibrin & tissue glue fluorescein strips pkt foam sclerotherapy fibre fogartis catheter 4 fr gasket for vaccume jar 1000 ml gasket for vaccume jar 600 ml gasket for humidifier bottel guide wire m 0.89mm, 150cm halogen bulb holder ( heavy duty ) hemodialysis fluid for bicarb made ( part a 10 ltr + part b 500gm ) hip u drape humbys knife disposable blade hydrocephalus shunt medium pressur ( vp shunt ) hydrogen peroxide 21% w / w, paracetic acid 4% w / w, acetic acid 10% w / w ( cold st disinfectant for dialysis ) icd bag implantable pain port with epidural catheter for long term pain management impregnated antimicrobial latex two way foleys catheter with silicon coated.it should be impregnated with silver nano particles to prevent catheter associated uti and catheter blockage should have strong drainage funnel, double fixed non return valve for free inflation and deflation. size 14 balloon capacity between 1ml to 30ml, 50ml impregnated antimicrobial latex two way foleys catheter with silicon coated.it should be impregnated with silver nano particles to prevent catheter associated uti and catheter blockage should have strong drainage funnel, double fixed non return valve for free inflation and deflation. size 16 balloon capacity between 1ml to 30ml, 50ml impregnated antimicrobial latex two way foleys catheter with silicon coated.it should be impregnated with silver nano particles to prevent catheter associated uti and catheter blockage should have strong drainage funnel, double fixed non return valve for free inflation and deflation. size 18 balloon capacity between 1ml to 30ml, 50ml impregnated antimicrobial latex two way foleys catheter with silicon coated.it should be impregnated with silver nano particles to prevent catheter associated uti and catheter blockage should have strong drainage funnel, double fixed non return valve for free inflation and deflation. size 20 balloon capacity between 1ml to 30ml, 50ml impregnated antimicrobial latex two way foleys catheter with silicon coated.it should be impregnated with silver nano particles to prevent catheter associated uti and catheter blockage should have strong drainage funnel, double fixed non return valve for free inflation and deflation. size 22 balloon capacity between 1ml to 30ml, 50ml impregnated antimicrobial latex two way foleys catheter with silicon coated.it should be impregnated with silver nano particles to prevent catheter associated uti and catheter blockage should have strong drainage funnel, double fixed non return valve for free inflation and deflation. size 24 balloon capacity between 1ml to 30ml, 50ml impregnated antimicrobial latex two way foleys catheter with silicon coated.it should be impregnated with silver nano particles to prevent catheter associated uti and catheter blockage should have strong drainage funnel, double fixed non return valve for free inflation and deflation. size 26 balloon capacity between 1ml to 30ml, 50ml intraocular lens 14 30d dioptre intravenous drip set pediatric size introducer sheath 0.97mm 6fr, ( 2.0mm ) , 11 cm introducer sheath 0.97mm, 7 fr, ( 2.3mm ) , 11cm j r c bag 1 ltr j r c bag 1.5 ltr j r c bag 1 / 2 ltr 500ml kehr t tube laser radial fibre 600 micron and 400 micron liga clip 200mm, 300mm, 400mm liver biopsy gun long length quincke spinal needle for pain management, size – g 22, length – 120mm & 150mm mackintosh double colour water proof roll ( 20 meter per roll ) malecot rubber catheter no 12 malecot rubber catheter no 16 malecot rubber catheter no 20 malecot rubber catheter no 22 malecot rubber catheter no 24 medical dry imaging film 10x12 medical dry imaging film 14x17 medical dry imaging film 8x10 methacrylate based oxygen permeable non adherent 3 dimensional transforming powder dressing size 4 x 4 microlaryngeal surgery tube no 5 monopolar cautry wire disposable neonatal urine collection and measurement bag 100 ml omaya reservoir large size oxygen adaptor 5 type oxygen catheter oxygen connection with flow meter for central line oxygen connection with flow meter for cylinder oxygen high pressure hose pipe oxygen penal regulator for oxygen liquied tank ( 1 25 kg ) oxygen regulator for control penal board ( oxygen pipe line ) oxygen tailpipe ( flexible metalic ) pacing leads 6 fr paediatric double lumen polyurethan cvc line, 3 fr, l 10cm, 15cm, paraffin gauze dressing material 10x10cm pediatric diapers peritonial dialysis catheter 200mm pediatric peritonial dialysis catheter 280mm adult peritonial dialysis fluid 1ltr. pigtail catheter 6 fr ( 150 cm ) pigtail catheter with needle 6 fr ( 30 cm ) plaster of paris powder ip 1 kg pkt plastic nozel cap post exposure prophylaxis kits ( pep kits ) pressure regulated v p shunt for peadtric probe for oxygen radiopaque polyurethane catheter with fixation wings and integral extension tube 2f, 5f ( leader flex ) rectified sprit 4.5 ltr. scrotals support short pencil point spinal needle g 25 / 22, l 38mm. sics kit ( small incision cataract surgery ) silicon / double nasal prong with universal connector. all sizes silicon cautery plate silicon folyes catheter 14 fr silicon folyes catheter no 12 silicon tubing set for endoflaton silk protein and antimicrobial nano silver based sterile surgical wound dressing sheet 10 cmx 25 cm silk protein and antimicrobial nano silver based sterile surgical wound dressing sheet 20 cmx 25 cm silk protein and antimicrobial nano silver based sterile surgical wound dressing sheet 20 cmx 40 cm silk protein and antimicrobial nano silver based sterile surgical mesh wound dressing 10 cmx 25 cm silk protein and antimicrobial nano silver based sterile surgical mesh wound dressing 20 cmx 25 cm silk protein and antimicrobial nano silver based sterile surgical mesh wound dressing 20 cmx 40 cm silk protein based sterile surgical wound dressing sheet 20 cmx 40 cm silk protein based sterile surgical pu foam dressing 20cmx20cm silkolatex nasopharyngeal airway, with adjustable flange and widen end. sterilized sizes 20, 22, 24, 26, 28, 30, 32, 34, 36 fr soda lime for anesthesia workstation 5kg spatula for papsmear sterilant cold disinfectant for dialysis containing peraetic acid hydrogen peroxide acetic acid 5 ltr. sterile post‐operative surgical dressing surgical kit drape gown t.piece circuit with oxygen tubing set ( complete set ) tear test strip ( 100 strips in box ) terrimo guide wire thomas splint tmt graph paper tommy syringe tounge depresser wooden tracheostomy filter transducer set for invasive b.p. triway folyes catheter no 22 turp set ureteric catheter urine collecting bag with urometer 1 ltr. vaccum adaptor 5 type vaccum pump belt vaccum pump oil vaccum regulator ventilator circuit ( heated wire ) ventilator mask water bed wipes wound protector extra small incision size 2 4 cm wound protector large incision size 9 14 cm wound protector large incision size 9 14 cm with retraction ring wound protector medium incision size 5 9 cm wound protector small incision size 2.5 6 cm x ray casset 12x15 x ray casset 10x12 x ray casset 8x10 x ray developer 22.5 lit. x ray films size 10x12 50film per pkt blue sensitive x ray films size 12x15 50film per pkt blue sensitive x ray films size 8x10 50film per pkt blue sensitive x ray fixer 22.5 lit x ray hangers ( clip type ) 10x12 x ray hangers ( clip type ) 12x15 x ray hangers ( clip type ) 8x10 x ray screen high speed 12x15 x ray screen high speed 8x10 x rayscreen high speed 10x12 180 absorbable polyglyconate knotless wound closure device with unidirectional 0 30cm , green 37mm 1 / 2 circle taper point 180 absorbable polyglyconate knotless wound closure device with unidirectional 2 0 30cm , green 37mm 1 / 2 circle taper point 3 dimentional polyester mesh with micro porosity, x stich macro porosicty and multidirectional elasticity with optimesed atello collagen 1 absorbable anti adhesive barrier 12cm 3 dimentional polyester mesh with micro porosity, x stich macro porosicty and multidirectional elasticity with optimesed atello collagen 1 absorbable anti adhesive barrier 15cm 3 dimentional polyester mesh with micro porosity, x stich macro porosicty and multidirectional elasticity with optimesed atello collagen 1 absorbable anti adhesive barrier 20cm 5 mm helical shaped non absorbable titanium tacker for laproscopic mesh fixation device with 30 tacks 5 mm screw shaped polyglycolic lactic acid absorbable tacker for laproscopic mesh fixation fevice with min 30 tacks absorbable gelatin based topical absorbable flowable hemostat with 6cc syringe pre filled with hemostatic matrix. with 14.3 cm white applicator tip & 14.6 cm blue flexible applicator tip absorbable intraperitoneal umbilical patch of polyester mesh with collagen barrier and having absorbable pgla expanders with size 6 cm circle fda approved absorbable intraperitoneal umbilical patch of polyester mesh with collagen barrier and having absorbable pgla expanders with size 8 cm circle, fda approved absorbable unidirectional barbed device polydioxanone size 1, 40 mm 1 / 2 circle taper point needle 45 cm absorbable unidirectional barbed device symmetric anchoring pattern, triclosan coated polydioxanone size 1, 40 mm 1 / 2 circle taper point needle 45 cm absorbable unidirectional barbed device, symmetric anchoring pattern, triclosan coated polydioxanone, size 1, 36mm 1 / 2 circle taper point needle, 45 cm black braided silk 2 0 rb 5333 suture 17mm 1 / 2c taper black braided silk 3 0 rb suture 17mm 1 / 2c taper black braided silk 5 0 rb suture 17mm 1 / 2c taper black braided silk eyeless needled suture usp, size 8 0 suture length 76cm, needlelength & description 3 / 8 circle round bodied 30mm blackbraided silk eyeless needled suture usp, size 6 0 suturelength 76cm, needlelength & description 1 / 2 circle round bodied 30mm bovine collagen and glycosaminoglycan ( chondroitin 6 sulfate ) and silicone layer ( bilayer ) dermal regeneration template 2 in x 2 in bovine collagen and glycosaminoglycan ( chondroitin 6 sulfate ) and silicone layer ( bilayer ) dermal regeneration template 4 in x 10 in bovine collagen and glycosaminoglycan ( chondroitin 6 sulfate ) and silicone layer ( bilayer ) dermal regeneration template 4 in x 5 in bovine collagen and glycosaminoglycan ( chondroitin 6 sulfate ) and silicone layer ( bilayer mashed ) mashed dermal regeneration template 2 in x 2 in bovine collagen and glycosaminoglycan ( chondroitin 6 sulfate ) and silicone layer ( bilayer mashed ) mashed dermal regeneration template 4 in x 10 in bovine collagen and glycosaminoglycan ( chondroitin 6 sulfate ) and silicone layer ( bilayer mashed ) mashed dermal regeneration template 4 in x 5 in braided synthetic absorbable eyeless needled suture usp code 2423, size 1 0 suture ( os ) copolymer of glycolied and e caprolactone, 1 0 ct 1 needle and 45cm suture length unidirectional spiral. copolymer of glycolied and e caprolactone, 2 0 ct 1 needle and 45cm suture length unidirectional spiral. copolymer of glycolied and e caprolactone, 3 0 rb 1 needle and 20cm suture length unidirectional spiral. copolymer of glycolied and e caprolactone, 3 0 rb 1 needle and 45cm suture length unidirectional spiral. knotless wound closure device with unidirectional 2 0 45cm , undyed 24mm 3 / 8 circle reverse cutting knotless wound closure device with unidirectional 3 0 58cm , undyed 24mm 3 / 8 circle reverse cutting macro porus partially absorbable mesh made up of approximately equal parts of polypropylene monofilament fiber ( 6 0 ) and poliglecaprone 25 monofilament fiber ( 5 0 ) with pore size 2.7 mm having a weight of 39 g / m2 and containing blue orientation stripes of polypropylene. 15cmx15cm monofilament glycomer 0, 90cm , violet 40mm 1 / 2 circle taper point monofilament glycomer 1 , 90cm , violet 40mm 1 / 2 circle taper point monofilament glycomer 2 0 , 75cm , violet 27mm 1 / 2 circle taper point monofilament glycomer 3 0 75cm , undyed 24mm 3 / 8 circle reverse cutting monofilament glycomer 3 0 75cm , violet 22mm 1 / 2 circle taper point patient return electrode with current limiting nature & hence eliminate patient pad site burns based on capacitive coupling principle & made of akton polymer can be used for all patient’s weight >350 grams, radiolucent & latex free, no adhesive related irritation to patient skin.can be used any side up for easy handling in or and us fda approved compatible to any electrosurgical generator, size: 36” l x 20”w x 1 / 8”thickness. perforator 14mm pistol grip curved coagulating shears with ergonomic handle in the following shaft length 36cm. can seal blood vessel up to and including 5mm in diameter compatible with ultrasonic vessel sealing dissector system polydioxanone 122cm , no 1 size loop sgle with 65 mm needle and 1 / 2 circle tp needle. polydioxanone barbed suture 1 0 polydioxanone suture voilet monofilament 17mm 1 / 2c taper no 4 0 90cm polydioxanone suture voilet monofilament 40mm 1 / 2c blunt point 1 240cm polydioxanone suture voilet monofilament double armed trocar point 2 0 70cm polydioxanone suture clear monofilament 36mm 1 / 2c taper 3 0 70cm polydioxanone suture voilet monofilament 17mm 1 / 2c 5 0 70cm polyglactin 4 0suture undyed braided 1 / 2c reverse cutting polyglactin 910 with triclosan no. 0 x 90 36mm hc rb polyglactin 910 with triclosan no. 1 x 100 55mm hc rb polyglactin 910 with triclosan no. 1 x 90 36mm hc tc progrip self fixating mesh 12*08cm progrip self fixating mesh 14*9cm progrip self fixating mesh 15*15cm progrip self fixating mesh 20*15cm progrip self fixating mesh 30*15cm protective disk with chg hydrophilic polyurethane absorptive foam with 92 g chlorhexidine gluconate ( chg ) 1 disk ( 2.5 cm ) 7mm center hole with radial slit usfda approved protective disk with chg hydrophilic polyurethane absorptive foam with 92 g chlorhexidine gluconate ( chg ) 1 disk ( 2.5 cm ) 4.0 mm center hole with radial slit usfda approved scissor grip curved coagulating shears with curved tapered tip for precise dissection and with 240 degree activation triggers that support multiple hand position in the following shaft length 17cm. can seal blood vessels up to & including 5mm in diameter with ultrasonic vessel sealing dissector . self gripping polyester / polypropylene monofilament mesh pre cut with pla grips with size 14 x 09 cm for left side , fda approved self gripping polyester / polypropylene monofilament mesh pre cut with pla grips with size 14 x 09 cm for right side, fda approved self gripping polyester / polypropylene monofilament mesh pre cut with pla grips with size 12 x 08 cm for left side, fda approved self gripping polyester / polypropylene monofilament mesh pre cut with pla grips with size 12 x 08 cm for right side, fda approved sterilised surgical needled suture 8mm 1 / 4 spatulated micropoint double 5 0 sterlized monofilament polyamide eyeless needled suture uspsize 6 0 suture length in cm 70cm needle length & description 3 / 8 circle reverse cutting cutting 12mm sterlized surgical chromic gutsutue eyeless needied usp, code 4268, size5 / 0, suture length in cm 76cm, needle length & description 3 / 8 circle reverse cutting 12mm. suture dyed polyester poly ( p dioxxanone ) 1 0, 24x4cm, 1 / 2 circle 36mm rb 20 anchors / inch bidirctional. synthetic absorbable surgical suture triclosan coated violet monofilament polydioxanone suture with 70 cm size 2 0 with 1 / 2 circle taper point sh, 25mm to 26 mm needle usfda approved synthetic absorbable surgical suture triclosan coated monofilament poliglecaprone 25 suture, length 70 cm, size 2 0 with 3 / 8 circle oval round body visi black jb needle 26 mm synthetic absorbable surgical suture triclosan coated violet monofilament polydioxanone suture with 90 cm size 1 with 1 / 2 circle taper point ct 1 40 mm needle usfda approved transducer with unlimited counts compatible with ultrasonic vessel sealing dissector system v shape clip applicators large v shape clip applicators medium v shape clip applicators small v shape ligation clip large v shape ligation clip medium v shape ligation clip small aciclovir 200mg / 5ml oral suspension 100ml bottle albendazole suspension 200 mg / 5ml bottle baclofen oral solution ip 1mg / ml syp calcium phosphate, 2:1 ratio, 100 ml bottle carbamazepine oral suspension usp 100ml syp chloramphenicol palmitate oral suspension ip 125mg / ml 100ml syp chloroquine phosphate , 160 mg / 10 ml ( 50 mg / 5 ml base ) , 60 ml bottle ciprofloxacin 125mg / 5ml syp 60 ml bottle co trimoxazole 30 ml cyanocobalamin 7.5 mcg+ferrous ammonium citrate 160 mg+folic acid 0.5 mg / 10ml cyclosporine oral solution usp 100mg / ml 50ml syrup cyproheptadine + lycine and vitamins 200ml syp cyproheptadine hcl 2 mg + tricholine citrate 275 mg, 200 ml bottle domperidon suspension 1mg / ml 30 ml bottle etiophylline + theophylline pediatric syp. ( 46.5+14mg / 5ml ) 60 ml bottle ibuprofen oral suspension bp 100mg / 5ml 100ml syp iron+zinc syp metronidazole 200mg / 5ml suspension 60ml bottle nitazoxanide 100mg / 5ml 30 ml bottle norfloxacine suspension ( 30 ml bottle ) oxetacaine 10mg + aluminium hydroxide 291mg + milk of magnesia 98 mg per 5ml 200 ml bottle paracetamol oral solution 150mg / ml 15 ml bottle with dropper paracetamol syrup / suspension 125 mg / 5ml ( 60ml bottle ) phenobarbitone syp 30ml. 20mg / 5ml. phenytoin sodium suspension 30mg / 5ml 100 ml bottle prednisolone sodium phosphate solution 5mg / 5ml 60ml syp salbutamol sulphate , 2 mg / 5 ml , 60 ml bottle sodium valporate oral solution 100ml syp sorbitol 7.15 gm+tricholine citrate 0.55 gm sulfamethoxazole and trimethoprim suspension ( 200mg+ 40mg / 5ml ) 100 ml bottle trypsin bromelain & rutoside trihydrate tablets 6 mercaptopurine , 50mg acarbose 25 mg aceclofenac 100mg+paracetamol 500mg , tablet aceclofenac+thiocolchicoside 100mg+4mg tablet aceclofenace 100mg+serratiopeptidase 15mg tab acenocoumarol 2 mg tab acenocoumarol 1mg acyclovir 200mg tab ademetionine 100mg tab afatinib 40 mg agomelantine 025 mg tab alpha lipoic acid 100 mg+folic acid 1.5 mg+mecobalamin 1.5 mg+vitamin b6 3 mg ambroxol hydrochloride 30mg tab amitriptyline 10 mg amlodipine ( 5 mg ) + metoprolol ( 50 mg ) artemether 80mg tab artesunate 50 mg+sulphadoxine 500 mg+pyrimethamine 25 mg tab aspirin 75 mg aspirin 150 mg aspirin 75 mg+clopidogrel 75 mg+rosuvastatin 10 mg aspirin 75 mg+prasugrel 10 mg atorvastatin 10 mg+aspirin 75 mg. baclofen 5mg tab benfothiamin 150mg betahistine 4mg tab betamethasone 0.5 mg bisoprolol 2.5 mg+hydrochlorothiazide 6.25 mg bisoprolol 5 mg+amlodipine 5 mg bosentan 62.5 mg tab brivaracetam 50mg tab bromocriptine 2.5mg tab buprinorphine 4mg buprinorphine 8 mg bupropion 300 cabargolin 0.25 mg cefadroxil 500 mg chlorthalidon 50 mg tab cilostazole 50mg tab cilostazole100mg tab cinnarizine 20 mg and dimenhydrinate 40 mg citicoline 500mg tab clopidogrel 75 mg+aspirin 75 mg clopidogrel 75 mg+atorvastatin 20 mg clotrimazole 400mg tab co trimoxazole tab cyclophosphamide 50 mg tab cyclosporine 300mg tab cynocobalmin + folic acid tab dapagliflozin 5mg tab dapsone 100 mg tab deferasirox dispersible 500mg tab deflazacort 6mg tab desmopressin 0.5mg tab dexamethasone 4 mg tab diphenylhydramine 50 mg domperidone+ranitidine 150mg tab drotaverine 40 mg tab drotaverine 80mg duloxetine 40mg dydrogesterone 10mg eltrombopag olamine 150mg tab empagliflozin 25mg tablet entecavir 0.5mg tab entecavir 1mg tab eplerenone 25mg erlotinib tablets ip 100mg escitalopram 10 mg tab esomeprazole 40mg ethambutol hydrochloride 400mg tab ethambutol hydrochloride 800mg tab etizolam+propranolol 20mg tab etophylline 77 mg+ theophyllin 23 mg etoposide 50 mg etoricoxib 90mg farmalin 1gm tab ( 100 tab per box ) fenofibrate 160mg tab ferrous sulphate tab. 200mg ( equivalent to 60mg elemental iron ) fludrocortisone 0.1mg tab folic acid 800 mcg fungal diastase 100 mg+papain 60 mg gabapentin 400 mg+nortriptyline 10 mg ganciclovir 1000mg tab glibenclamide 2.5mg tab gliclazide 60mg glimepiride 2 mg + metformin 500 mg + pioglitazone 15 mg glimepiride 2 mg+metformin 500 glipizide 5 mg+metformin 500 mg glucagon 0.1mg tablet glyceryl trinitrate 0.5 mg sublingual tab hydrocortisone 10 mg hydrocortisone 20mg tab hydroxyzine 10 mg tab hyoscine butylbromide tab 10mg ibuprofen 400 mg indapamide hemihydrate 1.5mg isoniazid 200 mg tab isosorbide 5 mononitrate 20 mg isosorbide mononitrate 30 mg itopride 150mg itopride hydrochloride 25 mg tab itopride hydrochloride 50 mg tab l carnosine 200mg tablet lactobacillus 120 lamotrigine 25mg tab lansoprazole 15mg tab lapatinib 250 mg levetiracetam 750mg tab levodopa + carbidopa 100+25mg levofloxacin 750mg tab loperamide 8 mg tab lorcaserine 10 mg tab losartan ( 50 mg ) + chlorthalidone ( 12.5 mg ) lurasidone 20 magnesium oxide 200 mg magnesium valproate 400 mg mebendazole 100 mg tab meclizine hydrochloride 25 mg mefenamic acid 250mg+dicyclomine 10mg tab megestrol acetate 40mg melatonin 3mg melatonin 6mg mercaptopurine 50mg tab mesalamine ( 5 aminosalicylic acid ) 400 mg tab metaclopramide 10 mg tab metformin ( 1000 mg ) + vildagliptin ( 50 mg ) metformin 500 mg+voglibose 0.3 mg methimazole 10 mg tab methocarbamol 500 mg. methotrexate 10 mg methotrexate 5 mg tab methylcobalamin +folic acid tab methylcobalamin 1500mg tab methyldopa 250 mg tab methylphenidate 10 mg methylphenidate 20 mg methylphenidate 5 mg metoclopramide 05 mg metoprolol 12.5 mg metoprolol 50 mg+ramipril 5 mg misoprostol 200 mg modafinil 200mg tab morphine sulphate 10mg tablet moxonidine 0.3 mg multivitamin tab nfi formula sugar coated vit a 2500 iu, vit b12 , vit b 6, 0.5 mg, vit c 50mg vit d3 200iu, niacinamide 25mg folic acid 0.2mg ( with approximateoverages ) mycophenolate mofetil, 500 mg n acetylcysteine 300mg tab naproxen 250 mg tab naproxen 500mg + domperidone 10mg tab naproxen 500mg tab nebivolol 5mg nicorandil 5 mg tab nicotinamide 250mg tab nicoumalone 1 mg nimesulide 100 mg nimodipine 30mg tablet nitazoxanide 200 mg nitazoxanide 500mg tab nitrocontin 2.6 nitroglycerin 2.5 mg ofloxacin 200mg +tinidazole 600mg tab ofloxacin 400mg tab olmesartan 10 mg olmesartan 20mg olmesartan medoxomil 20 mg+amlodipine 5 mg+hydrochlorothiazide 12.5 mg olmesartan medoxomil 40 mg+amlodipine 5 mg oxcarbazepine 150 mg tab oxcarbazepine 300 mg tab oxybutynin 2.5mg tab pancreatic enzyme 1000mg tab pancreatic enzyme 2000mg tab pancreatic enzyme 500mg tab pantoprazole 40 mg+domperidone 30 mg paracetamol, chlorpheniramine maleate, phenylephrine hydrochloride & caffeine tablets pazopanib 200mg / 400mg penicillin v 250 mg tab ( phenoxymethyl penicillin potassium ) pentoxifylline 400mg perampanel 4mg phenobarbitone 30 mg. pramipexol 0.26 sr pramipexol 0.50mg prazosin 10mg tab propranolol hydrochloride 40mg+flunarizine 10mg tab propylthiouracil 50mg prucalopride 2mg tab quetiapine 50mg tab racecadotril 100mg ranolazine sustained release 500mg tab rifaximin 550 mg tablet rivaroxaban 10mg tab rivaroxaban 15mg tab rivaroxaban 5mg tab rosuvastatin 20 mg sacubitril 24 mg+valsartan 26 mg secnidazole 500 mg tab sevelamer carbonate 400mg tab sevelamer carbonate 800mg tab sildenafil 25 mg silodosin 8mg tab sitagliptin 50 mg+metformin 500 mg sodamint tab solifenacin 5mg tab sulfamethoxazole and trimethoprim ( 100mg+ 20mg ) tab sulfasalazine 500mg tab sunitinib 50 mg tapentadol 50mg tab telmisartan 40 mg+amlodipine 5 mg telmisartan 80 mg+amlodipine 5 mg telmisartan 80 mg+hydrochlorothiazide 12.5 mg teneligliptin 20 mg tenofovir disoproxil 300mg tab terbutaline sulphate 2.5mg tab tetrabenazine 12.5mg tab tetrabenazine 20 mg tab tetrabenazine 25mg tab thiamine 200mg tab thiamine 75mg thyroxine sodium 137 mcg thyroxine sodium 62.5 mcg thyroxine sodium 12.5 mcg thyroxine sodium 150 mcg thyroxine sodium 125 mcg thyroxine sodium 88mcg tablet tianeptine 12.5 mg tolperisone hydrochloride 150 mg tab tolvaptan 15 mg topotecan 1 mg torsemide 10 mg+spironolactone 50 mg tramadol 37.5mg and acetaminophen 325mg tablet valganciclovir 450mg tab valganciclovir 500mg tab valganciclovir 900mg tab valsartan 40 mg venlafaxine 75 verapamil 120mg tab vidagliptin 100mg tab vidagliptin 80mg vilazodon 20mg vilazodon 40mg voriconazole 100mg tab voriconazole 150mg tab voriconazole 200 mg voriconazole 50mg tab vortioxetine 20mg vortioxetine 10mg vortioxetine 5 mg warfarin sodium 5 mg tab zonisamide 100 mg tab zonisamide 50 mg tab...

Directorate Of Health Services - Madhya Pradesh

33747699 supply of medicine and material medicine and material , medicine name , atropine inj 0.6 mg / ml 2 ml amp , bupivacaine hcl inj 0.5% 20 ml vial , glycopyrolate inj 0.2 mg / ml 1 ml amp , halothane inhalation 250 ml bottle , isoflurane inhalation 250 ml bottle , ketamine inj 10 mg / ml 10 ml vial , lignocaine inj 2% 30 ml vial , lignocaine gel 2% 30 gram tube , lignocaine +adrenaline inj 2% + 0.005 mg / ml30 ml vial , midazolam inj 1 mg / ml 5 ml amp / 10 ml vial , pentazocine injection 30mg / ml 1 ml ampule , thiopentone inj 0.5gm powder / vial 20 ml vial , nitrous ( store under pressure in metal cylinders of the type conforming to the appropriate safety regulations and at temperature not exceeding 37°c ) , oxygeninhalation , promethazine injection 10 mg / mlone injection 1 vial , propofal injection 10 mg / ml 1 ml / vial , aceclofenec tab 100mg 10 x10 , acetylsalicylic acidtablet 150 mg 10 x 10 , acetylsalicylic acid ( aspirin ) *tablet 25 mg 10 x 10 , allopurinol tablet300 mg 10 x 10 , allopurinol tablet 100 mg 10 x 10 , aspirin tab 75 mg 10 x 10 , atracurium inj 10 mg / ml 2.5 ml amp , diclofenac tab 50 mg 10 x 10 , diclofenac inj 25 mg / ml 3 ml amp , diclofenac 1% gel , fentanyl 50 microgram / ml 2 ml amp , hydroxychloroquine tablet 200 mg 10 x 10 , ibuprofen tab 400mg 10 x 10 , ibuprofen oral suspension 100mg / 5ml 60 ml bottle , morphine inj 10 mg / ml1 ml amp , paracetamol tab 500mg 10 x 10 , paracetamol drops 125mg / ml drops 125mg / ml , paracetamol inj150 mg / ml 2 ml amp , paracetamol syp 125mg / 5 ml 60 ml bottle , paracetamol tab 650mg 10 x 10 , pregabalin tablet 150 mg 10 x 10 , succinyl choline inj 50 mg / ml10 ml vial , sulfasalazine tablet 500 mg 10 x 10 , tapentadol tablet 100 mg 10 x 10 , tramadol inj 50 mg / ml 2 ml amp , tramadol tab 50mg 10 x 10 , betahistine tab 8 mg 10 x 10 , cinnarizine tab 25 mg 10 x 10 , adrenaline inj 1 mg / ml 1 ml amp , betamethasone tab 0.5 mg 10 x 10 , betamethasone sodium phosphate inj 4 mg / ml 1 ml amp , cetirizine tab 10 mg 10 x 10 , cetirizine syp 5mg / 5ml 30 ml bottle , chlorpheniramine inj 10 mg / ml10 ml vial , chlorpheniramine oral liquid 2 mg / 5 ml , dexamethasone inj 8 mg / 2 ml 2 ml vial , dexamethasone tab 0.5 mg 10 x 10 , hydrocortisone inj 100 mg / vial dry powder 100mg / vial , hydrocortisone ointment 0.5% , hydrocortisone ointment1% , hydroxyzine syrup 10 mg / 5 ml , hydroxyzinetablet25 mg 10 x 10 , pheniramine injection 22.75 mg / ml 2 ml vial , prednisolone tab 20 mg 10 x 10 , promethazine syp 5mg / 5ml 60 ml bottle , ferrous ascorbate ( 100mg. elemental iron+ folic acid 1.5 mg ) 10 x 10 , phytomenadione injection 10 mg / ml 10 mg ampule , carbamazepine tab 200 mg 10 x 10 , carbamazepine tablet 200 mg 10 x 10 , carbamazepineoral liquid 100 mg / 5 ml , diphenylhydantoin tab 30 mg 10x10 , levetiracetam tablet 250 mg 10 x 10 , magnesium sulphateinjection 500 mg / ml , phenobarbitone inj 200 mg 1 ml amp , phenobarbitone tab 30 mg 10 x 10 , phenytoin inj 50 mg / ml 2 ml amp , phenytoin / diphenylhydantoin tab 100mg 10 x 10 , sodium valproate tab 500 mg 10 x 10 , sodium valproate syrup each 5ml contains 200mg 200 ml bottle , valproate oral solution 200mg / 5ml 100 ml bottle , desferrioxamine injection 500 mg vial , naloxone inj 0.4 mg / ml 1 ml amp , pralidoxime ( pam ) inj 25 mg / ml 20 ml amp , abacavir tablet 300 mg 10 x 10 , acyclovir inj 250 mg / vial vial , acyclovir tab 200 mg 10 x 10 , acyclovir tab 800 mg 10 x 10 , albendazole 200mg / 5 ml 10 ml bottle , albendazole tab 400 mg 10 x 10 , amikacin inj 100 mg / 2 ml 2 ml vial , amikacin inj 500 mg / 2 ml vial2 ml vial , amoxycillin cap 250 mg 10 x 10 , amoxycillin cap 500 mg 10 x 10 , amoxycillin oral suspension 125 mg / 5 ml30 ml bottle , amoxycillin +clavulanic acid inj ( amoxycillin 500 + clavulanic acid 100 mg ) / vial , amoxycillin +clavulanic acid syp ( amoxicillin 200mg + clavulanic acid 28.5mg ) / 5ml 30 ml bottle , amoxycillin +clavulanic acid tab ( amoxycillin 500 + clavulanic acid 125mg ) 10 x 10 , amphotericin b injection 50 mg vial / ampoules , ampicillin cap 500 mg 10 x 10 , ampicillin inj 500 mg / vial , artesunate inj 60 mg / vial , artesunate powder for injection 120 mg , artesunate + sulphadoxine + pyrimethamine ( age group 15 or above ) ab artesunate 200 mg ( 3tab ) + sulphadoxine 750 mg ( 2tablets ) + pyrimethamine 37.5 mg ( 2 tab ) tablets ip1 combi pack , artesunate + sulphadoxine + pyrimethamine ( age group 9 to 14 years ) ab artesunate 150mg ( 3tab ) + sulphadoxine 500mg ( 2 tab ) +pyrimethamine 25mg tab ip ( 2tab ) 1 combi pack , artesunate + sulphadoxine + pyrimethamine ( age group between 1 4 years ) tab artesunate 50 mg ( 3 tab ) + sulphadoxine 500 mg ( 1 tab ) + pyrimethamine 25 mg ( 1 tab ) tablets ip 1 combi pack , azithromycin tab 250 mg 10 x 10 , azithromycin tab 500 mg 10 x 10 , azithromycin syp 200mg / 5ml 15 ml bottle , benzathine penicilline 6 lakh iu / vial , benzathine penicilline 12 lakh iu / vial , cefixime tab 50 mg 10 x 10 , cefixime tab 200 mg 10 x 10 , cefixime oral suspension 100mg / 5ml 10 ml bottle , cefotaxime inj 250 mg / vial , cefotaxime inj 500 mg / vial , cefotaxime inj 1gm / vial , cefpodoxime tab 200 mg 10 x 10 , ceftazidime powder for injection 250 mg , ceftazidime powder for injection 1gm , ceftriaxone inj 250 mg / vial , ceftriaxone inj 500 mg / vial , ceftriaxone inj 1 gm / vial , cephalexin cap 250 mg 10 x 10 , cephalexin syp 125mg / 5ml 30 ml bottle , chloroquine inj 40 mg / ml 5 ml amp , chloroquine syp 160mg / 10ml ( 50mg / 5ml base ) 60 ml bottle , chloroquine tab 250 mg 10 x 10 , ciprofloxacin tab 250 mg 10 x 10 , ciprofloxacintab 500 mg 10 x 10 , ciprofloxacin inj 200 mg / 100 ml 100 ml ffs bottle , clarithromycintablet 250 mg 10 x 10 , clindamycin capsule 150 mg 10 x 10 , clofazimine tablet 50 mg 4 10 x 10 , clofazimine capsule 100 mg 10 x 10 , clotrimazole ( vaginal tab ) pessary 500 mg ( with applicator ) single tab , clotrimazole cream 2%w / w 15 gram tube , cloxacillin capsule 125 mg 10 x 10 , cloxacillin capsule 500 mg 10 x 10 , cycloserine capsule 125 mg 10 x 10 , dapsone tablet 100 mg 10 x 10 , diethylcarbamazine tab 100 mg 10 x 10 , diethylcarbamazineoral liquid 120 mg / 5 ml , diloxanide furoate tablet 500 mg 10 x 10 , doxycycline cap 100mg 10 x 10 , doxycycline dry syrup 50 mg / 5 ml , fluconazole tab 150 mg 10 x 10 , furazolidone tab 100 mg 10 x 10 , gentamicin inj 40 mg / ml 2 ml amp , itraconazole tablet / capsule 100 mg 10 x 10 , ivermectin tab 12 mg 10 x 10 , levofloxacin tab 250 mg 10 x 10 , levofloxacin tab 500 mg 10 x 10 , linezolid tablet 600 mg 10 x 10 , meropenem 500 mg vial , metronidazole inj 500 mg / 100 ml100 ml ffs bottle , metronidazole tab 400 mg 10 x 10 , metronidazole oral suspension 200 mg / 5ml 60 ml bottle , norfloxacin tab 400 mg 10 x 10 , norfloxacin dispersible tablet 100 mg 10 x 10 , ofloxacin 200 mg 10 x 10 , ofloxacin 400mg 10 x 10 , piperacillin +tazobactam inj 4.5 gm / vial vial , primaquine tab 2.5 mg 10 x 10 , primaquine tab 15 mg 10 x 10 , primaquine tab 7.5 mg 10 x 10 , quinine inj 300 mg / ml 2 ml amp , quinine tab 300 mg 10 x 10 , sodium aminosalicylate granules 10 gm , sulfamethoxazole and trimethoprim tab800mg + 160mg 10 x 10 , sulfamethoxazole +trimethoprim tab200mg +40 mg 10 x 10 , sulfamethoxazole +trimethoprim oral liquid ( 200mg +40 mg ) / 5 ml 50 ml bottle , sulfamethoxazole+trimethoprim ( pediatric tablets ) tab 400 mg+80 mg 10 x 10 , tablet artemether ( a ) + lumefantrine ( b ) tablet 20 mg ( a ) + 120 mg ( b ) 1x6 tab , tablet artemether ( a ) + lumefantrine ( b ) oral liquid 80 mg ( a ) + 480 mg ( b ) / 5 ml , tablet artemether ( a ) + lumefantrine ( b ) tablet 80 mg ( a ) + 480 mg ( b ) , tablet penicillin v ( phenoxymethyl penicillin ) 250 mg , tinidazole tab 300 mg 10 x 10 , vancomycin powder for injection 1 g , vancomycin powder for injection 250 mg , vancomycin powder for injection 500 mg , flunarizine tablet 5 mg 10 x 10 , sumatriptan tablet 25 mg 10 x 10 , 5 fluro uracil 500 mg , bendamustine inj 100 mg , calcium leucovorin 50mg , capecitabine 500 mg , carboplatin 450 mg , cisplatin 50 mg , cyclophosphamide 500 mg , bleomycin inj 15 mg , docetaxel 120 mg , doxorubicin 50 mg , epirubicin 100 mg , bortezomib inj 2 mg , etoposide 100 mg , decarbazine inj 200 mg 10 mg / ml , erlotinib tab 150 mg , exemestine tab 25 mg , gemcitabine1.4 mg , fulvestrant inj 500 mg , imatinib mesylate 400 mg , gefitnib tab 250 mg , methotraxate 50 mg , oxaliplatin 100 mg , paclitaxel 260 mg , hydroxyurea cap 500 mg , ifosfamide inj 1 gm , tamoxifen 20 mg , irinotecan inj 100 mg , vincristin 1 mg , lenalidomide tab 25 mg , zoledronic acid 4 mg , letrozole tab 2.5mg , doxorubicin , pemetrexed inj 50 mg , pomalidomide cap 2 mg , rituximab inj 500 mg , sorafenib tab 200mg , sunitinib tab / capsule50 mg , temozolamide tab 250 mg , topotecan inj 4 mg , trastuzumab inj 440 mg , vinblastin inj 10 mg , vinorelbine inj 10 mg , trihexyphenidyl tab 2 mg 10 x 10 , levodopa ( a ) + carbidopa ( b ) tablet 100 mg ( a ) + 10 mg ( b ) cr 10 x 10 , levodopa ( a ) + carbidopa ( b ) tablet 100 mg ( a ) + 25 mg ( b ) cr 10 x 10 , levodopa ( a ) + carbidopa ( b ) tablet 250 mg ( a ) + 25 mg ( b ) 10 x 10 , diltiazem injection 5 mg / ml , adenosine inj 3 mg / ml 2 ml amp , amiodarone inj 50 mg / ml 3 ml amp , amiodarone tab 100 mg 10 x 10 , amlodipine tab 5 mg 10 x 10 , amlodipine tab 10 mg 10 x 10 , atenolol 100 mg 10 x 10 , atenolol tab 50 mg 10 x 10 , atorvastatin tab 10 mg 10 x 10 , atorvastatin tablet 40 mg 10 x 10 , chlorthalidone 12.5mg , chlorthalidone 25mg , clopidogrel tab 75 mg 10 x 10 , digoxin tab 0.25 mg 10 x 10 , digoxintab 250 mg 10 x 10 , diltiazem sr tablet 90 mg 10 x 10 , diltiazem tablet 60 mgl tablet 60 mgl 10 x 10 , diltizem tab 30 mg 10 x 10 , dobutamine inj 50 mg / ml 5 ml amp , dopamine inj 40 mg / ml5 ml amp , enalapril maleate tab 10 mg 10 x 10 , esmololinjection 10 mg / ml , finofibratetablet160 mg 10 x 10 , finofibrate tablet 40 mg 10 x 10 , hydrochlorothiazid tablet 12.5 mg 10 x 10 , hydrochlorothiazid tablet 50 mg 10 x 10 , isosorbide 5 mononitrate tab 20 mg 10 x 10 , isosorbide dinitrate tab 5 mg 10 x 10 , labetalol tab 100 mg 10 x 10 , labetalol inj 20 mg / 4 ml 4 ml amp , labetalol injection 5 mg / ml , methyldopa tab 250 mg 10 x 10 , metoprolol sr tab 25 mg 10 x 10 , metoprolol sr / plain tab 50 mg 10 x 10 , nifedipine cap 5 mg 10 x 10 , nifedipine tab 10 mg 10 x 10 , nitroglycerine ( glyceryl tri nitrate ) sub lingual tab 0.5 mg 10 tab , nitroglycerine ( glyceryl tri nitrate ) inj 25 mg / 5 ml 5 ml amp , noradrenaline inj 2 mg base / 2 ml amp. 2 ml amp , propranololtab 10 mg 10 x 10 , protamineinjection 50 mg / 5 ml , ramipril tab 2.5 mg 10 x 10 , streptokinaseinjection 15 lac / vialvial , telmisartan tab 40 mg 10 x 10 , verapamil tab 40 mg 10 x 10 , verapamilinjection 5 mg / 2 ml , urokinase ( 5 laciu ) vial , gum paint ( tannic acid ) 2% w / v 15 ml bottle , gutta percha ( gp ) 30tab / bottel , light cure composite , ketorolac10 mg tablet 10 x 10 , povidine iodine germicide gargle 20% w / v , gamma benzene hexachloride , benzoyl peroxide gel 5% , betamethasoneinjection 4 mg / ml 1 ml amp , betamethasone dipropionate ointment 0.05% 15 gram tube , calamine lotion 50 ml bottle , framycetin sulphate 1% cream 30 gram tube , fusidic acid cream / ointment 2% 5 gram tube , glycerin oral liquid , miconazole cream 2% w / w 15 gram tube , mupirocin cream / ointment 2% 5 gram tube , permethrin permethrin lotion 5% w / v ( 60 gm bottle , salicylic acid , silver sulphadiazine cream usp 1% 25 gram tube , haemodialysis fluid , intraperitoneal dialysis solution , bleaching powder containing not less than 30% w / w of available chlorine ( as per i.p ) containing not less than 30% w / w of available chlorine ( as per i.p ) 25 kg bag , cetrimide solution 20% ( concentrate for dilution ) , hydrogen peroxidesolution 6% , povidone iodine solution 5%, 100 ml bottle , povidone iodinevaginal pessary 200mg 10 x 10 , povidone iodine 5% ointment 15 gram tube , acetazolamide tab 250 mg 10 x 10 , furusemide tab 40 mg 10 x 10 , furusemide inj 10 mg / ml2 ml amp , hydrochlorothiazide tab 25 mg 10 x 10 , mannitol inj 20% 100 ml ffs bottle / 350 ml ffs bottle , mephentermine injection 30 ml vial mg / ml 10 ml vial , spironolactone tablet 25 mg 10 x 10 , xylometazoline nasal drops: adult ( 0.1% ) , boro spirit ear drops 0.183 gm boric acid in 2.08 ml of alcohol , normal saline nasal drops: sodium chloride drops 0.05% w / v , xylometazoline nasal drops 0.05 %, , turpentine oil 15% w / v 50ml bottel , wax solvent ear drops: benzocaine 2.7% w / v 10 ml bottel drop , wax solvent ear drops:paradichlorobenzene 2 % w / v 10 ml bottel , activated charcoal , hyoscine butylbromide 20mg / ml 1 ml vial / amp , tab mebeverine tab 200 mg 10 x 15 , bisacodyl tab 5mg10 x 10 , bisacodyl suppositories 5 mg 10 x 10 , dicyclomine hydrochloride inj 10 mg / ml 2 ml amp , dicyclomine hydrochloride tab 20 mg 10 x 10 , domperidone tab 10 mg 10 x 10 , domperidone 1mg per 1ml suspension , lactulose solution 10 gm / 15 ml , metoclopramide inj 5 mg / ml , metoclopramide tab 10 mg 10 x 10 , ondansetron tab 4 mg 10 x 10 , ondansetron inj 2 mg / ml 2 ml am , ondansetron syp 2mg / 5 ml 30 ml bottle , pantoprazole inj 40 mg / vial vial , rabeprazole tab 20 mg 10 x 10 , ranitidine tab 150 mg 10 x 10 , ranitidine inj 50 mg / 2 ml 2 ml amp , dicyclomine tablet 500 mg 10 x 10 , loperamide tablet 2 mg 10 x 10 , losartan 10 mg 10 x 10 , drotaverine inj 40 mg / 2 ml 2 ml amp , drotaverine tab 40 mg 10 x 10 , sucralfate syrup 1gm / 5ml 100ml bottle , sucralfatetablet 20 mg 10 x 10 , bicalutamidetablet 50 mg 10 x 10 , tamoxifen tablet 10 mg3 10 x 10 , ethinylestradioltablet 0.05 mg 10 x 10 , ethinylestradioltablet 0.01 mg 10 x 10 , empagliflozin 25 mg 10 x 10 , ethinylestradiol ( a ) + levonorgestrel ( b ) tablet 0.03 mg ( a ) + 0.15 mg ( b ) 10 x 10 , glibenclamidetablet 5 mg 10 x 10 , human chorionic gonadotropininjection 10000 iu vial of 1 ml injection , human chorionic gonadotropin injection 5000 iu vial of 2 ml injection , levonorgestreltablet 0.75 mg 10 x 10 , medroxyprogesteronetablet 10 mg 10 x 10 , medroxyprogesterone acetate injection 150 mg 1 ml / vial , methylprednisoloneinjection 1000 mg / ml vial , methylprednisolone tablet 16 mg 10 x 10 , methylprednisolonetablet 16 mg 10 x 10 , methylprednisolonetablet 4 mg 10 x 10 , ormeloxifenetablet 30 mg 10 x 10 , premix insulin 30:70 injection ( regular: nph ) 2 , premix insulin30:70 injection 40 iu / ml , sitagliptin tab 50 mg 10 x 10 , thinylestradiol ( a ) + levonorgestrel ( b ) tablet 0.03 mg ( a ) + 0.15 mg ( b ) with ferrous fumarate10 x 10 , metformin sr 1000mg 10x15 , pioglitazone 15mg , biphasic isophane insulin insulin biphasic aspart 30:70 100 iu / ml ( firm has to supply compatible pen along with cartridges as and when required without any extra cost ) ( 3ml cartridge ) , cartridges , carbimazole , carboprost ( 15 methyl pgf2a ) inj 250mcg 1 ml amp , clomiphene citrate 50 mg tab 10 x 10 , gliclazide tab 80 mg 10 x 10 , glimeperide tab 1 mg 10 x 10 , glimeperide tab 2 mg 10 x 10 , glucose packet 75 mg for ogtt test glucose packet 75 mg for ogtt test packet , insulin soluble inj 40 iu / ml 10 ml vial , levothyroxine tab 50 mcg 100 tab per bottle , levothyroxine tab 100 mcg 100 tab per bottle , metformin tab 500 mg 10 x 10 , iv human immunoglobin 5% iv ig ( 5mg / 100ml each ) , injection , anti d immunoglobulin for iv / im use ( monoclonal ) inj 150mcg 1 ml vial , anti d immunoglobulin for iv / im use ( monoclonal ) inj polyvalent 10 ml ( lyophilized ) inj 300mcg pfs / vial , anti snake venom , antitetanus immunoglobulins inj 250 iu / vial vial , hepatitis b immunoglobulin 100 iu / vial vial , rabies immunoglobulin 300 iu / 2 ml2 ml vial , rabies vaccine ( cell culture ) id / im inj 2.5 iu / ml 1 ml vial , formoterol inhaled bronchodilator , levosulbutamol 100 mcg , ambroxol hcl 15mg+terbutaline sulphate 1.25mg+guaiphenesin 50mg 5ml 15mg+1.25mg+50mg / 5m 100ml bottle , aminophylline inj 25 mg / ml 10 ml vial , bromhexine syp 4mg / 5ml 50 ml bottle , budesonide nebulising suspension containing budesonide 0.5 mg / 2 ml 2 ml amp , caffeine citrate inj 20 mg / ml 3 ml vial , deriphylline tablet sr 300 mg 10 x 10 , etophylline +theophylline tab 100 mg ( etophylline 77 + theophylline 23 ) mg 10 x 10 , etophylline +theophylline inj 220 mg / 2 ml ( 169.4+50.6 mg ) 2 ml amp , ipratropium inhalation ( mdi / dpi ) 20 mcg / dose ipratropium respirator solution for use in nebuliszer 250 mcg / ml , levosalbutamol 50mcg / dose , montelukastsyrup 60 ml bottle , montelukasttablet 5 mg 10 x 10 , salbutamol tab 4 mg 10 x 10 , salbutamol inhaler 100mcg / dose metered dose container , salbutamol syp 2mg / 5ml 60 ml bottle , syrup dextromethorphan syrup 10 mg / 5 ml 100 ml pack bottle , tiotropium inhalation ( dpi ) 18 mcg / dose , tiotropium inhalation ( dpi ) 9 mcg / dose , human albumin solution 5% bottel 250 ml , deferasirox tab 250mg 10 x 10 , dispersable tablet hydroxyurea 100 mg 10 x 10 , enoxaparin inj 40 mg equivalent to 4000 iu vial / pfs , erythropoietin injection 2000 iu / ml , erythropoietin injection 10000 iu / ml , ethamsylate tablet tab 250 mg 10 x 10 , heparin inj 1000 iu 5 ml vial , hydroxyureacapsule 500 mg 10 x 10 , inj. deferoxamine 500mg / vial vial , recombinant factor eight inhibitor bypassing activility ( feiba ) 500 units , recombinant factor ix 500iu , recombinant factor vii a 1 mg , recombinant factor viii 250iu , 500iu , tab. deferasirox tab 500 mg 30 tab , tab. deferiprone 500mg 10x10 , tranexamic acid inj 500 mg / 5 ml. , tranexamic acid tab 500mg 10x10 , warfarin tab 5 mg 10x10 , warfarin tablet 1 mg 10x10 , warfarin tablet 2 mg 10x10 , caffeine oral liquid 20 mg / ml , surfactant suspension inj 25 mg / ml 100 ml vial , donepezil tablet 5 mg 10 x 10 , water for injection , water for injection 5 ml amp 2 ml amp , disulfiram tablet 250 mg 10 x 10 , baclofen baclofen 40 mg tablet10 x 10 , duvadilan 10 mg10x50 , duvadilan inj 5mgvial , neostigmine inj 0.5 mg / ml 1 ml amp , vecuronium inj 2 mg / ml 2 ml amp , pilocarpine drops 4% 5 ml bottel , acyclovir ointment3% 5gm tube , atropine sulphate 1%, tube , 3 gm , carboxymethylcellulosedrops 0.5% 10 ml / vial , dexamethasone drop ( 0.1%, 5ml ) , eye drop 5ml eye drop , fluconazole eye drop 3 mg / ml ( 10 ml vial ) , eye drop10 ml eye drop , homatropinedrops 2% , lantanoprost 0.005% ( 5ml ) , eye drop 5ml eye drop , moxifloxacin 0.5% w / v ( 5 ml ) , eye drop 5ml eye drop , pilocarpinedrops 2% 5 ml bottel , pilocarpine drops 1% 5 ml bottel , prednisolone drops 1% 10 ml bottel , tropicamide drops 1% 5 ml drop , atropine 1% eye ointment 3 gram tube , atropine 1% eye drops 5 ml vial , chloramphenicol eye ointment 0.5% 4g / 5g tube , ciprofloxacin eye / ear drop 0.3% 5 ml vial , ciprofloxacin eye ointment 0.3% 3 / 3.5 gram tube , combo ear drop chloramphenicol 5% w / v +clotrimazole 1% +lignocaine hydrochloride 2% 5 ml drop , gentamicin ear / ear drop ( 0.3% ) 5 ml vial , timolol 0.5% eye drops 5 ml vial , codeine oral solution 15 mg / 5 ml 60 ml bottle , morphineinjection 15 mg / ml vial , morphine tablet 10 mg 10 x 10 , morphine tablet sr / 30 mg 10 x 10 , oxytocin injection 5 iu / ml injection 5 iu / ml1 ml ampule , drotaverine inj 40 mg / 2 ml 2 ml amp , methyl ergometrine maleate inj 0.2 mg / ml 1 ml amp , misoprostal tab 200 mcg 4 tab in 1 pack , combi pack with mifepristone + misoprostol ( 1 tablet of mifepristone 200 mg and 4 tablets of misoprostol 200mcg ) combi pack , methyl ergometrine maleate tab 0.125 mg 10 x 10 , mifepristone tab 200 mg 1 tab per pack , misoprostal tablet 100mcg 4 tab pack , misoprostoltablet 200mcg ( oral / vaginal ) 4 tab pack , risperidone 50 mg , alprazolam tab 0.25 mg 10 x 10 , chlorpromazine tab 100 mg 10 x 10 , clonazepam tablet 0.5 mg 10 x 10 , clozapine tablet 50 mg 10 x 10 , clozapine tablet 25 mg 10 x 10 , diazepam inj 5 mg / ml 2 ml amp , diazepam tab 5 mg 10 x 10 , escitalopram tablet 10 mg 10 x 10 , fluoxetine capsule 20mg 10 x 10 , fluphenazineinjection 25mg 1ml vial / ampoules , haloperidol inj 5 mg / ml 1 ml amp , haloperidol tab 5 mg 10 x 10 , imipramine tablet 25 mg 10 x 10 , lithium carbonatetablet 300 mg 10 x 10 , lorazepam tab 1 mg 10 x 10 , lorazepam inj 2 mg / ml , olanzapinetablet 5 mg 10 x 10 , olanzapine 10 mg 10 x 10 , phenobarbitonetablet 60mg 10 x 10 , promethazine injection 50 mg ( 25mg / ml ) 2ml vial / ampoules , risperidone tab 2 mg 10 x 10 , zolpidem 10 mg 10 x 10 , calcium gluconate inj 10% 10 ml vial , d 10 ( dextrose 10% ) iv fluid ( dextrose 10% ) 500 ml ffs bottle , d 25 injection ( dextrose ) iv fluid ( dextrose 25% ) 100 ml bottle , d 25 injection ( dextrose ) iv fluid ( dextrose 25% ) 500 ml bottle , dextrose 5% iv fluid ( dextrose 5% ) 500 ml ffs bottle , dextrose with saline i / v fluid ( dextrose 5% + saline 0.9% ) 500 ml ffs bottle , glucose ( a ) + sodium chloride ( b ) injection 5% ( a ) + 0.9% ( b ) 500ml ffs bottle , hydroxyethyl ( 6% saline solution for infusion ) starch 6%ip , pediatric solution like isolyte p, n / 2 & n / 5 pediatric solution like isolyte p, n / 2 & n / 5 100 ml bottle , potassium chloride oral solution 100mg / ml 200 ml bottle , reduced osmolarity ors pkt. who formula o.r.s. glucose 75meq, sodium 75m eq or m mol / l, chloride 65meq or m mol / l, potassium 20meq or m mol / l , citrate 10m mol / l osmolarity 245m osm / l, dextrose 13.5g / l sodium chloride 2.6g / l potassium chloride 1.5g / l, trisodium citrate dihydrate 2.9g / l+trisodium citrate dihydrate may be replaced by sodium hydrogen carbonate ( sodium bi carbonate ) 2.5g / l. sachet of 21.8gm , ringer lactate i / v 0.24 % v / v of lactic acid ( eq. to 0.32% w / v of sodium lactate ) , 0.6 % w / v sodium chloride, 0.04 %w / v potassium chloride and 0.027 % w / v calcium chloride 500 ml ffs bottle , sodium bicarbonate inj 7.5% w / v 10 ml amp , sodium chloride hypotonic inj n / 2 ( 0.45% ) 500 ml ffs bottle , sodium chloride isotonic inj 0.9% isotonic ( equivalent to na+154 m mol / l, cl+154 m mol / l ) 500 ml ffs bottle , sodium chloride isotonic inj 0.9% isotonic ( equivalent to na+154 m mol / l, cl+154 m mol / l ) 100 ml ffs bottle , nicotinamide tablet 50 mg7 10 x 10 , ascorbic acid ( vitamin c ) tablet 100 mg tablet 100 mg 10 x 10 , calcium carbonate .tab 500 mg 10 x 10 , calcium with vitamin d3 calcium equivalent to 500 mg & vit. d3 250 iu 10 x 10 , ferric carboxymaltose 250mg 10 x 10 , ferric carboxymaltose 50mg / ml 20 ml vial , folic acid tab 5mg 10 x 10 , iron & folic acid syp iron each 1 ml contains 20mg elemental iron+folic acid 100 ?g 50 ml bottle with dropper , iron & folic acid sugar coated iron folic acid sugar coated ( red tablet ) ferrous sulphate ip equivalent to60 mg elemental iron & 500 mcg folic acid ip 10 x 10 , iron & folic acid sugar coated iron folic acid sugar coated ( blue tablet ) ferrous sulphate ip equivalent to60 mg elemental iron & 500 mcg folic acid ip 10 x 10 , iron & folic acid sugar coated iron and folic acid sugar coated tab dried ferrous sulphate ip eq. to 45 mg ferrous iron and 400 mcg folic acid ip ( pink colored tab ) wifs junior ifa tablets 10 x 10 , iron sucrose inj 100 mg / 5 ml 5 ml amp , multivitamin sugar coated tab nfi formula sugar coated vit a 2500 iu , vit c 50mg, calcium pantothenate 1mg, vit b1 2 mg vit b6 0.5 mg vit d3 200 iu vit b2 2mg niacinamide 25mg folic acid 0.2mg. 10 x 10 , pyridoxine tab 10 mg 10 x 10 , pyridoxine tablet 40 mg 10 x 10 , pyridoxine tablet 100 mg 10 x 10 , riboflavin tablet 5 mg7 10 x 10 , thiamine injection 100 mg / ml , thiamine tablet 100 mg7 10 x 10 , vitamin a syp 100000 iu / ml with marked spoon for 1ml &2ml 100 ml bottle , vitamin k1 inj 1 mg / 0.5 ml 0.5 ml amp , vitamin. b complex tab nfi ( prophylactic ) b1 2 mg, b2 2mg, b6 0.5 mg, niacinamide 25 mg, calcium pantothenate 1 mg 10 x 10 , zinc sulphate tab dispersible 10mg 10 x 10 , zinc sulphate tab dispersible 20mg 10 x 10 , vitamin b12 inj, injection 500 mcg / ml ( 30 ml amp / vial ) , glacial acetic acid 99.99% 500 ml , visco pfs 3 ml prefilled syringe opthalmic , disposable gown , diclofenac+menthol 30 gm tube , cap antioxident 10x10 , tab. paracetamole 325 mg+ chlorpheniramine 4 mg + phenylepherine 10 mg 10x10 , syp diphynhydramine 100 ml , multivitamin drops 22 drops approx , material name , alkaline phosphatase 10x 22ml erba comfitable make , anti h span / tulip comfitable make , anti a1 lactin , anti d ( 1gg+2gm ) tulip / span / j.mitra comfitable make , anti ab anti sera span / tulip 10 ml comfitable make , ahg span / tulip vial comfitable make , abg cartiadge , albumine kit erba comfitable make , acitic acid 5% , acetone kit , bloting paper , bacilol , baby msks size 0, 1 , blood administration set , barium sulphate powder, susp. 95%w / v, powder ( hd ) 95% w / v 400 gram. , benedicts soluton ( qualitative ) 500 ml bottle , blood groupingseara antia, b&d ( 10 ml ) j.mitra / span / tulip comfitable make , blood lancet , blood bag 100 ml j.mitra / haemopack, hll life care comfitable make , blood bag 350 ml j.mitra / haemopack, hll life care comfitable make , blood bag 150ml ( single bag ) j.mitra / haemopack, hll life care comfitable make , blood bag 200ml ( single bag ) j.mitra / haemopack, hll life care comfitable make , blood cell counter key based gem , barium chloriad powder , barium chloriad ( 500 ml ) , brain tromoblastin for , b.t.c & c.t tube , basik fucksion powder , bruck sitrick , cidex , csf protien kit , csf suger kit , calcim reagent , crp kit ( agapee ) j.mitra / span qualicative 50 test kit comfitable make , crp kit 50 test kit erba comfitable make , cpk mb kit erba comfitable make rapid kit , capillaries ( serumbilirubinometer ) , capillaries ( wax ) , capillary tube for bt&ct , cover shlip ( 40gm ) , calorie meter , cyanemeth solution for hb ( drabkins solution , carbol fuchsin , culture media with nutrient agar high media company comfitable make , culture media with maconkey agar high media company comfitable make , culture media with blood agar high media company comfitable make , culture media with peptone water high media copany comfitable make , culture media with nutrient broth high media company comfitable make , culture plate , chikunguniya , counting numbers ( chekers ) , detaction for protien in urine ( uristixs ) 100strip , disposable cups for urine collection with screw cap , distilled water 5 letter , digital anyalytical balane 0.1gm to 160 gm , dengue card test span / j.mitra comfitable make , dropper rubber , drop mct oil , d.p.x. wax qualigence , esr tube , elisa plate reader with washer and printer , edta250 gm powder , e.d.t.a powder 500 gm , edta vial with screw cap , edta solution , electrolyte analyser reagents pack na+, k+ accurex enlite 2 para , electrolyte analyser reagents deproteinize , electrolyte analyser reagents riffil solution forna+, k+ and reffrence electrode , thermal paper roll for cell counter machine , electronic chemical weings scale , emmersion oil30ml , formaldehyde ( formalin ) 37% acq. 450 ml bottle , fliltter paper , field stain a qualigens , field stain b qualigens , forchest reagents 125 ml bottel , flask , flask , falckon tubecultre sterlized , glucose kit ( godpod ) , glutaraldehyde lotion 2% w / v stabilized 5 ltr. cans , glass droper , glass test tubes borosil glass 18 x 150 mm , glass piaptte , glass beaker 100 ml , glass beaker 200 ml , glass marking pencil ( white ) , glucometer sd company comfitable make , haemoglobin colour scale , heamocyto meter , glucometer stripsmorphan` comfitable make , glucometer strips acuchaklcomfitable make , glucometer stripssd company code free ivd , hydrogen peroxide sol. 20% w / v 1 ltr. bottle , h2so4 acid 20% , hb pipate , hb tube , hbsag card test rapiedj.mitra / span comfitable make , hdl chloleslestrol kit , h.c.v card rapid span / ing comfitable make , hdl kit erba comfitable make , hiv kit , hiv test card tridot flow through paste 3 dot span / j.mitra comfitable make , hematolgy cell counter reagents erma company pce 210 autodil er comfitable make , hematolgy cell counter reagents erma company pce 210 autolyse er comfitable make , hematolgy cell counter reagents erma company pce 210 autoclean er comfitable make , haemoglobin meter isi marked superior quality , hand sanitizer sterilium , incubator superior quality isi marked microbiology , listaman stain ( 500ml ) qualicative , laugles ioden , led bulb , lance paper , liquid hand wash , micropore , micro glass slide packet 50 slide packet , mp antigen test card for view for falciferum ozon / span / j.mitra comfitable make , malaria card test antibody j.mitra / span comfitable make , methylene blue , mithylated sprit100% , micropippate tips large , micropippate tips small , micropippate for analyzer erba company variable 5 50 comfitable make , micropippate for analyzer erba company variable 10 100 comfitable make , micropippate for analyzer erba company varialbe100 1000 comfitable make , micropippate for analyzer erba company varialbe 2micrlit. 1000 microlit comfitable make , multichanel pippate , n / 10 hcl , nitric acid 500 ml , new warce chamber , platilate diluting fluid , pt reagents span comfitable make , aptt reagents spancomfitable make , pandys reagent for csf , preganacy test strip 100strip , pasture piaptte ( borosil ) comfitable make , piaptte glass , phenol crystol , peatidisc large disposable , peatidisc small disposable , plain vial 12 x 75 with screw cap , permanentmarkers , pollythin 30 lit capacity , rapid pap kit span , rapid test kit for torch tes ( 1gm+1gg ) , r.b.c dilluting fluid ( 500 ml ) , r.a.factor 50 test kit qualicative j.mitra / span comfitable make , serum bluribine 4 x60 ml erbacomfitable make , serum bovine albumine 22% bsb span / tulip comfitable make , sodium citrate 3.8 % , sodium hypochlorid 5 lit jar , sulphuric acid ( 450 ml ) , serum tringlyieride ( 5x20ml ) , serum creatinine kit erba company 4 x60 ml comfitable make , serum protien kit erba comfitable make , staning rack , slide markers , slide stand , slide box 50 soidde , spirit lamp , sulpher powder , sulfuric acid 100% , semun diluting fluid , stop watch digtal , sypllis test card jaimitra / spam / biolab comfitable make , sputam cuntnar disposable , stickers ( blank ) 2x1 cm , twinket balt , taste tubeglass ( borosil ) 7.5x 12mm15 ml comfitable make , taste tubeglass ( borosil ) 7.5x 12mm5 ml comfitable make , tissue puper , teat rubber 1 ml , teat rubber 2 ml , teat rubber 5 ml , typhoid card test kitj.mitra / span comfitable make , torch test kit j.mitra / span comfitable make , t3, t4 tsh kit , test tube stand 10 holl , test tube stand 20 holl , thermocol box with packd , thermometer for water wath , triglyceride kit erba comfitable make , vdrl kit for sypllis comfitable make , vdrl kit j / mitra / span 50 test kit qualicative comfitable make , water wath , w.b.c dilluting fluid ( 500 ml ) , wbc diluting fluid 100ml , wintrob tube stand , xylene qualigens , zentition viloet 0.25% , zentition viloet 0.5% , zn stain , feeding tube for infant no. 6 , oxygen mask child , oxygen mask adult , cord clamp dispossable , plastic tubs , reagents for semi auto anyalyzer erba company , blood glucose kit erba company 50 test kit comfitable make , blood urea kit erba company 50 test kit comfitable make , sgpt test kit erba company 50 test kit comfitable make , sgot test kit erba company 50 test kit comfitable make , g6pd test kit erba company 50 test kit comfitable make , blood grouping sera 5 ml anti ab&d set j.mitra / span / tulip comfitable make , widal test kit erba company 50 test kit comfitable make , vdrl test kit erba company 50 test kit comfitable make , cholestrol kit erba company 50 test kit comfitable make , austrailia antigen card test , rpr kit for syplis 50 kit , lead protection partion , lead letters , lead protective barrir , lead goggle , lead protectvie apprean , lead rubber glove , lead gonad shield , intcifying screen kiren high speed comfitable make , intcifying screen kiren high speed comfitable make , intcifying screen kiren high speed comfitable make , intcifying screen kiren high speed comfitable make , xray castetes kiran, kr8 , xray castetes , xray castetes , xray castetes , xray hangers , xray hangers , xray hangers , xray hangers , x ray film 50 sheet packet , x ray film 50 sheet packet , x ray film 50 sheet packet , x ray film 50 sheet packet , x ray dental film 50 sheet packet , x ray developerpowder , x ray developerpowder , x ray fixerpowder , x ray fixerpowder , x ray view box , xray safe light , absorbent cotton wool ip 500 gm paket , absorbable gelatine sponge ip 66 80mm x 50mm x 10 mm , adhesive plaster usp 7.5 cm x10mts / roll , adhesive plaster usp 7.5 cm x5 mts roll , bismith lodoform paraffin paste , boric acid with sprit drop , b.b silk with 1 / 2 cir rb needle 20 mm length 75 cm no 1 , b.b silk with 1 / 2 cir rb needle 20 mm length 75 cm no 1 / 0 , b.b silk with 1 / 2 cir rb needle 20 mm length 75 cm no 2 , b.b silk with 1 / 2 cir rb needle 20 mm length 75 cm , b.b silk with 1 / 2 cir cutting needle 20 mm length 75 cm no 1 , b.b silk with 1 / 2 cir cutting needle 20 mm length 75 cm no1 / 0 , b.b silk with 1 / 2 cir cutting needle 20 mm length 75 cm no 2 , b.b silk with 3 / 8 cir rb reverse 2 / 0 cutting needle 45 mm length 76cm , b.b silk6 reels x 25 mts length 25 mts , cotton roll100 gm , cresol with soap sol. 5 ltr. cans , chromie with cd. rb needle 40 mm length 75cm , catgut chromic with 1 / 2 cir rb needle 40 mm length 95cm no. 1 , catgut chromic with 1 / 2 cir rb needle 40 mm length 95cm no. 1 0 , catgut chromic with 1 / 2 cir rb needle 40 mm length 95cm no. 2 , catgut chromic with 1 / 2 cir rb needle 40 mm length 95cm no. 2 0 , catgut chromic with cd cutting needle 12 mm length 70cm no. 1 , catgut chromic with cd cutting needle 12 mm length 70cm no. 1 0 , catgut chromic with cd cutting needle 12 mm length 70cm no. 2 , catgut chromic with cd cutting needle 12 mm length 70cm no. 2 0 , crap bandageall sizes , poly propylene with 1 / 2 cir rb needle 30 mm length 70 cm , poly propylene with 1 / 2 cir rb needle 40 mm length 70 cm , poly propylene with 1 / 2 cir rb heavy needle 30 mm length 70 cm , poly propylene with cutting needle 45 mm lengyh 100 cm , poly propylene with curved 8 / 0 rb bv double needle 7.6 mm length 60 cm , disposable syringe with needle cgs 1cc with mark 0 1ml , disposable syringe with needle cgs 2cc , disposable syringe with needle cgs 5cc , disposable syringe with needle cgs 10cc , disposable syringe with needle cgs 20cc , disposable syringe with needle cgs 50cc , disposable suction cather size: 12, 14 , disposable scale vein set size 20g , disposable scale vein set size 22g , disposable needle 18 g ( single use ) , disposable needle 20 g ( single use ) , disposable needle 22 g ( single use ) , disposable needle 23g ( single use ) , ecg gel 250 ml bottle , ecg paper80mm x 20mts for manual ecg machine bpl company 6208 view / view plus chemical red comfitable make , ecg paper 50mm x 20 mts computerzed for computer bpl company 6108tchemical blue comfitable make , endotracheal tube no 2.5 , endotracheal tube no 3 , endotracheal tube no 3.5 , endotracheal tube no 5 , endotracheal tube no 7 , endotracheal tube no 8 , foleys urinaty catheter size 8 ( 2way ) , foleys urinaty catheter size 10 ( 2way ) , foleys urinaty catheter size 14 ( 2way ) , foleys urinaty catheter size 16 ( 2way ) , foleys urinaty catheter size 18 ( 2way ) , foley balloon cather three way ( a ) fg 24 , glycerinc ip 30 ml plasric bottle , gention violet paint 0.5% 100ml bottle , hmf sachet , iv cannula ( two way ) size 18 , iv cannula ( two way ) size 20 , iv cannula ( two way ) size 22 , iv cannula ( two way ) size 24 , iv cannula ( two way ) size 26 , i.v. cannula sizes 23 two way , intravenous set ( adult ) with airway and needle , intravenous set ( children ) with airway and needle , infant mucus extractor , infant feeding tube ( catheter ) 8 g , infant feeding tube ( catheter ) 10 g , infant feeding tube no. 3.5 , infant feeding tube no. 7 , liquid paraffin ip 500 ml bottle , liqued stesimox , lysol , mackintosh double colour water proof , micro drip set , metrasses 3×6 with raxine cover 4 density , metrasses 2 5×4 with raxine cover 4 density for child bed , needle hypodermic insulin needle ( metallic non sterile ) size 26 gx1 / 2 , nasal prom for neonatiol , n 95 mask for swine flue , disposable mask , l.p. needle no. 22 , l.p. needle no. 23 , oxygen catheter , oxyzen flowmeter regulator , oxygen tube , plaster of paries 1kg pkt.isi qulity , paper adhesive plaster 1x9.0 mts , p.o.p. bandag 6 inch , p.o.p. bandag 4 inch , peadiartic chamber set 110 ml , pressure monitoring line , pvc apron , ryles tube ( p.v.s ) childrn size 10, 12 , ryles tube ( p.v.s ) adult size 16, 18, 14 , sanitary pads , slippers all sizes , sterile gloves size 6 isi marked , sterile gloves size 6 1 / 2 isi marked , sterile gloves size 7 isi marked , sterile gloves size 7 1 / 2 isi marked , surgical blade size 11, 100 blade per packet , surgical blade size 15, 100 blade per packet , surgical blade size 21, 100 blade per packet , surgical blade size 22, 100 blade per packet , surgical blade size 23, 100 blade per packet , suture needles curved &1 / 2 circle cutting assorted sizes 1 5 , suture needles curved &1 / 2 circle cutting assorted sizes 6 10 , suture needles curved &1 / 2 circle cutting assorted sizes 11 15 , suture 10 0 nylone , suture 8 0 silk , suture 5 0 mono phalment , suction catheter no.7 green , suction catheter no.8 green , suction catheter no.16 green , suction catheter no.14 green , scalp vein set ( single use diposable ) size 23 gauge , scalp vein set ( single use diposable ) size 24 gauge , spoon marked 1 ml / 2 ml plastic , surgical spirit 100 ml bottle , sterlium hand wash , three way connector , tincture benzoin co. 500 ml bottle , ultra sonogram gel 250 ml bottle , urinary drainage bag , volium drip set , vicryl no.1 polyglyoviont 1 / 2 cir needle 95 cm , vicryl no.1 0 polyglyoviont 1 / 2 cir needle 95 cm , vicryl no.2 polyglyoviont 1 / 2 cir needle 95 cm , wax dissoluent , pamper for children , oxygen key , tab. chlorine 500 mg isi marked , tab. water purifying 4 gm , montex test 2 tu , montex test 5 tu , 1 twv csx ¼ftlessa vanj dh vksj ls , e vks , p , qq mcy;w@, q ih ds yksxks yxk, tk, xsaa½ 2 iseiysv nis gq, ¼lwpuk i= uofookfgr naifr ds fy, tkudkjh ½ 3 lksan;z lkexzh@ lopnrk csx ¼ deiyhv csx fueu lkexzh dk uke& rksfy;k lsv nksvk ] da?khfcanhirrk ] usy dvj ] nks lsv :eky ] lsusvjh usifdu isdsv vksj khkk nksvk ½ lfgr 4 tkudkjh dkmz nik gqvk ftlesa { ks=h; vkkk rfkk , , u , e dh laidz dh tkudkjh 5 lwpuk i= ¼xhkz izjh { k.k fdv ds mi;ksx laca / kh funszk ij iw.kz lwpuk i=½ , d.mkse ckwdl ¼fvu½ , d.mkse ckwdl ¼qkbzcj½ , d.mkse ckwdl ¼ydm+h½ , osusvh ckwdl ¼fvu ½ , lsusvªjh usifdu isdsv 10 ihl , lsusvªjh usifdu isdsv 12 ihl , vkbzmsauvh fqdsku vsx qkwj u;w cksuz , vkbzmsauvh fqdsku vsx qkwj enj , digital wrist watch , digital thermometer , neonatal / infant weighing scale with sling , warm sleepig bag for neonates , blankets for neonates , mucus extractr , baby feeding spoon , torch with cells , bag for carrying kit / material during home visit , heamocheck book with strip complete , hemax cell cleaner 1 litre , hemax diluent 20 litre , hemax lyse 500ml , amber colored bottle 2 lit. , amber colored bottle 3 li. , ethanol absolute alcohol 500 ml , hcl 500 ml , diamond marker , tissue paper , auramine powder 25 gm , lense paper , thermacol box , sputum container , micro glass slide , forcep steel , weighing machine digital , water bath , paraffin role , spirit rectified 1 lit. , slide box 100 slide per box , glass beaker 200 ml , glass beaker 100 ml , permanent marker , slide rack , n / 95 mask , long stool lab , vinelands social maturity scale ( indian adaptalaion ) with manual , 16 pf questionnaire of age 16 and older with sheets with manual , binef kamath test of intelligence with manual , thematic apperception test ( indian adaption ) with manual , rorhchacs ink blot test cauds with location charts , nimhans neuro psychological battery for adult with manuals , nimhans index of sld with manuals , crescent blade , keraton ( 3.2 ) , disposable gown , vergin silk 8.0 black ( 1x12 ) , vergin silk 10.0 black ( 1x12 ) , vicryl 8.0 ( 1x12 ) , dark glass , cornear scissor , capsulereris forceps , scissor plain 4 inch , surgical blade 11 no. , side port , air cannula 27 g , fine port irrigaling vetis wire , banass scissor , trypan blue solution , propaciane hcl opthalmic solution , tropicaciyl plus eye drop , inj hyaluronidase ip 1500 iv , inj senscerocaine 0.5 1% , weight machine adult , scissor plain , artery forcep , tooth forcep , needle holder , oxygen flowmeter , cheatle forcep , sponge holdig forcep , bleaching powder 1 kg , stethoscope , labour ot fogging machine , ambu bag , cervical collar high neck , head mobilizer , fire extinguisherco2 2 kg , yoga mate , airotor hand piece , ultrasonic scaler , forcep ( set of 10 pieces ) , periosteal elevator , mouth mirror , sickle porpe , alginate , k file no. 10, 20 , 15, 25 , h file no. 15, 20, 25, 10 , formalin chamber , uv chamber , compressor , fracture plate , putty impression , zoe impression paste , upper & lower impression paste , abx diluent 20 lit can { horiba } , abx diluent 1 lit can { horiba } , white diff 1 lit { horiba } , abx minocleaner 100 ml { horiba } , printer ink modal h.p. tank4 bottel 3019 , t3 icromax , t4 icromax , tsh iromax , blood sugar erba , serum billirbin erba , blood uria erba , sgpt erba , sgot erba , uric acid erba , alkaline phosphate erba , total protin erba , hdl erba , total cholestrol erba , albumin erba , triglistride erba , diluent 20 lit hemax , :yse 500 ml hemax , cell cleaner e.z. 1 lit hemax , cleaner 100 ml hemax , printer |roll size 55 mm , printer roll size 50 mm , vtm kit 50 test / kit , standard q covid test card 25 test card / kit , face shield , ice gel pack 8x10 cm , brown tape 6 inch , zipper polythene 8x10 cm , polythene 1 kg red / black , sanitizer 100 ml , sanitizer 500 ml , shoe cover , disposable bed sheet , dead body suit , thermal scanner , pulse oxymeter , ppe kit , surgeon cap , disposable kelleys pad , latex examination gloves large 100 gloves / pkt , goggles , microglass slide blue star 50 slide / pkt , sanitiry napkin 8 pad / pkt , cough syrup sugar free 100 ml , tab vitamin c 500 mg sugar free , ct scan film 8x10 konica minolita , ct scan film 14x17 konica minolita , ct scan film 11x14konica minolita , shaving blade , ct scan film 10x12konica minolita...

Department of Higher Education - Madhya Pradesh

33579124 bids are invited for boq1 containers , boq2 sauce pan with lid , boq3 fry pan , boq4 tava roti / tava dosa , boq5 parrat , boq6 grater ( multipurpose ) , boq7 patila with lid , boq8 masala dabba , boq9 chimta , boq10 jhara , boq11 kadchhi , boq12 knife all types , boq13 peeler , boq14 chamcha , boq15 cutlery set , boq16 chakla belan , boq17 kadahi with lid , boq18 dinner set ( steel ) , boq19 bucket , boq20 dustbin , boq21 tub , boq22 pressure cooker , boq23 lighter , boq24 tray , boq25 crockeries ( tea set borosil glasses ) , boq26 namak daniset , boq27 stiching material—needle box. , boq28 chimni , boq29 gas chula with cylinder. , boq30 indection , boq31 paper napkins , boq32 cloth napkin , boq33 table mat , boq34 model parts of flower , boq35 model kidney , boq36 model human eye & ear , boq37 model brain , boq38 model heart , boq39 model of electric bell , boq40 weighting machine digital , boq41 microscope , boq42 stop clock , boq43 home science charts set , boq44 centrifue machine , boq45 sonometer sccale , boq46 scale electronice , boq47 weight sclae , boq48 calcium oxide , boq49 clycerol , boq50 iodine solution , boq51 phenol , boq52 glacial acetic acid , boq53 safferemine , boq54 potassium mydroxide , boq55 canada balson , boq56 fehling solution , boq57 calcium chloride , boq58 acid accumulator , boq59 cylender noggel / regulator / rubber set , boq60 bottele opener , boq61 sweing machine , boq62 washing machine , boq63 fabric colour set , boq64 bad sheet , boq65 soffa set cover , boq66 dinning table cover , boq67 vacume cleaner , boq68 aprin , boq69 tds meter , boq70 hair cap , boq71 microwave , boq72 phillips otg , boq73 toster , boq74 grill sandwich maker , boq75 hand grinder , boq76 steel bartan set , boq77 coffe maker , boq78 mixer and grider , boq79 juicer , boq80 all types seaser , boq81 water coler 20lit , boq82 aquagurd , boq83 computer for home sciencelab , boq84 modular kitchen total quantity : 118...

Directorate Of Medical Education - Madhya Pradesh

33336734 tender for supply of chemical and reagents for mdru department of sgm hospital rewa , mdru chemical and reagents , ammonium chloride 250gm , potassium bi carbonate 250gm , sodium chloride 250gm , tris hcl 250gm , sds 250gm , saturated phenol 500ml , chloroform 500ml , sodium acetate 250gm , isoamyle alcohol 500ml , glacial acetic acid 500ml , molecular biology grade agarose powder 250gm , bromophenol blue dye 2ml , ethidium bromide 5ml , molecular weight ( dna ladder ) 100bp & 1kb 50ug , molecular weight ( dna ladder ) 50bp 50ug , molecular weight ( dna ladder ) 25bp 50ug , taq polymerase 5000unit , amplitaq gold dna polymerase master mix 500 unit , mgcl2 100 ul , dntp mix 100 ul , dnase 100 unit , rnase 100 unit , proteinase k 100 unit , triss 250gm , edta 250gm , boric acid 250gm , teepol 5 liter , xylene cynol 5 ml , dmso 500 ml , tips i. 0.2 20 ?l tips 2 pack ( pack size of 1000 psc. each ) , tips ii. 20 200 ?l tips 2 pack ( pack size of 1000 psc. each ) , tips iii. 200 1000 ?l tips 2 pack ( pack size of 1000 psc. each ) , superscript ii rnase reverse transcriptase 10000 u ( 200u / ul ) , power sybrgreen pcr master mix 2.5 ml , power sybrgreen rt pcr reagent kit 5 ml , oligo ( dt ) 12 18 primer25 ?g , absolute ethanol 500 ml , pcr plates pack of 50 , sealing foil ( rt pcr / qpcr grade ) pack of 50 , filter tips i. 0.2 20 ?l filter barrier tips 2 pack ( pack size of 1000 psc. each ) , filter tips ii. 20 200 ?l filter barrier tips 2 pack ( pack size of 1000 psc. each ) , filter tips iii. 200 1000 ?l filter barrier tips 2 pack ( pack size of 1000 psc. each ) , mct variable tubes i. 20 200?l tubes 2 pack ( pack size of 1000 psc. each ) , mct variable tubes ii. 200 600 ?l tubes 2 pack ( pack size of 1000 psc. each ) , mct variable tubes iii. 500 2000 ?l tubes 2 pack ( pack size of 1000 psc. each ) , nitrile autodextorous gloves 2 pack ( pack size of 1000 psc. ) , mctstands for variable tubes sizes i. 20 200?l tubes stand pack size of 1000 psc. each , mctstands for variable tubes sizes ii. 200 600 ?l tubes stand pack size of 1000 psc. each , mctstands for variable tubes sizes iii. 500 2000 ?l tubes stand pack size of 1000 psc. each , filter tip boxes i. 0.2 20 ?l filter barrier tip box 2 pack ( pack size of 1000 psc. each ) , filter tip boxes ii. 20 200 ?l filter barrier tip box 2 pack ( pack size of 1000 psc. each ) , filter tip boxes iii. 200 1000 ?l filter barrier tip box 2 pack ( pack size of 1000 psc. each ) , rt pcr grade water 20 ml , tip discard box ( 1 2 liter capacity ) 10 each , graduated measuring cylinders 50, 100, 500, 1000 ml 05each , graduated beakers 50, 100, 500, 1000 ml 05 each , flat bottom tube 5ml ( with screw cap ) 500 psc. , tube stand ( 15ml falcon, 5ml, 2ml, 0.5ml, 0.2ml mct ) pack size of 500 psc. , graduated conical flask 50, 100, 500, 1000ml pack size of 5 psc. each , edta blood collection tube 5ml 100 psc. , plain vial ( for clot activator ) 100psc. , fluoride vial 100 psc. , test tube 5, 10ml 100 psc. , slide+cover slips 50 psc. , tissue paper roll 10 psc. , fine tissue cloth roll 10 psc. , cotton 10 psc. , wash bottle / dropping bottle, 200ml, 500ml, 1ltr 5 psc. , funnels variable range 5 psc. , plastic bottle, 200, 500, 1000ml 5 psc. , syringe + needle 2ml, 5ml pack size of 100 psc. each , nitrile gloves; medium and large size pack size of 1000 psc. , dna isolation kit pack size for 100 reaction , rna isolation kit pack size for 100 reaction , phenol 500 ml , hno3 ( nitric acid ) 500 ml , propionaldehyde pure ( 97% ) 500 ml , phthalic anhydride 500 ml , glacialacetic acid ar 500ml , hydrochloric acid ar 500 ml , sulfuric acid ar 500 ml , 2 amino ethanol 500 ml , pyridine ar 500 ml , ammonia solution ar 500 ml , ammonia chloride ar 500 ml , acetyl salicylic acid 500 ml , acetone ar 500 ml , anthranilic acid ar 500 ml , activated charcoal 500 ml , silica gel g 500ml , benzoicacid ar 500ml , sds 250 gm , colin ( cleaning detergent solution ) 500 ml , sterilium ( hand sanitizer ) 500 ml , dettol / lifeboy alcohol based hand sanitizer 500 ml , hypo 4% 1000ml , floor cleaner phenyl 500 ml , serum separator vial 3 ml 100 psc. , labolene 1000 ml , cleaning mop 5 psc. , broom 5 psc. , microwave gloves 2 pkt. , brown paper for autoclaving 10 rolls , liquid nitrogen 5ltrpkt. , phosphate buffer saline 500 ml , formalin 500 ml , paraffin wax ( 58 60c ) 250 gm , xylene , glycerol 250 ml , ammonia 100 ml , methanol 250 ml , acrylamide / bis ar 250 ml. , 10x tbe buffer 500 gm , urea 100 ml , ammonium persulfate 100 ml , temed 100 ml , 4’, 6 diamidino 2 phenylindole 100 ml , diethyl pyrocorbonate 100ug , pbs 500ml , mnl i 500 unit , bcli 1500 unit , hpych4v 100 unit , hpych4iii 250 unit , sau96i 500 unit , sfci 200 unit , bcci 500 unit , scrfi 500 unit , afliii 250 unit , scai 500 unit , avai 500 unit , bsmi 250 unit , tspri 500 unit , mboii 300 unit , bsh1236i 500 unit , banii 1000 unit , mph1103i 500 unit , dde i 500 unit , bsmb i 200 unit , afa i 500 unit , bal i 250 unit , fspi 500 unit , primers 5 od , fmr1 set 1 – f5 tcaggcgctcagctccgtttcggtttca 3 r5 5 aagcgccattggagccccgcacttcc 3 5 od , mecp2 exon 1 set 1 f5 gttatgtctttagtctttgg–3´ r5 tgtgtttatcttcaaaatgt–3´ 5 od , exon 2set 1 f5 cctgcctctgctcacttgtt–3´ r5 ggggtcatcatacatgggtc–3´ 5 od , exon 2set 2 f5 agcccgtgcagccatcagcc–3´ r5 gttccccccgaccccaccct–3´ 5 od , exon 3 set 1 – f5 tttgtcagagcgttgtcacc–3´ r5 cttcccaggacttttctcca–3´ 5 od , exon 3 set 2 f5 aaccacctaagaagcccaaa–3´ r5 ctgcacagatcggatagaagac–3´ 5 od , exon 3 set 3 f5 ggcaggaagcgaaaagctgag–3´, r5 tgagtggtggtgatggtggtgg–3´ 5 od , exon 3 set 4 – f5 5´–tggtgaagcccctgctggt–3´ r5 ctccctcccctcggtgtttg–3´ 5 od , exon 3 set 5 f5ggagaagatgcccagaggag–3´ r5 cggtaagaaaaacatccccaa–3´ 5 od , exon3 ( l100v ) f5 aaccacctaagaagcccaaa 3 r5 gcttaagcttccgtgtccagccttcaggta 3 5 od , putative promoter and exon 1. f5 gggtgcaatgaaacgctta 3 r5 tttaccacagccctctctcc 3 5 od , mc4r rs17782313 f 5 aagttctacctaccatgttcttgg 3 r 5 ttccccctgaagcttttcttgtcattttgat 3 5 od , fto rs9939609 f 5 aactggctcttgaatgaaataggattcaga 3 r5 agagtaacagagactatccaagtgcagtac 3 5 od , adipoqrs2241766 – f5 tgtgtgtgtggggtctgtct 3 r 5 tgtgatgaaagaggccagaa 3 5 od , rs1501299 f5 ctacactgatataaactatatggag 3 r5 ccccaaatcacttcaggttg 3 5 od , pomcrs6232 f5 ttgtgcccttcatctgaaca 3 r5 tgtagcaactttggcatgga 3 rs155971 f5tatatgcagccaccaatcca 3 r5 aaaatgaagggagaagcacaaa 3 5 od , ppar g ( pro12ala ) f5gcc aat tcaagc cca gtc 3 r5gat atgttt gca gac agt gta tca gtg aaggaa tcg ctt tcc g 3 5 od , kcnj11 ( rs5219 ) f5 gactctgcagtgaggcccta 3’ r5 acgttgcagttgcctttctt 3’ 5 od , capn10 ( rs3792267 ) f5 cacgcttgctgtgaagtaatgc 3’ r5 tgattcc catggtctgtagcac 3’ 5 od , pik3ca set 1 forward 5’ ggagtatttcatgaaacaaatgaatgatgcg 3’ 5 od , pik3ca set 1 reverse 5’ gagctttcattttctcagttatctt 3’ 5 od , bat 25 set 1 f 5’ tcgcctccaagaatgtaagt 3’ r 5’ tctgcattttaactatggctc 3’ 5 od , bat 26 set 1 f5’ tgactacttttgacttcagcc 3’ r5’ aaccattcaacatttttaaccc 3’ 5 od , d2s123 set 1 f5’ aaacaggatgcctgcctttta 3’ r5’ gtttggactttccacctatgggac 3’ 5 od , d5s346 set 1 f 5’ actcactctagtgataaatcg 3 r5 agcagataagacagtattactagtt 3 5 od , d17s250 – set 1 f5’ ggaagaatcaaatagacaat 3’ r5’ gctggccatatatatatttaaacc 3’ 5 od , impdh2 set 1 f5 gtttctgcggtatcccaatc 3 r5 cgagcaagtccagcctat 3 5 od , bmp6 rs73719353 f5’ gctcctttgcacttcgctgt 3’ r5’ aggctctgctg agctcctac 3’ 5 od , bmp6 rs73719341 f 5’tgaacttcccattcccctct 3’ r5’ataaaattagcattgatcca 3’ 5 od , bmp6 rs73719318 f5’caggtgctgtgcaacttctt 3’ r 5’agagggcaccatggttgcct 3’ 5 od , bmp6 rs73381662f 5’ ctgagattcaattaggccca 3’r 5’taaagaacagcaaaagtctg 3’ 5 od , bmp6 rs73381650 f 5’cacataaagattgctgcatt 3’ r 5’tagtaatcctaaaaatggga 3’ 5 od , anxa2 rs7170178 f 5’ ttcacagcagttcaaaatac 3’ r 5’ ctgggtttccagagatggaa 3’ 5 od , anxa2 rs73435133 f 5’ gagtgcaaggtgctgaggat 3’ r 5’ gatttcagacagcccttgca 3’ 5 od , anxa2 rs73418020 f 5’ tctgagagtgaaaggtgcac 3’ r 5’ tcccatcccctgaatccctg 3’ 5 od , anxa2 rs72746635 f 5’ cctgactcattgtcacatca 3’ r 5’ aagtggctttccactgccc 3’ 5 od , anxa2 rs73418025 f 5’ cttctcatcttactttt 3’ r 5’ agggaaggatacagaggaga 3’ 5 od , hsp 70 primer sequence 5 agcgt aacac cacca ttcc 3 ( forward ) 5 tggct cccac cctat ctc 3 ( reverse ) 5 od , the gapdh sequence forward primer 5 agc cac atc gct gag aca c 3, reverse primer 5 gcc caa tac gaccaa atcc 3. 5 od , total rna mini kit ( from human skin tissue ) 2 pack ( pack size for 100 reaction ) , human leptin elisa kit pack size for 96 reaction , human adiponectin elisa kit pack size for 96 reaction , human adipsin elisa kit pack size for 96 reaction , human resistin elisa kit pack size for 96 reaction , human iron elisa kit ( serum iron ) pack size for 96 reaction , human ferritin elisa kit ( serum / ferritin ) pack size for 96 reaction , thyroid estimation kit pack size for 96 reaction , ice maker machine for laboratory purpose 1 psc. , microwave gloves 2 pkt. , pcr mini cooler 03 psc. , pipette 0.5 10ul, 02 20ul, 10 100ul, 20 200ul and 100 1000ul. 1 psc. each , horizontal gel apparatus: 18 – 20 cm ( length ) x 25 – 30 ( breadth ) x 5 7.5 cm ( height ) , 40 60 samples, multichannel pipette compatible combs and gel caste 1 psc. each , mini horizontal gel apparatus: 9 cm w x 11 cm l with grooves ( 8.7 cm l x 1.2 cm h ) on the side for gripping the gel tray. it should have two comb slots on the same tray area. 1 psc. each , buffer capacity should be 600 ml for the buffer tanks and optimum gel runs with a fill line indicator for buffer levels along the unit side , multi size forceps lab set 01 pkt. , liquid nitrogen sample storage tanks 5 tanks ( 3, 5, 10, 20, 25 ltrs ) , liquid nitrogen sample handling gloves 5 sets of gloves , slide tray / rack pack of 3psc. , l mold pack of 2 psc. , tissue cassette steel pack of 2 psc. , electric tissue float bath ( thermostate ) 1 psc. , coupling jar pack of 2 psc. , staining rack pack of 3 psc. , whatman filter paper grade 1 & 2 2 pack ( pack size of 50 psc. ) , harri’s hematoxylin powder 2 pack of 50 gm , yellow eosin powder 2 pack of 50 gm , coverslip 18x18 ( microscopic ) 2pack ( pack size of 100 psc ) . , dpx mount 50 ml , thymol crystals 250 gm , plastic boxes 5 boxes , steel / aluminium boxes 3 boxes , hot plate 1 psc. , mx35 premier microtome blade ( 34 / 80mm ) 50 blades 1 box , diamond pen ( histopathology use ) 1 pen , embedding mold and embedding ring 5 psc. , human pai 1 elisa kit pack size of 96 reactions , mortar and pestle homogenizers 1 psc....

Directorate Of Health Services - Madhya Pradesh

33142079 supply of surgical material as per tender documents , alkaline phosphatase (alp) dea 300 ml(model ba 400 system (mfg bybio system)),consumable , alkaline phosphatase kit (kinetic) 10x2.2ml 44 test/kit consumable , anti abd grouping serum 3x10ml consumable , anti a sera igm(10 vial),consumable , anti b sera igm(10 vial),consumable , anti d sera igg+igm 10ml vial(each),consumable , anti d (polyvalent)(1x10 ml),consumable , anti h sera , auto pippets fixed volume 10 micro liters each , auto pippets fixed volume 1000 micro liters each , auto pippets fixed volume 20 micro liters each , benedicts qualitative reagent(1x5 lit),consumable , bilirubin (direct) as 300 ml(model ba 400 system (mfg bybio system)),consumable , bilirubin (total) 600 ml(model ba 400 system (mfg bybio system)),consumable , bilirubin caoillary heparinised vitrex(one packet contain 100 capillary),consumable , bilirubin kit (colorimeter semi auto) 4x60 ml 480 test/kit consumable , bilirubin standard 1x5 ml(model ba 400 system (mfg bybio system)),consumable , blood agar powder(500 grm),consumable , blood bag 100ml , blood bag 350ml , blood gluose (god/pod) semi auto end point(1000 ml),consumable , blood grouping anti sera a monoclonal : antisera should be transparent with more than one year shelf life at 2 6 c , it should give +++ agglutination at 1.256 dilution in 3 4 sec with a positive cells 10 ml , blood grouping anti sera a monoclonal(10 ml vial (mfg tulip diagnostics)),consumable , blood grouping anti sera b monoclonal : antisera should be transparent with more than one year shelf life at 2 6 c , it should give +++ agglutination at 1.256 dilution in 3 4 sec with b positive cells 10 ml , blood grouping anti sera b monoclonal(10 ml vial (mfg tulip diagnostics)),consumable , blood grouping anti sera d monoclonal : antisera should be transparent with more than one year shelf life at 2 6 c, it should give +++ agglutination at 1.256 dilution in 3 4 sec with d antigen positive cells. 10ml vail (eryclone anti d igm) , blood grouping anti sera d monoclonal(10 ml vial (mfg tulip diagnostics)),consumable , blood urea (bun) uv(1000 ml),consumable , blood urea reagent kit(200ml (2x100ml)),consumable , blood urea(arba),consumable , capillary tube 100 pieces consumable , cholesterol hdl direct 160 ml(model ba 400 system (mfg bybio system)),consumable , cholesterol kit end point enzymatic kit 50 test/kit , cholesterol kit end point enzymatic kit 5x20ml 200 test/kit , conc hcl (1x500 ml = 500 ml),consumable , cover slip 18 x 18 mm 10gm , cover slip with isi marked size:18x18mm(+/ 1.00mm),thikness 0.13.. to 0.17mm(pkt of 50 pieces),consumable , creatine calorimeter for semi auto kinetica 4x60ml 480 test kit , creatinin kit , crp kit 1x100 biolab qualitative) , crp test kit (latex/card) (25 test/kit) , crp test kit(latex/card),kit of 25 tests(mfg pathogyme diagnostics)(25 test / kit),consumable , dengu card antigen(25 card/pkt),consumable , dengue card test 100 test kit , developer powder (22.5 ltr) , diagnostic strips for urine sugar/albmin packing: 100 strip/pkt , dialysis starting kit disposable:a)sterile tray with top(disposable),size not less than 30x30cm b) sterile drape size not less than 45x45 cm 1no c) cotton ball 6 no d)cotton gauze pieces 1 , digital x ray film 10x12 (150 films/pkt) , digital x ray film 11x14 (150 films/pkt) , digital x ray film 8x10 (150 films/pkt) , echo jelly 20ml bottle , echo jelly 250 ml(mfg by precious life care),bottle , edta k3 vial each , edta solutions k3 (500 ml) , edta solutions k3(mfg by himedia)(500 ml bottle),consumable , field stain a 500ml , field stain b 500ml , filter paper sheet((whatmann no 01) sheets),consumable , fixer: it shall be powder fixer to produce clean radiographs available in pack size size: 13.5 ltr , fixer: it shall be powder fixer to produce clean radiographs available in pack size size: 9 ltr , formaldehyde 40% (conc. formaline)(1 x 30 lit),consumable , crp latex slide per test , gel matrix group card , gel matrix cross match card , g6pd deficiency test kit (mfg pathogyme diagnostics)(10 test / kit),consumable , glacial acetic acid (2.5 liter),consumable , glass slide 75mm x 25mm 1.1 mm , glass slide 75mm x 25mm 1.35 mm , glass slide with isi mark at least 75mm x 25 mm thickness at least 1.1mm,detail specifications i with smooth edges, without any scrathtches. ii glazed glass.iii no visual or chromatic abbretions(50 slides/packet),consumable , glass test tube 12 x 100 (medium size) heavy quality 100/pkt , glass test tube 12 x 75(small size) heavy quality 100/pkt , glass test tube 5 without edge , glucometer strip (1x100) , glucose kit (god/pod)(350ml),digonstic , h2so4 (sulphuric acid)(25% 500 ml bottle),consumable , hba ag elisa 96 kit 1x96(each),consumable , hba ag rapid card test(each),consumable , hbs antigeng kit card(pack of 10 card test with 10 dropper, 1 buffer solution, 10 pricking lancet and 10 alcohol swab),digonstic , hcl n/10 (500 ml bottle) , hcv elisa(96 test kit),consumable , hcv kit card test(25 test / kit),digonstic , heamoglobin colour scale book with special strip complete(1 x 200),consumable , hematology cell counter reagents as per requirement of cell counter cleaning solution 100 ml , hemoglobin color scale (starter kit) components (1) color scale 01/kit (2) test strip 1000/kit (3) printed literature for method of use/kit (4)lancet 1000/kit , hiv elisa kit (hiv micro elisa ag+ab 4th generation )(96 test kit),consumable , hiv kit card (25 test / kit) , hydrogen peroxide (conc.) h2o2 (500 ml),consumable , k3 blood vaccutainer edta 100 tubes/pkt , leishman stain 500 ml , malaria antigen card pf/pv card (as per nvbdcp guidelines)( 10 card, 10 dropper, 1 buffer solution) , malaria antigen, p vivax, p falciparum rapid diagnostics bivalentt test card (as per gio nvbdcp specification) pack of 10 card test with 10 dropper, 1 buffer solution, 10 pricking lancet, and 10 alcohol swab , malaria card (antigen) atleast 100 microbes/desi ltr. for both species , malaria pf/pv antigen card , malaria pf/pv rapid test , methyline blue(100 ml),solution , micro pipet 1000 fix and variable each , micropiptte 100 1000 , microtips (2 200 ul) 1x1000(each),consumable , n/10 hcl 500ml , nebulization mask kit (pediatrics) , nebulization mask kit, mfg by life o line technologist(pediatrics),consumable , nebulization mask kit (adult) , new born baby kit [4 piece set] , pregnancy test card(10 card pack(mfg oscar medicare pvt ltd)),consumable , ra factor 50 test kit qualicative , ra factor rapid kit (25 test/kit) 1:) should be based on latex agglutination slide test. 2:) qualitative and semiquantitative testing facility possible. 3:) test speed must be less than 2 minutes , test tube 12 x 100 (medicm size) 100/pkt , test tube 12 x 75 (small size) 100/pkt(12 x 75 (small size) 100/pkt),tube , test tube 15x125 , tips for auto pipettes 2 to 100 micro litres 1000/pkt(2 to 100 micro litres 1000/pkt),each , tips for auto pipettes 200 to 1000 micro litres 500/pkt(200 to 1000 micro litres 500/pkt),each , tips for auto pippetes 10 to 100 micro litres , tissue paper roll(each),consumable , tourniquet with belt (good quality pairs), pairs , tourniquet with belt (mfg by precious life care pvt ltd)(good quality pairs),consumable , typhoid card test kit (for igg and igm antibody detection) (25 test kit) , typhoid test card. , umbical cord clamps plastic material (box of 100 clamps)(mfg by precious life care),consumable , umbical cord clamps plastic material(box of 100 clamps),consumable , urine albumin & suger , usg gel(mfg precious life care pvt ltd)(250 ml bottle),consumable , usg thermal paper , vdrl (rpr) 1x100 sd strip , vdrl kit (strip) (mfg by alere)(50 test/kit),consumable , vdrl kit (strip)(50 test/kit),consumable , widal 2x2 sera slide kit , widal 2x2 tube test kit , widal 4x5 ml , slide blue star , sputum cup with sticker , paraffin strip roll , zipper polybag , alluminium foil roll , hand wash liquid , falcon tube , thermacol box , gel pack , bamboo stick , tape roll , spirit lamp , adhesive plasters usp 7.5 cm x 10 mts/roll , adhesive plasters usp 7.5 cm x 5 mts/roll , adhesive roll 1 inch x 5 m / roll , baby oxygen mask set of all sizes , blood bag with acd/cpd solution (disposable sterilised) with needle(100 ml),bag , blood bag with acd/cpd solution (disposable sterilised) with needle(350 ml),bag , disposable appron , disposable cap , disposable examination gloves made of natural rubber latex, pre powdered, non streile medium , disposable examination gloves made of natural rubber latex, pre powdered, non streile small , disposable examination gloves made of natural rubber latex, pre powdered, non streile, conforming to is 15354:2003 and amendment thereof. size: large , disposable needles 22g consumable , disposable needles is 10654:2002 22g , disposable needles is 10654:2002 24g , disposable needles is 10654:2002 26 g( ),needle , disposable paper gloves size 7 inches consumable , disposable paper gloves size 7,1/2 inches consumable , disposable plastic appron (full size) , disposable pricking lancet (pkt of 200 units) , disposable pricking lancet 100 units consumable , disposable scalp vein set size 20 no , disposable scalp vein set size 22 no , disposable sharp collection containers 1.5 l , disposable sharp collection containers 5 ltr , disposable sideport knife(num),consumable , disposable sterile gloves size 6 inches consumable , disposable sterile gloves size 6,1/2 inches consumable , disposable sterile gloves size 7 inches consumable , disposable sterile gloves size 7,1/2 inches consumable , disposable sterile hypodermic syringe 10ml(each),consumable , disposable suction catheter assorted covering all sizes 10,12,14,16,18 consumable , disposable suction catheter(size 12),consumable , disposable suction catheter(size 14),consumable , disposable surgeon cap(box of 100 caps) , disposable syringe (for vitamin k inj)(1ml with needle 26g),consumable , disposable syringe with needle(2ml each),syrings , disposable syringe with needle(3ml each),syrings , disposable syringe with needle(5ml each),needle , hub cutter non electric lockable safety portable box for disposal of hypodemic needles. consumable , kellys pad disposable , n 95 mask(as per attached specification),consumable , oxygen mask adult (standard size) , oxygen mask paediatric (standard size) , plain disposable vial 3ml(each),consumable , scalp vein set(size 24g, disposable),consumable , three layer surgical mask , urine container 5ml disposable (50 per pkt) , urine container size of the container shall be 30ml disposable (50 per pkt),consumable , x ray film 10 x 12 50 sheets/pack , x ray film 12 x 12 50 sheets/pack , x ray film 12 x 15 50 sheets/pack , b.b silk (12 foils/pkt)(3/8 rcut needle 45 mm length 76 cm, size 2/0)),consumable , b.b silk size 3/0 (12 foils/pkt)(3/8cir rcut needle 26mm length 76 cm),needle , b.b silk with 1/2 cir rb needle 20 mm length 75 cm non absorbable surgical suture usp size 3 0,(12foils/pkt),needle , b.b silk with 1/2 cir rb needle size:1/0 20 mm length 75 cm non absorbable surgical sutures usp surgical material , b.b. silk 6 reels x 25 mts size:1/0(6 reels is per box rate should be quoted for 6 reels),surgical material , black braided silk with 1/2 cir cd cutting needle 16 mm length 75 cm 3/0 (14 foils/pkt) , black braided silk with 1/2 cir cutting needle 30mm length 75 cm(1/0 12 foils/pkt),consumable , black braided silk with 1/2 cir rb needle 20 mm length 75 cm 1/0 13 foils/pkt , black braided silk with 1/2 cir rb needle 30 mm length 75 cm 2/0 12 foils/pkt , catgut chromic size:2/0 length 150 cm , catgut chromic with 1/2 cir rb needle 30 mm length 70cm no. 1 0, 12 foils per packet , catgut chromic with 1/2 cir rb needle 40 mm length 75cm no. 1 consumable , catgut chromic with 1/2 cir rb needle 40 mm length 75cm no. 2 consumable(each),consumable , chromic catgut (12 foils/pkt)(size:1/0 length 150 cm),consumable , chromic catgut , round body needle no. 1.0 , chromic catgut monofilament with 1/4 circle reverse cutting needle 6 0 ( 12 / pkt ) , chromic catgut no 1.0 round dody, 40 mm 12 foils/pkt , chromic catgut suture (12 foils/pkt)(3/8 cir r cutting needle 19 mm needle, suture length 76 cm size 4/0),needle , foleys urinary catheter silkolatex 2 way sterile, non toxic size 10 , foleys urinary catheter silkolatex 2 way sterile, non toxic size 10 , non absorbable braided silk black 10mm 3/8 circle reverse cutting micro point(38 cm),consumable , non absorbable braided silk black(12 mm 3/8 circle reverse cutting micropoint 38 cm ),consumable , silk no 1 cutting needle 1x12(1x12),consumable , suture mersilk 8 0 (12 foil) , silver nitrate solution 1 ltr. , urine bag 2 ltr. , plaster of paris 410x5mtr , plaster of paris 6 15x 5mtr , cumb sera , albumin , laryngo scope bulb , auto clave quil , idetification tag , peadiatric drip set , dresing pad , endotracheal tube no. 6 , endotracheal tube no. 2.5 to 5 ml. , dynaplast 10 cm. , sicklewive test kit , autoclave indicator , absorbent cotton roll 100 gm each consumable , absorbent cotton wool ip 500 grms(each),consumable , cotton crape bandage 10cm x 4m (box of 10 bandages) , cotton crape bandage 15cm x 4m (box of 10 bandages) , cotton delivery belt , adhesive tape 7.5cm x10(mtr/roll),consumable , cloth based surgical adhesive tape roll(1 inch x 5 mtr / roll),consumable , paper adhesive microporous surgical tape 3 inch x 5 m / roll (10 roll/pkt)(3 inch x 5 m / roll (10 roll/pkt)),consumable , paper adhesive plaster microporous surgical tape 1 inch x 9 m / roll , paper adhesive plaster microporous surgical tape 2 inch x 5m /roll , paper adhesive plaster microporous surgical tape 4 inch x 9 m / roll , paper adhesive plaster microporous surgical tape 6 inch x 10 m / roll , paper adhesive plaster microporous surgical tape 6 inch x 5m /roll , umblical cotton tape length 75cm. , disposable suction catheter(size 12),consumable , disposable suction catheter(size 14),consumable , feeding tube (catheter) 10g , foleys catheter size 12 2 way(10 each),consumable , foleys catheter size 14 2 way , foleys catheter size 14 3 way , foleys catheter size 16 2 way(11 each),consumable , foleys catheter size 18 2 way , foleys catheter size 20 2 way(12 each),consumable , foleys catheter size 22 2 way(13 each),consumable , foleys catheter size 24 2 way(14 each),consumable , foleys urinary catheter 2 way size 8 , infant feeding tube (catheter) size: 3g , infant feeding tube (catheter) size: 4g , infant feeding tube (catheter) size: 5g , infant feeding tube (catheter) size: 6g , surgical blade isi marked, size 15(100 per packet),surgical material , surgical blade isi marked, size 22(100/pkt),surgical material , surgical blade isi marked, size 23(100/pkt),surgical material , surgical blade isi marked, size 24(100/pkt),surgical material , surgical blade isi marked, size 25(100/pkt),surgical material , surgical blade, size 11 , ecg jelly 250 gms , ecg paper (chemical coated)(80mmx 20 mtr each),consumable , ecg paper computerizesd triple channel 20m , ecg paper(chemical coated) 50mm x 20mm roll , ecg paper(chemical coated) 50mm x 30 mtr. roll , ecg paper(wax coated) heavy quality 50mm x 30 mtr/ roll , ecg paper(wax coated) mfg by life o line technologist(50mm x 30 mtr, roll),consumable , ecg roll three channel 20m , ecg roll three channel mfg by life o line technologist(50 mm x 20 mtr),consumable , absorable surgical suture rb needle size no 1 0,30 mm length 70 cm , 12 foils per packet , polyglycolic acid (pga) , absorable surgical suture rb needle size no 1 ,30 mm length 70 cm , 12 foils per packet , polyglycolic acid (pga) , absorbable surgical suture braided polyglycolic acid 3/8 circle reverse cuttingg(12mm 45 cm spatulated needle),consumable , blood vessel introducers needles 16g, sterilized, set , chromic (12 foils/pkt)(3/8 rb needle 30 mm, length 76 cm, size 2/0),needle , chromic size 1, (12 foils/pkt)(1/2 cir rb needle 40 mm, length 76 cm),needle , chromic size 1, 12 foils/pkt(1/2 cir rb needle 45 mm, length 100 cm),needle , insulin syringe/ each (graduation upto 100 units) 30 g needle, 40 units/ml(30 g needle, 40 units/ml),syrings , intravenous set with airway and needle((adult)),surgical material , intravenous set with airway and needle(children),surgical material , spinal needle no. 23 , sterile hypodermic syring with needle 10 ml , sterile hypodermic syring with needle 20 ml , sterile hypodermic syring with needle(5 ml),syrings , sterile hypodermic syringe with needle, mfg by ph health care pvt ltd(20 ml),consumable , vicryl no. 1 rb , vicryl no. 2.0 rb , cannula fixer set consumable , i.v cannula with injection valve size : 18g , i.v. cannula with injection valve 20g , iv cannula (two way) size 20 , iv cannula (two way) size 22 , iv cannula (two way) size 24 , iv cannula size 26g( ),consumable , biomedical waste collection plastic bag small(all colours) , biomedical waste collection plastic bag medium(all colours) , biomedical waste collection plastic bag large(all colours) , mattress 5kg cotton 3 ft x 6 ft , pillow with 2kg cotton , tericot sharee , compunder dress (male) , bed sheet single bed(white) , bedsheet double bed(white) , bed sheet single bed(coloured) , bedsheet double bed(coloured) , baby diapers small (10 diaper per pkt) , chair cushion box type , chair cushion box type , chair cushion cover , compounder coat/lab tec /xry tec std size , curtain green redymade , curton cloth rangeen , curton cloth rangeen design , dionised water 5 ltr cane(each) , front aprin , metresses 3x6 with raxine cover 4 density , napkin sup. quality std size(white) , napkin sup. quality std size(coloured) , peticote blauge cloth shuti rangeen , peticote/blauge cloth shuti bleach , pillow cover cloth bleach , rangeen baag print kapda , rangeen baag print kapda , rangeen design towel beev kapda , rangeen design weft stripe kapda , table cloth rangeen (small) , table cloth rangeen (large) , biomedical waste collection plastic dustbin small(all colours) , biomedical waste collection plastic dustbin medium(all colours) , biomedical waste collection plastic dustbin large(all colours)...

Madhya Pradesh Public Health Services Corporation Limited - Madhya Pradesh

33111294 t 338/ mpphscl/ general surgical consumables and kits /rc/2022 online rate contract tender for supply of general surgical consumables and kits to various hospitals of government of madhya pradesh for a period of 18 months , general surgical consumables and kits , cold sterilant solution (5 ltr can) , synthetic, monofilament, nonabsorbable polyprolene mesh (7.5 x 15 cm) , barium sulphate,hd 300 grm, , basic fuchsin chemical name:pararosaniline hydrochloride,chemical structure c20h20cin3 mol wt:337.86 dye content: approx 85% 88% dye content must be mentioned color: metalic green(25 gms glass bottle),consumable , bone cement, 40 g pack , capillary tube, 100 pieces , cassette 10 x 12 , cassette 12 x 15 , cassette,6.5 x 8.5 , cassette,8 x 10 , coated polyster with 1/2 cirgreen needle 17 mm (curved reverse cutting or curved round body or taper cut) size:2/0 length 90cm , collagen sheets 10 x 10 cm sheet , corrugated drainage sheet, sterile, multichannel, single use(2 inch x 6 inch (pvc) piece),consumable , cryo pen permanent marker, fine tip, alcohol resistant and water resistant, for labelling cryovials. , cvp line complete set , dead body bag (*as per attached specification) , dental x ray film size 31 x 41 mm (150 films / pkt) rate should be quoted for packet of 150 , disposable hypodermic, needle for opthalmic use no 2, 1 , disposable needles is 10654:2002 26 g (1 1/2 inch) , disposable needles is 10654:2002 26 g (1 inch) , disposable syringe with needle 10ml , disposable syringe with needle 20ml syringes , disposable syringe with needle(1ml each),syrings , disposable syringe with needle(2ml each),syrings , disposable syringe with needle(3ml each),syrings , dj stent for ureter,8 fr , epidural set 18 n0. , epidural set 20 n0. , fixer powder ( fixer with hardner),( 22.5 ltr/pkt) , fogger solution 5 lit cane containing of hydrogen peroxide i.p 11.0% w/v and silver nitrate dilute 0.01% w/v , formaldehyde 40% (conc. formalin) (1 x 30 lit), consumable , glacial acetic acid (liquid) 100 ml bottles , glutaraldehyde solution 2% in 5liter can (2 strips/vials per each can) (5 liter can), consumable , guide wire 3mm , hepatitis b core (hbc) igm antibody (elisa) (*as per attached specification) , hi speed cassette screen,10 x 12/each , hi speed cassette screen,12 x 15/each , hi speed cassette screen,6.5 x 8.5/each , hi speed cassette screen,8 x 10/each , icd bag 1000 ml , infant feeding tube (catheter) size: 3g , infant feeding tube size: 5g , insulin syringe {auto disabled (ad)/reuse prevantion (rup) syringe} with 31g needle (single unit pack) is marked, 40 iu(each),consumable , insulin syringe {auto disabled (ad)/reuse prevantion (rup) syringe}/ each (graduation upto 100 units) 30g needle, 40 units/ml (30 g needle, 40units/ml) syringe(each),consumable , insulin syringe with 31g needle (single unit pack) is marked, 100iu, {auto disabled (ad)/re use prevantion (rup) syringe(each),consumable , intra oral dental x ray film, size 0,1,2,3, 4 150 films in one packet each size , iohexol injection 350 mg iodine/ml(20 ml vail) , latex based baloon capacity (3 ml) foleys catheter(3 way, size 12),consumable , latex based baloon capacity (30 50ml) foleys catheter(size 14 3 way),consumable , lead letter 0 9 sets, (100 clips/pkt) , lead letter a to z set , lugol iodine 100 ml bottles , lugols iodine (5% solution) (potassium iodine 10% w/v and iodine 5% w/v , mantoux reagent (purified protein derivative), 10 tu vial , mantoux reagent (purified protein derivative), 5 tu vial , mentoux reagent 2 tuberculin unit (tu) strength(5ml vial)1 vial of tuberculin ppd contains 5ml reagent , n/10 hcl 100 ml , nasal prong(each),consumable (neonatal size 00) , paediatric epidural set(19g needle, metal stylet,22g catheter,0.22micron epidural catheter lor syringe) , pd catheter swan neck double cuff with catheter kit size 41cm to 47c.m. , pd catheter swan neck with curl with double cuff size 62.5 cm , polyamide mono filament (nylon) with 1/2 cir cut needle 20/16 mm length 70 cm size 2/0(12 foils/pkt),consumable , polypropylene size 2/0 (12 foils/pkt)(1/2 cir rb needle 25mm, length 45 cm),needle , quincke pediatric spinal needles, g 25, length 2.0 inch , reuse prevention syringe sterile single use reuse prevention syringe with fixed needle scompliance to iso 7886:4 type i and b,flow wrap/ blister pkg using medical grade breathable paper, eto sterilized.(10 ml) , reuse prevention syringe sterile single use reuse prevention syringe with fixed needles compliance to iso 7886:4 type i,b,flow wrap/ blister pack using medical grade breathable paper, eto sterilized(2ml),syrings , reuse prevention syringe sterile single use reuse prevention syringe with fixed needles compliance to iso 7886:4 type i,b,flow wrap/ blister pack using medical grade breathable paper, eto sterilized(3ml),syrings , reuse prevention syringe sterile single use reuse prevention syringe with fixed needles complianceto iso 7886:4 type i,b,flow wrap/ blister pack using medical grade breathable paper, eto sterilized(5ml),syrings , rnase/ dnase away solution, for complete removal of rnase/ dnase contamination from work surfaces, pipettes and equipments(should be stable at room temperature) , silk suture for eye spatulated micropoint reverse cutting needle, double armed suture 12 foils/pkt 9 0 , silk suture spatulated micropoint reverse cutting needle, double armed suture 12 foils/pkt 10 0 , spinal (l.p.) needle disposable 24 g with syringe , spinal needle 26 g(each) needle with syringe , spinal needle with metal stylet,(g 23),needle , spinal needle(g 22 l 120 mm),consumable , sterile disposable urine container 20ml , suction tube, silicone, int. diam. 8 mm, length minimum 2 m , sulphuric acid(500ml glass bottle),consumable , suture needles curved 1/2 circle round body assorted size 11 15 6 nos. /pkt. , suture needles curved 1/2 circle round body assorted size 16 20 6 nos. /pkt. , suture needles curved 1/2 circle round body assorted size 6 10 6 nos. /pkt. , suture needles curved 1/2 circle round body assorted,size 1 5 6 nos. /pkt. , suture needles curved and cutting 1/2 circle cutting,size 6 10 6 nos. /pkt. , suture needles curved and cutting 1/2 circle,size 11 15 6 nos. /pkt. , suture needles curved and cutting 1/2 circle,size 16 20 6 nos. /pkt. , suture needles curved and cutting,size 1 5 6 nos. /pkt. , sutures 10 0 silk,12 foils/pkt , troponin 1 kit(10 test per pack),consumable...

Ministry Of Defence - Madhya Pradesh

32705555 bids are invited for glacial acetic acid (q3) , formaldehyde solution as per is: 3321 (q3) , methanol lr grade (q3) , perchloric acid (q3) total quantity : 7...

Directorate Of Health Services - Madhya Pradesh

32422152 surgical materials suplly of surgical materials , alkaline phosphatase ( alp ) dea 300 ml ( model ba 400 system ( mfg bybio system ) ) , consumable , alkaline phosphatase kit ( kinetic ) 10x2.2ml 44 test / kit consumable , anti abd grouping serum 3x10ml consumable , anti a sera igm ( 10 vial ) , consumable , anti b sera igm ( 10 vial ) , consumable , anti d sera igg+igm 10ml vial ( each ) , consumable , anti d ( polyvalent ) ( 1x10 ml ) , consumable , anti h sera , auto pippets fixed volume 10 micro liters each , auto pippets fixed volume 1000 micro liters each , auto pippets fixed volume 20 micro liters each , benedicts qualitative reagent ( 1x5 lit ) , consumable , bilirubin ( direct ) as 300 ml ( model ba 400 system ( mfg bybio system ) ) , consumable , bilirubin ( total ) 600 ml ( model ba 400 system ( mfg bybio system ) ) , consumable , bilirubin caoillary heparinised vitrex ( one packet contain 100 capillary ) , consumable , bilirubin kit ( colorimeter semi auto ) 4x60 ml 480 test / kit consumable , bilirubin standard 1x5 ml ( model ba 400 system ( mfg bybio system ) ) , consumable , blood agar powder ( 500 grm ) , consumable , blood bag 100ml , blood bag 350ml , blood gluose ( god / pod ) semi auto end point ( 1000 ml ) , consumable , blood grouping anti sera a monoclonal : antisera should be transparent with more than one year shelf life at 2 6 c , it should give +++ agglutination at 1.256 dilution in 3 4 sec with a positive cells 10 ml , blood grouping anti sera a monoclonal ( 10 ml vial ( mfg tulip diagnostics ) ) , consumable , blood grouping anti sera b monoclonal : antisera should be transparent with more than one year shelf life at 2 6 c , it should give +++ agglutination at 1.256 dilution in 3 4 sec with b positive cells 10 ml , blood grouping anti sera b monoclonal ( 10 ml vial ( mfg tulip diagnostics ) ) , consumable , blood grouping anti sera d monoclonal : antisera should be transparent with more than one year shelf life at 2 6 c, it should give +++ agglutination at 1.256 dilution in 3 4 sec with d antigen positive cells. 10ml vail ( eryclone anti d igm ) , blood grouping anti sera d monoclonal ( 10 ml vial ( mfg tulip diagnostics ) ) , consumable , blood urea ( bun ) uv ( 1000 ml ) , consumable , blood urea reagent kit ( 200ml ( 2x100ml ) ) , consumable , blood urea ( arba ) , consumable , capillary tube 100 pieces consumable , cholesterol hdl direct 160 ml ( model ba 400 system ( mfg bybio system ) ) , consumable , cholesterol kit end point enzymatic kit 50 test / kit , cholesterol kit end point enzymatic kit 5x20ml 200 test / kit , conc hcl ( 1x500 ml = 500 ml ) , consumable , cover slip 18 x 18 mm 10gm , cover slip with isi marked size:18x18mm ( + / 1.00mm ) , thikness 0.13.. to 0.17mm ( pkt of 50 pieces ) , consumable , creatine calorimeter for semi auto kinetica 4x60ml 480 test kit , creatinin kit , crp kit 1x100 biolab qualitative ) , crp test kit ( latex / card ) ( 25 test / kit ) , crp test kit ( latex / card ) , kit of 25 tests ( mfg pathogyme diagnostics ) ( 25 test / kit ) , consumable , dengu card antigen ( 25 card / pkt ) , consumable , dengue card test 100 test kit , developer powder ( 22.5 ltr ) , diagnostic strips for urine sugar / albmin packing: 100 strip / pkt , dialysis starting kit disposable:a ) sterile tray with top ( disposable ) , size not less than 30x30cm b ) sterile drape size not less than 45x45 cm 1no c ) cotton ball 6 no d ) cotton gauze pieces 1 , digital x ray film 10x12 ( 150 films / pkt ) , digital x ray film 11x14 ( 150 films / pkt ) , digital x ray film 8x10 ( 150 films / pkt ) , echo jelly 20ml bottle , echo jelly 250 ml ( mfg by precious life care ) , bottle , edta k3 vial each , edta solutions k3 ( 500 ml ) , edta solutions k3 ( mfg by himedia ) ( 500 ml bottle ) , consumable , field stain a 500ml , field stain b 500ml , filter paper sheet ( ( whatmann no 01 ) sheets ) , consumable , fixer: it shall be powder fixer to produce clean radiographs available in pack size size: 13.5 ltr , fixer: it shall be powder fixer to produce clean radiographs available in pack size size: 9 ltr , formaldehyde 40% ( conc. formaline ) ( 1 x 30 lit ) , consumable , crp latex slide per test , gel matrix group card , gel matrix cross match card , g6pd deficiency test kit ( mfg pathogyme diagnostics ) ( 10 test / kit ) , consumable , glacial acetic acid ( 2.5 liter ) , consumable , glass slide 75mm x 25mm 1.1 mm , glass slide 75mm x 25mm 1.35 mm , glass slide with isi mark at least 75mm x 25 mm thickness at least 1.1mm, detail specifications i with smooth edges, without any scrathtches. ii glazed glass.iii no visual or chromatic abbretions ( 50 slides / packet ) , consumable , glass test tube 12 x 100 ( medium size ) heavy quality 100 / pkt , glass test tube 12 x 75 ( small size ) heavy quality 100 / pkt , glass test tube 5 without edge , glucometer strip ( 1x100 ) , glucose kit ( god / pod ) ( 350ml ) , digonstic , h2so4 ( sulphuric acid ) ( 25% 500 ml bottle ) , consumable , hba ag elisa 96 kit 1x96 ( each ) , consumable , hba ag rapid card test ( each ) , consumable , hbs antigeng kit card ( pack of 10 card test with 10 dropper, 1 buffer solution, 10 pricking lancet and 10 alcohol swab ) , digonstic , hcl n / 10 ( 500 ml bottle ) , hcv elisa ( 96 test kit ) , consumable , hcv kit card test ( 25 test / kit ) , digonstic , heamoglobin colour scale book with special strip complete ( 1 x 200 ) , consumable , hematology cell counter reagents as per requirement of cell counter cleaning solution 100 ml , hemoglobin color scale ( starter kit ) components ( 1 ) color scale 01 / kit ( 2 ) test strip 1000 / kit ( 3 ) printed literature for method of use / kit ( 4 ) lancet 1000 / kit , hiv elisa kit ( hiv micro elisa ag+ab 4th generation ) ( 96 test kit ) , consumable , hiv kit card ( 25 test / kit ) , hydrogen peroxide ( conc. ) h2o2 ( 500 ml ) , consumable , k3 blood vaccutainer edta 100 tubes / pkt , leishman stain 500 ml , malaria antigen card pf / pv card ( as per nvbdcp guidelines ) ( 10 card, 10 dropper, 1 buffer solution ) , malaria antigen, p vivax, p falciparum rapid diagnostics bivalentt test card ( as per gio nvbdcp specification ) pack of 10 card test with 10 dropper, 1 buffer solution, 10 pricking lancet, and 10 alcohol swab , malaria card ( antigen ) atleast 100 microbes / desi ltr. for both species , malaria pf / pv antigen card , malaria pf / pv rapid test , methyline blue ( 100 ml ) , solution , micro pipet 1000 fix and variable each , micropiptte 100 1000 , microtips ( 2 200 ul ) 1x1000 ( each ) , consumable , n / 10 hcl 500ml , nebulization mask kit ( pediatrics ) , nebulization mask kit, mfg by life o line technologist ( pediatrics ) , consumable , nebulization mask kit ( adult ) , new born baby kit [ 4 piece set ] , pregnancy test card ( 10 card pack ( mfg oscar medicare pvt ltd ) ) , consumable , ra factor 50 test kit qualicative , ra factor rapid kit ( 25 test / kit ) 1: ) should be based on latex agglutination slide test. 2: ) qualitative and semiquantitative testing facility possible. 3: ) test speed must be less than 2 minutes , test tube 12 x 100 ( medicm size ) 100 / pkt , test tube 12 x 75 ( small size ) 100 / pkt ( 12 x 75 ( small size ) 100 / pkt ) , tube , test tube 15x125 , tips for auto pipettes 2 to 100 micro litres 1000 / pkt ( 2 to 100 micro litres 1000 / pkt ) , each , tips for auto pipettes 200 to 1000 micro litres 500 / pkt ( 200 to 1000 micro litres 500 / pkt ) , each , tips for auto pippetes 10 to 100 micro litres , tissue paper roll ( each ) , consumable , tourniquet with belt ( good quality pairs ) , pairs , tourniquet with belt ( mfg by precious life care pvt ltd ) ( good quality pairs ) , consumable , typhoid card test kit ( for igg and igm antibody detection ) ( 25 test kit ) , typhoid test card. , umbical cord clamps plastic material ( box of 100 clamps ) ( mfg by precious life care ) , consumable , umbical cord clamps plastic material ( box of 100 clamps ) , consumable , urine albumin & suger , usg gel ( mfg precious life care pvt ltd ) ( 250 ml bottle ) , consumable , usg thermal paper , vdrl ( rpr ) 1x100 sd strip , vdrl kit ( strip ) ( mfg by alere ) ( 50 test / kit ) , consumable , vdrl kit ( strip ) ( 50 test / kit ) , consumable , widal 2x2 sera slide kit , widal 2x2 tube test kit , widal 4x5 ml , slide blue star , sputum cup with sticker , paraffin strip roll , zipper polybag , alluminium foil roll , hand wash liquid , falcon tube , thermacol box , gel pack , bamboo stick , tape roll , spirit lamp , adhesive plasters usp 7.5 cm x 10 mts / roll , adhesive plasters usp 7.5 cm x 5 mts / roll , adhesive roll 1 inch x 5 m / roll , baby oxygen mask set of all sizes , blood bag with acd / cpd solution ( disposable sterilised ) with needle ( 100 ml ) , bag , blood bag with acd / cpd solution ( disposable sterilised ) with needle ( 350 ml ) , bag , disposable appron , disposable cap , disposable examination gloves made of natural rubber latex, pre powdered, non streile medium , disposable examination gloves made of natural rubber latex, pre powdered, non streile small , disposable examination gloves made of natural rubber latex, pre powdered, non streile, conforming to is 15354:2003 and amendment thereof. size: large , disposable needles 22g consumable , disposable needles is 10654:2002 22g , disposable needles is 10654:2002 24g , disposable needles is 10654:2002 26 g ( ) , needle , disposable paper gloves size 7 inches consumable , disposable paper gloves size 7, 1 / 2 inches consumable , disposable plastic appron ( full size ) , disposable pricking lancet ( pkt of 200 units ) , disposable pricking lancet 100 units consumable , disposable scalp vein set size 20 no , disposable scalp vein set size 22 no , disposable sharp collection containers 1.5 l , disposable sharp collection containers 5 ltr , disposable sideport knife ( num ) , consumable , disposable sterile gloves size 6 inches consumable , disposable sterile gloves size 6, 1 / 2 inches consumable , disposable sterile gloves size 7 inches consumable , disposable sterile gloves size 7, 1 / 2 inches consumable , disposable sterile hypodermic syringe 10ml ( each ) , consumable , disposable suction catheter assorted covering all sizes 10, 12, 14, 16, 18 consumable , disposable suction catheter ( size 12 ) , consumable , disposable suction catheter ( size 14 ) , consumable , disposable surgeon cap ( box of 100 caps ) , disposable syringe ( for vitamin k inj ) ( 1ml with needle 26g ) , consumable , disposable syringe with needle ( 2ml each ) , syrings , disposable syringe with needle ( 3ml each ) , syrings , disposable syringe with needle ( 5ml each ) , needle , hub cutter non electric lockable safety portable box for disposal of hypodemic needles. consumable , kellys pad disposable , n 95 mask ( as per attached specification ) , consumable , oxygen mask adult ( standard size ) , oxygen mask paediatric ( standard size ) , plain disposable vial 3ml ( each ) , consumable , scalp vein set ( size 24g, disposable ) , consumable , three layer surgical mask , urine container 5ml disposable ( 50 per pkt ) , urine container size of the container shall be 30ml disposable ( 50 per pkt ) , consumable , x ray film 10 x 12 50 sheets / pack , x ray film 12 x 12 50 sheets / pack , x ray film 12 x 15 50 sheets / pack , b.b silk ( 12 foils / pkt ) ( 3 / 8 rcut needle 45 mm length 76 cm, size 2 / 0 ) ) , consumable , b.b silk size 3 / 0 ( 12 foils / pkt ) ( 3 / 8cir rcut needle 26mm length 76 cm ) , needle , b.b silk with 1 / 2 cir rb needle 20 mm length 75 cm non absorbable surgical suture usp size 3 0, ( 12foils / pkt ) , needle , b.b silk with 1 / 2 cir rb needle size:1 / 0 20 mm length 75 cm non absorbable surgical sutures usp surgical material , b.b. silk 6 reels x 25 mts size:1 / 0 ( 6 reels is per box rate should be quoted for 6 reels ) , surgical material , black braided silk with 1 / 2 cir cd cutting needle 16 mm length 75 cm 3 / 0 ( 14 foils / pkt ) , black braided silk with 1 / 2 cir cutting needle 30mm length 75 cm ( 1 / 0 12 foils / pkt ) , consumable , black braided silk with 1 / 2 cir rb needle 20 mm length 75 cm 1 / 0 13 foils / pkt , black braided silk with 1 / 2 cir rb needle 30 mm length 75 cm 2 / 0 12 foils / pkt , catgut chromic size:2 / 0 length 150 cm , catgut chromic with 1 / 2 cir rb needle 30 mm length 70cm no. 1 0, 12 foils per packet , catgut chromic with 1 / 2 cir rb needle 40 mm length 75cm no. 1 consumable , catgut chromic with 1 / 2 cir rb needle 40 mm length 75cm no. 2 consumable ( each ) , consumable , chromic catgut ( 12 foils / pkt ) ( size:1 / 0 length 150 cm ) , consumable , chromic catgut , round body needle no. 1.0 , chromic catgut monofilament with 1 / 4 circle reverse cutting needle 6 0 ( 12 / pkt ) , chromic catgut no 1.0 round dody, 40 mm 12 foils / pkt , chromic catgut suture ( 12 foils / pkt ) ( 3 / 8 cir r cutting needle 19 mm needle, suture length 76 cm size 4 / 0 ) , needle , foleys urinary catheter silkolatex 2 way sterile, non toxic size 10 , foleys urinary catheter silkolatex 2 way sterile, non toxic size 10 , non absorbable braided silk black 10mm 3 / 8 circle reverse cutting micro point ( 38 cm ) , consumable , non absorbable braided silk black ( 12 mm 3 / 8 circle reverse cutting micropoint 38 cm ) , consumable , silk no 1 cutting needle 1x12 ( 1x12 ) , consumable , suture mersilk 8 0 ( 12 foil ) , silver nitrate solution 1 ltr. , urine bag 2 ltr. , plaster of paris 410x5mtr , plaster of paris 6 15x 5mtr , cumb sera , albumin , laryngo scope bulb , auto clave quil , idetification tag , peadiatric drip set , dresing pad , endotracheal tube no. 6 , endotracheal tube no. 2.5 to 5 ml. , dynaplast 10 cm. , sicklewive test kit , autoclave indicator , absorbent cotton roll 100 gm each consumable , absorbent cotton wool ip 500 grms ( each ) , consumable , cotton crape bandage 10cm x 4m ( box of 10 bandages ) , cotton crape bandage 15cm x 4m ( box of 10 bandages ) , cotton delivery belt , adhesive tape 7.5cm x10 ( mtr / roll ) , consumable , cloth based surgical adhesive tape roll ( 1 inch x 5 mtr / roll ) , consumable , paper adhesive microporous surgical tape 3 inch x 5 m / roll ( 10 roll / pkt ) ( 3 inch x 5 m / roll ( 10 roll / pkt ) ) , consumable , paper adhesive plaster microporous surgical tape 1 inch x 9 m / roll , paper adhesive plaster microporous surgical tape 2 inch x 5m / roll , paper adhesive plaster microporous surgical tape 4 inch x 9 m / roll , paper adhesive plaster microporous surgical tape 6 inch x 10 m / roll , paper adhesive plaster microporous surgical tape 6 inch x 5m / roll , umblical cotton tape length 75cm. , disposable suction catheter ( size 12 ) , consumable , disposable suction catheter ( size 14 ) , consumable , feeding tube ( catheter ) 10g , foleys catheter size 12 2 way ( 10 each ) , consumable , foleys catheter size 14 2 way , foleys catheter size 14 3 way , foleys catheter size 16 2 way ( 11 each ) , consumable , foleys catheter size 18 2 way , foleys catheter size 20 2 way ( 12 each ) , consumable , foleys catheter size 22 2 way ( 13 each ) , consumable , foleys catheter size 24 2 way ( 14 each ) , consumable , foleys urinary catheter 2 way size 8 , infant feeding tube ( catheter ) size: 3g , infant feeding tube ( catheter ) size: 4g , infant feeding tube ( catheter ) size: 5g , infant feeding tube ( catheter ) size: 6g , surgical blade isi marked, size 15 ( 100 per packet ) , surgical material , surgical blade isi marked, size 22 ( 100 / pkt ) , surgical material , surgical blade isi marked, size 23 ( 100 / pkt ) , surgical material , surgical blade isi marked, size 24 ( 100 / pkt ) , surgical material , surgical blade isi marked, size 25 ( 100 / pkt ) , surgical material , surgical blade, size 11 , ecg jelly 250 gms , ecg paper ( chemical coated ) ( 80mmx 20 mtr each ) , consumable , ecg paper computerizesd triple channel 20m , ecg paper ( chemical coated ) 50mm x 20mm roll , ecg paper ( chemical coated ) 50mm x 30 mtr. roll , ecg paper ( wax coated ) heavy quality 50mm x 30 mtr / roll , ecg paper ( wax coated ) mfg by life o line technologist ( 50mm x 30 mtr, roll ) , consumable , ecg roll three channel 20m , ecg roll three channel mfg by life o line technologist ( 50 mm x 20 mtr ) , consumable , absorable surgical suture rb needle size no 1 0, 30 mm length 70 cm , 12 foils per packet , polyglycolic acid ( pga ) , absorable surgical suture rb needle size no 1 , 30 mm length 70 cm , 12 foils per packet , polyglycolic acid ( pga ) , absorbable surgical suture braided polyglycolic acid 3 / 8 circle reverse cuttingg ( 12mm 45 cm spatulated needle ) , consumable , blood vessel introducers needles 16g, sterilized, set , chromic ( 12 foils / pkt ) ( 3 / 8 rb needle 30 mm, length 76 cm, size 2 / 0 ) , needle , chromic size 1, ( 12 foils / pkt ) ( 1 / 2 cir rb needle 40 mm, length 76 cm ) , needle , chromic size 1, 12 foils / pkt ( 1 / 2 cir rb needle 45 mm, length 100 cm ) , needle , insulin syringe / each ( graduation upto 100 units ) 30 g needle, 40 units / ml ( 30 g needle, 40 units / ml ) , syrings , intravenous set with airway and needle ( ( adult ) ) , surgical material , intravenous set with airway and needle ( children ) , surgical material , spinal needle no. 23 , sterile hypodermic syring with needle 10 ml , sterile hypodermic syring with needle 20 ml , sterile hypodermic syring with needle ( 5 ml ) , syrings , sterile hypodermic syringe with needle, mfg by ph health care pvt ltd ( 20 ml ) , consumable , vicryl no. 1 rb , vicryl no. 2.0 rb , cannula fixer set consumable , i.v cannula with injection valve size : 18g , i.v. cannula with injection valve 20g , iv cannula ( two way ) size 20 , iv cannula ( two way ) size 22 , iv cannula ( two way ) size 24 , iv cannula size 26g ( ) , consumable , biomedical waste collection plastic bag small ( all colours ) , biomedical waste collection plastic bag medium ( all colours ) , biomedical waste collection plastic bag large ( all colours ) , mattress 5kg cotton 3 ft x 6 ft , pillow with 2kg cotton , tericot sharee , compunder dress ( male ) , bed sheet single bed ( white ) , bedsheet double bed ( white ) , bed sheet single bed ( coloured ) , bedsheet double bed ( coloured ) , baby diapers small ( 10 diaper per pkt ) , chair cushion box type , chair cushion box type , chair cushion cover , compounder coat / lab tec / xry tec std size , curtain green redymade , curton cloth rangeen , curton cloth rangeen design , dionised water 5 ltr cane ( each ) , front aprin , metresses 3x6 with raxine cover 4 density , napkin sup. quality std size ( white ) , napkin sup. quality std size ( coloured ) , peticote blauge cloth shuti rangeen , peticote / blauge cloth shuti bleach , pillow cover cloth bleach , rangeen baag print kapda , rangeen baag print kapda , rangeen design towel beev kapda , rangeen design weft stripe kapda , table cloth rangeen ( small ) , table cloth rangeen ( large ) , biomedical waste collection plastic dustbin small ( all colours ) , biomedical waste collection plastic dustbin medium ( all colours ) , biomedical waste collection plastic dustbin large ( all colours ) ...

Directorate Of Health Services - Madhya Pradesh

32077142 supply of material suture surgical and other consumables in district hospital datia 1 material suture surgical and other consumables 2 absorbant cotton woll 500gm. 3 absorbant cotton woll 100gm. 4 adhesive paper tape 4x 9 mtr. 5 adhesive plaster 7.5 x 5 mtr 6 adhesive plaster 10 x 5 mtr 7 adhesive plaster 1 roll 8 adhesive plaster 1 / 2 roll 9 blood administration set 10 b.b. silk 6 reels x 25 mts length 25 mts. size 1 / 0 11 catgut chromic legth 150 cm size 1 / 0 12 catgut chromic legth 150 cm size 1 13 catgut chromic legth 150 cm size 2 / 0 14 catgut plan legth 150 cm size 1 / 0 15 catgut plan legth 150 cm size 2 / 0 16 catgut plan legth 150 cm size 3 / 0 17 catgut plan legth 150 cm size 4 / 0 18 cup goggle ( kala chasma ) 19 disposable surgical cap 20 insulin syringe / each ( graduation upto 100 units ) 30 g needle, 40 units / ml ( 30 g needle, 40 units / ml ) , syrings 21 disposable needle 23 g 22 disposable needle 24 g 23 disposable needle 24x1 / 2 g 24 disposable needle 26 g 25 disposable needle 26x1 / 2 g 26 disposable needle 27 g 27 disposable sterile gloves b.i.s specification gloves, surgical rubber, made of hypoallergic latex 100%, electronically tested sterilized by gamma irradiation / eto is no : 13422 92, 6 inch / pair [ 700163 ] 28 disposable sterile gloves b.i.s specification gloves, surgical rubber, made of hypoallergic latex 100%, electronically tested sterilized by gamma irradiation / eto is no : 13422 92, 6.5 inch / pair [ 700163 ] 29 disposable sterile gloves b.i.s specification gloves, surgical rubber, made of hypoallergic latex 100%, electronically tested sterilized by gamma irradiation / eto is no : 13422 92, 7 inch / pair [ 700163 ] 30 disposable sterile gloves b.i.s specification gloves, surgical rubber, made of hypoallergic latex 100%, electronically tested sterilized by gamma irradiation / eto is no : 13422 92, 7.5 inch / pair [ 700163 ] 31 disposable sterile gloves b.i.s specification gloves, surgical rubber, made of hypoallergic latex 100%, electronically tested sterilized by gamma irradiation / eto is no : 13422 92, 6 inch / pair [ 700163 ] 32 disposable suction cathetor assorted covering all size 33 disposable syringe with needle 50 cc 34 disposable syringe with needle 20 cc 35 disposable syringe with needle 10 cc 36 disposable syringe is with needle isi 5 cc 37 disposable syringe is with needle isi 3 cc 38 disposable syringe is with needle isi 2 cc 39 eye drape disposable ( eye towel ) towel size 70x70cmadhesivearea 08x08cm 40 endotracheal tube size internal diameter 2.5 41 endotracheal tube size internal diameter 3 42 endotracheal tube size internal diameter 3.5 43 endotracheal tube size internal diameter 5 44 endotracheal tube size internal diameter 5.5 45 endotracheal tube size internal diameter 7 46 endotracheal tube size internal diameter 7.5 47 endotracheal tube size internal diameter 8 48 endotracheal tube size internal diameter 6 49 endotracheal tube size internal diameter 6.5 50 foldable iol sterile lens +16 25 d 51 folly, s urinary catheter three way size 16 52 folly, s urinary catheter three way size 18 53 folly, s urinary catheter three way size 20 54 folly, s urinary catheter two way size 16 55 folly, s urinary catheter two way size 18 56 haemoglobin colour scale ( starter kit ) componantss 1. colour scale 1, 2. test strip 1000 / kit, 3 printed literature for method of use / kit, 4. lancent 1000 / kit 57 haemoglobin colour scale strip 1000 strip / pack 58 hot water bag 59 hernia mesh 3 60 hernia mesh 4 61 hernia mesh 6 62 hernia mesh 12 63 id wrist band ( mother & child ) 64 infant feeding tube ( catheter ) 5 g 65 infant feeding tube ( catheter ) 6 g 66 infant feeding tube ( catheter ) 7 g 67 infant feeding tube ( catheter ) 8 g 68 infant feeding tube ( catheter ) 10 g 69 infant mucus extractor pvc 70 infusion ( syringe ) pump conector 71 intravenous set ( adult ) with airway and needle 72 intravenous set ( children ) with airway and needle 73 iv cannula size 18g with inj. valve ( port ) 74 iv cannula size 20g with inj. valve ( port ) 75 iv cannula size 22g with inj. valve ( port ) 76 iv cannula size 24g with inj. valve ( port ) 77 iv cannula size 26g with inj. valve ( port ) 78 mackintosh double colour water proof rubber isi marked 79 micro volume drip set 80 n 95 mask 81 needle hypodermic 0 size 24gx11 1 / 2 82 needle hypodermic 0 size 26gx11 1 / 2 83 non foldable iol sterile lens pc + all size 84 one needle vicril size 01 85 one needle vicril size 02 86 one needle vicril size 1 0 87 one needle vicril size 2 0 88 one needle vicril size 1 89 one needle vicril size 3 0 90 one needle vicril size 4 0 91 rolled bandage 15cm x 5mtr 92 ryles tube ( pvc ) 10 x12 93 ryles tube ( pvc ) 16 x18 94 sugical blade, size 11 95 sugical blade, size 15 96 sugical blade, size 23 97 suture mersilk 8 0 98 suture needles curved and cutting size 1 5 99 suture needles curved and cutting size 6 10 100 suture needles curved and cutting size 11 15 101 suture needles curved and cutting size 16 20 102 suture needles curved1 / 2 circleroundbody assortedsize 1 5 103 suture needles curved1 / 2 circleroundbody assortedsize 11 15 104 suture needles curved1 / 2 circleroundbody assortedsize 16 20 105 disposable three layer surgical mask 106 umblical cord clamp 107 umblical cotton tape length 75 cm 108 urinary drainage bag cap with non return valve ( eo sterile ) , mfg by life o line technologist ( 2 litre ) , consumable [ 700876 ] 109 sics blades cresent knives 110 sics bladess keratome 3.2 knives 111 sics blades 15 degreelance tip knives 112 polythene size 8x10 55 micron ( red / blak ) for immunisation 113 polythene size 7x5 with zip for immunisation 114 buds for eye surgery 50pcs. 115 phaco drape for eye surgery all size 116 autoclavable phaco tubings for abbott soveneir compact machine 117 mvr blades for phaco surgery 118 hand wash sanitizer 100 ml ( antiseptic ) 119 artery forceps mosquitocurved 120 artery forceps mosquito straight 121 artery forceps spencer coachercurveds.s. 122 artery forceps spencer coacherstraights.s. 123 artery forceps spencer well size 12.5cm curved 124 artery forceps spencer well size 12.5cm straight 125 artery forceps spencer well size 15 cm curved 126 artery forceps spencer well size 15 cm straight 127 artery forceps spencer well size 17.5 cm straight 128 autoclave drum 6 x 4 129 drum for autoclave6x6 130 drum for autoclave9 x 5 131 drum for autoclave11 x 5 132 drum for autoclave11 x 9 133 drum for autoclave14 x 9 134 heater for autoclave. 135 strips for autoclave sterlity testing 136 plug and socket. for autoclave. 137 pressure gauge, with colour code. for autoclave. 138 pressure release valve. for autoclave. 139 steam release valve. for autoclave. 140 silicone rubber sralgasket for autoclave 141 baby tray ss 142 basket typeforegin body remover 143 bed pan female with cover s.s. superior quality size standard 144 bed pan male with cover s.s. superior quality size standard 145 biopsy forceps endoscopiyupper urinary tract ( 829 07 ) wolf 146 biopsy forceps endoscopylower urinary tract ( 8952 65 ) wolf 147 bipolar forceps connecting cableof wolf 148 bipolar scissors mayo 149 blood presure instrument digital ( iso / ce ) 150 stethoscope adult 151 stethoscope paediatrics 152 bronchoscopybiopsy forcep 153 chietels forcep 160 mm 154 dormia basket 155 dressing forceps plain s.s. size 12.5cm 156 dressing forceps plain s.s. size 15 cm 157 dressing scissor straight s.s. superiorquality size 12.5 cm 158 dressing scissor straight s.s. superiorquality size 15 cm 159 dressing scissor straight s.s. superiorquality size 17 cm 160 dressing scissor straight s.s. superiorquality size 20 cm 161 dressing drum ( s.s. ) 11x 9 162 dressing drum ( s.s. ) 12x 10 163 dressing drum ( s.s. ) 12x 15 164 dustwin made of birgin plastic with lid 50 ltr all colours as pe specific for biomedical waste 165 dustwin made of birgin plastic with lid 20 ltr all colours as pe specific for biomedical waste 166 dustwin made of birgin plastic with lid 10 ltr all colours as pe specific for biomedical waste 167 polethene for biomedical waste management ( as per rules pollution control boad ) ( any size ) 168 endoscopic rotating multiple clip applier 169 forcep plan 160 mm 170 forcep spring type dressing 160 mm 171 instrument tray with cover s.s. superior quality size 10 x 8 172 instrument tray with cover s.s. superior quality size 10 x 12 173 instrument tray with cover s.s. superior quality size 12 x 15 174 kidney tray s.s. superior quality size 6 175 kidney tray s.s. superior quality size 8 176 kidney tray s.s. superior quality size 10 177 nebuliser kit 178 needle holder 12 179 oxygen cylinder key 180 oxygen flowmetwr with bpc 181 sponge tissue forceps size 15 cm 182 sponge holding forcep ( s.s. ) 15 cm 183 sponge holding forcep ( s.s. ) 20 cm 184 scissor cord cutting curved on flat 160 mm ( s.s. ) 185 scissor surgical straight 140 mm ( s.s. ) 186 stitch scissor s.s. superior quality 187 urine pot male s.s. superior quality size standard 188 urine pot fe male s.s. superior quality size standard 189 suture cutting scissors 190 midwifery with forceps 191 uterine curetts sharp&blunt 192 obstetrical forceps 193 uterine sound sims 194 vaginal speculum sims 195 vaginal speculum cusco 196 uterine depresores sims 197 hand sanitizer 100 ml ( antiseptic ) 198 hand wash solution 500 ml 199 weight machine adult mannual isi / ce certified 200 weight machine adult digital isi / ce certified 201 weight machine child mannual isi / ce certified 202 weight machine child digital isi / ce certified 203 b.p. apparatus with age appropriate calf size ( as per specification rbsk programe ) 204 weghing scale ( mechanical newborn weighing scale ( as per specification rbsk programe ) 205 hight measuring tap ( bangle type ) ( as per specification rbsk programe ) 206 infantometer ( as per specification rbsk programe ) 207 standiometer ( as per specification rbsk programe ) 208 stethoscope ( paediatrics ) ( as per specification rbsk programe ) 209 red ring plastic for child ( as per specification rbsk programe ) 210 plastic box ( 18 inch x 8 inch x 8 inch ) ( as per specification rbsk programe ) 211 vision chart, referance chart ( as per specification rbsk programe ) 212 torch ( small withpencill cell ) ( as per specification rbsk programe ) 213 small bottle with raisins size 450 ml ( as per specification rbsk programe ) 214 colour wool 100 gm ( as per specification rbsk programe ) 215 digital bp instrument branded is / ce crtified 216 digital thermameter ( as per specification for hbnc kit ) 217 digital wrist watch ( as per specification for hbnc kit ) 218 spring weighing scale capacity 5 kg weight ( as per specification for hbnc kit ) 219 spoon for baby feeding ss 5 ml ( as per specification for hbnc kit ) 220 warm bag for newborn ( as per specification for hbnc kit ) 221 bag for home visit ( as per specification for hbnc kit ) 222 peledi ( as per specification for hbnc kit ) 223 baby blanket ( as per specification for hbnc kit ) 224 alkaline phosphatase kinetic 5x10ml semauto 225 bilirubin kit ( semi auto ) 4x60ml 480 test / kit end point 226 blood sugar kit ( god / pod ) 1 ltr 2x200 ml semi auto endpoint 227 blood sugar kit ( god / pod ) 1 ltr 10x100 ml semi auto endpoint 228 blood urea gldh kinetic kit liquid stable 5x10 ml semi auto 229 cholesterol kit end point enzymatic kit 5x20ml semi auto 230 creatininefor semi auto kinetic 4x60ml / 480test / kit 231 liquidstable calcium ocpc auto mono vial 232 liquid stable sgpt semi auto 5x10 mlend point 233 liquid stable sgot semi auto 5x10 ml end point 234 liquid stable serum albumine semi auto 4x50 ml 235 liquid stable serum amylase mono vial semi auto 236 serum total protin kit semi auto end point 237 uric acid kit semi auto 4x50 ml end point 238 liquid stable direct ldl cholesterol 3x10ml semi auto 239 serum creteninkinetic semi auoto 2x50ml 240 serum triglycerid liquid stable anz end point 5x10ml semi auto 241 hbsag kit card 25 card / kit 242 chikunguniya card test kit lgg+lgm 243 dengue card test 10 test 10 test kit lgg + lgm 244 hcv kit test card test 245 hiv kit card 246 hiv test card tridot flow through based 2 dot 247 ra factor kit lates / card 248 crp test kit ( latex?card ) 249 typhaid rapid card igg=igm s / s above 99% 250 malaria card antigen igg+igm pf / pv 251 malaria card antibody igg+igm pf / pv 252 vdrl ( syphlish ) test card 253 urine pregnancy test card 254 strip for albumin urine and suger 100 strip / bottle 255 urin strip multipara 256 urine strip for ketone 100 strip / bottle 257 blood grouping anti sera a monoclonal 258 blood grouping anti sera b monoclonal 259 blood grouping anti sera d monoclonal 260 widal test kit slide test 261 rbcdiluting fluid 500 ml 262 wbc diluting fluid 500ml 263 edta solutions 500ml 264 h2so4 acid 20% 500 ml 265 h2so4 acid ( concentrated ) 266 hcl n / 10 500 ml 267 g6 pd deficiency test kit 268 acetone detection kit 269 absorbable gelatine sponge ip 66 80mm x 50mm x 10mm 270 barium choliride 10% 271 bile pigment kit 25ml 272 cyanemeth solution fot hb 5 litre 273 distill water 5 ltr. for pathology use 274 emersion oil 275 field stain a 276 field stain b 277 fouchets reagent 278 french chalk powder, 400 gm packet 279 geatian violet ( gram stain ) 100 ml 280 gram iodine ( gram stain ) 125ml 281 haemoglobin colour scale with paper 282 hypochioride solution 4% 283 leishman stain 500 ml 284 lence cleaning solution 285 liquid soap 500 ml 286 liquid stable biochemistry callibrator 6x3 ml 287 lithium electrodes each 288 m.t.test 5tu, 10 tu 5 ml 289 mantoux ppd test 1 tu 290 mantoux ppd test 2 tu 291 mantoux ppd test 5 tu 292 methyl blue for ( z n ) 125ml 293 p.h.paper 294 platelett diluting fluid 100 ml 295 potassium kit 296 sidar wood oil 25 ml 297 seman diluting fluid 100 ml 298 seman analysis fluid 299 sodium citrate 3.8% 500ml 300 sodium nitreprosied 500 gram 301 sodium hypochloride concentrat 4% 302 autopipette stand plastic 303 autopipette multiple dispenser 304 beaker 1 lit. plastic 305 beaker 100 ml plastic 306 beaker 2 lit. plastic 307 beaker 250 ml plastic 308 beaker 500 ml plastic 309 beaker 1 lit. glass 310 beaker 100 ml glass 311 beaker 2 lit. glass 312 beaker 250 ml glass 313 beaker 500 ml glass 314 bilirubin cappilary heprinised vitrex 315 bottle brown glass 250ml 316 blood bag 100 ml 317 blood bag 350 ml 318 chloride electrode each 319 flask brown glass 250 ml 320 flask brown glass 1000 ml 321 burrete 25cc 322 burrete stop cok 323 broom stick 8 324 bunsan burner each 325 capiliary tube ( ctbt ) 326 conicalflask 500 ml 327 cover slip squre 22*40mm 328 cover slip squre 22*50mm 329 dreyers tube ( for widal test ) 330 dropping bottle 125cc plastic 331 dropping bottle 250cc plastic 332 disposable dropper 5 ml 333 disposable dropper 500 ml 334 esr tube ( wintrobe tube ) 335 esr tube stand ( wintrobe ) 336 falcon tube 50ml sterilized 337 felix tube ( for widal test 338 filter papers; qualitative 18.5 cm dia; pore size, 20 25 μ; 339 filter paper 8 x 10 rectangular sheet 340 glass funnel 3 341 glass funnel 6 342 glass petridish 3 inch 343 glass petridish 4 inch 344 glass rod for staining 345 glass slide 75*25 mm 346 hemoglobin pipette 347 hemoglobin tube 348 hemoglobin tube ( round ) 349 litmus paper blue / red pack each 350 measuring cylinder 100ml glass 351 measuring cylinder 250ml glass 352 measuring cylinder 500ml glass 353 measuring cylinder 50ml glass 354 micro centrifuge tube 355 pasteur pippet glass 356 pilot tube blood bank 100 piece 357 pipette graduated 01ml 358 pipette graduated 02ml 359 pipette graduated 05ml 360 pipette graduated 10ml 361 pricking needle blood lancet 362 reagent bottle 250cc plastic 363 reagent bottle 500cc plastic 364 ria vial with screw cap, size: 12x75mm, polypropylene. 365 serum test tube stand 366 serum tube 367 test tube 12*100mm. 368 test tube 15*125 369 test tube 15*150mm 370 test tube holder 371 test tube stant for 12 hole plastic 372 test tube stant for 18 hole plastic 373 test tube brush small 374 test tube brush big 375 wash bottle 100 ml plastic 376 wash bottle 50 ml plastic 377 drying rach for slide ( for 50 100 slide ) 378 thermacol box ( od18.5x12.5x13 cm / id 379 permanet marker ( blue, black, red ) 380 smear transporting box plastic 381 smear transporting box wooden 382 neubar chamber 383 glass slide staining rack 384 test tube stand plactic 18 to 24 hole 385 urine container with safety lock 40 ml sterile 386 slide holder metal 387 basin enamal 40 cm diameter 388 bowl enamal 20 cm diameter 389 glass jar narrow mouth with rubber stoper 30 ltr 390 steaker adhesiv label 391 tranparent aprin 392 biohazar label 3x2 393 calory meter reading tube 394 cover slip 18x18mm 10 gm 395 cover slip 22x22 mm 10gm 396 filter paper large sheet 397 edta vail with safety cap 398 glass beekar 100 ml 399 glass marking white each 400 glass micro slide 401 glass test tube 3 without edge 402 glass test tube 3 with edge 403 glass test tube 4 with edge 404 glass test tube with edge 405 glass test tube 5 with edge 406 glass test tube 6 without edge 407 glass test tube 6 with edge 408 hb pippet ( superior ) gdrjarman 409 hb reading tube 410 laboratory dropper 1 ml 411 laboratory dropper 3 ml 412 micro glass coverslim 1x20 pack 413 micropore 1.5 414 n 95 mask 415 pilot tube with cap 5 ml 416 puscher pippet dryer each 417 rubber tips each 418 slide box ( 50 slide ) 419 slide stand 1x4 420 slider forcep each 421 sprit lamp 422 sputum cups 50 ml 423 staining rod alluminium each 424 sterelie container each 5 ml plastic 425 sterelise swab tubes each 426 sterelise swab ( alcoholic ) 427 sterelise culture tube each 428 test tubes ( medium 12x100 size ) 429 test tube ( small 12x75 size ) 430 tips for auto pippertes 2 100 micro liters 431 tips for auto pippetes 200 1000 micro liters 432 tissue roll cotton 200 grams 433 variable auto pippets 10 to 100 micro liters 434 variable auto pippets 5 to 50 micro liters 435 variable auto pippets 100 to 1000 micro liters 436 glucometer strips sd check 437 glucometer strips dr.morpon 438 glucometer strips acusure 439 glucometer strips nipro 440 latex free tourniquet, size : width 1 inch x length 18 inch 441 potassium electrode each 442 septum each 443 sodium electrode each 444 urine culture pot 30 ml 445 storage vials with screw cap polypropylene 2 ml 446 basic fuchin powder 85% 88% ( to calculate the requirement of basic fuschin 447 methylated sprit ethanol denetured + 5 % isopropyle alchohol+5% methanol mol structure: c2h5oh mol.wt. 46.07 purity 90 % 448 methylene blue powder methylionine chloride, structure: c16h18ci3s, mol.wt. 319.9, dye contain: sold be available on the container approximately 82% 449 pottasium dichromate chemical formula k2cr207, formula wt: minimum assay 99.5% 450 phenolic compounds cotaining disinfactants houshold disinfactant, containing phenolic compounds such monochlorophenol, coaltar acid, oils & emulsifiers etc. the a 451 sulphuric acid formula wt 98.08 specific gravity 1:84 minimum assay 98% 452 malachite green hydrochloride, structure:c23h25cin2, molecular wt=364.9, colour:green, dye 453 methyl blue methylene thionine chloride, chem.structure:c16h18cin3s, molecular wt 319.9, dye content approx 82% ( dye content must be mentioned 454 auramine c17h22c1n3, mol. wt. 303.84 455 hydrochloric acid concentrated hcl, mol.wt.: 36.46 specific gravity 1.18 456 pottasium permagnete kmno4 formula wt.158 457 liquid parafin ( heavy grade ) refractive index of 1.48 itshould be colourless, odorless, transparent, free from fluorescence in day light with relative dencity of 0.2 458 sodium citrate trisodium citrate dihydrate, ar grade chemical structure: na3c6h5o7, 2h, o, mol.wt. ( fw ) :294.10 459 pottasium phosphate pottasium dihydrogen ortho phosphate kh2po4, mol.wt. 136.1, minimum assay:99% 460 magnesium sulphate mgso4, 7h2o, mol.wt.246.48, purity: 99.5% 461 magnesium citrate tribasic, c12h10mg3014.9h2o mol.wt. 613.28 462 l asaragine monohydrite c4h8n23.h2o mol.wt. 150.14 463 glyserol formula: ch2ohchohch2oh mol.wt.92.1, purity:99.5 % 464 sodium hydroxide pellet formula: naoh, wt. 40 minimum assay:98% 465 cetyl pyridinium chloride structure: c21h38c1n. h2o / 358 466 sodium chloride nacl mol.wt. 58.44 minimum assay;99.9 467 dihydrostreptomycin sesquisulphate sigma d 7253 468 isonicotinic acid hidrazyde sigma i 3377 469 refampcin sigma r 3501 470 ethambutol dihydrochloride sigma e 4630 471 pnb para nitro benzonic acid formukla wt. 472 filter paper 1, 12.5 cms diameter 4 filtering carbol fuschin using a small funnel of 10 cm maximum diameter, smooth on one 473 diamond mark 6 holder with artificial diamond ( hard stone ) embedded at 1 and with screw cap to mark one microscope glass slide 474 carbolic acid: phenol structure: c6h5oh mol.wt. 94.11 melting point: 40 degree centegrate purity 95 %, please note: the critical concentation of phenol in carbol fuschin is 5%, phenol is highly corosive, handle with extreme care 475 lens paper soft microscope lens cleaning tissue 4x6 booklet, each booklet containing 100 sheet 476 phenyl 40 % 477 ethanol 100 % 478 thermacol box 8x16 479 ppt vials ( 2tu ) 480 stop watch 481 stain stand 482 disposable ecg electrode packet of 100 483 e.c.g. gelly 484 ecg paper ( wax coated ) 50mmx30mtrs 485 ecg paper ( chemical coated ) 50mmx20mtrs 486 ecg paper computerizes triple channel chemical 487 ecg roll 50mmx30mtr 488 radiation protection device 6x15 489 radiation protection device 10x12 490 sonogarphy gelly 491 thermal printing paper roll 492 usg paper roll 493 usg jelly 494 x ray caste size 10x12 495 x ray caste size 12x12 496 x ray caste size 12x15 497 x ray caste size 8x10 498 x ray casset size 6.5x8.5 499 x ray casset with screen blue 6.5x8.5 intensifying 500 x ray casset with screen blue 8x10 intensifying 501 x ray casset with screen blue 10x12 intensifying 502 x ray casset with screen blue 12x15 intensifying 503 x ray casset with screen blue 12x15 intensifying 504 x ray film ways 505 x ray led cover sheet 506 chest stand bowl type 507 chest stand flowr type 508 x ray developing tank ss22 ltr 509 x ray developing tank ss13.5 ltr 510 x ray developing tank ss9.5 ltr 511 led apron medium 22x36 11 lbs ( thickness to lead equibalant 0.5 mm 512 led apron medium 24x38 11 lbs ( thickness to lead equibalant 0.5 mm 513 led protective varier 514 lead partition abc type ( 4x6 ) 515 lead gloves size 5 n0. 516 lead gloves size 7 n0. 517 x ray devolper 13.5 ltr 518 x ray film 10x12 519 x ray film12x15 520 x ray film12x12 521 x ray film 8x10 522 x ray film 6.5x8.5 523 x ray film digital 10x10 ( fuji ) 524 x ray film digital 11x14 ( fuji ) 525 x ray film digital 14x17 ( fuji ) 526 x ray film digital 8x10 ( fuji ) 527 x ray film digital 12x12 ( fuji ) 528 x ray film digital 12x15 ( fuji ) 529 x ray fixor 13.5 ltr 530 x ray fixor 9.5 ltr 531 x ray hangar 10x12 532 x ray hangar 12x12 533 x ray hangar 12x15 534 x ray hangar 8x10 535 x ray hangar 6.5x8.5 536 x ray intensifing screen 6.5x6.8 537 x ray intensifing screen 08x10 538 x ray intensifing screen10x10 539 x ray intensifing screen10x10 540 x ray intensifing screen12x15 541 x ray lead number0 9 542 x ray lead letterr&l symbol 543 x ray lead lettera z 544 x ray view box double 545 x ray view box single 546 ecg roll 108t / 6108t make bpl 547 ecg roll 6208t make bpl 548 ecgroll make gotiz twelve ( 12 ) chanel 549 ecgroll make gotiz six ( 6 ) chanel 550 ecgroll make gotiz three ( 3 ) chanel 551 ecgroll make gotiz single ( 1 ) chanel 552 hanger for dantel x ray 553 safe light for x ray dark room 554 size of film 10 inch x 12 inch digital x ray film ( dihl ( pack of 150 ) ) , film 555 auto dill solution ( erma ) 556 autolyse solution ( erma ) 557 auto clean solution ( erma ) 558 m 52 diff lyse ( bc 5000 ) 559 m 52 lh lyse ( bc 5000 ) 560 m 52 d diluent ( bc 5000 ) 561 probe cleaner ( bc 5000 ) 562 cbc paper roll 563 t3 i chromo analyzer 564 t4 ( nano scan reader ) 565 tsh nano scan reader 566 lugol solution 100 ml 567 potassium di chromate 568 na+ 569 k+ 570 prothrombin time 5 ml 571 a v blood lines with av pressure transducer ( acceptable for fitting to all standard dialyzers ) with side tubing ( for heparinization and av pressure monitoring ) ce and iso certificate essential with protector for all machines types and dialysers ( post pump tubing sets options medical grade clear tubing guarded access ports for reduced infection risks parts of superior quality, each ) , consumable 572 1.3 and 1.4 adult di lyzer 573 hemodialysis fluid for bicarb made ( part a 10 ltr +part b 500gm 2 / pkt ) , consumable [ 700254 ] 574 size of film 8 inch x 10 inch digital x ray film ( dihl ( pack of 150 ) ) , film 575 medicine plaster of paris powder ( medicine pop ) 576 size of film 14 inch x 17 inch digital x ray film ( dihl ( pack of 100 ) ) , film 577 torch igg 4 in 1 casset test kit 578 strips for autoclave sterlity testing ( steam indicator strips class1 ) 579 surgical mop 2 pc. 30 cm x 30 cm 580 laringoscope blade 00 no. 581 laringoscope blade 0 no. 582 laringoscope blade 1 no. 583 laringoscope bulb 584 nasal prong 0 no. 585 ambu bag 250 ml 586 ambu bag 500 ml 587 umblical catheter 588 hub cutter manual 589 hub cutter electric ( electric needle cutter ) 590 prolene mesh 7.6 cm x 15 cm 591 prolene mesh 15 cm x 15 cm 592 anatomical transparent mask size 0 593 anatomical transparent mask size 1 594 anatomical transparent mask size 2 595 anatomical transparent mask size 3 596 anatomical transparent mask size 4 597 anatomical transparent mask size 5 598 baiin circuit adult 599 baiin circuit pediatric jackson rees 600 magells forcep 601 stillitte adult 602 stillitte peadiatric 603 suction catheter disposable 604 airways size 0, 1, 2, 3, 4, 5 605 filter for oxygen concentrator 606 vein detector 607 c pap machine nasal prong size 0 608 c pap machine nasal prong size 1 609 c pap machine circuit 610 kellys pad disposable 611 sanitary pad 612 cidex solution 613 glacial acetic acid 500 ml 614 lugols iodine solution 100 ml 615 dynaplast 10cm x 4 m 616 dynaplast 8cm x 4 m 617 thermometer digital 618 room thermometer 619 refridgerator thermometer 620 spatula ( pap smear ) 621 calf for bp apparatus adult 622 calf for bp apparatus adult 623 dial monitor for bp apparatus 624 bulb for bp apparatys 625 artery forcep 626 mosquito forcep 627 sponge holding forcep 628 bp handle 3no. 629 bp handle 4no. 630 allis forcep 631 mayo scissor curved 632 scissors straight 633 tooth forcep 634 debakey ( non tooth forcep ) 635 nibbler ( rongeur ) 636 periosteal elevator 637 curettes 638 self centering bone holding forcep 639 bone rasp 640 pliers 641 formalin chamber ( l size ) 642 oxygen hood ( pediatric ) 643 bone holding forcep 644 jumbo cutter 645 wire passer 646 lawmans clamp ( m size ) 647 t handle 648 carbon drill bit 649 cannulated drill 650 b.b silk ( 12 foils / pkt ) ( 3 / 8rcut needle 45mm length 76cm, size 2 / 0 ) ( consumable ) 651 b.b silk size 3 / 0 ( 12 foils / pkt ) ( 3 / 8cir rcut needle 26mm length 76 cm ) 652 b.b silk with 1 / 2 cir rb / cutting needle 30 mm length 75 cm non absorbable ( size 2 0, 12 foils / pkt ) 653 b.b silk with 1 / 2 cir rb needle 20 mm length at least 75 cm non absorbable surgical suture usp size 3 0 654 black braided silk with 1 / 2 cir cutting needle 30mm length 75 cm ( 1 / 0 12 foils / pkt ) 655 b.b silk with 1 / 2 cir rb needle size:4 / 0 20 mm ( length at least 75 cm, 12 foils per packet ) 656 catgut chromic with 1 / 2 cir rb needle 30 mm length 70cm no. 1 0, 12 foils per packet ( needle 30 mm length 70cm no. 1 0 657 catgut chromic with 1 / 2 cir cutting needle 12mm ( length 70cm no.3 0, 12 foils per pakt ) 658 catgut chromic with 1 / 2 cir rb needle 40 mm length 75cm no. 2 consumable ( each ) 659 chromic catgut suture ( 12 foils / pkt ) ( 3 / 8 cir r cutting needle 19 mm needle, suture length 76 cm size 4 / 0 660 polyglactin 30 mm 1 / 2 circle round body 90 cm size 1 / 0 ( 12 foils / pkt ) 661 polyglycolic acid absorbable surgical suture ( 12 foils / pkt ) ( 1 / 2 cir rb needle 20 mm, length 70 cm size 3 / 0 ) 662 polyglactin 30 mm 1 / 2 circle round body 90 cm size 2 / 0 ( 12 foils / pkt ) 663 polyglactin 30 mm 1 / 2 circle round body 90 cm size 3 / 0 ( 12 foils / pkt ) 664 polyglycolic acid absorbable surgical suture ( 12 foils / pkt ) ( 1 / 2 cir rb needle 40 mm, length 90 cm size 2 / 0 ) 665 baby diaper 666 infusion connecting tube 6 inch 667 infusion connecting tube 1.5 inch...

Directorate Of Medical Education - Madhya Pradesh

32061822 tender for purchase of chemical and reagent for mdru dep tender for purchase of chemical and reagent for mdru dep , supply of chemicals and reagents for mdru , ammonium chloride 250gm , potassium bi carbonate 250gm , sodium chloride 250gm , tris hcl 250gm , sds 250gm , saturated phenol 500ml , chloroform 500ml , sodium acetate 250gm , isoamyle alcohol 500ml , glacial acetic acid 500ml , molecular biology grade agarose powder 250gm , bromophenol blue dye 2ml , ethidium bromide 5ml , molecular weight ( dna ladder ) 100bp & 1kb 50ug , molecular weight ( dna ladder ) 50bp 50ug , molecular weight ( dna ladder ) 25bp 50ug , taq polymerase 5000unit , amplitaq gold dna polymerase master mix 500 unit , mgcl2 100 ul , dntp mix 100 ul , dnase 100 unit , rnase 100 unit , proteinase k 100 unit , triss 250gm , edta 250gm , boric acid 250gm , teepol 5 liter , xylene cynol 5 ml , dmso 500 ml , mnl i 500 unit , bcli 1500 unit , hpych4v 100 unit , hpych4iii 250 unit , sau96i 500 unit , sfci 200 unit , bcci 500 unit , scrfi 500 unit , afliii 250 unit , scai 500 unit , avai 500 unit , bsmi 250 unit , tspri 500 unit , mboii 300 unit , bsh1236i 500 unit , banii 1000 unit , mph1103i 500 unit , dde i 500 unit , bsmb i 200 unit , afa i 500 unit , bal i 250 unit , fspi 500 unit , primers 5 od , fmr1 set 1 – f5 tcaggcgctcagctccgtttcggtttca 3 5 od , r5 5 aagcgccattggagccccgcacttcc 3 5 od , mecp2 exon 1 set 1 f5 gttatgtctttagtctttgg–3´ r5 tgtgtttatcttcaaaatgt–3´ 5 od , exon 2set 1 f5 cctgcctctgctcacttgtt–3´ r5 ggggtcatcatacatgggtc–3´ 5 od , exon 2set 2 f5 agcccgtgcagccatcagcc–3´ r5 gttccccccgaccccaccct–3´ 5 od , exon 3 set 1 – f5 tttgtcagagcgttgtcacc–3´ r5 cttcccaggacttttctcca–3´ 5 od , exon 3 set 2 f5 aaccacctaagaagcccaaa–3´ r5 ctgcacagatcggatagaagac–3´ 5 od , exon 3 set 3 f5 ggcaggaagcgaaaagctgag–3´, r5 tgagtggtggtgatggtggtgg–3´ 5 od , exon 3 set 4 – f5 5´–tggtgaagcccctgctggt–3´ r5 ctccctcccctcggtgtttg–3´ 5 od , exon 3 set 5 f5ggagaagatgcccagaggag–3´ r5 cggtaagaaaaacatccccaa–3´ 5 od , exon3 ( l100v ) f5 aaccacctaagaagcccaaa 3 r5 gcttaagcttccgtgtccagccttcaggta 3 5 od , putative promoter and exon 1. f5 gggtgcaatgaaacgctta 3 r5 tttaccacagccctctctcc 3 5 od , mc4r rs17782313 f 5 aagttctacctaccatgttcttgg 3 r 5 ttccccctgaagcttttcttgtcattttgat 3 5 od , fto rs9939609 f 5 aactggctcttgaatgaaataggattcaga 3 r5agagtaacagagactatccaagtgcagtac 3 5 od , adipoqrs2241766 – f5 tgtgtgtgtggggtctgtct 3 r 5 tgtgatgaaagaggccagaa 3 5 od , rs1501299 f5 ctacactgatataaactatatggag 3 r5 ccccaaatcacttcaggttg 3 5 od , pomcrs6232 f5 ttgtgcccttcatctgaaca 3 r5 tgtagcaactttggcatgga 3 5 od , rs155971 f5tatatgcagccaccaatcca 3 r5 aaaatgaagggagaagcacaaa 3 5 od , ppar g ( pro12ala ) f5gcc aat tcaagc cca gtc 3 r5gat atgttt gca gac agt gta tca gtg aaggaa tcg ctt tcc g 3 5 od , kcnj11 ( rs5219 ) f5 gactctgcagtgaggcccta 3’ r5 acgttgcagttgcctttctt 3’ 5 od , capn10 ( rs3792267 ) f5 cacgcttgctgtgaagtaatgc 3’ r5 tgattcc catggtctgtagcac 3’ 5 od , pik3ca set 1 forward 5’ ggagtatttcatgaaacaaatgaatgatgcg 3’ reverse 5’ gagctttcattttctcagttatctt 3’ 5 od , bat 25 set 1 f 5’ tcgcctccaagaatgtaagt 3’ r 5’ tctgcattttaactatggctc 3’ 5 od , bat 26 set 1 f5’ tgactacttttgacttcagcc 3’ r5’ aaccattcaacatttttaaccc 3’ 5 od , d2s123 set 1 f5’ aaacaggatgcctgcctttta 3’ r5’ gtttggactttccacctatgggac 3’ 5 od , d5s346 set 1 f 5’ actcactctagtgataaatcg 3 r5 agcagataagacagtattactagtt 3 5 od , d17s250 – set 1 f5’ ggaagaatcaaatagacaat 3’ r5’ gctggccatatatatatttaaacc 3’ 5 od , impdh2 set 1 f5 gtttctgcggtatcccaatc 3 r5 cgagcaagtccagcctat 3 5 od , bmp6 rs73719353 f5’ gctcctttgcacttcgctgt 3’ r5’ aggctctgctg agctcctac 3’ 5 od , bmp6 rs73719341 f 5’tgaacttcccattcccctct 3’ r5’ataaaattagcattgatcca 3’ 5 od , bmp6 rs73719318 f5’caggtgctgtgcaacttctt 3’ r 5’agagggcaccatggttgcct 3’ 5 od , bmp6 rs73381662 f 5’ ctgagattcaattaggccca 3’ r 5’taaagaacagcaaaagtctg 3’ 5 od , bmp6 rs73381650 f 5’cacataaagattgctgcatt 3’ r 5’tagtaatcctaaaaatggga 3’ 5 od , anxa2 rs7170178 f 5’ ttcacagcagttcaaaatac 3’ r 5’ ctgggtttccagagatggaa 3’ 5 od , anxa2 rs73435133 f 5’ gagtgcaaggtgctgaggat 3’ r 5’ gatttcagacagcccttgca 3’ 5 od , anxa2 rs73418020 f 5’ tctgagagtgaaaggtgcac 3’ r 5’ tcccatcccctgaatccctg 3’ anxa2 rs72746635 f 5’ cctgactcattgtcacatca 3’ r 5’ aagtggctttccactgccc 3’ 5 od , anxa2 rs73418025 f 5’ cttctcatcttactttt 3’ r 5’ agggaaggatacagaggaga 3’ 5 od , hsp 70 primer sequence 5 agcgt aacac cacca ttcc 3 ( forward ) 5 tggct cccac cctat ctc 3 ( reverse ) 5 od , the gapdh sequence forward primer 5 agc cac atc gct gag aca c 3, reverse primer 5 gcc caa tac gaccaa atcc 3. 5 od , tips i. 0.2 20 ?l tips pack size of 1000 each , tips ii. 20 200 ?l tips pack size of 1000 each , tips iii. 200 1000 ?l tips pack size of 1000 each , superscript ii rnase reverse transcriptase 10000 u ( 200u / ul ) , power sybrgreen pcr master mix 2.5 ml , power sybrgreen rt pcr reagent kit 5 ml , oligo ( dt ) 12 18 primer25 ?g , absolute ethanol 500 ml , pcr plates pack of 50 , sealing foil ( rt pcr / qpcr grade ) pack of 50 , filter tips pack size of 1000 psc. each , i. 0.2 20 ?l filter barrier tips , filter tips pack size of 1000 psc. each , ii. 20 200 ?l filter barrier tips , filter tips pack size of 1000 psc. each , iii. 200 1000 ?l filter barrier tips , mct variable tubes , i. 20 200?l tubes pack size of 1000 psc. , ii. 200 600 ?l tubes each , iii. 500 2000 ?l tubes , nitrile autodextorous gloves pack size of 1000 psc. , mctstands for variable tubes sizes pack size of 1000 psc. each , i. 20 200?l tubes stand , mctstands for variable tubes sizes pack size of 1000 psc. each , ii. 200 600 ?l tubes stand , mctstands for variable tubes sizes pack size of 1000 psc. each , iii. 500 2000 ?l tubes stand , filter tip boxes pack size of 1000 psc. each , i. 0.2 20 ?l filter barrier tip box , filter tip boxes pack size of 1000 psc. each , ii. 20 200 ?l filter barrier tip box , filter tip boxes pack size of 1000 psc. each , iii. 200 1000 ?l filter barrier tip box , rt pcr grade water 20 ml , tip discard box ( 1 2 liter capacity ) 10 each , graduated measuring cylinders 50, 100, 500, 1000ml 05each , graduated beakers50, 100, 500, 1000ml 05 each , flat bottom tube 5ml ( with screw cap ) 500 psc. , tube stand ( 15ml falcon, 5ml, 2ml, 0.5ml, 0.2ml mct ) pack size of 500 psc. , graduated conical flask 50, 100, 500, 1000ml pack size of 5 psc. each , edta blood collection tube 5ml 100 psc. , plain vial ( for clot activator ) 100psc. , fluoride vial 100 psc. , test tube 5, 10ml 100 psc. , slide+cover slips 50 psc. , tissue paper roll 10 psc. , fine tissue cloth roll 10 psc. , cotton 10 psc. , wash bottle / dropping bottle, 200ml, 500ml, 1ltr 5 psc. , funnels variable range 5 psc. , plastic bottle, 200, 500, 1000ml 5 psc. , syringe + needle 2ml, 5ml pack size of 100 psc. each , nitrile gloves; medium and large size pack size of 1000 psc. , dna isolation kit pack size for 100 reaction , rna isolation kit pack size for 100 reaction , total rna mini kit ( human skin tissue ) pack size for 100 reaction , human leptin elisa kit pack size for 96 reaction , human adiponectin elisa kit pack size for 96 reaction , human adipsin elisa kit pack size for 96 reaction , human resistin elisa kit pack size for 96 reaction , human iron elisa kit ( serum iron ) pack size for 96 reaction , human ferritin elisa kit ( serum / ferritin ) pack size for 96 reaction , thyroid estimation kit pack size for 96 reaction , chloroform 500 ml , phenol 500 ml , isoamyl alcohol 500 ml , hno3 500 ml , propionaldehyde pure ( 97% ) 500 ml , phthalic anhydride 500 ml , glacialacetic acid ar 500ml , hydrochloric acid ar 500 ml , sulfuric acid ar 500 ml , 2 amino ethanol 500 ml , pyridine ar 500 ml , ammonia solution ar 500 ml , ammonia chloride ar 500 ml , acetyl salicylic acid 500 ml , acetone ar 500 ml , anthranilic acid ar 500 ml , activated charcoal 500 ml , silica gel g 500ml , benzoicacid ar 500ml , sds 250 gm , cholin cleaner 500 ml , sterilium 500 ml , hand sanitizer 500 ml , hypo 4% 1000ml , floor cleaner phenyl 500 ml , serum separator vial 3 ml 100 psc. , labolene 1000 ml , cleaning mop 5 psc. , broom 5 psc. , ice maker machine for laboratory purpose 1 psc. , microwave gloves 2 pkt. , pcr mini cooler 03 psc. , brown paper for autoclaving 10 rolls , pipette 0.5 10ul, 02 20ul, 10 100ul, 20 200ul and 100 1000ul. 1 psc. each , horizontal gel apparatus: 18 – 20 cm ( length ) x 25 – 30 ( breadth ) x 5 7.5 cm ( height ) , 40 60 samples, multichannel pipette compatible combs and gel caste 1 psc. each , mini horizontal gel apparatus: 9 cm w x 11 cm l with grooves ( 8.7 cm l x 1.2 cm h ) on the side for gripping the gel tray. it should have two comb slots on the same tray area. buffer capacity should be 600 ml for the buffer tanks and optimum gel runs with a fill line indicator for buffer levels along the unit side 1 psc. each , multi size forceps lab set 01 pkt. , liquid nitrogen sample storage tanks 5 tanks ( 3, 5, 10, 20, 25 ltrs ) , liquid nitrogen 5ltrpkt. , liquid nitrogen sample handling gloves 5 sets of gloves , phosphate buffer saline 500 ml , formalin 500 ml , slide tray / rack pack of 2 psc. , paraffin wax ( 58 60c ) 250 gm , l mold pack of 2 psc. , tissue cassette steel pack of 2 psc. , electric tissue float bath ( thermostate ) 1 psc. , coupling jar pack of 2 psc. , staining rack pack of 2 psc. , whatman filter paper grade 1 & 2 pack size of 50 psc. , harri’s hematoxylin powder 50 gm , yellow eosin powder 50 gm , coverslip 18x18 ( microscopic ) 100 psc. , dpx mount 50 ml , xylene 250 ml , glycerol 100 ml , thymol crystals 250 gm , plastic boxes 5 boxes , steel / aluminium boxes 3 boxes , ammonia 250 ml , hot plate 1 psc. , methanol 250 ml. , mx35 premier microtome blade ( 34 / 80mm ) 50 blades 1 box , diamond pen ( histopathology use ) 1 pen , embedding mold and embedding ring 5 psc. , acrylamide / bis ar 500 gm , 10x tbe buffer 100 ml , urea 100 ml , ammonium persulfate 100 ml , temed 100 ml , 4’, 6 diamidino 2 phenylindole 100ug , human pai 1 elisa kit pack size of 96 reactions , diethyl pyrocorbonate 5 ml , pbs 500ml , mortar and pestle homogenizers...

Government College - Madhya Pradesh

31937159 rate contract for medical items rate contract for medical items , items , hbsagcard 50 , hiv card 50 , urine for albumin / sugar 100 , urine for pregnancy stip and card 50 , malaria antigen pf / pv 50 , urine strip for 10 para ( laura ) 100 , urine strip for 5 para 100 , syphlis card for vdrl 50 , rapidaso ( latex slide test ) 20 , rapid crp ( latex slide test ) 20 , rapid ra ( latex slide test ) 20 , rapid widal ( o, h, ah, bh ) slide test 4*5ml , widal ( o, h, ah, bh ) test tube method 4x50ml , blood group kit ( antisera ) 3*10ml , glucose ( god pod ) 4x50ml , cholesterol ( chod pod mathod ) 4x25ml , direct hdl cholesterol 2 x 24 / 2 x 8 ml , triglycerides ( gpo pap 4x25ml , bilirubin ( t&d ) ( modified jendrassik method ) 4x50ml , sgot ( ast ) kinetic 5*10ml , sgpt ( alt ) kinetic 5*10ml , alkaline phosphatase ( pnpp ) kinetic 3*10ml , uric acid ( uricase ) 5x5ml , urea ( ned kinetic ) 4 x 20 / 4 x 5ml , creatinine fk ( kinetic ) 2 x 25 / 2 x 25ml , ra ( quantitative immune turbid metric 50ml , aso ( quantitative ) 50ml , calcium ( ocpc ) 1x50ml , crp ( rapid quantitativetest finecare ) 25 test , crp ( quantitative ) 2 x 20 / 2 x 5ml , hba1c ( rapid quantitativetest finecare ) 25 test , electrolyte ( na, k, cl ) medica , electrolyte internal filling solution medica regent pack , electrolyte daily cleaningsolution medica regent pack , electrolyte easily level control medica regent pack , sodium hypochlorite 5 lt , diluent ( 20 liter ) mindraym 30 d , rinse cleaner ( 20 liter ) mindray m 30 r , lyse ( 500ml ) mindray m 30 cfl , probe cleaner ( 17ml ) mindray , quality control ( 17ml ) mindray , vitamin d ( rapid quantitativetest finecare ) 25 test , psa ( rapid quantitativetest finecare ) 25 test , ca 125 ( elisa ) 96 test , vitamin b12 ( elisa ) 96 test , lh ( elisa ) 96 test , fsh ( elisa ) 96 test , prl ( elisa ) 96 test , hbsag ( elisa ) 96 test , ferritin ( elisa ) 96 test , t3 ( rapid quantitativetest finecare ) 25 test , t4 ( rapid quantitativetest finecare ) 25 test , tsh ( rapid quantitativetest finecare ) 25 test , il 6 ( rapid quantitativetest finecare ) 25 test , d dimer ( rapid quantitativetest finecare ) 25 test , t3 ( elisa ) 96 test , t4 ( elisa ) 96 test , tsh ( elisa ) 96 test 96 test , isotonac ( nihon koden ) 18 lt , cleanac ( nihon koden ) 5 ltr , cleanac 3 ( nihon koden ) 2 ltr , hemolynac 3n 500ml , bariumchloride 10% w / v 500ml , benadictsreagent 5lt , fouchet’s reagent 250ml , drabkins solution with standard ( for hb ) 5000ml , glacial acetic acid 500ml , edta 5% w / v 500ml , sulfuric acid con. 500ml , field stain a 500ml , field stain b 500ml , hydrochloric acid n / 10 500ml , immersion oil ( microscopy grade ) dropping bottle 30ml , immersion oil ( microscopy grade ) dropping bottle 25 ml , wbc diluting fluid 500ml , rbc diluting fluid 500ml , reticulocyte counting fluid ( biolab ) 25 ml , semen diluting fluid 100ml , formalin 5 lt , formalin 30lt , fructose 100ml , acetone 250 test , leishman stain with buffer 250ml , sulphur powder 500g , liquor ammonia solution 500gm , sodium nitroproside 100gm , carbol fuchsin ( zn strong ) 500ml , meth line blue 500ml , xyline 2.5ltr , needle 23, 24 1x100nos , sprit 4.5 ltr ( methy ) , distilled water 5ltr , paps smear staining , slide stand alu , esr niddle , micropipete stand , hemocytometr , glucometre dr morphen , glucometer strips 1x50nos dr morphen , micropipette fix volume , micropipette variable volume 0.5 5ul , micropipette variable volume 5 50ul , micropipette variable volume 10 100ul , micropipette variable volume 20 200ul , micropipette variable volume 100 1000ul , incubator ( inner chamber ss digital with fan ) 14x14x14 , water wath ( digital ) 10x12x7 , hemoglobin meter , urinometer , slide box , pipette glass 2.0ml , pipette glass 5.0ml , pipette glass 0.2ml , pipette glass 0.1ml , pipette glass 10*75mm , pipette glass 10*75mm , test tube without rim glass 12*100mm , test tube without rim plastic 1x100nos , test tube without rim 1x100nos , test tube without rim 1x100nos , reagent bottle , reagent bottle 12 inch , plastic droper , glass rod , rbc pipette 100 , wbc pipette 10gm , capillary tube 1x100nos , cover slip 18, or 22mm 1x20 nos pack , wintrobe tube for esr , test tube cleaning brush , pipette bulb , test tube holder , tourniquet , citrate vail , edta k3 vail , fluoridevail , plain vail ( activator ) , ria vail 100 , chattels forceps straight ss , urine container sterile 30 ml 1 pack , micropipete tips 10 100 u and 100 1000 u, 1 pack , tissue paper , filterpaper 100 pack , insulin syringe , polythene gloves 100 , surgical gloves 6; no 7 n0 , non dispo gloves 100 , postmortem gloves , syringe 50ml , syringe , 20 ml , syringe 10 ml , syringe , 5ml , syringe 2ml , ecg gelly 250ml , usg gelly 250ml , cotton roll 500 g , usg roll upp 1105 in ( 110mmx20m ) thirmal print media ) , dental x ray film ( 1.0.p.a.25x33mm ) , gloves powder 500gm , povidione solution 500 ml , povidione ointment 15gm , savlon 1ltr , dettol 1ltr., , dettol500ml, , dettol 100ml , hydrogen peroxide 450 ml 30ml , lignocaine gelly 2% , lignocaine inj with adrenol 2% 30ml , lignocaine spray 10 % , lignocaine inj 2% , lignocaine inj 4% , lignocaine tropical vail 4% , tinbenzone 100ml , pure hand , bandage ( antiseptic ) , micropore 2inch , micropore 4inch , n. saline, dns, d5, d10 , scalpvan set , berbar thred 20 no. , enima pot , enima pipe with nozal , hot water beg , rubber catheter red , bandage than , roll bandage 0.5x 0.5, 7 , roll bandage 5x 5 , roll bandage 10x5 , ecg roll ( 12 channel gotiz ) , mechontosh , head cap disposable 100 , sanityzer 5lt , x ray film digital fuzi 14x17 , x ray film digital duzi 8 x 10 , nylon silk suture4.0 , 31inch*72inch color white non woven fabric for single use bedsheet , weighing machine adult , weighing machine child , weighing machine digital , stethoscope adult , stethoscope child , bp instrument led mercury , glucometer strips 1x50nos dmorphen , formalin4.5 lt , pulse oximeter , non contact thermometer , face mask disposable 3 layar , n 95 face mask , occult blood card , alkaline phosphatase kit ( alp ) , alanine aminotransferase kit ( alt ) , ? amylase kit ( amy ) , aspartate aminotransferase kit ( ast ) , bilirubin direct kit , bilirubin direct kit , bilirubin total kit , bilirubin total kit , calcium kit , c reactive protein kit ( 1*40ml+1*10ml ) , gamma–glutamyltransferase kit ;ggt , glucose kit ( 4*40ml+2*20ml ) , hdl cholesterol kit ( 1*40ml+1*14ml ) , ldl cholesterol kit ( 1*40ml+1*14ml ) , total cholesterol kit ( 4*40ml ) , triglycerides kit ( 4*40ml ) , uric acid kit ( 4*40ml+2*20ml ) , urea kit ( 4*35ml+2*18ml ) , creatine...

Directorate Of Health Services - Madhya Pradesh

31881514 materials surgical, lab regents, consumables materials surgicals, lab regents, consumables 1.00 lab test kits and reagent 1.01 alkaline phosphatase ( alp ) dea 300 ml ( model ba 400 system ( mfg bybio system ) ) , consumable 1.00 each 1.02 alkaline phosphatase kit ( kinetic ) 10x2.2ml 44 test / kit consumable 1.00 each 1.03 anti abd grouping serum 3x10ml consumable 1.00 each 1.04 anti a sera igm ( 10 vial ) , consumable 1.00 each 1.05 anti b sera igm ( 10 vial ) , consumable 1.00 each 1.06 anti d sera igg+igm 10ml vial ( each ) , consumable 1.00 each 1.07 anti d ( polyvalent ) ( 1x10 ml ) , consumable 1.00 each 1.08 anti h sera 1.00 each 1.09 auto pippets fixed volume 10 micro liters each 1.00 each 1.10 auto pippets fixed volume 1000 micro liters each 1.00 each 1.11 auto pippets fixed volume 20 micro liters each 1.00 each 1.12 benedicts qualitative reagent ( 1x5 lit ) , consumable 1.00 each 1.13 bilirubin ( direct ) as 300 ml ( model ba 400 system ( mfg bybio system ) ) , consumable 1.00 each 1.14 bilirubin ( total ) 600 ml ( model ba 400 system ( mfg bybio system ) ) , consumable 1.00 each 1.15 bilirubin caoillary heparinised vitrex ( one packet contain 100 capillary ) , consumable 1.00 each 1.16 bilirubin kit ( colorimeter semi auto ) 4x60 ml 480 test / kit consumable 1.00 each 1.17 bilirubin standard 1x5 ml ( model ba 400 system ( mfg bybio system ) ) , consumable 1.00 each 1.18 blood agar powder ( 500 grm ) , consumable 1.00 each 1.19 blood bag 100ml 1.00 each 1.20 blood bag 350ml 1.00 each 1.21 blood gluose ( god / pod ) semi auto end point ( 1000 ml ) , consumable 1.00 each 1.22 blood grouping anti sera a monoclonal : antisera should be transparent with more than one year shelf life at 2 6 c , it should give +++ agglutination at 1.256 dilution in 3 4 sec with a positive cells 10 ml 1.00 each 1.23 blood grouping anti sera a monoclonal ( 10 ml vial ( mfg tulip diagnostics ) ) , consumable 1.00 each 1.24 blood grouping anti sera b monoclonal : antisera should be transparent with more than one year shelf life at 2 6 c , it should give +++ agglutination at 1.256 dilution in 3 4 sec with b positive cells 10 ml 1.00 each 1.25 blood grouping anti sera b monoclonal ( 10 ml vial ( mfg tulip diagnostics ) ) , consumable 1.00 each 1.26 blood grouping anti sera d monoclonal : antisera should be transparent with more than one year shelf life at 2 6 c, it should give +++ agglutination at 1.256 dilution in 3 4 sec with d antigen positive cells. 10ml vail ( eryclone anti d igm ) 1.00 each 1.27 blood grouping anti sera d monoclonal ( 10 ml vial ( mfg tulip diagnostics ) ) , consumable 1.00 each 1.28 blood urea ( bun ) uv ( 1000 ml ) , consumable 1.00 each 1.29 blood urea reagent kit ( 200ml ( 2x100ml ) ) , consumable 1.00 each 1.30 blood urea reagent kit ( 200ml ( 2x100ml ) ) , consumable 1.00 each 1.31 blood urea ( arba ) , consumable 1.00 each 1.32 capillary tube 100 pieces consumable 1.00 each 1.33 cholesterol hdl direct 160 ml ( model ba 400 system ( mfg bybio system ) ) , consumable 1.00 each 1.34 cholesterol kit end point enzymatic kit 50 test / kit 1.00 each 1.35 cholesterol kit end point enzymatic kit 5x20ml 200 test / kit 1.00 each 1.36 conc hcl ( 1x500 ml = 500 ml ) , consumable 1.00 each 1.37 cover slip 18 x 18 mm 10gm 1.00 each 1.38 cover slip with isi marked size:18x18mm ( + / 1.00mm ) , thikness 0.13.. to 0.17mm ( pkt of 50 pieces ) , consumable 1.00 each 1.39 creatine calorimeter for semi auto kinetica 4x60ml 480 test kit 1.00 each 1.40 creatinin kit 1.00 each 1.41 crp kit 1x100 biolab qualitative ) 1.00 each 1.42 crp latex slide per test 1.00 each 1.43 crp test kit ( latex / card ) ( 25 test / kit ) 1.00 each page 11 of 22 1.44 crp test kit ( latex / card ) , kit of 25 tests ( mfg pathogyme diagnostics ) ( 25 test / kit ) , consumable 1.00 each 1.45 dengu card antigen ( 25 card / pkt ) , consumable 1.00 each 1.46 dengue card test 100 test kit 1.00 each 1.47 developer powder ( 22.5 ltr ) 1.00 each 1.48 diagnostic strips for urine sugar / albmin packing: 100 strip / pkt 1.00 each 1.49 dialysis starting kit disposable:a ) sterile tray with top ( disposable ) , size not less than 30x30cm b ) sterile drape size not less than 45x45 cm 1no c ) cotton ball 6 no d ) cotton gauze pieces 1 1.00 each 1.50 digital x ray film 10x12 ( 150 films / pkt ) 1.00 each 1.51 digital x ray film 11x14 ( 150 films / pkt ) 1.00 each 1.52 digital x ray film 8x10 ( 150 films / pkt ) 1.00 each 1.53 echo jelly 20ml bottle 1.00 each 1.54 echo jelly 250 ml ( mfg by precious life care ) , bottle 1.00 each 1.55 edta k3 vial each 1.00 each 1.56 edta solutions k3 ( 500 ml ) 1.00 each 1.57 edta solutions k3 ( mfg by himedia ) ( 500 ml bottle ) , consumable 1.00 each 1.58 field stain a 500ml 1.00 each 1.59 field stain b 500ml 1.00 each 1.60 filter paper sheet ( ( whatmann no 01 ) sheets ) , consumable 1.00 each 1.61 fixer: it shall be powder fixer to produce clean radiographs available in pack size size: 13.5 ltr 1.00 each 1.62 fixer: it shall be powder fixer to produce clean radiographs available in pack size size: 9 ltr 1.00 each 1.63 formaldehyde 40% ( conc. formaline ) ( 1 x 30 lit ) , consumable 1.00 each 1.64 gel matrix group card 1.00 each 1.65 gel matrix cross match card 1.00 each 1.66 g6pd deficiency test kit ( mfg pathogyme diagnostics ) ( 10 test / kit ) , consumable 1.00 each 1.67 glacial acetic acid ( 2.5 liter ) , consumable 1.00 each 1.68 glass slide 75mm x 25mm 1.1 mm 1.00 each 1.69 glass slide 75mm x 25mm 1.35 mm 1.00 each 1.70 glass slide with isi mark at least 75mm x 25 mm thickness at least 1.1mm, detail specifications i with smooth edges, without any scrathtches. iiglazed glass.iii no visual or chromatic abbretions ( 50 slides / packet ) , consumable 1.00 each 1.71 glass test tube 12 x 100 ( medium size ) heavy quality 100 / pkt 1.00 each 1.72 glass test tube 12 x 75 ( small size ) heavy quality 100 / pkt 1.00 each 1.73 glass test tube 5 without edge 1.00 each 1.74 glucometer strip ( 1x100 ) 1.00 each 1.75 glucose kit ( god / pod ) ( 350ml ) , digonstic 1.00 each 1.76 h2so4 ( sulphuric acid ) ( 25% 500 ml bottle ) , consumable 1.00 each 1.77 hba ag elisa 96 kit 1x96 ( each ) , consumable 1.00 each 1.78 hba ag rapid card test ( each ) , consumable 1.00 each 1.79 hbs antigeng kit card ( pack of 10 card test with 10 dropper, 1 buffer solution, 10 pricking lancet and 10 alcohol swab ) , digonstic 1.00 each 1.80 hcl n / 10 ( 500 ml bottle ) 1.00 each 1.81 hcv elisa ( 96 test kit ) , consumable 1.00 each 1.82 hcv kit card test ( 25 test / kit ) , digonstic 1.00 each 1.83 heamoglobin colour scale book with special strip complete ( 1 x 200 ) , consumable 1.00 each 1.84 hematology cell counter reagents as per requirement of cell counter cleaning solution 100 ml 1.00 each 1.85 hemoglobin color scale ( starter kit ) components ( 1 ) color scale 01 / kit ( 2 ) test strip 1000 / kit ( 3 ) printed literature for method of use / kit ( 4 ) lancet 1000 / kit 1.00 each 1.86 hiv elisa kit ( hiv micro elisa ag+ab 4th generation ) ( 96 test kit ) , consumable 1.00 each 1.87 hiv kit card ( 25 test / kit ) 1.00 each 1.88 hydrogen peroxide ( conc. ) h2o2 ( 500 ml ) , consumable 1.00 each 1.89 k3 blood vaccutainer edta 100 tubes / pkt 1.00 each 1.90 leishman stain 500 ml 1.00 each 1.91 malaria antigen card pf / pv card ( as per nvbdcp guidelines ) ( 10 card, 10 dropper, 1 buffer solution ) 1.00 each page 12 of 22 1.92 malaria antigen, p vivax, p falciparum rapid diagnostics bivalentt test card ( as per gio nvbdcp specification ) pack of 10 card test with 10 dropper, 1 buffer solution, 10 pricking lancet, and 10 alcohol swab 1.00 each 1.93 malaria card ( antigen ) atleast 100 microbes / desi ltr. for both species 1.00 each 1.94 malaria pf / pv antigen card 1.00 each 1.95 malaria pf / pv rapid test 1.00 each 1.96 methyline blue ( 100 ml ) , solution 1.00 each 1.97 micro pipet 1000 fix and variable each 1.00 each 1.98 micropiptte 100 1000 1.00 each 1.99 microtips ( 2 200 ul ) 1x1000 ( each ) , consumable 1.00 each 1.100 n / 10 hcl 500ml 1.00 each 1.101 nebulization mask kit ( pediatrics ) 1.00 each 1.102 nebulization mask kit, mfg by life o line technologist ( pediatrics ) , consumable 1.00 each 1.103 nebulization mask kit ( adult ) 1.00 each 1.104 new born baby kit [ 4 piece set ] 1.00 each 1.105 pregnancy test card ( 10 card pack ( mfg oscar medicare pvt ltd ) ) , consumable 1.00 each 1.106 ra factor 50 test kit qualicative 1.00 each 1.107 ra factor rapid kit ( 25 test / kit ) 1: ) should be based on latex agglutination slide test. 2: ) qualitative and semiquantitative testing facility possible. 3: ) test speed must be less than 2 minutes 1.00 each 1.108 test tube 12 x 100 ( medicm size ) 100 / pkt 1.00 each 1.109 test tube 12 x 75 ( small size ) 100 / pkt ( 12 x 75 ( small size ) 100 / pkt ) , tube 1.00 each 1.110 test tube 15x125 1.00 each 1.111 tips for auto pipettes 2 to 100 micro litres 1000 / pkt ( 2 to 100 micro litres 1000 / pkt ) , each 1.00 each 1.112 tips for auto pipettes 200 to 1000 micro litres 500 / pkt ( 200 to 1000 micro litres 500 / pkt ) , each 1.00 each 1.113 tips for auto pippetes 10 to 100 micro litres 1.00 each 1.114 tissue paper roll ( each ) , consumable 1.00 each 1.115 tourniquet with belt ( good quality pairs ) , pairs 1.00 each 1.116 tourniquet with belt ( mfg by precious life care pvt ltd ) ( good quality pairs ) , consumable 1.00 each 1.117 typhoid card test kit ( for igg and igm antibody detection ) ( 25 test kit ) 1.00 each 1.118 typhoid test card. 1.00 each 1.119 umbical cord clamps plastic material ( box of 100 clamps ) ( mfg by precious life care ) , consumable 1.00 each 1.120 umbical cord clamps plastic material ( box of 100 clamps ) , consumable 1.00 each 1.121 urine albumin & suger 1.00 each 1.122 usg gel ( mfg precious life care pvt ltd ) ( 250 ml bottle ) , consumable 1.00 each 1.123 usg thermal paper 1.00 each 1.124 vdrl ( rpr ) 1x100 sd strip 1.00 each 1.125 vdrl kit ( strip ) ( mfg by alere ) ( 50 test / kit ) , consumable 1.00 each 1.126 vdrl kit ( strip ) ( 50 test / kit ) , consumable 1.00 each 1.127 widal 2x2 sera slide kit 1.00 each 1.128 widal 2x2 tube test kit 1.00 each 1.129 widal 4x5 ml 1.00 each 1.130 slide blue star 1.00 each 1.131 sputum cup with sticker 1.00 each 1.132 paraffin strip roll 1.00 each 1.133 zipper polybag 1.00 each 1.134 alluminium foil roll 1.00 each 1.135 hand wash liquid 1.00 each 1.136 falcon tube 1.00 each 1.137 thermacol box 1.00 each 1.138 gel pack 1.00 each 1.139 bamboo stick 1.00 each 1.140 tape roll 1.00 each 1.141 spirit lamp 1.00 each 2.00 disposible material page 13 of 22 2.01 adhesive plasters usp 7.5 cm x 10 mts / roll 1.00 each 2.02 adhesive plasters usp 7.5 cm x 5 mts / roll 1.00 each 2.03 adhesive roll 1 inch x 5 m / roll 1.00 each 2.04 baby oxygen mask set of all sizes 1.00 each 2.05 blood bag with acd / cpd solution ( disposable sterilised ) with needle ( 100 ml ) , bag 1.00 each 2.06 blood bag with acd / cpd solution ( disposable sterilised ) with needle ( 350 ml ) , bag 1.00 each 2.07 disposable appron 1.00 each 2.08 disposable cap 1.00 each 2.09 disposable examination gloves made of natural rubber latex, pre powdered, non streile medium 1.00 each 2.10 disposable examination gloves made of natural rubber latex, pre powdered, non streile small 1.00 each 2.11 disposable examination gloves made of natural rubber latex, pre powdered, non streile, conforming to is 15354:2003 and amendment thereof. size: large 1.00 each 2.12 disposable needles 22g consumable 1.00 each 2.13 disposable needles is 10654:2002 22g 1.00 each 2.14 disposable needles is 10654:2002 24g 1.00 each 2.15 disposable needles is 10654:2002 26 g ( ) , ne 2.16 disposable paper gloves size 7 inches consumable 1.00 each 2.17 disposable paper gloves size 7, 1 / 2 inches consumable 1.00 each 2.18 disposable plastic appron ( full size ) 1.00 each 2.19 disposable pricking lancet ( pkt of 200 units ) 1.00 each 2.20 disposable pricking lancet 100 units consumable 1.00 each 2.21 disposable scalp vein set size 20 no 1.00 each 2.22 disposable scalp vein set size 22 no 1.00 each 2.23 disposable sharp collection containers 1.5 l 1.00 each 2.24 disposable sharp collection containers 5 ltr 1.00 each 2.25 disposable sideport knife ( num ) , consumable 1.00 each 2.26 disposable sterile gloves size 6 inches consumable 1.00 each 2.27 disposable sterile gloves size 6, 1 / 2 inches consumable 1.00 each 2.28 disposable sterile gloves size 7 inches consumable 1.00 each 2.29 disposable sterile gloves size 7, 1 / 2 inches consumable 1.00 each 2.30 disposable sterile hypodermic syringe 10ml ( each ) , consumable 1.00 each 2.31 disposable suction catheter assorted covering all sizes 10, 12, 14, 16, 18 consumable 1.00 each 2.32 disposable suction catheter ( size 12 ) , consumable 1.00 each 2.33 disposable suction catheter ( size 14 ) , consumable 1.00 each 2.34 disposable surgeon cap ( box of 100 caps ) 1.00 each 2.35 disposable syringe ( for vitamin k inj ) ( 1ml with needle 26g ) , consumable 1.00 each 2.36 disposable syringe with needle ( 2ml each ) , syrings 1.00 each 2.37 disposable syringe with needle ( 3ml each ) , syrings 1.00 each 2.38 disposable syringe with needle ( 5ml each ) , needle 1.00 each 2.39 hub cutter non electric lockable safety portable box for disposal of hypodemic needles. consumable 1.00 each 2.40 kellys pad disposable 1.00 each 2.41 n 95 mask ( as per attached specification ) , consumable 1.00 each 2.42 oxygen mask adult ( standard size ) 1.00 each 2.43 oxygen mask paediatric ( standard size ) 1.00 each 2.44 plain disposable vial 3ml ( each ) , consumable 1.00 each 2.45 scalp vein set ( size 24g, disposable ) , consumable 1.00 each 2.46 three layer surgical mask 1.00 each 2.47 urine container 5ml disposable ( 50 per pkt ) 1.00 each 2.48 urine container size of the container shall be 30ml disposable ( 50 per pkt ) , consumable 1.00 each 3.00 x ray related 3.01 x ray film 10 x 12 50 sheets / pack 1.00 each 3.02 x ray film 12 x 12 50 sheets / pack 1.00 each 3.03 x ray film 12 x 15 50 sheets / pack 1.00 each page 14 of 22 4.00 catgut / b.b. silk 4.01 b.b silk ( 12 foils / pkt ) ( 3 / 8 rcut needle 45 mm length 76 cm, size 2 / 0 ) ) , consumable 1.00 each 4.02 b.b silk size 3 / 0 ( 12 foils / pkt ) ( 3 / 8cir rcut needle 26mm length 76 cm ) , needle 1.00 each 4.03 b.b silk with 1 / 2 cir rb needle 20 mm length 75 cm non absorbable surgical suture usp size 3 0, ( 12foils / pkt ) , needle 1.00 each 4.04 b.b silk with 1 / 2 cir rb needle size:1 / 0 20 mm length 75 cm non absorbable surgical sutures usp surgical material 1.00 each 4.05 b.b. silk 6 reels x 25 mts size:1 / 0 ( 6 reels is per box rate should be quoted for 6 reels ) , surgical material 1.00 each 4.06 black braided silk with 1 / 2 cir cd cutting needle 16 mm length 75 cm 3 / 0 ( 14 foils / pkt ) 1.00 each 4.07 black braided silk with 1 / 2 cir cutting needle 30mm length 75 cm ( 1 / 0 12 foils / pkt ) , consumable 1.00 each 4.08 black braided silk with 1 / 2 cir rb needle 20 mm length 75 cm 1 / 0 13 foils / pkt 1.00 each 4.09 black braided silk with 1 / 2 cir rb needle 30 mm length 75 cm 2 / 0 12 foils / pkt 1.00 each 4.10 catgut chromic size:2 / 0 length 150 cm 1.00 each 4.11 catgut chromic with 1 / 2 cir rb needle 30 mm length 70cm no. 1 0, 12 foils per packet 1.00 each 4.12 catgut chromic with 1 / 2 cir rb needle 40 mm length 75cm no. 1 consumable 1.00 each 4.13 catgut chromic with 1 / 2 cir rb needle 40 mm length 75cm no. 2 consumable ( each ) , consumable 1.00 each 4.14 chromic catgut ( 12 foils / pkt ) ( size:1 / 0 length 150 cm ) , consumable 1.00 each 4.15 chromic catgut , round body needle no. 1.0 1.00 each 4.16 chromic catgut monofilament with 1 / 4 circle reverse cutting needle 6 0 ( 12 / pkt ) 1.00 each 4.17 chromic catgut no 1.0 round dody, 40 mm 12 foils / pkt 1.00 each 4.18 chromic catgut suture ( 12 foils / pkt ) ( 3 / 8 cir r cutting needle 19 mm needle, suture length 76 cm size 4 / 0 ) , needle 1.00 each 4.19 foleys urinary catheter silkolatex 2 way sterile, non toxic size 10 1.00 each 4.20 foleys urinary catheter silkolatex 2 way sterile, non toxic size 10 1.00 each 4.21 non absorbable braided silk black 10mm 3 / 8 circle reverse cutting micro point ( 38 cm ) , consumable 1.00 each 4.22 non absorbable braided silk black ( 12 mm 3 / 8 circle reverse cutting micropoint 38 cm ) , consumable 1.00 each 4.23 silk no 1 cutting needle 1x12 ( 1x12 ) , consumable 1.00 each 4.24 suture mersilk 8 0 ( 12 foil ) 1.00 each 4.25 silver nitrate solution 1 ltr. 1.00 bottle 4.26 urine bag 2 ltr. 1.00 each 4.27 plaster of paris 4 10x5mtr 1.00 each 4.28 plaster of paris 6 15x 5mtr 1.00 each 4.29 cumb sera 1.00 each 4.30 albumin 1.00 each 4.31 laryngo scope bulb 1.00 each 4.32 auto clave quil 1.00 each 4.33 idetification tag 1.00 each 4.34 peadiatric drip set 1.00 each 4.35 dresing pad 1.00 each 4.36 endotracheal tube no. 6 1.00 each 4.37 endotracheal tube no. 2.5 to 5 ml. 1.00 each 4.38 dynaplast 10 cm. 1.00 each 4.39 sicklewive test kit 1.00 each 4.40 autoclave indicator 1.00 each 5.00 cotton and related, chadar, bedsheet 5.01 absorbent cotton roll 100 gm each consumable 1.00 each 5.02 absorbent cotton wool ip 500 grms ( each ) , consumable 1.00 each 5.03 cotton crape bandage 10cm x 4m ( box of 10 bandages ) 1.00 each 5.04 cotton crape bandage 15cm x 4m ( box of 10 bandages ) 1.00 each 5.05 cotton delivery belt 1.00 each 6.00 adhesive tape 6.01 adhesive tape 7.5cm x10 ( mtr / roll ) , consumable 1.00 each 6.02 cloth based surgical adhesive tape roll ( 1 inch x 5 mtr / roll ) , consumable 1.00 each page 15 of 22 6.03 paper adhesive microporous surgical tape 3 inch x 5 m / roll ( 10 roll / pkt ) ( 3 inch x 5 m / roll ( 10 roll / pkt ) ) , consumable 1.00 each 6.04 paper adhesive plaster microporous surgical tape 1 inch x 9 m / roll 1.00 each 6.05 paper adhesive plaster microporous surgical tape 2 inch x 5m / roll 1.00 each 6.06 paper adhesive plaster microporous surgical tape 4 inch x 9 m / roll 1.00 each 6.07 paper adhesive plaster microporous surgical tape 6 inch x 10 m / roll 1.00 each 6.08 paper adhesive plaster microporous surgical tape 6 inch x 5m / roll 1.00 each 6.09 umblical cotton tape length 75cm. 1.00 each 7.00 catheter 7.01 disposable suction catheter ( size 12 ) , consumable 1.00 each 7.02 disposable suction catheter ( size 14 ) , consumable 1.00 each 7.03 feeding tube ( catheter ) 10g 1.00 each 7.04 foleys catheter size 12 2 way ( 10 each ) , consumable 1.00 each 7.05 foleys catheter size 14 2 way 1.00 each 7.06 foleys catheter size 14 3 way 1.00 each 7.07 foleys catheter size 16 2 way ( 11 each ) , consumable 1.00 each 7.08 foleys catheter size 18 2 way 1.00 each 7.09 foleys catheter size 20 2 way ( 12 each ) , consumable 1.00 each 7.10 foleys catheter size 22 2 way ( 13 each ) , consumable 1.00 each 7.11 foleys catheter size 24 2 way ( 14 each ) , consumable 1.00 each 7.12 foleys urinary catheter 2 way size 8 1.00 each 7.13 infant feeding tube ( catheter ) size: 3g 1.00 each 7.14 infant feeding tube ( catheter ) size: 4g 1.00 each 7.15 infant feeding tube ( catheter ) size: 5g 1.00 each 7.16 infant feeding tube ( catheter ) size: 6g 1.00 each 8.00 blade 8.01 surgical blade isi marked, size 15 ( 100 per packet ) , surgical material 1.00 each 8.02 surgical blade isi marked, size 22 ( 100 / pkt ) , surgical material 1.00 each 8.03 surgical blade isi marked, size 23 ( 100 / pkt ) , surgical material 1.00 each 8.04 surgical blade isi marked, size 24 ( 100 / pkt ) , surgical material 1.00 each 8.05 surgical blade isi marked, size 25 ( 100 / pkt ) , surgical material 1.00 each 8.06 surgical blade, size 11 1.00 each 9.00 ecg 9.01 ecg jelly 250 gms 1.00 each 9.02 ecg paper ( chemical coated ) ( 80mmx 20 mtr each ) , consumable 1.00 each 9.03 ecg paper computerizesd triple channel 20m 1.00 each 9.04 ecg paper ( chemical coated ) 50mm x 20mm roll 1.00 each 9.05 ecg paper ( chemical coated ) 50mm x 30 mtr. roll 1.00 each 9.06 ecg paper ( wax coated ) heavy quality 50mm x 30 mtr / roll 1.00 each 9.07 ecg paper ( wax coated ) mfg by life o line technologist ( 50mm x 30 mtr, roll ) , consumable 1.00 each 9.08 ecg roll three channel 20m 1.00 each 9.09 ecg roll three channel mfg by life o line technologist ( 50 mm x 20 mtr ) , consumable 1.00 each 10.00 needle 10.01 absorable surgical suture rb needle size no 1 0, 30 mm length 70 cm , 12 foils per packet , polyglycolic acid ( pga ) 1.00 each 10.02 absorable surgical suture rb needle size no 1 , 30 mm length 70 cm , 12 foils per packet , polyglycolic acid ( pga ) 1.00 each 10.03 absorbable surgical suture braided polyglycolic acid 3 / 8 circle reverse cuttingg ( 12mm 45 cm spatulated needle ) , consumable 1.00 each 10.04 blood vessel introducers needles 16g, sterilized, set 1.00 each 10.05 chromic ( 12 foils / pkt ) ( 3 / 8 rb needle 30 mm, length 76 cm, size 2 / 0 ) , needle 1.00 each 10.06 chromic size 1, ( 12 foils / pkt ) ( 1 / 2 cir rb needle 40 mm, length 76 cm ) , needle 1.00 each 10.07 chromic size 1, 12 foils / pkt ( 1 / 2 cir rb needle 45 mm, length 100 cm ) , needle 1.00 each 10.08 insulin syringe / each ( graduation upto 100 units ) 30 g needle, 40 units / ml ( 30 g needle, 40 units / ml ) , syrings 1.00 each 10.09 intravenous set with airway and needle ( ( adult ) ) , surgical material 1.00 each 10.10 intravenous set with airway and needle ( children ) , surgical material 1.00 each page 16 of 22 10.11 spinal needle no. 23 1.00 each 10.12 sterile hypodermic syring with needle 10 ml 1.00 each 10.13 sterile hypodermic syring with needle 20 ml 1.00 each 10.14 sterile hypodermic syring with needle ( 5 ml ) , syrings 1.00 each 10.15 sterile hypodermic syringe with needle, mfg by ph health care pvt ltd ( 20 ml ) , consumable 1.00 each 10.16 vicryl no. 1 rb 1.00 each 10.17 vicryl no. 2.0 rb 1.00 each 11.00 iv cannula 11.01 cannula fixer set consumable 1.00 each 11.02 i.v cannula with injection valve size : 18g 1.00 each 11.03 i.v. cannula with injection valve 20g 1.00 each 11.04 iv cannula ( two way ) size 20 1.00 each 11.05 iv cannula ( two way ) size 22 1.00 each 11.06 iv cannula ( two way ) size 24 1.00 each 11.07 iv cannula size 26g ( ) , consumable 1.00 each 11.08 biomedical waste collection plastic bag small ( all colours ) 1.00 each 11.09 biomedical waste collection plastic bag medium ( all colours ) 1.00 each 11.10 biomedical waste collection plastic bag large ( all colours ) 1.00 each 11.11 mattress 5kg cotton 3 ft x 6 ft 1.00 each 11.12 pillow with 2kg cotton 1.00 each 11.13 tericot sharee 1.00 each 11.14 compunder dress ( male ) 1.00 each 11.15 bed sheet single bed ( white ) 1.00 each 11.16 bedsheet double bed ( white ) 1.00 each 11.17 bed sheet single bed ( coloured ) 1.00 each 11.18 bedsheet double bed ( coloured ) 1.00 each 11.19 baby diapers small ( 10 diaper per pkt ) 1.00 each 11.20 chair cushion box type 1.00 each 11.21 chair cushion box type 1.00 each 11.22 chair cushion cover 1.00 each 11.23 compounder coat / lab tec / xry tec std size 1.00 each 11.24 curtain green redymade 1.00 each 11.25 curton cloth rangeen 1.00 each 11.26 curton cloth rangeen design 1.00 each 11.27 dionised water 5 ltr cane ( each ) 1.00 each 11.28 front aprin 1.00 each 11.29 metresses 3x6 with raxine cover 4 density 1.00 each 11.30 napkin sup. quality std size ( white ) 1.00 each 11.31 napkin sup. quality std size ( coloured ) 1.00 each 11.32 peticote blauge cloth shuti rangeen 1.00 each 11.33 peticote / blauge cloth shuti bleach 1.00 each 11.34 pillow cover cloth bleach 1.00 each 11.35 rangeen baag print kapda 1.00 each 11.36 rangeen baag print kapda 1.00 each 11.37 rangeen design towel beev kapda 1.00 each 11.38 rangeen design weft stripe kapda 1.00 each 11.39 table cloth rangeen ( small ) 1.00 each 11.40 table cloth rangeen ( large ) 1.00 each 11.41 biomedical waste collection plastic dustbin small ( all colours ) 1.00 each 11.42 biomedical waste collection plastic dustbin medium ( all colours ) 1.00 each 11.43 biomedical waste collection plastic dustbin large ( all colours ) ...

Government Medical College - Madhya Pradesh

31823117 supply of chemical, reagents and consumables 2 2, 4 dnph 3 2, 6 dichloro phenol 4 4, amino antipyrine 5 acetic anhydriye 6 acetone 7 agar 8 agarose 9 alpha keto glutaric acid 10 alpha naphthol 11 amino acids 12 ammonia 13 ammonium molybdate 14 ammonium oxalate 15 ammonium persulphate 16 ammonium sulphate powder 17 amonical silver nitrate 18 anitmonic trichloride 19 arabinose 20 arsenic acid 21 barium chloride 22 benzidine powder 23 beta mercepto ethanol 24 bile pigments 25 bis acrylamide 26 blue litmus paper 27 bromophenol blue 28 butanol 29 calcium chloride 30 casein 31 ccl4 32 charcoal 33 cholesterol crystals 34 citric acid 35 concentrated h2so4 36 concentrated hno3 37 concentrated hcl 38 coomassie brilliant blue r 250 stain 39 copper sulphate 40 creatinine pure 41 cupric acetate 42 dextrin powder 43 di sodium phenyl phosphate 44 diacetyl monoaxime 45 diethyl pyrocarbonate 46 disodium monohydrogen ortho phosphate 47 dithiothreitol 48 dl alanine 49 dl aspartic acid 50 edta 51 eosin 52 ether 53 ethyl alcohol 54 ferric chloride 55 filter papers 56 filter papers whatmans no. 1 sheets 57 fluroglucinol powder 58 formaldehyde 59 formic acid 60 fructose powder 61 galactose powder 62 gelatin 63 glacial acetic acid 64 globulin 65 glucose powder 66 glycerol 67 hydrogen peroxide 68 hydroxy quinoline 69 iodine crystals 70 isopropanol 71 k2hpo4 72 keratin 73 kh2po4 74 lactic acid 75 lactose powder 76 lead acetate 77 lead oxide 78 liquid bromine 79 lithium chloride 80 low retention auto pipette tips 81 magnesium chloride 82 magnesium oxide 83 magnesium sulphate 84 maltose powder 85 mercuric chloride 86 mercuric sulphate 87 methanol absolute 88 methyl red 89 methylene blue 90 molybdic acid 91 monosodium dihydrogen phosphate 92 ninhydrin 93 nitrocellulose membranes 94 orcinol 95 orthophosphoric acid 96 paradimethylamino benzaldehyde 97 pasture pipettes 98 peptone powder 99 perchloric acid 100 ph papers range 2 14 101 phenol 102 phenolphthelin indicator 103 phenyl hydrazine hydrochloride 104 phenyl mercuric acetate 105 phenyl phosphate 106 phloroglucinol 107 phosphomolybdic acid 108 picric acid 109 potassium chloride 110 potassium ferricyanide 111 potassium ferrocyanide 112 potassium hydroxide 113 potassium iodide 114 potassium oxalate 115 potassium permanganate 116 potassium sodium tartarate 117 protein molecular weight markers 118 pvdf membranes 119 red litmus paper 120 resorcinol 121 silver nitrate 122 sodium acetate powder 123 sodium benzoate 124 sodium bicarbonate 125 sodium carbonate 126 sodium chloride 127 sodium citrate 128 sodium dithionite 129 sodium dodisyl sulphate ( sds ) 130 sodium hydroxide 131 sodium hypobromide 132 sodium hypochromate 133 sodium nitrite 134 sodium nitropruside crystals 135 sodium pyruvate 136 sodium sulphite 137 sodium tungstate 138 sprit lamps stainless steel 139 starch powder 140 sucrose powder 141 sudan black 142 sulphanilic acid 143 sulphosalysilic acid 144 sulphur powder 145 tannic acid 146 temed 147 thiosemicarbazide 148 thymol blue indicator 149 toffers indicator 150 trichloro acetic acid 151 tricine 152 tris base 153 urea 154 urease powder 155 uric acid crystals 156 vaniline 157 vitamin a 158 vitamin c 159 zinc chloride 160 zinc sulphate 161 bovine serum albumin 162 di sodium edta 163 ethidium bromide 164 xylene cyanol 165 potassium dichromate 166 twin 20 167 coomassie brilliant blue g 250 168 sodium deoxy cholate 169 glycine 170 amido black 171 6 amino hexanoic acid 172 ponceau s 173 fast green fcf 174 guanidine chlorid 175 ethidium bromide 176 bromophenol blue 177 methylene blue 178 bromocresol green s 179 lithium carbonate 180 bacteriological peptone 181 beef extract 182 yeast extract 183 malt extract 184 nutrient agar 185 blood agar base 186 cystine lactose electrolyte deficient agar 187 macconkey agar 188 agar agar 189 robertson cooked meat broth 190 bile salt agar 191 thiosulphate citrate bile salt sucrose 192 2.92 bile aesculin agar 193 brain heart infusion broth 194 2.94 mueller hinton agar 195 pikes media ( h. inf. ) 196 plet media ( b. anthracis ) 197 pnf medium ( s. pyogenes ) 198 lj medium 199 sda 200 bile salt agar 201 ss agar 202 sorbotolmacconkey agar ( ehec ) 203 tetrathionate broth 204 selenite f broth 205 stuart transport medium 206 thayer martin medium 207 triple sugar iron agar 208 sim medium 209 simmon’s citrate agar 210 christensen urea agar 211 dca 212 pre reduced anaerobically sterilized media 213 mannitol salt agar 214 xld agar 215 wilson blair brilliant green bismuth sulphite agar 216 hoyle’s tellurite lysed blood agar 217 mrvp broth 218 glucose 219 sucrose 220 lactose 221 maltose 222 mannitol 223 inulin 224 amikacin 30μg 225 amoxicillin 25 μg 226 ampicillin / cloxacillin 10 μg 227 amoxicillin + clavulanic acid 20+10 μg 20+10 μg 228 ampicillin +salbactam 10+10 μg 10 vial each 229 azithromycin 15 μg 230 aztreonam 30 μg 231 bacitracin 130 μg / μl 232 carbenicillin 100 μg 233 cefaclor 30 μg 30 μg 234 cefalexin 30 μg 30 μg 235 cefazolin 30 μg 30 μg 236 cefepime 30 μg 237 cefixime 5 μg 238 cefoperazone 75 μg 239 cefoparazone+ salbactam 75+30 μg 240 cefotaxime 30 μg 241 cefotetan 30 μg 242 cefoxitin 30 μg 243 cefpirome 30 μg 244 cefpodoxime 10 μg 245 ceftazidime 30 μg 246 ceftriaxone 30 μg 247 cefuroxime 30 μg 248 cephalotin 30 μg 249 chloramphenicol 30 μg 250 ciprofloxacin 5 μg 251 clarithromycin 15 μg 252 clindamycin 2 μg 253 colistin 10 μg 254 doripenem 10 μg 255 doxycycline 30 μg 256 ertapenem 10 μg 257 erythromycine 15 μg 258 fosfomycin 200 μg 259 gentamicin 10 μg 260 gentamicin ( high load ) 120 μg 261 imipenem 10 μg 262 kanamycin 30 μg 263 levofloxacin 5 μg 264 lincomycin 15 μg 265 linezolid 30 μg 266 meropenem 10 μg 267 moxifloxacin 5 μg 268 nalidixic acid 30 μg 269 netilmicin 30 μg 270 nitrofurantoin 300 μg 271 norfloxacin 10 μg 272 ofloxacin 5 μg 273 oxacillin 1 μg 274 penicillin 6 μg / 10iu 275 piperacillin 100 μg 276 piperacillin+tazobactam 100+10 μg 277 polymixin 50 μg / 300 ui 278 quinupristin dalfopristin 15 μg 279 rifampicin 5 μg 280 spectinomycin 100 μg 281 streptomycin 10 μg 282 streptomycin ( high load ) 300 μg 283 teicoplanin 30 μg 284 tetracycline 30 μg 285 ticarcillin 75 μg 286 ticarcillin+clavulanic acid 75+10 μg 287 tigecycline 15 μg 288 tobramycin 10 μg 289 trimethoprim+sulfamethoxazole 1.25+23.75 μg 290 trimethoprim 5 μg 291 vancomycin 30 μg 292 polymyxin b 30 μg 293 elisa kit for hbsag 294 elisa kit for dengue ns 1 295 elisa kit for dengue igm 296 rapid card test dengue ns1 297 elisa kit for chikungunya igm 298 torch nanoplex igg / igm ( nano elisa kit ) 299 aso latex agglutination test 300 crp latex agglutination test 301 ra latex agglutination test 302 widal slide agglutination test 303 rpr test kit 304 vdrl test 305 hbsag card test 306 malaria card test 307 hav igm card test 308 hcvigm card test 309 gram stain 310 acid fast bacilli staining 311 india ink 312 albert stain 313 potassium hydrochloride 314 lectophenol cotton blue 315 lugols iodine 316 nacl crystal 317 stain a and stain b 318 methanol 319 surgical spirit 320 melachite green 321 nigrosine 322 h2so4 323 kmno4 crystal 324 iodine 325 hydrogen peroxide 326 oxidase reagent ( tetramethyl p phenylenediaminedihydochloride ) 327 rabbit plasma 328 kovac’s reagent or ehrlich reagent 329 potassium nitrate ( kno3 ) 330 optochin disc 331 sodium deoxycholate 332 bacitracin disk 333 potassium iodide 334 potassium hydroxide 335 formaldehyde 40% 336 glycerine 337 potassium acetate 338 pyridine 339 sodium hydrosulphite 340 thymol crystal 341 2 propanol 342 xylene 343 paraffin wax 344 pap stain 345 giemsa stain 346 hematoxylene stain 347 eosin stain 348 sodium metabisulphite 349 brilliant cresyl blue 350 leishman stain 351 ethyl alcohol 352 methanol 353 glacial acetic acid 354 dpx 355 cdi tissue marking dyes 356 sodium iodate 357 potassium alum 358 citric acid 359 chloral hydrate 360 1% aq potassiumferrocyanide 361 2% aq. hydrochloric acid 362 turk diluting fluid 363 pandy’s reagent 364 trichloroacetic acid 365 ehrlich’s reagent 366 lugol’s iodine 367 n / 10 hcl 368 semen diluting fluid 369 sulfur powder 370 bovine albumin 371 g6pd reagent 372 cedar wood oil 373 drabkin solution for hb 374 edta powder 375 filter paper sheet 376 fouchets reagent 377 liquid ammonia 378 methylene blue 379 rbc dilution fluid 380 rectified spirit 381 3% acetic acid 382 chlorhexidine 0.5% hand rub 383 fluorescein 384 rhodamine 385 acridine orange 386 salmonella diagnostic antiserum 2ml – 0:2 387 salmonella diagnostic antiserum 2ml – 0:4 388 salmonella diagnostic antiserum 2ml – o:9 389 salmonella diagnostic antiserum 2ml – h d 390 salmonella diagnostic antiserum poly o’ a g 2ml 391 vibrio cholera diagnostic antiserum ogawa 2ml 392 vibrio cholera diagnostic antiserum inaba 2ml 393 vibrio cholera diagnostic antiserum 2ml – poly’o’ 394 shigella boydii antiserum polyvalent 2ml 395 shigella dysenteriae antiserum polyvalent 2ml 396 shigella flexneri antiserum polyvalent 2ml 397 shigella sonnei antiserum polyvalent 2ml 398 desorb u 399 owner koller buffer 400 cacl2 0.025 m 401 cephascreen 402 neoplastine solvent 2 403 listest d di plus ( layex ) 404 listest d di ( buffer ) 405 liquid fib 406 liatest control n 407 neoplastine c1 plus r 2 408 lh lyse m52 409 diff lyse m52 410 diluent m52 411 prob cleaner 412 aspen m 68 diluent 413 aspen m 68 lb lyse 414 aspen m 68 lh lyse 415 aspen m 68 ld lyse 416 aspen m 68 fd dye 417 aspen probe cleaner 418 alfa lyse 419 alfa dilutents...

Madhya Pradesh Power Generating Company Limited - Madhya Pradesh

31599391 procurement of fine chemicals at chemistry laboratory, 2x660 mw, ph ii, sstpp, mppgcl, dongalia procurement of fine chemicals at chemistry laboratory, 2x660 mw, ph ii, sstpp, mppgcl, dongalia , 2 propanol packing size 2.5 l ( detail technical specification as per tender schedule ) , glacial acetic acid packing size 2.5 l ( detail technical specification as per tender schedule ) , hydroxylammonium chloride packing size 100 g ( detail technical specification as per tender schedule ) , sodium hydroxide pellets packing size 500 g ( detail technical specification as per tender schedule ) , ammonium acetate packing size 500 g ( detail technical specification as per tender schedule ) , sodium sulfite packing size 500 g ( detail technical specification as per tender schedule ) , oxalic acid packing size 500 g ( detail technical specification as per tender schedule ) , hydrochloric acid ( 35% ) packing size 5 l ( detail technical specification as per tender schedule ) , test chlor packing size 100 ml ( detail technical specification as per tender schedule ) , kcl standard solution ( 1413 ?s ) packing size 480 ml ( detail technical specification as per tender schedule ) , potassium chloride packing size 500 g ( detail technical specification as per tender schedule ) , universal ph indictaor packing size 500 ml ( detail technical specification as per tender schedule ) , 0.45?m membrane filter paper ( dia. 47mm ) packing size 1 pc. ( 100 in each ) ( detail technical specification as per tender schedule ) , kcl standard solution ( 147 ?s ) packing size 500 ml ( detail technical specification as per tender schedule ) , mercuric iodide red packing size 100 g ( detail technical specification as per tender schedule ) , toluene packing size 2.5 l ( detail technical specification as per tender schedule ) , edta disodium salt packing size 500 g ( detail technical specification as per tender schedule ) , 1, 10 phenanthroline packing size 25 g ( detail technical specification as per tender schedule ) , sodium metabisulfite packing size 1 kg ( detail technical specification as per tender schedule ) , buffer tablets ph 4.0 packing size 1 pc ( 20 tab ) ( detail technical specification as per tender schedule ) , buffer tablets ph 7.0 packing size 1 pc ( 20 tab ) ( detail technical specification as per tender schedule ) , buffer tablets ph 9.0 packing size 1 pc ( 20 tab ) ( detail technical specification as per tender schedule ) , turbidity standard 4000 ntu packing size 100 ml ( detail technical specification as per tender schedule ) ...

Public Health Engineering Department - Madhya Pradesh

31433312 schedule of quantity for supply of chemicals for crm 11 parameters nabl for subdivision laboratory ambah 1 auto zero burette capacity 50 ml with reservior capacity 2000ml 50ml ( ambar ) ( nabl ceritified ) 2 measuring cylinder 25ml ( nabl ceritified ) 3 sample bottle 2 ltr plastic 4 edta solution n / 50 500ml 5 sulphuric acid n / 50 500 ml 6 silver nitrate 0.0141 500 ml 7 nacl 500gram 8 ammonia buffer solution 500ml 9 eriochrome black t indicator 100ml 10 ammonium purpurate 5gram 11 naoh 500ml 12 potassium chromate 100ml 13 1:10 phenon throlime 500ml 14 cons. hcl 500ml 15 sodium acetate 500 ml 16 hydroxyl amine hydro chloride 500ml 17 pda 500ml 18 amonia solution 500ml 19 barium chloride 500gram 20 conditioning reagent 500ml 21 alizarin red zirconyl mix indicator 500ml 22 ammonium per sulphate 500gram 23 cons. sulphuric acid 500ml 24 phonophaline indicator 100ml 25 mixed indicator 100ml 26 o.t. solution 500ml 27 universal indicator 500ml 28 methanol 500 ml 29 m 7 fc agar media 500 gram 30 sodium thiosulphate 500ml 31 nitric acid 500ml 32 ph buffer standard 7.0 500ml bnd 33 ph buffer standard 4.0 500ml, bnd 34 ph buffer standard 9.2 500ml, bnd 35 calcium satandard 1000mg 475ml bnd 36 alkalinity standard 500ml ( sodium carbonate ) , bnd, 0.1 n bnd 37 chloride standard 500mg / lit. , bnd 38 iron standard 475ml , bnd 39 nitrate standard 475ml , bnd 40 fluoride standard 500ml, bnd 41 manganese standard 500ml, bnd 42 sulphate standard 500ml, bnd 43 colour standard 250ml , bnd 44 conductivity standard 475ml bnd 45 turbidity standard 400ntu 500ml , bnd 46 what men filter paper 12.5cm 1pkt 47 membrane filter 0.45 1pkt 48 cottan 500gram 49 burette pump rubber 50 spefula law steel 51 tong steel 52 washing brush 53 tissue paper 1pkt 54 special reagent 500ml 55 glacial acetic acid 500ml 56 tds meter 308 orion systronics, ranges 0.1 ppm to 200 ppt, accuracy ±15 ( nabl ceritified ) 57 hot air oven capacity 71 ltr temp. range rt+20 250 degree c ambient temp. 5 40 degree c inner dimension 450*450*350mm ) 58 thermometer 2.0 degree c, 0 to 360degree c with calibration certificate 59 memran filter assembly 47 mm with pump ( tarson ) 60 water bath 61 laboratory bacteriological incubater 45*45*45cm 90ltr. cube ft. 3 shelves 3 fully ss body temprature range ambient +5 to +90 degree c ( nabl ceritified ) 62 fist aid kit 63 weight box e 2, 23 weight including fractitional weights 200 gm...

Directorate Of Health Services - Madhya Pradesh

31311197 supply for medicine , material, and equipment etc. , tablet and capsuls 1 tablet and capsuls 2 acetazolamide tab ( 250mg ) , tablet 3 acyclovir tab 400 mg ( 400 mg ) , tablet 4 acyclovir tab. ip 200mg ( dt tablets also acceptable ) , tablet 5 acyclovir ( 800mg ) , tablet 6 albendazole ip ( 400mg ) , tablet 7 alfacalcidiol capsule ( 0.25 mcg ) , capsule 8 alprazolam ( 0.5mg ) , tablet 9 alprazolam ( tab 0.25mg ) , tablet 10 amiodarone ( 100mg tab ) , tablet 11 amlodipin tab ( 5mg ) , tablet. 12 amlodipine ( 10 mg ) , tablet 13 amlodipine ( 2.5mg ) , tablet 14 amoxicillin + clavulanic acid ( 200 mg + 28.5 mg ) , tablet 15 amoxicillin cap. 250 mg. 16 amoxicillin cloxacillin and lactic acid bacillus capsules 250mg 17 amoxicillin trihydrate dispersible 125 mg tab ( 125 mg ) , tablet 18 amoxycillin and clavulanic acid i.p. ( 500mg + 125mg ) , tablet 19 amoxycillin dispersible tablets ip amoxicillin trihydrate ip equivalent to amoxicillin ( 250mg ) , tablet 20 amoxycilline ( 500mg ) , capsule 21 ampicillin trihydrate capsules ( 500mg 10x10 ) , capsule 22 anticold ( paracetamol 300mg+cetirizine hcl 5mg tablet ) 23 antioxident ( cap ) , capsule 24 artesunate + sulphadoxine + pyrimethamineip ( age group 15 or above ) ( 200 mg ( 3tab ) + 750 mg ( 2tab ) + 37.5 mg ( 1tab ) ) , combi blister pack 25 artesunate + sulphadoxine + pyrimethamine ( age group between 1 4 year ) ( 50 mg ( 3 tab ) +500 mg ( 1 tab ) +25 mg ( 1 tab ) ) , combi blister pack 26 ascorbic acid ( vitamin c ) tab i.p. ( 500mg ) , tablet 27 aspirin low dose 75mg tab 28 atenolol ( 100mg ) , tablet 29 atenolol ( 25 mg ) , tablet 30 atenolol ( 50mg tab ) , tablet 31 atorvastatin ( 10 mg ) , tablet 32 atorvastatin ( 20mg ) , tablet 33 azithromycin ( 250mg ) , tablet 34 azithromycin ( 500mg tab ) , tablet 35 b complex minerals with zinc cap ( ) , capsule 36 betahistine ( 8 mg tab ) , tablet 37 betamethasone ( 0.5 mg ) , tablet 38 bisacodyl ( 5mg tab ) , tablet 39 calcium carbonate ( 500 mg ) , tablet 40 calcium with vitamin d tablets usp calcium carbonate 1.25g eq. to elemental ( calcium 500mg and cholecalciferol ip 250 iu ) , tablet 41 carbamazepine ( 200 mg ) , tablet 42 carbimazole ( 10 mg ) , tablet 43 cefadroxil 250 mg tab 44 cefadroxil 500 mg tab 45 cefixime ( 200 mg tab ) , tablet 46 cefixime ( 50 mg dt ) , tablet 47 cefpodoxime 100 mg ( ) , tablet 48 cefpodoxime ( 200 mg ( dispersible tab ) , tablet 49 cefpodoxime ( 50 mg ) , tablet 50 cefuroxime 250 mg, tablet 51 cefuroxime 500 mg, tablet 52 cephalexin dispersible ( 125 mg ) , tablet 53 cephalexine ( 250mg ) , capsule 54 cephalexine ( 500mg ) , capsule 55 cetirizine ( 10 mg ) , tablet 56 chewable antacid tablet 57 chloraxozone + paracetamol ( 250 mg + 500 mg ) tab 58 chloroquine phosphate tab. ( 250mg ) , tablet 59 chlorpromazine hydrochloride ( 25 mg ) , tablet 60 chlorpromazine ( 100 mg ) , tablet 61 chlorpromazine ( 50 mg ) , tablet 62 cinnarizine ( 25 mg ) , tablet 63 ciprofloxacin + tinidazole ( 250 mg + 300 mg ) , tablet 64 ciprofloxacin 500mg + tinidazole 600mg ( ) , tablet 65 ciprofloxacin ( 250mg ) , tablet 66 ciprofloxacin ( 500mg ) , tablet 67 clobazam ( 5 mg ) , tablet 68 clomiphene citrate ( 50 mg tab ) , tablet 69 clonazepam 0.25 mg ( tablet ) , tablet 70 clonazepam ( 0.5mg ) , tablet 71 clopidogrel + aspirin ( 75 mg + 150 mg ) , capsule 72 clopidogrel ( 75 mg ) , tablet 73 clotrimazole ( vaginal tab ) 500 mg ( with applicator ) , tablet 74 cloxacillin capsules 500mg 75 deferasirox dispersible ( 250mg ) , tablet 76 deferasirox dispersible ( 500mg ) , tablet 77 deriphylline tablet ( sustained release ) , tablet 78 dexamethasone ( 0.5mg ) , tablet 79 dexamethasone ( 4 mg ) , tablet 80 diazepam ( 5 mg ) , tablet 81 diclofenac 50mg +seratopeptidase 10mg tab ( 10mg ) , tablet 82 diclofenac sodium + paracetamol +serratiopeptidase 50 mg +325 mg + 10 mg tab 83 diclofenac sodium 50mg + paracetamol 325mg tab 84 diclofenac sodium ( 50 mg ) , tablet 85 diclofenac+paracetamol+chlorzoxazoe ( 50 mg + 325 mg + 250 mg ) , tablet 86 dicyclomine hydrochloride ( 20 mg ) , tablet 87 dicyclomine tab. 10mg 88 diethylcarbamazine tab ( 100mg ) , tablet 89 diethylcarbamazine ( 50 mg ) , tablet 90 digoxin tab ( 0.25mg ) , tablet 91 diltiazem ( 30 mg ) , tablet 92 diphenylhydantoin tablet ( 100 mg ) , tablet 93 dispersible zinc tab ( 10mg ) , tablet 94 dispersible zinc ( 20mg ) , tablet 95 divalproex sodium 250 mg tab 96 divalproex sodium 500 mg tab 97 domperidone ( 10mg ) , tablet 98 doxycycline capsule 100mg 99 doxycycline tab. 100mg ( ) , tablet 100 doxylamine succinate + pyridoxine ( 10mg+10mg ) , tablet 101 doxylamine succinate ( 10 mg ) , tablet 102 drotaverine ( 40 mg ) , tablet 103 dydrogesterone 10 mg tab 104 each combipack red colour blister pack contains 3tab of artesunate 150mg and 2 tab of sulphadoxine pyrimethamine ( 500mg + 25mg ) ( age group 9 to 14 years ) , tablet 105 enalapril maleate tab ( 2.5mg ) , tablet 106 enalapril maleate tab ( 5mg ) , tablet 107 erythomycin stearate ( 250mg ) , tablet 108 erythromycin stearate ( 500 mg ) , tablet 109 escitalopram 10 mg tab ( 10 mg ) , tablet 110 escitalopram ( 5 mg ) , tablet 111 ethamsylate 250mg tablet 112 etiophylline ( 77 mg ) + theophylline ( 23 mg ) tab 113 etiophylline theophylline sr tab. 300mg ( ) , tablet 114 etophylline + theophylline sr tablet 231mg + 69mg ( ) , tablet 115 ferrous ascorbate 100mg ( elemental iron ) +folic acid 1.5mg ( tablet ) , tablet 116 fluconazole 100 mg tab 117 fluconazole ( 150 mg ) , tablet 118 flunarizine 10 mg tab 119 fluoxetine cap ( 20 mg ) , capsule 120 fluoxetine ( 10 mg ) , tablet or capsule 121 fluphenazine ( 2.5 mg ) , tablet 122 folic acid ip ( 5 mg ) , tablet 123 furazolidone ( 100mg ) , tablet 124 furosemide tab ( 40mg ) , tablet 125 gabapentine ( 100 mg ) , tablet 126 glibenclamide ( 5 mg ) , tablet 127 gliclazide ( 80 mg ) , tablet 128 glimepiride ( 1 mg ) , tablet 129 glimepiride ( 2 mg ) , tablet 130 griseofulvin ( tablet 250 mg ) , tablet 131 haloperidol ( 5mg ) , tablet 132 hydrochlorothiazide tab ( 25 mg ) , tablet 133 hydrochlorthiazide ( 12.5 mg ) , tablet 134 ibuprofen 400mg+ paracetamol 325mg tablet ( ) , tablet 135 ibuprofen ( 200 mg ) , tablet 136 ibuprofen ( 400mg ) , tablet 137 imipramine ( 25 mg ) , tablet 138 iron and folic acid enteric coated tab dried ferrous sulphate equ. to ferrous iron 100 mg and folic acid 0.5 mg ( blue tablet ) 139 iron and folic acid enteric coated tab. dried ferrous sulphate ip equ. to ferrous iron 100 mg and folic acid ip 0.5 mg granules ( red tablet ) ( ) , tablet 140 iron and folic acid entric coated tab. ferrous suplhate ip 333.335mg equivalent to 100mg of elemental ( red tablet ) , tablet 141 iron and folic acid sugar coated tab dried ferrous sulphate ip eq. to 45 mg ferrous iron and 400 mcg folic acid ip ( pink colored tab ) wifs junior ifa tablets ( detail specification as per tender ) ( 400 mcg ) , tablet 142 iron folic acid sugar coated ( blue tablet ) ferrous sulphate ip equivalent to 60 mg elemental iron & 500 mcg folic acid ip ( 60 mg + 500 mcg ) , tablet 143 iron folic acid sugar coated ( red tablet ) ferrous sulphate ip equivalent to 60 mg elemental iron & 500 mcg folic acid ip ( 60 mg + 500 mcg ) , tablet 144 iron folic acid sugar coated tablet dried ferrous sulphate ip eq. to 45mgferrous iron and 400mcg folic acid ip ( pink coloured tab ) wifs junior ifa tablets ( detail specification as per tender ) ( 45mg + 400mcg ) , tablet 145 isosorbide dinitrate tab ip ( 5mg ) , tablet 146 isosorbide mononitrate ( 20mg ) , tablet 147 isosorbide 5 mononitrate ( tab.20 mg ) , tablet 148 isoxsuprine ( 10mg ) , tablet 149 itraconazole cap ( 100 mg ) , capsule 150 ketoconazole tab 200mg ( ) , tablet 151 labetalol ( 100 mg ) , tablet 152 lactobacillus ( ( lactobacillus 60 million spores ) ) , tablet 153 levocetirizine + monteleukast ( 5 mg + 10 mg ) , tablet 154 levofloxacin ( 250mg ) , tablet 155 levofloxacin ( 500mg ) , tablet 156 lithium carbonate ( 300 mg ) , tablet 157 lorazepam 1 mg tab 158 lorazepam ( 2 mg ) , tablet 159 losartan tab 25 tablet 160 losartan ( 50 mg ) , tablet 161 magnesium hydroxide and aluminium hydroxide ( ) , tablet 162 medroxy progesterone acetate 10 mg tab 163 mefenamic acid + dicyclomine tab ( 250 mg + 10 mg ) , tablet 164 mefenamic acid + drotaverine hcl 250 mg + 80 mg tab 165 mehylcobalamine 1500 mcg, alpha lipoic acid 100 mg, folic acid 1.5 mcg, thiamine mononitrate 10 mg ( pyridoxine hcl 3 mg ) , capsule 166 metformin + glimepiride 500 mg + 2 mg tab 167 metformin 500mg + gliclazide 80mg tablet ( 10x10 ) , tablet 168 metformin ( 500 mg ) , tablet 169 metformine 500mg + glibenclamide 5mg ( tab ) , tablet 170 methyl ergometrine maleate tab. 0.125mg 171 methyl prednisolone sodium succinate tablet 8 mg 172 methyl prednisolone tab ( 16 mg ) , tablet 173 methyl prednisolone ( 4mg ) , tablet 174 methyl prednisolone ( 8mg ) , tablet 175 methylcobalamin + alpha lipoic acid ( 1500 mcg + 100 mg ) , capsule 176 methylcobalamin / mecobalamin ( 500 mcg ) , tablet 177 methyldopa tab. 250mg 178 metoclopramide ( 10mg ) , tablet 179 metoprolol ( 50mg ) , tablet 180 metronidazole tab ( 400mg ) , tablet 181 micronised progesterone ( 100 mg ) , tablet 182 micronised progesterone ( 400 mg ) , capsule 183 micronised progestrone ( 200 mg ) , tablet 184 mifepristone ( 200 mg ) , tablet 185 mifepristone 200mg ( 1 tab ) +misoprostol 200mcg ( 4 tab ) ( combipack ) , tablet 186 mirtazapine 15 mg ( tablet ) , tablet 187 misoprostol 400 mcgtablets 188 misoprostol ( 200mcg ) , tablet 189 multivitamin sugar coated tab nfi formula multivitamin sugar ( item with additional vitamin will also be considered ) , tablet 412 190 nifedipine ( sublingual ) 10 mg ( ) , capsule 191 nifedipine capsule 5mg cap 192 nifedipine tablets 10mg tab 193 nimesulide +paracetamol ( 100 + 325 mg ) , tablet 194 nimesulide ( 100 mg ) , tablet 195 nitrofruantoin ( 100mg ) , tablet 196 nitroglycerine ( glyceryl trinitrate ) ( sublingual tab 0.5 mg ) , tablet 197 norfloxacin tab. 400mg 198 norfloxacine 400mg and tinidazole 600mg ( tab ) , tablet 199 ofloxacin + ornidazole ( 200mg and 500mg ) , tablet 200 ofloxacin tab 200mg 201 ofloxacin tab 400 mg ( ofloxacin tab 400 mg ) , tablet 202 olanzapine 2.5 mg tab 203 olanzapine 7.5 mg tab 204 olanzapine ( 5 mg ) , tablet 205 omeprazole + domperidone 20 mg + 10 mg ( capsule ) , capsule 206 omeprazole capsule ( 40 mg ) , capsule 207 omeprazole ( 20mg ) , capsule 208 ondansetron tab 4 mg 209 ornidazole tab ( 500 mg ) , tablet 210 pantoprazole 40 mg, domperidone 10 mg ( tab ) , tablet 211 pantoprazole tab ( 40 mg ) , tablet 212 paracetamol tab 650 mg ( 650 mg ) , tablet 213 paracetamol ( 500mg ) , tablet 214 penicillin v ( phenoxymethyl penicillin potassium ) ( 250 mg ) , tablet 215 pentoprazole 40mg, domperidone 10mg tab tablet 216 phenobarbitone tab. 60 mg ( ) , tablet 217 phenobarbitone ( 30 mg ) , tablet 218 phenobarbitone ( 60 mg tab ) , tablet 219 phenytoin sodium ( 100mg ) , tablet 220 piroxicam ( 20 mg ) , capsule 221 prednisolone tab 20 mg ( dispersible tablet also acceptable ) , tablet 222 prednisolone ( 10 mg ) , tablet 223 prednisolone ( 5mg ) , tablet 224 primaquin ( 2.5mg ) , tablet 225 primaquin ( 7.5mg ) , tablet 226 primaquine ( 15mg ) , tablet 227 promethazine tab ( 25 mg ) , tablet 228 promethazine ( 50 mg ) , tablet 229 propranolol tab ( 10 mg ) , tablet 230 pyridoxine tab 10mg 231 quinine sulphate ( 300mg ) , tablet 232 quinine sulphate ( ip 600mg ) , tablet 233 rabeprazole ( 20 mg ) , tablet 234 ramipril ( 2.5 mg ) , tablet 235 ramipril ( 5 mg ) , tablet 236 ranitidine ( 150mg ) , tablet 237 risperidone ( 2 mg ) , tablet 238 roxithromycin 150mg tablet 239 salbutamol sulphate ( 4mg ) , tablet 240 secnidazole ( 500 mg tab ) , tablet 241 serratiopeptidase 10 mg tab 242 sodium valporate 300 mg tab 243 sodium valproate + valproate 333 mg + 145 mg ( tablet ) , tablet 244 sodium valproate enteric coated tab. bp ( 200 mg ) , tablet 245 sodium valproate ( 200mg ) , tablet 246 sulfamethoxazole +trimethoprim tab ( 200 mg + 40 mg ) , tablet 247 sulfamethoxazole and trimethoprim ( 100 mg and 20mg ) , tablet 248 sulfamethoxazole and trimethoprim ( 400mg + 80mg ) , tablet 249 sulfamethoxazole and trimethoprim ( 800mg + 160mg ) , tablet 250 tablet paracetamole 250mg 251 telmisartan, hydrochlorthiazide ( 40 mg + 12.5 mg ) , tablet 252 telmisatran ( 40 mg ) , tablet 253 thyroxine sodium tab 100 mcgtablet 254 thyroxine sodium tab ( 50mcg ( 100 tab bottle ) ) , tablet 255 tinidazole ( 300 mg ) , tablet 256 tinidazole ( 500mg ) , tablet 257 torasemide tab ( 20mg ) , tablet 258 torasemide ( 10mg ) , tablet 259 tramadol cap ( 50mg ) , capsule 260 tramadol ( 50mg ) , tablet 261 tranexamic acid 500 mg tab tablet 262 trihexyphenidyl ( 2mg ) , tablet 263 verapamil ( 40 mg ip ) , tablet 264 vitamin a cap usp soft gelatin capsule ( 2 lakh iu ) , capsule 265 vitamin a cap usp soft gelatin capsule ( 1 lakh iu ) , capsule 266 vitamin b1 10mg, b2 10mg, b6 3mg, b12 15mcg, niacinamide 100mg, calcium panthenol 50mg, folic acid 1.5mg, vitamin c 150mg, biotin 100mcg or more tab ( ) , tablet 267 vitamin c tab 500 mg tablet 268 vitamin c ( 100 mg ) , tablet 269 vitamin. b complex nfi ( prophylactic ) ( b12 mg, b22mg, b6 0.5 mg, niacinamide 25 mg, calcium pantothenate 1 mg ) , tablet 270 vitamin. b complex ( nfi ( prophylactic ) tablet 271 vitamin e usp ( 400 mg ) , capsule 272 voglibose ( 0.3mg tab ) , tablet 273 warfarin sodium ( 5 mg ) , tablet 274 zinc dispersible ( 20mg ) , tablet 275 zinc sulphate dispersible ( 10mg ) , tablet 276 zolpidem 10 mg ( tablet ) , tablet 277 syrup 278 albendazole suspension 200mg / 5ml ( 10 ml bottle ) , syrup 279 alkaline citrate with k oral solution each 10 ml contains sodium citric 1 gram potassium citrate 0.65 gram citric acid 1 gram syrup 280 alkaline citrate with k oral solution ( 100ml ) , syrup 281 ambroxol hcl 15mg+terbutaline sulphate 1.25mg+guaiphenesin 50mg 5ml ( 100ml bottle ) , syrup 282 amoxicillin and clavulanic acid i.p. ( 200+28.5mg ( 30 ml bottle ) ) , suspension 078 283 ampicillin syrup ( 125 mg / 5 ml 30 ml bottle ) , syrup 284 antacid mint flavour ( 170ml ) , syrup 285 antacid syrup , 170 ml ( dried alluminium hydroxide gel 200 mg, simethicon ( 25 mg / 5 ml ) , syrup 286 anti oxidant lycopen 200 ml syrup ( vitamins multi minerals ) , syrup 287 azithromycin ( 200mg / 5ml ( 15 ml bottle ) ) , suspension 288 bromhexine hcl 4 mg+ guaiphensin 50 mg + terbutaline sulphate 1.25 mg / 5ml syp ( 100 ml bottle ) , syrup 289 bromhexine hydrochloride ( 4mg / 5ml syrup ( 50ml bottle ) ) , syrup 290 calcium carbonate + vitamin d3 + zinc ( 200 ml syrup ) , syrup 291 calcium syp 100ml syrup ( 240mg / 5 ml ) 292 carbamazepine ( 100 mg / 5 ml 100 ml bottle ) , syrup 293 cefadroxil syrup ( 125 mg / 5 ml 30 ml bottle ) , syrup 294 cefixime oral suspension ( 100 mg / 5 ml ( 30 ml bottle ) ) , suspension 295 cephalexine ( each 5ml contains 125mg ( 30ml bottle ) ) , syrup 296 cetirizine syrup ( 5mg / 5ml 30 ml bottle ) , syrup 297 cetirizine ( 5mg / 5ml ( 60 ml bottle ) ) , syrup 298 chloroquine phosphate suspension equivalent to chloroquine ( 50mg / 5ml ( 60 ml bottle ) ) , suspension 299 cough syrup ( each 5ml contains ammonium chloride 138mg, diphenhydramine hcl 14.08mg, sodium citrate 57.03mg, menthol 2.5mg ) 300 cyproheptadine hcl + tricholine citrate ( 2mg + 275 mg / 5 ml ( 200ml bottle ) ) , syrup 301 dextromethorphan 10mg / 5ml ( 100ml bottle ) , syrup 302 dextromethorphan hydrobromide syrup 13.5 mg / 5ml ( 30 ml bottle ) , syrup 303 dextromethorphan syrup ( 60ml bottle ) ( 10mg / 5ml ) , syrup 304 dicyclomine syrup 305 diphenhydramine syrup ( 12.5mg / 5ml ( 100 ml bottle ) ) , syrup 306 disodium hydrogen citrate 1.25gm / 5ml 100 ml ( 100 ml ) , syrup 307 domperidone suspension 1mg / ml ( 30ml bottle ) , suspension 308 drop paracetamol 100mg / 15ml 309 etiophylline +theophylline ( ( 46.5+14 ) mg / 5ml ( 100 ml bottle ) ) , syrup 310 ibuprofen 100mg + paracetamol 125mg per 5 ml syrup ( 60 ml bottle ) , syrup 311 ibuprofen syrup 100mg / 5ml ( 60 ml bottle ) ( 60 ml bottle ) , syrup 312 iron ferrous sulphate folic acid 100ml ( each 5ml contains ferrous sulphate i.p equivalent to elementary iron 100mg folic acid i.p 0.5mg ) , syrup 313 iron folic acid syrup, each ml containing 20mg elemental iron&100mcgfolic acid with suitable anti oxidant, antimicrobial agent and food grade flavouring agent.the bottle should have 6 fragmented markings at equal intervals ( if an artificial sweetening is used it should be highlighted on the label. warning should be put on label medication should be kept out of reach of children. ( as per attached specification ) ( 50ml bottle with auto dispenser ) ) , syrup 314 lactulose ( 10gm / 15ml ( 100 ml bottle ) ) , solution 315 magnesium hydroxide + aluminium hydroxide simethecon 250 mg + 250 mg + 50 mg / 5 ml 170 ml bottle ( syrup ) , syrup 316 metoclopramide syrup ( 5mg / 5ml ( 30 ml bottle ) ) , syrup 317 metronidazole 100mg / 5ml ( 30ml ) , syrup 318 metronidazole oral suspension ( 200 mg / 5ml ( 60 ml bottle ) ) , suspension 319 milk of magnesia + liquid paraffin ( 11.25ml+3.75ml ) / 15ml ( 200 ml bottle ) , syrup 320 multivitamin 200ml syrup 321 multivitamine 100ml syrup ( 100 ml ) , syrup 322 norfloxacin + tinidazole ( ( 100 mg + 100 mg ) 30ml syrup ) , syrup 323 norfloxacin +metronidazole 30ml syrup 324 ofloxacin+ metronidazole ( 30ml ) , syrup 325 ondansetron ( 2mg / 5ml 30ml bottle ) , syrup 326 oseltamivir 12 mg / ml syrup ( 75ml bottle ) , syrup 327 paracetamol syrup / suspension 125 mg / 5ml ( 60ml bottle ) 328 paracetamol ( 125 mg / ml ) , drop 329 paraffin liquid ( liquid paraffin 1.25ml + milk of magnesia 3.75ml + sodium picosulphate 3.33ml ) syrup 330 phenobarbitone syp 200mg / 5ml ( ) , syrup 331 potassium chloride syrup 200ml ( each ) , syrup 332 promethazine 5 mg / 5ml ( 60 ml bottle ) , syrup 333 quinine sulphate 150mg / 5ml syrup 60 ml 334 salbutamol sulphate ( 2mg / 5ml 60ml ) , syrup 335 salbutamol ( 2mg / 5ml ( 100ml bottle ) ) , syrup 336 sodium valproate oral solution ( 200 mg / 5 ml ) , solution 337 sulfamethoxazole +trimethoprim suspension ( 200 mg + 40 mg ) / 5 mlsuspension ( 50 ml bottle ) , suspension 338 syp. cefodroxil 125mg / 30ml syrup 339 syp. cetirizine 5mg / 5ml 30ml syrup ( syp. cetirizine 5mg / 5ml 30ml syrup ) , syrup 340 syrup 50ml bottle ( each 1 ml contains 20 mg elemental iron and 100 mcg folic acid syrup as per the standards provided with dropper ) , syrup 341 syrup cefpodoxime 50 mg 342 syrup paracetamole 250mg / ml 343 vitamin a syrup ( 100000 iu / ml with market spoon for 1ml and 2 ml ( 100 ml bottle ) ) , syrup 344 vitamin b complex nfi formula ( 100ml bottle ) , syrup 345 vitamin b complex nfi formula ( 200ml bottle ) , syrup 346 vitamin d3 ( cholecalciferol ) ( 400 iu / ml ( 100 ml bottle ) ) , syrup 347 zinc sulphate 10 mg elemental zinc / 5 ml ( 100 ml bottle ) , syrup 348 zinc sulphate syrup 20mg / 5ml ( 50 ml bottle ) , syrup 349 inhaler / powder 350 bleaching powder containing not less than 30% w / w of available chlorine ( as per i.p ) , powder 351 budesonide nebulising suspension containing budesonide ( 0.5 mg / 2 ml, 2ml amp ) , suspension 352 budesonide respules 0.25mg / 2ml inhalation ( 2ml amp / respule ) , inhaler 353 budesonide ( inhalation 200 mcg per dose ) , inhaler 354 charcoal activated ( powder ) ( 100 gm box / pouch ) , oral powder 355 glucose pouch ( 75 gm ) ( powder ( product copp exempted for this item ) ) , powder 356 ors packet who formula sodium chloride 2.5g, potessium chloride 1.5g, sodium citrete 2.09g dextrose 13.6g, 20.5gm pouch ( ) , powder 357 ors who powder glucose anhydrous 13.5g / l, sodium chloride 2.6g / l, potassium chloride 1.5g / l, trisodium citrate 2.9g / l 358 salbutamol inhalation ip 100mcg / dose ( 200 metered dose container ) , inhaler 359 salbutamol nebuliser solution bp sabutamol sulphate eq. to salbutamol 1mg per ml ( 2.5 ml amp ) , ampule 360 salbutamol nebulizing solution ( 5 mg / 2.5 ml ) , ampule 361 vitamin d3 granules ( 60000 iu sachet ) , powder 362 injection 363 acyclovir inj ( 250 mg / vial ) , injection 364 acyclovir inj ( 500mg / vial ) , injection solution for 365 adenosine inj 6 mg / 2ml ( 2ml amp ) 366 adrenaline ( 1 mg / ml ( 1 ml amp ) ) , injection 367 alpha beta arteether ( 150mg / 2ml ) , injection 368 amikacin ( 100mg / 2ml vial ) , injection 369 amikacin ( 250mg / 2ml ) , injection 370 amikacin ( 500mg / 2ml ( 2ml vial ) ) , injection 371 aminophylline ( 25 mg / ml 10 ml vial ) , injection 372 amiodarone 50mg / ml ( 3ml vial / amp ) , injection 373 amoxicillin + clavulanic acid ( 125 mg + 25 mg / vial ) , injection 374 amoxicillin 250mg + clavulanic acid 50mg inj vial 375 amoxicillin ( 250 mg / vial ) , injection 376 amoxycillin +clavulanic acid ( ( amoxycillin 500 + clavulanic acid 100 mg ) / vial ) , injection 377 amoxycillin and potassium clavulanate i.p. ( 1 gm + 0.2 gm / 10 ml vial ) , injection 378 amoxycilline and clavulanic acid inj 379 amphotericin b inj ip ( 50 mg ) , injection 380 ampicillin inj. 250 mg / vial 381 ampicillin ( 1 gm vial ) , injection 382 ampicillin ( 500 mg / vial ) , injection 383 ampicilline + cloxacilline injection ( 250 mg + 250 mg ) vial injection 5ml vial ( ) , injection 384 anti d immunoglobulin for iv / im use ( monoclonal ) ( 150mcg ( 1ml vial ) ) , injection 385 anti rabies immunoglobulin inj 300 iu per 2ml ( 2ml vial ) ( 300 iu per 2ml ) , injection solution for 386 anti rabies immunoglobulin ( inj.150 iu per 2 ml vial ) , injection 387 anti rabies vaccine i.p. inj. human ( tissue culture ) for i / d and i / m route 2.5 iu with ( 1ml diluents ) , vial 388 anti snake venom polyvalent inj 10ml ( lyophilized ) ( 10 ml vial ) , injection 389 artesunate ( 60 mg / vial ) , injection 390 atracurium besylate ( 10mg / ml inj amp ) , injection 391 atracurium ( 10mg / ml ( 2.5ml vial / amp ) ) , injection 392 atropine sulphate 0.6 mg / ml sc / im / iv ( 2ml amp ) , injection 393 azithromycin inj 100mg / 5ml 394 azithromycin ( 500 mg / 5ml inj ) , vial 395 benzathine penicillin ( 6 lakh iu / vial ) , vial 396 benzathine penicilline 12 lac iu / vial vial 397 benzyl penicillin 10lac / vial ( penicillin g ) , injection 398 betamethasone sodium phosphate ( ml contain betamethasone na phosphate equal to 4mg of betame ( 1ml amp ) ) , injection 399 biphasic isophane insulin ( 30 / 70 100iu / ml ( 10 ml vial ) ) , injection 400 bupivacaine hcl for spinal anaesthesia 0.5% ( heavy ) amp ( 4 ml amp ) , injection 401 bupivacaine hcl for spinal ( inj 0.5%+8.25% dextrose ) , ampule 402 bupivacaine hydrochloride inj 0.25% ( 20 ml vial ) ( 20 ml vial ) , injection 403 bupivacaine hydrochloride ( 0.5% ( 20 ml vial ) ) , injection 404 caffeine citrate inj. 20mg / ml ( 3 ml vial ) ( 20mg / ml 3 ml vial ) , injection 405 calcium gluconate ( 10% ( 10 ml vial ) ) , injection 406 calcium leucovorin 50 mg / vial inj 407 carboprost promithamin ( 1ml amp ) ( 250mcg / ml ) , injection 408 carboprost ( 250 mcg ( 1 ml amp / vial ) ) , injection 409 cefoperazone 1000mg + sulbactam 1000mg inj ( vial ) , injection 410 cefoperazone 500mg + sulbactam 500mg ( vial ) , injection 411 cefotaxime sodium inj ( 500 mg / vial ) , injection 412 cefotaxime sodium ( 1 gm vial ) , injection 413 cefotaxime sodium ( 250 mg vial ) , injection 414 cefotaxime sodium ( 500 mg / vial ) , injection 415 ceftriaxone 1000mg + sulbactam 500mg ( vial ) , injection 416 ceftriaxone inj 500mg vial 417 ceftriaxone ( 1g ) , injection 418 ceftriaxone ( 250mg vial ) , injection 419 ceftriaxone ( 500mg vial ) , injection 420 ceftriaxone+tazobactum 250mg+31.25mg inj ( vial ) , injection solution for 421 ceftrioxone inj.usp ( 1gm / vial ) , injection 422 chloroquine phosphate ( 40mg / ml ( 5 ml amp ) ) , injection 423 chlorpheniramine maleate 10mg / ml inj 10 ml vial 424 chlorpromazine inj ip ( 25mg / ml ( 2ml amp ) ) , injection solution for 425 ciprofloxacin inj 200 mg / 100 ml ( 100 ml ffs bottle ) , injection 426 cloxacillin sodium inj. 500mg 427 dexamethasone sodium inj 4mg / 2ml ( 2ml vial ) , injection 428 dexamethasone sodium phosphate ( 8mg / 2ml ( 2ml vial ) ) , injection 429 dextrose 25% ( 500ml ffs bottle ) , injection 430 dextrose 5% ( 500ml ffs bottle ) , injection 431 dextrose with saline ( 5% + 0.9% ( 500ml ffs bottle ) ) , injection 432 dextrose ( 10% inj 500 ml ffs btl ) , injection 433 dextrose ( 25% 100 ml ffs bottle ) , injection 434 diazepam ( 5 mg / ml ( 2 ml amp ) ) , injection 435 diclofenac sodium 25 mg / ml ( 3ml amp ) , injection 436 dicyclomine ( 10mg / ml ( 2 ml amp ) ) , injection 437 digoxin 250mcg / ml ( 2ml amp ) , injection 438 dobutamine hcl 50 mg / ml ( 5ml amp ) , injection 439 dobutamine ( 12.5 mg / ml 20 ml vial ) , injection 440 dobutamine ( 50 mg / 5 ml ) , injection 441 dopamine hcl 40 mg / ml ( 5ml amp ) , injection 442 doxorubicin ( lypholozed ) ( 50mg vial ) , injection 443 drotaverine ( 40mg / 2ml ( 2ml amp ) ) , injection 444 enoxaparin ( 40mg equivalent to 4000 iu vial / pfs ) , injection 445 enoxaparin ( 60mg equivalant to 6000 iu vial / pfs ) , injection 446 erythropoietin ( 4000 iu inj vial ) , injection 447 ethamsylate inj ( 250mg ( 2ml amp ) ) , injection 448 etiophylline and theophylline ( 220 mg / 2ml ) , injection 449 fentanyl citrate inj 50 mcg / ml ( 2ml ampoule ) , ampoule 450 ferric carboxymaltose 50mg / ml ( 10ml vial ) , injection 451 fluconazole iv ( 2mg / ml ( 100ml bottle ) ) , injection 452 fluphenazine 1 ml amp ( 25 mg / ml ) , injection 453 frusemide ( 10 mg / ml ( 2 ml amp ) ) , injection 454 gentamicin inj ( 40 mg / ml 2 ml amp ) , injection 455 gentamicin inj ( 80 mg / ml ( 2 ml amp ) ) , injection 456 gentamycin 40 mg / ml 10 ml vial ( 10 ml vial ) , injection 457 glyceryl trinitrate 5mg / ml inj 10ml vial ( nitroglycerine ) ( 5mg / ml ) , injection solution for 458 glycopyrolate 0.5% 5ml and neostigmin 2.5 mg / 5 ml injection ( each ) , injection 459 glycopyrrolate inj. 0.2 mg / ml ( 1 ml amp ) , injection 460 haloperidol inj 5mg / ml ( 1 ml amp ) 461 hcg ( human chorionic gonadotropin ) inj 5000 iu vial 462 heparin inj ( 5000iu / ml 5ml vial ) , injection solution for 463 heparin ( 1000iu / ml 5ml vial ) , injection 464 hepatitis b immunoglobulin im inj 200 iu / vial 465 hepatitis b immunoglobulin ( 100 iu / vial ) , vial 466 human albumin solution i.p. 20%w / v ( 100 ml vial ) ( ) , injection solution for 467 human anti d. immunoglobulin ( monoclonal ) ( 300mcg / vial ) , injection 468 human chorionic gonadotropin inj 5000 iu 1ml amp 469 human insulin regular / soluble ( 100iu / ml ( 10ml vial ) ) , injection 470 human insulin regular / soluble ( 40iu / ml ( 10ml vial ) ) , injection 471 human normal immunoglobin ( 5gm / 100ml ) , injection 472 hydrocortisone sodium succinate ( 100 mg / vial ) , injection 473 hyoscine butylbromide 20mg / ml ( 1ml vial / amp ) , injection 474 insulin human mixtard inj. 30:70 ( ) , injection solution for 475 insulin soluble inj. 40 iu / ml 476 iron sucrose usp ( 100 mg / 5 ml ( 5 ml amp ) ) , injection 477 iron sucrose ( 20 mg ) , injection 478 isoxsuprine hydrochloride inj. 5mg / ml ( 2 ml amp ) ( 2 ml ) , injection solution for 479 iv human immunoglobin 5% iv ig ( 5mg / 100ml each ) , injection 480 ketamine hydrochloride ( 10mg / ml ( 10ml vial ) ) , injection 481 labetalol ( 20 mg / 4 ml ( 4ml amp ) ) , injection 482 lidocaine 2% inj. 30 ml vial ( ) , injection solution for 483 lignocaine 2 % ( 21.3 mg / ml ( 30 ml vial ) ) , injection 484 lignocaine 2% + adrenaline 5 mcg / ml ( 30 ml ) , vial 485 lorazepam2 mg / ml1 ml vial 486 magnesium suplhate injection i.p.50 % w / v ( 1 ml amp ) ( 1 ml amp ) , ampule 487 magnesium suplhate ( 50 % w / v ( 2ml amp ) ) , injection 488 mannitol inj. 20% 350ml ffs bottle 489 medroxy progesterone acetate ( 150mg / ml 1 ml amp ) , injection 490 mephentermine inj 30mg / ml ( 10 ml vial ) , injection 491 meropenem ( 1gm ) , injection 492 meropenem ( 500 mg / vial ) , injection 493 methyl ergometrine inj meleate ( 0.2 mg / ml ( 1ml amp ) ) , injection 494 methyl prednisolone sodium succinate inj. usp 125mg ( 10ml ) , vial 495 methyl prednisolone sodium succinate inj. usp 500mg 496 methyl prednisolone sodium succinate inj.1000mg vial 497 metoclopramide inj. 5mg / ml ( 2 ml amp ) 498 metoprolol inj 1 mg / ml ( 5ml vial ) , injection solution for 499 metronidazole 500mg / 100 ml ( 100 ml ffs bottle ) , injection 500 micronised progestrone ( 50 mg / ml 4 ml amp ) , injection 501 midazolam ( 1mg / ml ( 5ml amp ) ) , injection 502 midazolam ( 1mg / ml ( 5ml amp ) ) , injection 503 morphine sulphate inj. ip 10mg / ml ( 1ml ampoule ) , injection 504 morphine sulphate inj. ip 15mg / ml 505 multivitamin 10ml amp inj 506 n acetyl cysteine inj 200mg / ml in 10ml amp 507 naloxone inj. 0.4 mg / ml ( 1ml ampoule ) , injection solution for 508 neostigmine ( 0.5mg / ml ( 1ml amp ) ) , injection 509 nitroglycerine inj. usp 25 mg / 5ml ( 5ml amp ) 510 noraderanaline bitartrate ( 2 mg base / 2ml ( 2ml amp ) ) , injection 511 omeprazole 40mg ( vial ) , injection 512 ondansetron ( 2 mg / ml ( 2 ml amp ) ) , injection 513 oxytocin 10 iu / ml ( per ampolule ) , injection 514 oxytocin inj ( 5 iu / ml ( 1ml amp ) ) , injection 515 paracetamol inj ( 150mg / ml 2ml amp ( 2ml amp ) ) , injection 516 pentaprazole inj vial ( 40 mg ) , injection 517 pentazocin lactate ( 30mg / ml ( 1 ml amp ) ) , injection 518 pheniramine maleate ( 22.75 mg / ml ( 2 ml amp ) ) , injection 519 phenobarbitone ( 200 mg / ml ) , injection 520 phenytoin sodium inj. 100 mg ( ) , vial 521 phenytoin sodium ( 50 mg / ml ( 2ml amp ) ) , injection 522 phytomenadione injection ( 10 mg / ml ) , injection 523 piperacillin + tazobactam 1000 mg + 125 mg vial 10 ml vial ( ) , injection 524 piperacillin + tazobactum ( 4.5 g ) , injection 525 pralidoxime ( pam ) inj. 25 mg / ml ( 20 ml amp / vial ) , injection 526 promethazine inj 25 mg / ml ( 2 ml amp ) ( 2 ml amp ) , injection 527 promethazine ( 50mg ( 25mg / ml ) ) , injection 528 propofol 1% ( 10ml / 5ml 20ml ) , injection 529 quinine dihydrochloride ( 300mg / ml ( 2ml amp ) ) , injection 530 quinine sulphate inj. 300mg / ml . 531 rabies immunoglobulin inj 300 iu ( ( 2ml vial pfs ) ) , injection 532 rabies vaccine ip inj human ( chick embryo / vero cell culture ) intra muscular ( ) , injection solution for 533 ranitidine ( 50mg / 2ml , 2ml amp ) , injection 534 ringer lactate ip i / v 0.24 % w / v of lactic acid ( eq. to 0.32% w / v of sodium lactate ) , 0.6 % w / v sodium chloride, 0.04 % w / v potassium chloride and 0.027 % w / v calcium chloride ( 500ml ffs bottle ) , injection solution for 535 risperidone ( 12.5 mg ) , injection 536 snake venom anti serum ip liquid form ( ) , injection 537 sodium bicarbonate inj. 7.5% w / v ( 10ml ) , ampoule 538 sodium chloride n / 2 injection ip ( 0.45% ) ( 500ml ffs bottle ) , injection 539 sodium thiopentone inj. 0.5 gm powder / vial ( 20ml vial ) 540 sodium thiopentone ( 500mg ) , injection powder for 541 soluble insulin 30% isophane insulin 70% 100 iu inj 542 streptokinase inj 15 lac iu ( vial / amp ) , injection 543 succinyl choline ( 50mg / ml ( 10 ml vial ) ) , injection 544 teicoplanin ( 200 mg / vial ) , injection 545 tetanus immunoglobulin ( usp / ip 250 iu / vial ) , injection 546 tetanus toxide inj 5ml 547 tetanus toxiod 0.5ml 548 tramadol ( 100mg / ml ( 2 ml amp ) ) , injection 549 tramadol ( 50mg / ml ( 2ml amp ) ) , injection 550 tranexamic acid injection bp / ip ( 100mg / ml ( 5ml amp ) ) , injection 551 urokinase ( 5 lac iu / vial inj ) , injection powder for 552 vecuronium bromide inj 2mg / ml ( 2ml amp ) 553 vecuronium bromide inj 4mg / ml amp 554 vitamin b complex injection nfi formula 30ml / vial ( 30ml / vial ) , injection 555 vitamin b12 inj 500 mcg / ml ( 30 ml amp ) 556 vitamin k1 ( 1mg / 0.5ml ( 0.5 ml amp ) ) , injection 557 water for injection 5 ml amp 558 water for injection inj 10 ml amp 559 water for injection ip ( 2 ml amp ) , injection 560 iv fluid 561 ciprofloxacin inj 100 mg / 50ml ( 100ml ffs bfs bottle ) 562 dextrose 10% 500ml 563 dextrose 25% 100ml 564 dextrose 25% inj 500ml 565 dextrose 5% 500ml 566 dextrose with saline 5% + 0.9% inj 500ml 567 electrolyte m inj 500ml 568 electrolyte p inj 500ml 569 fluconazole iv ( 2mg / ml ( 100ml bottle ) ) , injection 570 halothane bp 250ml 571 human normal immunoglobin ( 5gm / 100ml ) , injection 572 isoflurane inhalation 573 mannitol inj. 20% 350ml ffs bottle 574 mannitol injection i.p. 20% 100ml bottle 575 normal saline 0.9% 500ml 576 ringer lactate inj iv 500ml 577 sodium chloride 0.9% injection ip 100ml bottle 578 eye drops / ear drops 579 atropine sulphate 1% ( 5 ml vial ) , eye drop 580 atropine sulphate eye drops 1% ( 5 ml vial ) ( 5 ml vial ) , eye drops / ointment 581 atropine sulphate eye ointment ( 1% ) , ointment 582 carboxymethylcellulose eye drop ip 1% w / v 10ml vial ( sodium cmc also accepted ) , eye drop 583 carboxymethylcellulose ( 5 ml ) , eye drop 584 cerumenolytic ( for ear wax ) each 10 ml contains paradichlorobenzene 2%benzocaine 2.7%chlorbutol 5%turpentine oil 15% ( 10 ml vial ) , ear drops 585 chloramphenicol 0.5% ( 5ml ) , eye drop 586 chloramphenicol eye ointment 1% ( 4 gram ) , tube 587 chloramphenicol ( 1% ( 5 ml vial ) ) , eye drop 588 ciprofloxacin + dexamethosone ( 0.3%+0.1% ) ( 5ml ) , eye drop 589 ciprofloxacin 0.3% ( 5ml vial ) , eye drop 590 ciprofloxacin eye ointment 0.3% ( 3gm tube ) 591 clotrimazole + lignocaine ear drop 1% ( 5ml vial ) , drop 592 clotrimazole 1%w / v +lignocaine 2%w / v ear drop 10ml vial bfs / ffs squeeze ( 10ml vial ) , vial 593 combo ear drop ( chloramphenicol 5% w / v + clotrimazole 1% + lignocaine hydrochloride 2% ) , ear drop 594 fluconazole eye drop 3 mg / ml ( 10 ml vial ) ( 3 mg ) , eye drop 595 gentamicin 0.3% eye / ear drops ( 5ml ffs squeeze vial ) , eye drop 596 moxifloxacine eye drop 0.5%w / v 597 ofloxacin + dexamethasone 10 ml eye drop ( 10 ml ) , drop 598 ofloxacin + dexamethosone ( 0.3%+ 0.1% ( 10 ml ) ) , eye drop 599 ofloxacin 0.3% w / v of ofloxacin ph.eur. ( 5 ml vial ) , eye drop 600 timolol maleate eye drop i.p. 0.5 %w / v ( 5 ml vial ) ( 5 ml ) , solution 601 cream / ointment 602 aciclovir 3% ( 5gm tube ) , ointment 603 aciclovir cream 5% ( 5g tube ) ( ) , cream 604 acyclovir 5% ( 5gm ) , ointment or cream 605 atropine sulphate eye ointment 1% ( 3 gm tube ) 606 beclomethasone dipropionate, clotrimazole, neomycine sulphate, chlorocresol ( 0.025% + 1% + 0.5% + 0.1% w / w ( 5gm tube ) ) , ointment or cream 607 beclomethasone dipropionate, neomycin sulphate, miconazole nitrate ( 0.025 % + 0.5 % + 2 % ( 5 gm tube ) ) , ointment 608 benzoic acid + salicylic acid ( 6% + 3% ( 15 gm tube ) ) , ointment 609 benzoyl peroxide 2.5% 20 gm ( ointment / gel ) , tube 610 betamethasone dipropionate ( 0.05% ( 15gm ) tube ) , ointment or cream 611 betamethasone valerate cream 0.05% ( 15gm tube ) , ointment 612 betamethasone valerate oint 0.1% ( 15 gm tube ) , ointment 613 betamethasone valerate oint / cream ip. 0.12% 614 bisacodyl ( 5 mg ) , suppository 615 calaminelotion ( ( contains per 1000 ml: calamine 150 gm, zinc oxide 50 gm, bentonite 30 gm, sodium citrate 5gm, liquified phenol 5ml, glycerin 50 ml purified waterfreshly boiled and cooled to produced 1000ml ) 50 ml bottle ) , lotion 616 cetrimide cream bp ( 0.1% w / w ) , tube 617 cetrimide cream solution 20% concentrative for dilution ( 0.2 mg ) , cream 618 chloramphenicol eye ointment 1% ( 4 gram ) , tube 619 ciprofloxacin eye ointment 0.3% ( 3gm tube ) 620 clobetasol 0.05% + gentamicin 0.1% cream 10 gm ( 10 gm tube ) , cream 621 clotrimazole cream 1% ( 15 gm tube ) , cream 622 clotrimazole i.p. 2%w / w ( 15gm tube ) , cream 623 compound benzoic acid ointment 624 framycetin sulphate 1% cream ( 30 gm tube ) , cream 625 fusidic acid 0.02 ( 15 gm ) , cream 626 fusidic acid cream / sodium fusidic ointment 2% 5gm tube ( 5 gm ) , tube 627 fusidic acid cream / sodium fusidic ointment 2% 5gm tube ( 5 gm ) , tube 628 gamma benzene hexachloride solution / lotion 1% ( ( 100 ml ) ) , bottle 629 gentamycin sulphate 0.1% ( 15gm tube ) , ointment 630 lignocaine hydrochloride ( 2% w / v ( 30 gm tube ) ) , gel 631 miconazole cream i.p. 2% w / w ( 15 gm tube ) , cream 632 mupirocin ( 2% w / w ( 5 gm tube ) ) , ointment 633 neomycin sulphate+bacitracin zinc ( 5mg+500 iu / gm ointment ( 15gm tube ) ) , tube 634 permethrin 5% ( 30 gm ) , cream 635 permethrin lotion 5% w / v 60 ml bottle 636 povidone iodine cream 250 gm 637 povidone iodine ointment 5% 15gm tube 638 povidone iodine ointment 5% 250gm jar ( ) , each 639 povidone iodine ointment 5% ( 15gm tube ) , tube 640 povidone iodine vaginal ( 200 mg ) , pessary 641 povidone iodine ( 5% 100 ml ) , solution 642 salicylic acid ointment ( 6% ) , ointment 643 salicylic acid ( 0.02 30 gm ) , ointment 644 silver sulphadiazine cream usp 1% ( 500 gm jar ) , cream 645 silver sulphadiazine cream ( usp 1% w / w 25gm ) , tube 646 soframycin ointmenttube / ointment 647 consumables / disposible material 648 adhesive plasters usp 7.5 cm x 5 mts / roll 649 adhesive roll 1 inch x 5 m / roll 650 alkaline phosphatase ( alp ) dea 300 ml ( model ba 400 system ( mfg bybio system ) ) , consumable 651 alkaline phosphatase kit ( kinetic ) 10x2.2ml 44 test / kit consumable 652 auto pippets fixed volume 10 micro liters each 653 auto pippets fixed volume 1000 micro liters each 654 auto pippets fixed volume 20 micro liters each 655 benedicts qualitative reagent ( 1x5 lit ) , consumable 656 bilirubin ( direct ) as 300 ml ( model ba 400 system ( mfg bybio system ) ) , consumable 657 bilirubin ( total ) 600 ml ( model ba 400 system ( mfg bybio system ) ) , consumable 658 bilirubin caoillary heparinised vitrex ( one packet contain 100 capillary ) , consumable 659 bilirubin kit ( colorimeter semi auto ) 4x60 ml 480 test / kit consumable 660 bilirubin standard 1x5 ml ( model ba 400 system ( mfg bybio system ) ) , consumable 661 blood agar powder ( 500 grm ) , consumable 662 blood bag 100ml 663 blood bag 350ml 664 blood gluose ( god / pod ) semi auto end point ( 1000 ml ) , consumable 665 blood grouping anti sera a monoclonal 666 blood grouping anti sera a, b and d combo kit monoclonal 667 blood grouping anti sera b monoclonal 668 blood grouping anti sera d monoclonal 669 blood urea reagent kit 670 capillary tube 100 pieces consumable 671 cholesterol hdl direct 160 ml ( model ba 400 system ( mfg bybio system ) ) , consumable 672 cholesterol kit end point enzymatic kit 5x20ml 200 test / kit 673 conc hcl ( 1x500 ml = 500 ml ) , consumable 674 cover slip 18 x 18 mm 10gm 675 cover slip with isi marked size:18x18mm ( + / 1.00mm ) , thikness 0.13.. to 0.17mm ( pkt of 50 pieces ) , consumable 676 creatine calorimeter for semi auto kinetica 4x60ml 480 test kit 677 creatinin kit 678 crp kit 1x100 biolab qualitative ) 679 crp test kit ( latex / card ) , kit of 25 tests ( mfg pathogyme diagnostics ) ( 25 test / kit ) , consumable 680 cvc diluent 681 diagnostic strips for urine sugar / albmin packing: 100 strip / pkt 682 dialysis starting kit disposable:a ) sterile tray with top ( disposable ) , size not less than 30x30cm b ) sterile drape size not less than 45x45 cm 1no c ) cotton ball 6 no d ) cotton gauze pieces 1 683 digital x ray film 10x12 ( 150 films / pkt ) 684 digital x ray film 11x14 ( 150 films / pkt ) 685 digital x ray film 8x10 ( 150 films / pkt ) 686 disposable appron consumable 687 disposable cap 688 disposable examination gloves made of natural rubber latex, pre powdered, non streile medium 689 disposable examination gloves made of natural rubber latex, pre powdered, non streile, conforming to is 15354:2003 and amendment thereof. size: large 690 disposable needles 22g consumable 691 disposable needles is 10654:2002 26 g ( ) , needle 692 disposable paper gloves size 7 inches consumable 693 disposable paper gloves size 7, 1 / 2 inches consumable 694 disposable plastic appron ( full size ) 695 disposable pricking lancet ( pkt of 100 units ) 696 disposable sharp collection containers 1.5 l 697 disposable sterile gloves size 61 / 2 inches consumable 698 disposable sterile gloves size 7, 1 / 2 inches consumable 699 disposable sterile hypodermic syringe 10ml ( each ) , consumable 700 disposable suction catheter ( size 12 ) , consumable 701 disposable suction catheter ( size 14 ) , consumable 702 disposable surgeon cap ( box of 100 caps ) 703 disposable syringe ( for vitamin k inj ) ( 1ml with needle 26g ) , consumable 704 disposable syringe with needle ( 2ml each ) , syrings 705 disposable syringe with needle ( 3ml each ) , syrings 706 disposable syringe with needle ( 5ml each ) , needle 707 edta k3 vial each 708 falcon tube 709 field stain a 500ml 710 field stain b 500ml 711 filter paper sheet ( ( whatmann no 01 ) sheets ) , consumable 712 fixer: it shall be powder fixer to produce clean radiographs available in pack size size: 13.5 ltr 713 fixer: it shall be powder fixer to produce clean radiographs available in pack size size: 9 ltr 714 formaldehyde 40% ( conc. formaline ) ( 1 x 30 lit ) , consumable 715 g6pd deficiency test kit ( mfg pathogyme diagnostics ) ( 10 test / kit ) , consumable 716 glacial acetic acid ( 2.5 liter ) , consumable 717 glass slide with isi mark at least 75mm x 25 mm thickness at least 1.1mm, detail specifications i with smooth edges, without any scrathtches. ii glazed glass.iii no visual or chromatic abbretions ( 50 slides / packet ) , consumable 718 glass test tube 12 x 100 ( medium size ) heavy quality 100 / pkt 719 glass test tube 12 x 75 ( small size ) heavy quality 100 / pkt 720 glucometer strip ( 1x100 ) 721 glucose kit ( god / pod ) ( 350ml ) , digonstic 722 hand wash liquid 500ml 723 hbs antigeng kit card ( pack of 10 card test with 10 dropper, 1 buffer solution, 10 pricking lancet and 10 alcohol swab ) , digonstic 724 hcl n / 10 ( 500 ml bottle ) 725 hcv kit card test ( 25 test / kit ) , digonstic 726 heamoglobin colour scale book with special strip complete ( 1 x 200 ) , consumable 727 hematology cell counter reagents as per requirement of cell counter cleaning solution 100 ml 728 hemoglobin color scale ( starter kit ) components ( 1 ) color scale 01 / kit ( 2 ) test strip 1000 / kit ( 3 ) printed literature for method of use / kit ( 4 ) lancet 1000 / kit 729 hiv elisa kit ( hiv micro elisa ag+ab 4th generation ) ( 96 test kit ) , consumable 730 hiv kit card ( 25 test / kit ) 731 hub cutter non electric lockable safety portable box for disposal of hypodemic needles. consumable 732 hydrogen peroxide ( conc. ) h2o2 ( 500 ml ) , consumable 733 ice gel pack 734 kellys pad disposable 735 leishman stain 500 ml 736 malaria antigen, p vivax, p falciparum rapid diagnostics bivalentt test card ( as per gio nvbdcp specification ) pack of 10 card test with 10 dropper, 1 buffer solution, 10 pricking lancet, and 10 alcohol swab 737 methyline blue ( 100 ml ) , solution 738 micro pipet 1000 fix and variable each 739 micropiptte 100 1000 740 microtips ( 2 200 ul ) 1x1000 ( each ) , consumable 741 n 95 mask ( as per attached specification ) , consumable 742 nebulization mask kit ( pediatrics ) 743 nebulization mask kit ( adult ) 744 new born baby kit [ 4 piece set ] 745 oxygen mask adult ( standard size ) 746 oxygen mask paediatric ( standard size ) 747 paraffin strip roll 748 pregnancy test card ( 10 card pack ( mfg oscar medicare pvt ltd ) ) , consumable 749 ra factor 50 test kit qualicative 750 ra factor rapid kit ( 25 test / kit ) 1: ) should be based on latex agglutination slide test. 2: ) qualitative and semiquantitative testing facility possible. 3: ) test speed must be less than 2 minutes 751 sputum cup 752 test tube 12 x 100 ( medicm size ) 100 / pkt 753 test tube 12 x 75 ( small size ) 100 / pkt ( 12 x 75 ( small size ) 100 / pkt ) , tube 754 test tube 15x125 755 thermacol box 756 three layer surgical mask 757 tips for auto pipettes 200 to 1000 micro litres 500 / pkt ( 200 to 1000 micro litres 500 / pkt ) , each 758 tips for auto pippetes 10 to 100 micro litres 759 tissue paper roll ( each ) , consumable 760 tourniquetbelt 761 typhoid card test kit ( for igg and igm antibody detection ) ( 25 test kit ) 762 typhoid test card. 763 umbical cord clamps plastic material ( box of 100 clamps ) ( mfg by precious life care ) , consumable 764 umbical cord clamps plastic material ( box of 100 clamps ) , consumable 765 urine albumin & suger 766 urine container size of the container shall be 30ml disposable ( 50 per pkt ) , consumable 767 usg gel ( mfg precious life care pvt ltd ) ( 250 ml bottle ) , consumable 768 vdrl ( rpr ) 1x100 sd strip 769 vdrl kit ( strip ) ( 50 test / kit ) , consumable 770 zipper polybag 771 surgical spirit ( 100ml ) , bottle...

Public Health Engineering Department - Madhya Pradesh

31147814 schedule of quantity for supply of chemicals for crm 11 parameters nabl for subdivision laboratory ambah and sabalgarh distt morena 1 auto zero burette capacity 50 ml with reservior capacity 2000ml 50ml ( white colour ) ( nabl ceritified ) 2 auto zero burette capacity 50 ml with reservior capacity 2000ml 50ml ( ambar ) ( nabl ceritified ) 3 pipette 10ml ( nabl ceritified ) 4 pipette 20ml ( nabl ceritified ) 5 pipette 50ml ( nabl ceritified ) 6 measuring cylinder 10ml ( nabl ceritified ) 7 measuring cylinder 25ml ( nabl ceritified ) 8 measuring cylinder 50ml hexagonal ( nabl ceritified ) 9 measuring cylinder graduate 100ml ( nabl ceritified ) 10 measuring cylinder 500ml ( nabl ceritified ) 11 pipette controller plastic graduate 10ml 12 pipette controller plastic graduate 20ml 13 pipette controller plastic graduate 50ml 14 petry disk 0.47ml 15 conical flask 250ml 16 conical flask 400ml 17 beaker 100ml 18 beaker 400ml 19 beaker 2000ml 20 beaker 2000ml 21 reagent bottle 100ml ( fshm ) 22 reagent bottle 250ml ( fshm ) 23 reagent bottle 500ml ( fshm ) 24 pipette graduate 1ml ( nabl ceritified ) 25 volumetric flask 100ml ( nabl ceritified ) 26 funnel 4 dia 27 nesselar cylinder 100ml 28 gooch crucibal 30ml 2.1 or 2.4 ( nabl ceritified ) 29 sintered disk g 5 1 2 ( nabl ceritified ) 30 sample bottle 2 ltr plastic 31 sample bottle 4 ltr plastic 32 beaker 250ml 33 glass beeds 500 gram 34 glass rod 4 50pkt 35 pipette 5ml ( nabl ceritified ) 36 reagent bottle 125 ml 37 beaker 50ml 38 beaker 200ml 39 bod bottle 300 ml 40 bod bottle 500 ml 41 reagent bottle 2000ml 42 test tube 50x150 43 test tube 50x100 1 edta solution n / 50 ml 2 sulphuric acid n / 50 500 ml 3 silver nitrate 0.0141 500 ml 4 nacl 500gram 5 ammonia buffer solution 500ml 6 eriochrome black t indicator 100ml 7 ammonium purpurate 5gram 8 naoh 500ml 9 potassium chromate 100ml 10 1:10 phenon throlime 500ml 11 cons. hcl 500ml 12 sodium acetate 500 ml 13 hydroxyl amine hydro chloride 500ml 14 pda 500ml 15 ammonia solution 500 ml 16 barium chloride 500gram 17 conditioning reagent 500ml 18 alizarin red zirconyl mix indicator 500ml 19 ammonium per sulphate 500gram 20 cons. sulphuric acid 500ml 21 phonophaline indicator 100ml 22 mixed indicator 100ml 23 o.t. solution 500ml 24 universal indicator 500ml 25 methanol 500 ml 26 m 7 fc agar media 500 gram 27 sodium thiosulphate 500ml 28 nitric acid 500ml 29 ph buffer standard 7.0 500ml nist 30 ph buffer standard 4.0 500ml, nist 31 ph buffer standard 9.2 500ml, nist 32 calcium satandard 2000mg 475ml nist 33 alkalinity standard 500ml ( sodium carbonate ) , nist, 0.1 n nist 34 chloride standard 500mg / lit. , nist 35 iron standard 475ml , nist 36 nitrate standard 475ml , nist 37 fluoride standard 500ml, nist 38 manganese standard 500ml, nist 39 sulphate standard 500ml, nist 40 colour standard 250ml , nist 41 turbidity standard 400ntu 500ml , nist 42 what men filter paper 12.5cm 1pkt 43 membrane filter 0.45 1pkt 44 cottan 500gram 45 burette pump rubber 46 spefula law steel 47 tong steel 48 washing brush 49 tissue paper 1pkt 50 paper acid washed 2 2.5 cm 51 distilled water iron free 52 conductivity standard 475ml nist 53 special reagent 500ml 54 glacial acetic acid 500ml 1 turbidity meter meter model no. 135 systronics, 4 ranges 0 1, 0 10, 0 100, 0 2000 , orion ( nabl ceritified ) 2 ph meter model no. 362 orion systronics, ranges 0 14, resolution 0.001, accuracy ±0.002 ph, ( nabl ceritified ) 3 tds meter 308 orion systronics, ranges 0.1 ppm to 200 ppt, accuracy ±15 ( nabl ceritified ) 4 conductivity meter 304 orion systronics, ranges 0.1 micromhose to 200 ms ( nabl ceritified ) 5 spectrophotometer 166 systronics ( nabl ceritified ) 6 oven ( hot air ) 12”x12” 7 auto clave 14”x22” 8 distillation plant 9 fridge 10 sample fridge ( with temperature 0 80 c ) ( nabl ceritified ) 11 memran filter assembly 47 mm with pump ( tarson ) 12 water bath 13 incubater bod ( nabl ceritified ) 14 hot plate 15 electronic balance lc 0.1mg, 200 gm capacity ( nabl ceritified ) 16 hydrometer range 1 2 point gradation ( nabl ceritified ) 17 hygrometer, for humidity and temperature range 0 100% ( nabl ceritified ) 18 digital therm meter ( nabl ceritified ) 19 apron 20 google 21 fist aid kit 22 weight box e 2, 23 weight including fractitional weights 200 gm 23 vaccum desicator 250 mm with cover borosil ( nabl ceritified ) ...

Madhya Pradesh Power Generating Company Limited - Madhya Pradesh

31042486 procurement of fine chemicals at chemistry laboratory, 2x660 mw, ph ii, sstpp, mppgcl, dongalia p 1 2 propanol ( packing size 2.5 l ) 2 glacial acetic acid ( packing size 2.5 l ) 3 hydroxylammonium chloride ( packing size 100 g ) 4 sodium hydroxide pellets ( packing size 500 g ) 5 ammonium acetate ( packing size 500 g ) 6 sodium sulfite ( packing size 500 g ) 7 oxalic acid ( packing size 500 g ) 8 hydrochloric acid ( 35% ) ( packing size 5 l ) 9 test chlor ( packing size 100 ml ) 10 kcl standard solution ( 1413 μs ) ( packing size 480 ml ) 11 potassium chloride ( packing size 500 g ) 12 universal ph indictaor ( packing size 500 ml ) 13 0.45μm membrane filter paper ( dia. 47mm ) ( packing size 1 pc. ( 100 in each ) ) 14 kcl standard solution ( 147 μs ) ( packing size 500 ml ) 15 mercuric iodide red ( packing size 100 g ) 16 toluene ( packing size 2.5 l ) 17 edta disodium salt ( packing size 500 g ) 18 1, 10 phenanthroline ( packing size 25 g ) 19 sodium metabisulfite ( packing size 1 kg ) 20 buffer tablets ph 4.0 ( packing size 1 pc ( 20 tab ) ) 21 buffer tablets ph 7.0 ( packing size 1 pc ( 20 tab ) ) 22 buffer tablets ph 9.0 ( packing size 1 pc ( 20 tab ) ) 23 turbidity standard 4000 ntu ( packing size 100 ml ) ...

Department of Higher Education - Madhya Pradesh

30982231 bids are invited for ferocyanide , glacial acetic acid , glucose , ferroussulphate , calcium sulphate , hydrochloric acid ( dilute ) , hydrochloric acid ( conc. ) , hydroxyl amine , isoproponol , formic acid , iodoform , iodine crystal , iodine solution , dinitro benzene , isopropyl alcohol , iron particles , charkol , lead oxide , liquid ammona , lead acetate solution , meryric chloride , meta dinipobenzene , methyl orangeinclicator , methyl alcohol , methyl acetate , magnesiumcrystal , manganese dioxide , magnisium carbonate ( mgco3 ) , methyl oxalate , mercuric nitrate , nitric acid ( cone ) , nitric acid ( dil. ) , 2.4 dinitrophenylhydrazine , naphthoi , b naphthol , nitro benzene , nickel choride , oxalic acid , potessium hydroxide , potassium todide , phenolphthalein indicator , phenol , potassium permagnate , prcaic acid , pthadic acid , potassium dichoomate , potassium nipate , resorcinol , raney nickel , stannouschloride , strontium choride , sodium metal , sulphuric acid ( conc. ) , sulphuric aud ( dilute ) , sodium nitropruside , sodium nitropate , sodium hydroxide , salicylic acid , silicon, silver , salt of lead , sodium bicarbonate , shiff reagent , sodium sulphate , sodium nitrite , succinic acid , succinicanhydride , starch , sodium hypochlorite , silica gel , sodium thiosulphate , phthalic anhydride , seric ammoniumnitrate , thiourea , tartearic acid , tissue paper , trinitrobenzene , toluene , tollen reagents , sodiumchloride , urea , sucrose , watch glass ( 3?&4 ) , testtube holder , funnel ( glass ) , flask ( 250ml ) , flask ( 100ml ) , flask ( 50 ml ) , conical flask ( 250 ml ) , conical flask ( 20 ml ) , conical flask ( 50 ml ) , testtube ( 10ml ) , reagent bottle ( 100ml ) , reagent bottle ( 50ml ) , beaker ( 100ml ) , beaker ( 250 ml ) , beaker ( 500ml ) , test tube holder , beaker ( 50ml ) , beaker ( 20ml ) 2 / 112ml ) , test tube holder , beaker ( 50ml ) , beaker ( 20ml ) total quantity : 80622...

Directorate Of Health Services - Madhya Pradesh

30887701 supply of drugs surgical sutures materials equipment etc supply of drugs surgical sutures materials equipment etc , tablet , acetazolamide tab ( 250mg ) , tablet , acyclovir tab 400 mg ( 400 mg ) , tablet , acyclovir ( 800mg ) , tablet , albendazole tablets ip 400mg , alprazolam ( 0.5mg ) , tablet , aluminium hydroxide+magnesium aluminium silicate+magnesium hydroxide+simethecon ( tab 300 mg+50mg + 25 mg+25 mg ) , tablet , amlodipin tab ( 5mg ) , tablet , amlodipine ( 10mg ) , tablet , amlodipine ( 2.5mg ) , tablet , amoxicillin + clavulanic acid ( 200 mg + 28.5 mg ) , tablet , amoxicillin trihydrate dispersible 125 mg tab ( 125 mg ) , tablet , amoxycillin and clavulanic acid i.p. ( 500mg + 125mg ) , tablet , amoxycillin dispersible tablets ip amoxicillin trihydrate ip equivalent to amoxicillin ( 250mg ) , tablet , antacid chewable tablet containing aluminum hydroxide equivalent to dried gel 250mg+ magnesium hydroxide 250mg+ simethicone 50mg usp , anticold ( paracetamol 300mg+cetirizine hcl 5mg tablet , ascorbic acid ( vitamin c ) tab i.p. ( 500mg ) , tablet , aspirin low dose 75mg tab , atenolol ( 100mg ) , tablet , atenolol ( 25 mg ) , tablet , atorvastatin ( 10 mg ) , tablet , atorvastatin ( 20mg ) , tablet , atorvastatin ( 40mg ) , tablet , atorvastatin ( 5 mg ) , tablet , carbamazepine ( sr ) 100 mg tab , carbamazepine tab ( 400mg ) , tablet , carbamazepine ( 200 mg ) , tablet , cefadroxil 250 mg tab , cefadroxil 500 mg tab , cefixime ( 50 mg dt ) , tablet , cefpodoxime 100 mg ( ) , tablet , cefpodoxime ( 200 mg ( dispersible tab ) ) , tablet , cefpodoxime ( 50 mg ) , tablet , cefuroxime 250 mg, tablet , cefuroxime 500 mg, tablet , cephalexin dispersible ( 125 mg ) , tablet , cetirizine ( 10 mg ) , tablet , chewable antacid containing magnesium hydroxide minimum 250mg to 500mg+aluminimum hydroxide minimum 250mg to 500mg +simethecon / dimethicon minimum 25mg to 50mg tab ( additional component will also be accept ) , tablet , chloraxozone + paracetamol 250 mg + 500 mg tab , chlorpromazine hydrochloride ( 25 mg ) , tablet , chlorpromazine ( 50 mg ) , tablet , cinnarizine ( 25 mg ) , tablet , ciprofloxacin + tinidazole ( 250 mg + 300 mg ) , tablet , ciprofloxacin 500mg + tinidazole 600mg ( ) , tablet , clobazam ( 5 mg ) , tablet , clobazam ( 10 mg ) , tablet , clonazepam 0.25 mg ( tablet ) , tablet , clonazepam ( 1 mg ) , tablet , clopidogrel ( 75 mg ) , tablet , deferasirox dispersible ( 250mg ) , tablet , deferasirox dispersible ( 500mg ) , tablet , dexamethasone ( 0.5mg ) , tablet , dexamethasone ( 4 mg ) , tablet , diazepam ( 5 mg ) , tablet , diclofenac 50mg +seratopeptidase 10mg tab ( 10mg ) , tablet , diclofenac sodium + paracetamol +serratiopeptidase 50 mg +325 mg + 10 mg tab , diclofenac sodium 50mg + paracetamol 325mg tab , diclofenac+paracetamol+chlorzoxazoe ( 50 mg + 325 mg + 250 mg ) , tablet , dicyclomine hydrochloride ( 20 mg ) , tablet , diethylcarbamazine tab ( 100mg ) , tablet , diethylcarbamazine ( 50 mg ) , tablet , digoxin tab 0.25mg ( 25x10 ) , tablet , dilitiazem tablets i.p. 30 mg , diltiazem tablet ( 60 mg ) , tablet , dispersible zinc tab ( 10mg ) , tablet , dispersible zinc ( 20mg ) , tablet , disulfiram 250 mg tab , divalproex sodium 250 mg tab , divalproex sodium 500 mg tab , divalproex sodium 750 mg tab , domperidone ( 10mg ) , tablet , doxycycline tab. 100mg ( ) , tablet , doxylamine succinate + pyridoxine ( 10mg+10mg ) , tablet , doxylamine succinate ( 10 mg ) , tablet , drotaverine ( 40 mg ) , tablet , drotaverine ( 80 mg ) , tablet , dydrogesterone 10 mg tab , enalapril maleate tab ( 5mg ) , tablet , erythomycin stearate ( 250mg ) , tablet , erythromycin stearate ( 500 mg ) , tablet , escitalopram 10mg tablet ( 10x10 ) , tablet , escitalopram ( 20 mg ) , tablet , escitalopram ( 5 mg ) , tablet , ethamsylate 250mg tablet , ethamsylate tab 250 mg ( ) , tablet , etiophylline theophylline sr tab. 300mg ( ) , tablet , etophylline + theophylline sr tablet 231mg + 69mg ( ) , tablet , ferrous ascorbate 100mg ( elemental iron ) +folic acid 1.5mg tablet , fluconazole 100 mg tab , fluconazole ( 150 mg ) , tablet , flunarizine 10 mg tab , fluphenazine ( 2.5 mg ) , tablet , folic acid ip ( 5 mg ) , tablet , furazolidone ( 100mg ) , tablet , gabapentine ( 100 mg ) , tablet , glibenclamide ( 5 mg ) , tablet , gliclazide ( 80 mg ) , tablet , griseofulvin ( tablet 250 mg ) , tablet , haloperidol ( 5mg ) , tablet , hydrochlorthiazide ( 12.5 mg ) , tablet , ibuprofen 400mg+ paracetamol 325mg tablet ( ) , tablet , ibuprofen ( 200 mg ) , tablet , ibuprofen ( 400mg ) , tablet , iron and folic acid enteric coated tab dried ferrous sulphate equ. to ferrous iron 100 mg and folic acid 0.5 mg ( blue tablet ) , iron and folic acid enteric coated tab. dried ferrous sulphate ip equ. to ferrous iron 100 mg and folic acid ip 0.5 mg granules ( red tablet ) ( ) , tablet , iron and folic acid entric coated tab. ferrous suplhate ip 333.335mg equivalent to 100mg of elemental ( red tablet ) , tablet , iron and folic acid sugar coated tab dried ferrous sulphate ip eq. to 45 mg ferrous iron and 400 mcg folic acid ip ( pink colored tab ) wifs junior ifa tablets ( detail specification as per tender ) ( 400 mcg ) , tablet , isosorbide mononitrate ( 20mg ) , tablet , isosorbide 5 mononitrate ( tab.20 mg ) , tablet , isoxsuprine ( 10mg ) , tablet , ketoconazole tab 200mg ( ) , tablet , labetalol ( 100 mg ) , tablet , lactobacillus ( ( lactobacillus 60 million spores ) ) , tablet , levocetirizine + monteleukast ( 5 mg + 10 mg ) , tablet , levofloxacin ( 250mg ) , tablet , levofloxacin ( 500mg ) , tablet , lorazepam 1 mg tab , lorazepam ( 2 mg ) , tablet , losartan tab 25 mg ( 10x10 ) , tablet , losartan ( 50 mg ) , tablet , magnesium hydroxide and aluminium hydroxide ( ) , tablet , medroxy progesterone acetate 10 mg tab , mefenamic acid + dicyclomine tab ( 250 mg + 10 mg ) , tablet , mefenamic acid + drotaverine hcl 250 mg + 80 mg tab , metformin + glimepiride 500 mg + 2 mg tab , metformin 500mg + gliclazide 80mg tablet ( 10x10 ) , tablet , metformin ( 500 mg ) , tablet , metformine 500mg + glibenclamide 5mg ( tab ) , tablet , methyl prednisolone sodium succinate tablet 8 mg , methyl prednisolone tab ( 16 mg ) , tablet , methyl prednisolone ( 4mg ) , tablet , methyl prednisolone ( 8mg ) , tablet , methylcobalamin / mecobalamin ( 500 mcg ) , tablet , metoclopramide ( 10mg ) , tablet , metoprolol ( 50mg ) , tablet , metronidazole tab ( 400mg ) , tablet , micronised progesterone ( 100 mg ) , tablet , micronised progestrone ( 200 mg ) , tablet , mifepristone 200mg ( 1 tab ) +misoprostol 200mcg ( 4 tab ) ( combipack ) , tablet , mirtazapine 15 mg ( tablet ) , tablet , misoprostol 400 mcg 4 tablets / strip , misoprostol ( 200mcg ) , tablet , nifedipine tablets 10mg tab , nimesulide +paracetamol ( 100 + 325 mg ) , tablet , nimesulide ( 100 mg ) , tablet , nitrofruantoin ( 100mg ) , tablet , norfloxacine 400mg and tinidazole 600mg ( tab ) , tablet , ofloxacin + ornidazole ( 200mg and 500mg ) , tablet , ofloxacin tab 400 mg ( ofloxacin tab 400 mg ) , tablet , olanzapine 2.5 mg tab , olanzapine 7.5 mg tab , olanzapine ( 5 mg ) , tablet , ornidazole tab ( 500 mg ) , tablet , pantoprazole 40 mg, domperidone 10 mg ( tab ) , tablet , pantoprazole tab ( 40 mg ) , tablet , paracetamol tab 650 mg ( 650 mg ) , tablet , paracetamol ( 500mg ) , tablet , penicillin v ( phenoxymethyl penicillin potassium ) ( 250 mg ) , tablet , pentoprazole 40mg, domperidone 10mg tab tablet , phenobarbitone tab. 60 mg ( ) , tablet , phenobarbitone ( 30 mg ) , tablet , phenytoin sodium ( 100mg ) , tablet , prednisolone ( 10 mg ) , tablet , prednisolone ( 5mg ) , tablet , primaquin ( 2.5mg ) , tablet , primaquin ( 7.5mg ) , tablet , promethazine tab ( 25 mg ) , tablet , promethazine ( 50 mg ) , tablet , propranolol tab ( 10 mg ) , tablet , quinine sulphate ( 300mg ) , tablet , quinine sulphate ( ip 600mg ) , tablet , rabeprazole ( 20 mg ) , tablet , ramipril ( 2.5 mg ) , tablet , ramipril ( 5 mg ) , tablet , ranitidine ( 150mg ) , tablet , roxithromycin 150mg tablet , salbutamol sulphate ( 4mg ) , tablet , secnidazole ( 500 mg tab ) , tablet , serratiopeptidase 10 mg tab , sodium valporate 300 mg tab , sodium valproate + valproate 333 mg + 145 mg ( tablet ) , tablet , sodium valproate enteric coated tab. bp ( 200 mg ) , tablet , sodium valproate ( 200mg ) , tablet , sulfamethoxazole +trimethoprim tab ( 200 mg + 40 mg ) , tablet , sulfamethoxazole and trimethoprim ( 100 mg and 20mg ) , tablet , sulfamethoxazole and trimethoprim ( 400mg + 80mg ) , tablet , sulfamethoxazole and trimethoprim ( 800mg + 160mg ) , tablet , telmisartan, hydrochlorthiazide ( 40 mg + 12.5 mg ) , tablet , telmisatran ( 40 mg ) , tablet , thyroxine sodium tab 100 mcg ( 100 tab bottle ) ( 100 tab ) , tablet , tinidazole ( 300 mg ) , tablet , tinidazole ( 500mg ) , tablet , torasemide tab ( 20mg ) , tablet , torasemide ( 10mg ) , tablet , tramadol ( 50mg ) , tablet , tranexamic acid 500 mg tab tablet , verapamil ( 40 mg ip ) , tablet , vitamin b1 10mg, b2 10mg, b6 3mg, b12 15mcg, niacinamide 100mg, calcium panthenol 50mg, folic acid 1.5mg, vitamin c 150mg, biotin 100mcg or more tab ( ) , tablet , vitamin b1 10mg, b2 10mg, b6 3mg, b12 15mcg, niacinamide 75mg, calcium panthenol 50mg ( folic acid 1.5mg, vitamin c 150mg, biotin 100mcg or more ) , tablet , vitamin c tab 500 mg tablet , vitamin. b complex ( nfi ( prophylactic ) ) , tablet , voglibose ( 0.3mg tab ) , tablet , warfarin sodium 5 mg ( 5 mg ) , tablet , zinc sulphate dispersible ( 10mg ) , tablet , capsule , alfacalcidiol capsule ( 0.25 mcg ) , capsule , amoxicillin cloxacillin and lactic acid bacillus capsules 250mg , amoxycilline ( 500mg ) , capsule , ampicillin trihydrate ( 500mg ) , capsule , antioxident ( cap ) , capsule , b complex minerals with zinc cap ( ) , capsule , cephalexine ( 250mg ) , capsule , cephalexine ( 500mg ) , capsule , clopidogrel + aspirin ( 75 mg + 150 mg ) , capsule , cloxacillin capsules 500mg , doxycycline ( 100 mg ) , capsule , itraconazole cap ( 100 mg ) , capsule , mehylcobalamine 1500 mcg, alpha lipoic acid 100 mg, folic acid 1.5 mcg, thiamine mononitrate 10 mg ( pyridoxine hcl 3 mg ) , capsule , methylcobalamin + alpha lipoic acid ( 1500 mcg + 100 mg ) , capsule , micronised progesterone ( 400 mg ) , capsule , nifedipine ( sublingual ) 10 mg ( ) , capsule , nifedipine capsule 5mg cap , omeprazole + domperidone 20 mg + 10 mg ( capsule ) , capsule , omeprazole capsule ( 40 mg ) , capsule , omeprazole ( 20mg ) , capsule , piroxicam ( 20 mg ) , capsule , tramadol cap ( 50mg ) , capsule , vitamin a cap usp soft gelatin capsule ( 2 lakh iu ) , capsule , vitamin a cap usp soft gelatin capsule ( 1 lakh iu ) , capsule , vitamin e usp ( 400 mg ) , capsule , syrup , albendazole suspension 200mg / 5ml ( 10 ml bottle ) , syrup , alkaline citrate with k oral solution each 10 ml contains sodium citric 1 gram potassium citrate 0.65 gram citric acid 1 gram syrup , alkaline citrate with k oral solution ( 100ml ) , syrup , ambroxol hcl 15mg+terbutaline sulphate 1.25mg+guaiphenesin 50mg 5ml ( 100ml bottle ) , syrup , ampicillin syrup ( 125 mg / 5 ml 30 ml bottle ) , syrup , ampicilline 125mg / 30ml syrup , antacid mint flavour ( 170ml ) , syrup , antacid syrup , 170 ml ( dried alluminium hydroxide gel 200 mg, simethicon ( 25 mg / 5 ml ) , syrup , anti oxidant lycopen 200 ml syrup ( vitamins multi minerals ) , syrup , bromhexine hcl 4 mg+ guaiphensin 50 mg + terbutaline sulphate 1.25 mg / 5ml syp ( 100 ml bottle ) , syrup , bromhexine hydrochloride ( 4mg / 5ml syrup ( 50ml bottle ) ) , syrup , calcium carbonate + vitamin d3 + zinc ( 200 ml syrup ) , syrup , calcium syp 100ml syrup ( 240mg / 5 ml ) , carbamazepine ( 100 mg / 5 ml 100 ml bottle ) , syrup , cefadroxil syrup ( 125 mg / 5 ml 30 ml bottle ) , syrup , cefixime syrup 50mg / 5ml ( 30 ml bottle ) , syrup , cephalexine ( each 5ml contains 125mg ( 30ml bottle ) ) , syrup , cetirizine syrup ( 5mg / 5ml 30 ml bottle ) , syrup , cetirizine ( 5mg / 5ml ( 60 ml bottle ) ) , syrup , chloroquine phosphate ( ) , syrup , cough syrup ( each 5ml contains ammonium chloride 138mg, diphenhydramine hcl 14.08mg, sodium citrate 57.03mg, menthol 2.5mg ) , cyproheptadine hcl + tricholine citrate ( 2mg + 275 mg / 5 ml ( 200ml bottle ) ) , syrup , dextromethorphan 10mg / 5ml ( 100ml bottle ) , syrup , dextromethorphan hydrobromide syrup 13.5 mg / 5ml ( 30 ml bottle ) , syrup , dextromethorphan syrup ( ) , syrup , dextromethorphan syrup ( 60ml bottle ) ( 10mg / 5ml ) , syrup , dicyclomine syrup , diphenhydramine syrup ( 12.5mg / 5ml ( 100 ml bottle ) ) , syrup , disodium hydrogen citrate 1.25gm / 5ml 100 ml ( 100 ml ) , syrup , drop paracetamol 100mg / 15ml , etiophylline +theophylline ( ( 46.5+14 ) mg / 5ml ( 100 ml bottle ) ) , syrup , ibuprofen 100mg + paracetamol 125mg per 5 ml syrup ( 60 ml bottle ) , syrup , ibuprofen syrup 100mg / 5ml ( 60 ml bottle ) ( 60 ml bottle ) , syrup , iron ferrous sulphate folic acid 100ml ( each 5ml contains ferrous sulphate i.p equivalent to elementary iron 100mg folic acid i.p 0.5mg ) , syrup , iron syrup 200 ml ( elemental iron 40 mg, ammonium citrate 200 mg, cyanocobalamin 7.5 mg, folic acid 0.5 mg, zinc sulphate 7 mg / 5 ml ) , consumable , magnesium hydroxide + aluminium hydroxide simethecon 250 mg + 250 mg + 50 mg / 5 ml 170 ml bottle ( syrup ) , syrup , metoclopramide syrup ( 5mg / 5ml ( 30 ml bottle ) ) , syrup , metronidazole 100mg / 5ml ( 30ml ) , syrup , milk of magnesia + liquid paraffin ( 11.25ml+3.75ml ) / 15ml ( 200 ml bottle ) , syrup , multivitamin 200ml syrup , multivitamine 100ml syrup ( 100 ml ) , syrup , norfloxacin + tinidazole ( ( 100 mg + 100 mg ) 30ml syrup ) , syrup , norfloxacin +metronidazole 30ml syrup , ofloxacin+ metronidazole ( 30ml ) , syrup , ondansetron syrup 2mg / ml , ondansetron ( 2mg / 5ml 30ml bottle ) , syrup , oseltamivir 12 mg / ml syrup ( 75ml bottle ) , syrup , paracetamol syrup / suspension 125 mg / 5ml ( 60ml bottle ) , paraffin liquid ( liquid paraffin 1.25ml + milk of magnesia 3.75ml + sodium picosulphate 3.33ml ) syrup , phenobarbitone syp 200mg / 5ml ( ) , syrup , potassium chloride syrup 200ml ( each ) , syrup , quinine sulphate 150mg / 5ml syrup 60 ml , salbutamol sulphate ( 2mg / 5ml 60ml ) , syrup , salbutamol ( 2mg / 5ml ( 100ml bottle ) ) , syrup , syp. cefodroxil 125mg / 30ml syrup , syp. cetirizine 5mg / 5ml 30ml syrup ( syp. cetirizine 5mg / 5ml 30ml syrup ) , syrup , syrup 50ml bottle ( each 1 ml contains 20 mg elemental iron and 100 mcg folic acid syrup as per the standards provided with dropper ) , syrup , syrup cefpodoxime 50 mg , vitamin a syrup ( 100000 iu / ml with market spoon for 1ml and 2 ml ( 100 ml bottle ) ) , syrup , vitamin b complex nfi formula ( 100ml bottle ) , syrup , vitamin b complex nfi formula ( 200ml bottle ) , syrup , vitamin d3 ( cholecalciferol ) ( 400 iu / ml ( 100 ml bottle ) ) , syrup , zinc sulphate 10 mg elemental zinc / 5 ml ( 100 ml bottle ) , syrup , zinc sulphate syrup 20mg / 5ml ( 50 ml bottle ) , syrup , inhaler / powder , budesonide respules 0.25mg / 2ml inhalation ( 2ml amp / respule ) , inhaler , budesonide ( inhalation 200 mcg per dose ) , inhaler , salbutamol inhalation ip 100mcg / dose ( 200 metered dose container ) , inhaler , salbutamol nebuliser solution bp sabutamol sulphate eq. to salbutamol 1mg per ml ( 2.5 ml amp ) , ampule , salbutamol nebulizing solution ( 5 mg / 2.5 ml ) , ampule , ors packet who formula sodium chloride 2.5g, potessium chloride 1.5g, sodium citrete 2.09g dextrose 13.6g, 20.5gm pouch ( ) , powder , ors who powder glucose anhydrous 13.5g / l, sodium chloride 2.6g / l, potassium chloride 1.5g / l, trisodium citrate 2.9g / l , vitamin d3 granules ( 60000 iu sachet ) , powder , injection , acyclovir inj 250 mg / vial , acyclovir inj ( 500mg / vial ) , injection solution for , adenosine inj 6 mg / 2ml ( 2ml amp ) , adrenaline ( 1 mg / ml ( 1 ml amp ) ) , injection , alpha beta arteether ( 150mg / 2ml ) , injection , amikacin ( 100mg / 2ml vial ) , injection , amikacin ( 250mg / 2ml ) , injection , amikacin ( 500mg / 2ml ( 2ml vial ) ) , injection , aminophylline ( 25 mg / ml 10 mg vial ) , injection , amiodarone 50mg / ml ( 3ml vial / amp ) , injection , amoxicillin + clavulanic acid ( 125 mg + 25 mg / vial ) , injection , amoxicillin 250mg + clavulanic acid 50mg inj vial , amoxicillin ( 250 mg / vial ) , injection , amoxycillin +clavulanic acid ( ( amoxycillin 500 + clavulanic acid 100 mg ) / vial ) , injection , amoxycillin and potassium clavulanate i.p. ( 1 gm + 0.2 gm / 10 ml vial ) , injection , amoxycilline and clavulanic acid inj , amphotericin b inj ip ( 50 mg ) , injection , ampicillin inj. 250 mg / vial , ampicillin ( 1 gm vial ) , injection , ampicillin ( 500 mg / vial ) , injection , ampicilline + cloxacilline injection ( 250 mg + 250 mg ) vial injection 5ml vial ( ) , injection , anti d immunoglobulin for iv / im use ( monoclonal ) ( 150mcg ( 1ml vial ) ) , injection , anti rabies immunoglobulin inj 300 iu per 2ml ( 2ml vial ) ( 300 iu per 2ml ) , injection solution for , anti rabies immunoglobulin ( inj.150 iu per 2 ml vial ) , injection , anti snake venom polyvalent inj 10ml ( lyophilized ) ( 10 ml vial ) , injection , artesunate ( 60 mg / vial ) , injection , atracurium besylate ( 10mg / ml inj amp ) , injection , atracurium ( 10mg / ml ( 2.5ml vial / amp ) ) , injection , atropine sulphate 0.6 mg / ml sc / im / iv ( 2ml amp ) , injection , azithromycin inj 100mg / 5ml , azithromycin ( 500 mg / 5ml inj ) , vial , benzyl penicillin 10lac / vial ( penicillin g ) , injection , betamethasone sodium phosphate ( ml contain betamethasone na phosphate equal to 4mg of betame ( 1ml amp ) ) , injection , biphasic isophane insulin ( 30 / 70 100iu / ml ( 10 ml vial ) ) , injection , biphasic isophane insulin ( 30 / 70 40iu / ml ( 10 ml vial ) ) , injection , bupivacaine hcl for spinal anaesthesia 0.5% ( heavy ) amp ( 4 ml amp ) , injection , bupivacaine hcl for spinal ( inj 0.5%+8.25% dextrose ) , ampule , bupivacaine hydrochloride inj 0.25% ( 20 ml vial ) ( 20 ml vial ) , injection , caffeine citrate inj. 20mg / ml ( 3 ml vial ) ( 20mg / ml 3 ml vial ) , injection , calcium chloride inj. ( ) , injection solution for , calcium gluconate ( 10% ( 10 ml vial ) ) , injection , calcium leucovorin 50 mg / vial inj , carboprost promithamin ( 1ml amp ) ( 250mcg / ml ) , injection , carboprost ( 250 mcg ( 1 ml amp / vial ) ) , injection , cefoperazone 1000mg + sulbactam 1000mg inj ( vial ) , injection , cefoperazone 500mg + sulbactam 500mg ( vial ) , injection , cefotaxime sodium inj ( 500 mg / vial ) , injection , cefotaxime sodium ( 1 gm vial ) , injection , cefotaxime sodium ( 250 mg vial ) , injection , ceftriaxone 1000mg + sulbactam 500mg ( vial ) , injection , ceftriaxone inj 500mg vial , ceftriaxone ( 1g ) , injection , ceftriaxone ( 250mg vial ) , injection , ceftriaxone+tazobactum 250mg+31.25mg inj ( vial ) , injection solution for , ceftrioxone inj.usp ( 1gm / vial ) , injection , chlorpheniramine maleate 10mg / ml inj 10 ml vial , chlorpromazine inj ip ( 25mg / ml ( 2ml amp ) ) , injection solution for , cloxacillin sodium inj. 500mg , dexamethasone sodium inj 4mg / 2ml ( 2ml vial ) , injection , dexamethasone sodium phosphate ( 8mg / 2ml ( 2ml vial ) ) , injection , diazepam ( 5 mg / ml ( 2 ml amp ) ) , injection , diclofenac sodium 25 mg / ml ( 3ml amp ) , injection , dicyclomine ( 10mg / ml ( 2 ml amp ) ) , injection , digoxin 250mcg / ml ( 2ml amp ) , injection , dobutamine hcl 50 mg / ml ( 5ml amp ) , injection , dobutamine ( 12.5 mg / ml 20 ml vial ) , injection , dobutamine ( 50 mg / 5 ml ) , injection , dopamine hcl 40 mg / ml ( 5ml amp ) , injection , doxorubicin ( lypholozed ) ( 50mg vial ) , injection , drotaverine ( 40mg / 2ml ( 2ml amp ) ) , injection , enoxaparin ( 20mg / 0.2ml ) ( 0.2 ml prefilled syringe ) , injection , enoxaparin sodium 40mg ( 20mg / 0.2ml ) prefilled syringe inj ( ) , syrings , enoxaparin ( 40mg equivalent to 4000 iu vial / pfs ) , injection , enoxaparin ( 60mg equivalant to 6000 iu vial / pfs ) , injection , erythropoietin ( 4000 iu inj vial ) , injection , ethamsylate inj ( 250mg ( 2ml amp ) ) , injection , etiophylline and theophylline ( 220 mg / 2ml ) , injection , fentanyl citrate inj 50 mcg / ml ( 2ml ampoule ) , ampoule , ferric carboxymaltose 50mg / ml ( 10ml vial ) , injection , fluconazole iv ( 2mg / ml ( 100ml bottle ) ) , injection , gentamicin inj ( 80 mg / ml ( 2 ml amp ) ) , injection , gentamicin inj. 40 mg / ml, 2ml amp , gentamycin 40 mg / ml 10 ml vial ( 10 ml vial ) , injection , glyceryl trinitrate 5mg / ml inj 10ml vial ( nitroglycerine ) ( 5mg / ml ) , injection solution for , glycopyrolate 0.5% 5ml and neostigmin 2.5 mg / 5 ml injection ( each ) , injection , glycopyrrolate inj. 0.2 mg / ml ( 1 ml amp ) ( 1 ml amp ) , injection solution for , haloperidol inj 5mg / ml ( 1 ml amp ) , hcg ( human chorionic gonadotropin ) inj 5000 iu vial , heparin inj ( 5000iu / ml 5ml vial ) , injection solution for , heparin ( 1000iu / ml 5ml vial ) , injection , hepatitis b immunoglobulin im inj 200 iu / vial , human albumin solution i.p. 20%w / v ( 100 ml vial ) ( ) , injection solution for , human chorionic gonadotropin inj 5000 iu 1ml amp , human insulin regular / soluble ( 100iu / ml ( 10ml vial ) ) , injection , human insulin regular / soluble ( 40iu / ml ( 10ml vial ) ) , injection , human normal immunoglobin ( 5gm / 100ml ) , injection , hydrocortisone inj 100 mg / vial ( ) , injection , hydrocortisone sodium succinate inj. 200mg vial ( ) , injection , hydrocortisone sodium succinate ( 100 mg / vial ) , injection , hyoscine butylbromide 20mg / ml ( 1ml vial / amp ) , injection , inj.iv dns ( ) , injection , insulin biphasic / premix 50:50 ( 100 iu / ml ( 10 ml vial ) ) , injection , insulin biphasic / premix 50:50 ( 40 iu / ml ( 10 ml vial ) ) , injection , insulin human mixtard inj. 30:70 ( ) , injection solution for , insulin soluble inj. 40 iu / ml , iron sucrose usp ( 100 mg / 5 ml ( 5 ml amp ) ) , injection , iron sucrose ( 20 mg ) , injection , isoxsuprine hydrochloride inj. 5mg / ml ( 2 ml amp ) ( 2 ml ) , injection solution for , iv human immunoglobin 5% iv ig ( 5mg / 100ml each ) , injection , ketamine hydrochloride inj. 50mg / ml ( 2 ml amp ) , ketamine hydrochloride ( 10mg / ml ( 10ml vial ) ) , injection , ketamine hydrochloride ( 50mg / ml ( 10 ml vial ) ) , injection , labetalol ( 20 mg / 4 ml ( 4ml amp ) ) , injection , lidocaine 2% inj. 30 ml vial ( ) , injection solution for , lignocaine 2 % ( 21.3 mg / ml ( 30 ml vial ) ) , injection , magnesium suplhate injection i.p.50 % w / v ( 1 ml amp ) ( 1 ml amp ) , ampule , magnesium suplhate injection i.p.50 % w / v 10ml amp , magnesium suplhate ( 50 % w / v ( 2ml amp ) ) , injection , medroxy progesterone acetate ( 150mg / ml 1 ml amp ) , injection , mephentermine inj 30mg / ml ( 10 ml vial ) , injection , meropenem ( 1gm ) , injection , meropenem ( 500 mg / vial ) , injection , methyl ergometrine inj meleate ( 0.2 mg / ml ( 1ml amp ) ) , injection , methyl prednisolone sodium succinate inj. usp 125mg ( 10ml ) , vial , methyl prednisolone sodium succinate inj. usp 500mg , methyl prednisolone sodium succinate inj.1000mg vial , metoclopramide inj. 5mg / ml ( 2 ml amp ) , metoprolol inj 1 mg / ml ( 5ml vial ) , injection solution for , micronised progestrone ( 50 mg / ml 4 ml amp ) , injection , midazolam ( 1mg / ml ( 10ml vial / amp ) ) , injection , midazolam ( 1mg / ml ( 5ml amp ) ) , injection , morphine sulphate inj. ip 10mg / ml ( 1ml ampoule ) , injection solution for , morphine sulphate inj. ip 15mg / ml , multivitamin 10ml amp inj , n acetyl cysteine inj 200mg / ml in 10ml amp , naloxone inj. 0.4 mg / ml ( 1ml ampoule ) , injection solution for , neostigmine ( 0.5mg / ml ( 1ml amp ) ) , injection , nitroglycerine inj. usp 25 mg / 5ml ( 5ml amp ) , noraderanaline bitartrate ( 2 mg base / 2ml ( 2ml amp ) ) , injection , noraderanaline inj. 2 mg base / 2 ml amp , omeprazole 40mg ( vial ) , injection , ondansetron ( 2 mg / ml ( 2 ml amp ) ) , injection , oxytocin 10 iu / ml ( per ampolule ) , injection , oxytocin inj ( 5 iu / ml ( 1ml amp ) ) , injection , pantaprazole ( 40mg ) , injection , paracetamol inj ( 150mg / ml 2ml amp ( 2ml amp ) ) , injection , pentaprazole inj vial ( 40 mg ) , injection , pentazocin lactate ( 30mg / ml ( 1 ml amp ) ) , injection , pheniramine maleate ( 22.75 mg / ml ( 2 ml amp ) ) , injection , phenobarbitone ( 200 mg / ml ) , injection , phenytoin sodium 250 mg / 5 ml ( 5ml vial ) , injection , phenytoin sodium inj. 100 mg ( ) , vial , phenytoin sodium ( 50 mg / ml ( 2ml amp ) ) , injection , piperacillin + tazobactam 1000 mg + 125 mg vial 10 ml vial ( ) , injection , piperacillin + tazobactam 2000 mg + 250 mg 20ml vial ( ) , injection , piperacillin + tezobactin ( 4.5 g ) , injection , potassium chloride inj. 150 mg / 10ml , pralidoxime ( pam ) inj. 25 mg / ml ( 20 ml amp / vial ) , injection , promethazine inj 25 mg / ml ( 2 ml amp ) ( 2 ml amp ) , injection , propofol 1% ( 10ml / 5ml 20ml ) , injection , quinine dihydrochloride ( 300mg / ml ( 2ml amp ) ) , injection , quinine sulphate inj. 300mg / ml . , rabies immunoglobulin inj 300 iu ( ( 2ml vial pfs ) ) , injection , rabies vaccine inj ( vero cell culture ) inj. intra dermal ( ) , vial , rabies vaccine ip human ( ( cell culture ) ) , injection solution for , rabies vaccine ip inj human ( chick embryo / vero cell culture ) intra muscular ( ) , injection solution for , ranitidine ( 50mg / 2ml , 2ml amp ) , injection , snake venom anti serum ip liquid form ( ) , injection , sodium bicarbonate inj. 7.5% w / v ( 10ml ) , ampoule , sodium thiopentone ( 500mg ) , injection powder for , soluble insulin 30% isophane insulin 70% 100 iu inj , streptokinase inj 15 lac iu ( vial / amp ) , injection , streptokinase inj ( ) , injection solution for , succinyl choline inj. 50mg / ml 1ml amp , succinyl choline ( 50mg / ml ( 10 ml vial ) ) , injection , teicoplanin ( 200 mg / vial ) , injection , tetanus immunoglobulin ( usp / ip 250 iu / vial ) , injection , tetanus toxide inj 5ml ( ) , injection solution for , tetanus toxiod ( inj. ) , injection , tetanus toxoid ( adsorbed ) ip ( 5ml vial ) , injection , tramadol ( 100mg / ml ( 2 ml amp ) ) , injection , tramadol ( 50mg / ml ( 2ml amp ) ) , injection , tranexamic acid inj. 125mg / ml amp , tranexamic acid injection bp / ip ( 100mg / ml ( 5ml amp ) ) , injection , urokinase ( 5 lac iu / vial inj ) , injection powder for , vancomycin hydrochloride ( 1000mg vial ) , injection , vecuronium bromide inj 2mg / ml ( 2ml amp ) , vecuronium bromide inj 4mg / ml amp , vitamin b complex injection nfi formula 30ml / vial ( 30ml / vial ) , injection , vitamin b12 inj 500 mcg / ml ( 30 ml amp ) , vitamin k1 ( 1mg / 0.5ml ( 0.5 ml amp ) ) , injection , water for injection 5 ml amp , water for injection inj 10 ml amp , water for injection ip ( 2 ml amp ) , injection , iv fluid , ciprofloxacin inj 100 mg / 50ml ( 100ml ffs bfs bottle ) , dextrose 10% 500ml bfs bottle ( ) , injection solution for , dextrose 10% ( ffs / bfs 500ml bottle ) , injection , dextrose 25% inj 500ml bfs bottle ( ) , injection solution for , dextrose 25% inj 500ml ffs / bfs bottle ( ) , injection solution for , dextrose 25% inj ( 100ml ffs / bfs bottle ) , injection solution for , dextrose 25% ( 500ml ffs bottle ) , injection , dextrose 5% 500ml bfs bottle ( ) , injection , dextrose 5% inj 500ml ffs / bfs bottle ( ) , bottle , dextrose 5% ( 500ml ffs bottle ) , injection , dextrose 50% inj 100ml ffs / bfs bottle ( dextrose 50% inj 100ml ffs / bfs bottle ) , injection solution for , dextrose 50% inj. bottle ( 500ml ffs / bfs ) , injection solution for , dextrose with saline 5% + 0.9% inj 500ml bfs bottle , dextrose with saline 5% + 0.9% inj 500ml ffs / bfs bottle , dextrose with saline ( 5% + 0.9% ( 500ml ffs bottle ) ) , injection , electrolyte g inj 500ml bfs bottle ( ) , injection solution for , electrolyte g inj ffs / bfs bottle ( 500ml ) , injection solution for , electrolyte g ( multi electrolyte with 5% dextrose iv injection type iv ip ) intravenous fluid [ each 100ml contains: anhydrous dextrose 5 gm, sod.chloride 0.37g, potassium chloride 0.13g, ammonium chloride 0.37g ] ( 500ml ffs bottle ) ( 500 ml ) , bottle , electrolyte m inj 500ml bfs bottle ( ) , injection solution for , electrolyte m inj 500ml ffs / bfs bottle ( ) , injection solution for , electrolyte m inj ( 500ml ffs bottle ) , injection solution for , electrolyte p inj 500ml bfs bottle ( ) , injection solution for , electrolyte p inj 500ml ffs / bfs bottle ( ) , injection solution for , electrolyte p inj ( 500ml ffs bottle ) , injection solution for , fluconazole iv ( 2mg / ml ( 100ml bottle ) ) , injection , human normal immunoglobin ( 5gm / 100ml ) , injection , mannitol inj. 20% 350ml ffs bottle , mannitol injection i.p. 20% 100ml bottle ( ) , injection solution for , moxifloxacin ( 100ml ) , injection , normal saline ( 0.9% ( 500ml ffs bottle ) ) , injection , ofloxacin infusion ( 2mg / 1ml ( 100ml ffs bottle ) ) , bottle , ofloxacin inj 2mg / 1ml 100ml , ringer lactate inj iv 500ml bfs bottle ( ) , injection solution for , ringer lactate inj iv 500ml ffs / bfs bottle ( ) , injection solution for , ringer lactate ip i / v 0.24 % w / v of lactic acid ( eq. to 0.32% w / v of sodium lactate ) , 0.6 % w / v sodium chloride, 0.04 % w / v potassium chloride and 0.027 % w / v calcium chloride ( 500ml ffs bottle ) , injection solution for , sodium chloride 0.9% injection ip 100ml bottle ( ) , injection powder for , surgical spirit ( 100ml ) , bottle , eye drops / ear drops , atropine sulphate eye drops 1% ( 5 ml vial ) ( 5 ml vial ) , eye drops / ointment , carboxymethylcellulose eye drop ip 1% w / v 10ml vial ( sodium cmc also accepted ) , eye drop , carboxymethylcellulose ( 5 ml ) , eye drop , chloramphenicol 0.5% ( 5ml ) , eye drop , chloramphenicol ( 1% ( 5 ml vial ) ) , eye drop , ciprofloxacin + dexamethosone ( 0.3%+0.1% ) ( 5ml ) , eye drop , ciprofloxacin 0.3% ( 5ml vial ) , eye drop , clotrimazole 1%w / v +lignocaine 2%w / v ( 10ml ) , eye drop , fluconazole eye drop 3 mg / ml ( 10 ml vial ) ( 3 mg ) , eye drop , gentamycin 0.3% eye / ear drops ( 5ml ffs squeeze vial ) , eye drop , moxifloxacin 0.5% w / v ( 5 ml ) , eye drop , moxifloxacine eye drop 0.5%w / v , ofloxacin + dexamethasone 10 ml eye drop ( 10 ml ) , drop , ofloxacin + dexamethosone ( 0.3%+ 0.1% ( 10 ml ) ) , eye drop , ofloxacin 0.3% w / v of ofloxacin ph.eur. ( 5 ml vial ) , eye drop , cerumenolytic ( for ear wax ) each 10 ml contains paradichlorobenzene 2%benzocaine 2.7%chlorbutol 5%turpentine oil 15% ( 10 ml vial ) , ear drops , clotrimazole + lignocaine ear drop 1% ( 5ml vial ) , drop , clotrimazole 1%w / v +lignocaine 2%w / v ear drop 10ml vial bfs / ffs squeeze ( 10ml vial ) , vial , cream / ointment , aciclovir 3% ( 5gm tube ) , ointment , aciclovir cream 5% ( 5g tube ) ( ) , cream , acyclovir 5% ( 5gm ) , ointment or cream , atropine sulphate eye ointment 1% ( 3 gm tube ) , beclomethasone dipropionate, clotrimazole, neomycine sulphate, chlorocresol ( 0.025% + 1% + 0.5% + 0.1% w / w ( 5gm tube ) ) , ointment or cream , beclomethasone dipropionate, neomycin sulphate, miconazole nitrate ( 0.025 % + 0.5 % + 2 % ( 5 gm tube ) ) , ointment , benzoic acid + salicylic acid ( 6% + 3% ( 15 gm tube ) ) , ointment , benzoyl peroxide 2.5% 20 gm ( ointment / gel ) , tube , betamethasone dipropionate ( 0.05% ( 15gm ) tube ) , ointment or cream , betamethasone valerate cream 0.05% ( 15gm tube ) , ointment , betamethasone valerate oint 0.1% ( 15 gm tube ) , ointment , betamethasone valerate oint / cream ip. 0.12% , cetrimide cream bp ( 0.1% w / w ) , tube , chloramphenicol eye ointment 1% ( 4 gram ) , tube , ciprofloxacin eye ointment 0.3% ( 3gm tube ) , clobetasol 0.05% + gentamicin 0.1% cream 10 gm ( 10 gm tube ) , cream , clotrimazole cream 1% ( 15 gm tube ) , cream , clotrimazole cream 1% ( 15 gm tube ) , cream , clotrimazole i.p. 2%w / w ( 15gm tube ) , cream , compound benzoic acid ointment , cream sumag ( ) , cream , framycetin sulphate 1% cream ( 30 gm tube ) , cream , fusidic acid 0.02 ( 15 gm ) , cream , fusidic acid cream / sodium fusidic ointment 2% 5gm tube ( 5 gm ) , tube , gentamycin sulphate 0.1% ( 15gm tube ) , ointment , miconazole cream i.p. 2% w / w ( 15 gm tube ) , consumable , mupirocin ( 2% w / w ( 5 gm tube ) ) , ointment , neomycin sulphate+bacitracin zinc ( 5mg+500 iu / gm ointment ( 15gm tube ) ) , tube , permethrin 5% ( 30 gm ) , cream , povidone iodine cream 250 gm , povidone iodine ointment 5% 15gm tube , povidone iodine ointment 5% 250gm jar ( ) , each , salicylic acid ointment ( 6% ) , ointment , salicylic acid ( 0.02 30 gm ) , ointment , silver sulphadiazine cream usp 1% w / w 25gm , silver sulphadiazine cream usp 1% ( 500 gm jar ) , cream , soframycin ointment 30 mg tube ( ) , ointment , lab test kits and reagent , alkaline phosphatase ( alp ) dea 300 ml ( model ba 400 system ( mfg bybio system ) ) , consumable , alkaline phosphatase kit ( kinetic ) 10x2.2ml 44 test / kit consumable , anti abd grouping serum 3x10ml consumable , anti b sera igm ( 10 vial ) , consumable , anti d sera igg+igm 10ml vial ( each ) , consumable , anti d ( polyvalent ) ( 1x10 ml ) , consumable , auto pippets fixed volume 10 micro liters each , auto pippets fixed volume 1000 micro liters each , auto pippets fixed volume 20 micro liters each , benedicts qualitative reagent ( 1x5 lit ) , consumable , bilirubin ( direct ) as 300 ml ( model ba 400 system ( mfg bybio system ) ) , consumable , bilirubin ( total ) 600 ml ( model ba 400 system ( mfg bybio system ) ) , consumable , bilirubin caoillary heparinised vitrex ( one packet contain 100 capillary ) , consumable , bilirubin kit ( colorimeter semi auto ) 4x60 ml 480 test / kit consumable , bilirubin standard 1x5 ml ( model ba 400 system ( mfg bybio system ) ) , consumable , blood agar powder ( 500 grm ) , consumable , blood bag 100ml , blood bag 350ml , blood gluose ( god / pod ) semi auto end point ( 1000 ml ) , consumable , blood grouping anti sera a monoclonal : antisera should be transparent with more than one year shelf life at 2 6 c , it should give +++ agglutination at 1.256 dilution in 3 4 sec with a positive cells 10 ml , blood grouping anti sera a monoclonal ( 10 ml vial ( mfg tulip diagnostics ) ) , consumable , blood grouping anti sera b monoclonal : antisera should be transparent with more than one year shelf life at 2 6 c , it should give +++ agglutination at 1.256 dilution in 3 4 sec with b positive cells 10 ml , blood grouping anti sera b monoclonal ( 10 ml vial ( mfg tulip diagnostics ) ) , consumable , blood grouping anti sera d monoclonal : antisera should be transparent with more than one year shelf life at 2 6 c, it should give +++ agglutination at 1.256 dilution in 3 4 sec with d antigen positive cells. 10ml vail ( eryclone anti d igm ) , blood grouping anti sera d monoclonal ( 10 ml vial ( mfg tulip diagnostics ) ) , consumable , blood urea ( bun ) uv ( 1000 ml ) , consumable , blood urea reagent kit ( 200ml ( 2x100ml ) ) , consumable , blood urea reagent kit ( 200ml ( 2x100ml ) ) , consumable , blood urea ( arba ) , consumable , capillary tube 100 pieces consumable , cholesterol hdl direct 160 ml ( model ba 400 system ( mfg bybio system ) ) , consumable , cholesterol kit end point enzymatic kit 50 test / kit , cholesterol kit end point enzymatic kit 5x20ml 200 test / kit , conc hcl ( 1x500 ml = 500 ml ) , consumable , cover slip 18 x 18 mm 10gm , cover slip with isi marked size:18x18mm ( + / 1.00mm ) , thikness 0.13.. to 0.17mm ( pkt of 50 pieces ) , consumable , creatine calorimeter for semi auto kinetica 4x60ml 480 test kit , creatinin kit , crp kit 1x100 biolab qualitative ) , crp latex slide per test , crp test kit ( latex / card ) ( 25 test / kit ) , crp test kit ( latex / card ) , kit of 25 tests ( mfg pathogyme diagnostics ) ( 25 test / kit ) , consumable , dengu card antigen ( 25 card / pkt ) , consumable , dengue card test 100 test kit , developer powder ( 22.5 ltr ) , diagnostic strips for urine sugar / albmin packing: 100 strip / pkt , dialysis starting kit disposable:a ) sterile tray with top ( disposable ) , size not less than 30x30cm b ) sterile drape size not less than 45x45 cm 1no c ) cotton ball 6 no d ) cotton gauze pieces 1 , digital x ray film 10x12 ( 150 films / pkt ) , digital x ray film 11x14 ( 150 films / pkt ) , digital x ray film 8x10 ( 150 films / pkt ) , echo jelly 20ml bottle , echo jelly 250 ml ( mfg by precious life care ) , bottle , edta k3 vial each , edta solutions k3 ( 500 ml ) , edta solutions k3 ( mfg by himedia ) ( 500 ml bottle ) , consumable , field stain a 500ml , field stain b 500ml , filter paper sheet ( ( whatmann no 01 ) sheets ) , consumable , fixer: it shall be powder fixer to produce clean radiographs available in pack size size: 13.5 ltr , fixer: it shall be powder fixer to produce clean radiographs available in pack size size: 9 ltr , formaldehyde 40% ( conc. formaline ) ( 1 x 30 lit ) , consumable , g6pd deficiency test kit ( mfg pathogyme diagnostics ) ( 10 test / kit ) , consumable , glacial acetic acid ( 2.5 liter ) , consumable , glass slide 75mm x 25mm 1.1 mm , glass slide 75mm x 25mm 1.35 mm , glass slide with isi mark at least 75mm x 25 mm thickness at least 1.1mm, detail specifications i with smooth edges, without any scrathtches. ii glazed glass.iii no visual or chromatic abbretions ( 50 slides / packet ) , consumable , glass test tube 12 x 100 ( medium size ) heavy quality 100 / pkt , glass test tube 12 x 75 ( small size ) heavy quality 100 / pkt , glass test tube 5 without edge , glucometer strip ( 1x100 ) , glucose kit ( god / pod ) ( 350ml ) , digonstic , h2so4 ( sulphuric acid ) ( 25% 500 ml bottle ) , consumable , hba ag elisa 96 kit 1x96 ( each ) , consumable , hba ag rapid card test ( each ) , consumable , hbs antigeng kit card ( pack of 10 card test with 10 dropper, 1 buffer solution, 10 pricking lancet and 10 alcohol swab ) , digonstic , hcl n / 10 ( 500 ml bottle ) , hcv elisa ( 96 test kit ) , consumable , hcv kit card test ( 25 test / kit ) , digonstic , heamoglobin colour scale book with special strip complete ( 1 x 200 ) , consumable , hematology cell counter reagents as per requirement of cell counter cleaning solution 100 ml , hemoglobin color scale ( starter kit ) components ( 1 ) color scale 01 / kit ( 2 ) test strip 1000 / kit ( 3 ) printed literature for method of use / kit ( 4 ) lancet 1000 / kit , hiv elisa kit ( hiv micro elisa ag+ab 4th generation ) ( 96 test kit ) , consumable , hiv kit card ( 25 test / kit ) , hydrogen peroxide ( conc. ) h2o2 ( 500 ml ) , consumable , k3 blood vaccutainer edta 100 tubes / pkt , leishman stain 500 ml , malaria antigen card pf / pv card ( as per nvbdcp guidelines ) ( 10 card, 10 dropper, 1 buffer solution ) , malaria antigen, p vivax, p falciparum rapid diagnostics bivalentt test card ( as per gio nvbdcp specification ) pack of 10 card test with 10 dropper, 1 buffer solution, 10 pricking lancet, and 10 alcohol swab , malaria card ( antigen ) atleast 100 microbes / desi ltr. for both species , malaria pf / pv antigen card , malaria pf / pv rapid test , methyline blue ( 100 ml ) , solution , micro pipet 1000 fix and variable each , micropiptte 100 1000 , microtips ( 2 200 ul ) 1x1000 ( each ) , consumable , n / 10 hcl 500ml , nebulization mask kit ( pediatrics ) , nebulization mask kit, mfg by life o line technologist ( pediatrics ) , consumable , nebulization mask kit ( adult ) , new born baby kit [ 4 piece set ] , pregnancy test card ( 10 card pack ( mfg oscar medicare pvt ltd ) ) , consumable , ra factor 50 test kit qualicative , ra factor rapid kit ( 25 test / kit ) 1: ) should be based on latex agglutination slide test. 2: ) qualitative and semiquantitative testing facility possible. 3: ) test speed must be less than 2 minutes , test tube 12 x 100 ( medicm size ) 100 / pkt , test tube 12 x 75 ( small size ) 100 / pkt ( 12 x 75 ( small size ) 100 / pkt ) , tube , test tube 15x125 , tips for auto pipettes 2 to 100 micro litres 1000 / pkt ( 2 to 100 micro litres 1000 / pkt ) , each , tips for auto pipettes 200 to 1000 micro litres 500 / pkt ( 200 to 1000 micro litres 500 / pkt ) , each , tips for auto pippetes 10 to 100 micro litres , tissue paper roll ( each ) , consumable , tourniquet with belt ( good quality pairs ) , pairs , tourniquet with belt ( mfg by precious life care pvt ltd ) ( good quality pairs ) , consumable , typhoid card test kit ( for igg and igm antibody detection ) ( 25 test kit ) , typhoid test card. , umbical cord clamps plastic material ( box of 100 clamps ) ( mfg by precious life care ) , consumable , umbical cord clamps plastic material ( box of 100 clamps ) , consumable , urine albumin & suger , usg gel ( mfg precious life care pvt ltd ) ( 250 ml bottle ) , consumable , usg thermal paper , vdrl ( rpr ) 1x100 sd strip , vdrl kit ( strip ) ( mfg by alere ) ( 50 test / kit ) , consumable , vdrl kit ( strip ) ( 50 test / kit ) , consumable , widal 2x2 sera slide kit , widal 2x2 tube test kit , widal 4x5 ml , slide blue star , sputum cup with sticker , paraffin strip roll , zipper polybag , alluminium foil roll , hand wash liquid , falcon tube , thermacol box , gel pack , bamboo stick , tape roll , spirit lamp , disposible material , adhesive plasters usp 7.5 cm x 10 mts / roll , adhesive plasters usp 7.5 cm x 5 mts / roll , adhesive roll 1 inch x 5 m / roll , baby oxygen mask set of all sizes , blood bag with acd / cpd solution ( disposable sterilised ) with needle ( 100 ml ) , bag , blood bag with acd / cpd solution ( disposable sterilised ) with needle ( 350 ml ) , bag , disposable appron consumable , disposable cap , disposable examination gloves made of natural rubber latex, pre powdered, non streile medium , disposable examination gloves made of natural rubber latex, pre powdered, non streile small , disposable examination gloves made of natural rubber latex, pre powdered, non streile, conforming to is 15354:2003 and amendment thereof. size: large , disposable needles 22g consumable , disposable needles is 10654:2002 22g , disposable needles is 10654:2002 24g , disposable needles is 10654:2002 26 g ( ) , needle , disposable paper gloves size 7 inches consumable , disposable paper gloves size 7, 1 / 2 inches consumable , disposable plastic appron ( full size ) , disposable pricking lancet ( pkt of 200 units ) , disposable pricking lancet 100 units consumable , disposable scalp vein set size 20 no , disposable scalp vein set size 22 no , disposable sharp collection containers 1.5 l , disposable sharp collection containers 5 ltr , disposable sideport knife ( num ) , consumable , disposable sterile gloves size 6 inches consumable , disposable sterile gloves size 61 / 2 inches consumable , disposable sterile gloves size 7, 1 / 2 inches consumable , disposable sterile hypodermic syringe 10ml ( each ) , consumable , disposable suction catheter assorted covering all sizes 10, 12, 14, 16, 18 consumable , disposable suction catheter ( size 12 ) , consumable , disposable suction catheter ( size 14 ) , consumable , disposable surgeon cap ( box of 100 caps ) , disposable syringe ( for vitamin k inj ) ( 1ml with needle 26g ) , consumable , disposable syringe with needle ( 2ml each ) , syrings , disposable syringe with needle ( 3ml each ) , syrings , disposable syringe with needle ( 5ml each ) , needle , hub cutter non electric lockable safety portable box for disposal of hypodemic needles. consumable , kellys pad disposable , n 95 mask ( as per attached specification ) , consumable , oxygen mask adult ( standard size ) , oxygen mask paediatric ( standard size ) , plain disposable vial 3ml ( each ) , consumable , scalp vein set ( size 24g, disposable ) , consumable , three layer surgical mask , urine container 5ml disposable ( 50 per pkt ) , urine container size of the container shall be 30ml disposable ( 50 per pkt ) , consumable , x ray related , x ray film 10 x 12 50 sheets / pack , x ray film 12 x 12 50 sheets / pack , x ray film 12 x 15 50 sheets / pack , catgut / b.b. silk , b.b silk ( 12 foils / pkt ) ( 3 / 8 rcut needle 45 mm length 76 cm, size 2 / 0 ) ) , consumable , b.b silk size 3 / 0 ( 12 foils / pkt ) ( 3 / 8cir rcut needle 26mm length 76 cm ) , needle , b.b silk with 1 / 2 cir rb needle 20 mm length 75 cm non absorbable surgical suture usp size 3 0, ( 12foils / pkt ) , needle , b.b silk with 1 / 2 cir rb needle size:1 / 0 20 mm length 75 cm non absorbable surgical sutures usp surgical material , b.b. silk 6 reels x 25 mts size:1 / 0 ( 6 reels is per box rate should be quoted for 6 reels ) , surgical material , black braided silk with 1 / 2 cir cd cutting needle 16 mm length 75 cm 3 / 0 ( 14 foils / pkt ) , black braided silk with 1 / 2 cir cutting needle 30mm length 75 cm ( 1 / 0 12 foils / pkt ) , consumable , black braided silk with 1 / 2 cir rb needle 20 mm length 75 cm 1 / 0 13 foils / pkt , black braided silk with 1 / 2 cir rb needle 30 mm length 75 cm 2 / 0 12 foils / pkt , catgut chromic size:2 / 0 length 150 cm , catgut chromic with 1 / 2 cir rb needle 30 mm length 70cm no. 1 0, 12 foils per packet , catgut chromic with 1 / 2 cir rb needle 40 mm length 75cm no. 1 consumable , catgut chromic with 1 / 2 cir rb needle 40 mm length 75cm no. 2 consumable ( each ) , consumable , chromic catgut ( 12 foils / pkt ) ( size:1 / 0 length 150 cm ) , consumable , chromic catgut , round body needle no. 1.0 , chromic catgut monofilament with 1 / 4 circle reverse cutting needle 6 0 ( 12 / pkt ) , chromic catgut no 1.0 round dody, 40 mm 12 foils / pkt , chromic catgut suture ( 12 foils / pkt ) ( 3 / 8 cir r cutting needle 19 mm needle, suture length 76 cm size 4 / 0 ) , needle , foleys urinary catheter silkolatex 2 way sterile, non toxic size 10 , foleys urinary catheter silkolatex 2 way sterile, non toxic size 10 , non absorbable braided silk black 10mm 3 / 8 circle reverse cutting micro point ( 38 cm ) , consumable , non absorbable braided silk black ( 12 mm 3 / 8 circle reverse cutting micropoint 38 cm ) , consumable , silk no 1 cutting needle 1x12 ( 1x12 ) , consumable , suture mersilk 8 0 ( 12 foil ) , cotton and related, chadar, bedsheet , absorbent cotton roll 100 gm each consumable , absorbent cotton wool ip 500 grms ( each ) , consumable , cotton crape bandage 10cm x 4m ( box of 10 bandages ) , cotton crape bandage 15cm x 4m ( box of 10 bandages ) , cotton delivery belt , adhesive tape , adhesive tape 7.5cm x10 ( mtr / roll ) , consumable , cloth based surgical adhesive tape roll ( 1 inch x 5 mtr / roll ) , consumable , paper adhesive microporous surgical tape 3 inch x 5 m / roll ( 10 roll / pkt ) ( 3 inch x 5 m / roll ( 10 roll / pkt ) ) , consumable , paper adhesive plaster microporous surgical tape 1 inch x 9 m / roll , paper adhesive plaster microporous surgical tape 2 inch x 5m / roll , paper adhesive plaster microporous surgical tape 4 inch x 9 m / roll , paper adhesive plaster microporous surgical tape 6 inch x 10 m / roll , paper adhesive plaster microporous surgical tape 6 inch x 5m / roll , umblical cotton tape length 75cm. , catheter , disposable suction catheter ( size 12 ) , consumable , disposable suction catheter ( size 14 ) , consumable , feeding tube ( catheter ) 10g , foleys catheter size 12 2 way ( 10 each ) , consumable , foleys catheter size 14 2 way , foleys catheter size 14 3 way , foleys catheter size 16 2 way ( 11 each ) , consumable , foleys catheter size 18 2 way , foleys catheter size 20 2 way ( 12 each ) , consumable , foleys catheter size 22 2 way ( 13 each ) , consumable , foleys catheter size 24 2 way ( 14 each ) , consumable , foleys urinary catheter 2 way size 8 , infant feeding tube ( catheter ) size: 3g , infant feeding tube ( catheter ) size: 4g , infant feeding tube ( catheter ) size: 5g , blade , surgical blade isi marked, size 15 ( 100 per packet ) , surgical material , surgical blade isi marked, size 22 ( 100 / pkt ) , surgical material , surgical blade isi marked, size 23 ( 100 / pkt ) , surgical material , surgical blade isi marked, size 24 ( 100 / pkt ) , surgical material , surgical blade, size 11 , ecg , ecg jelly 250 gms , ecg paper ( chemical coated ) ( 80mmx 20 mtr each ) , consumable , ecg paper computerizesd triple channel 20m , ecg paper ( chemical coated ) 50mm x 20mm roll , ecg paper ( chemical coated ) 50mm x 30 mtr. roll , ecg paper ( wax coated ) heavy quality 50mm x 30 mtr / roll , ecg paper ( wax coated ) mfg by life o line technologist ( 50mm x 30 mtr, roll ) , consumable , ecg roll three channel 20m , ecg roll three channel mfg by life o line technologist ( 50 mm x 20 mtr ) , consumable , needle , absorable surgical suture rb needle size no 1 0, 30 mm length 70 cm , 12 foils per packet , polyglycolic acid ( pga ) , absorbable surgical suture braided polyglycolic acid 3 / 8 circle reverse cuttingg ( 12mm 45 cm spatulated needle ) , consumable , blood vessel introducers needles 16g, sterilized, set , chromic ( 12 foils / pkt ) ( 3 / 8 rb needle 30 mm, length 76 cm, size 2 / 0 ) , needle , chromic size 1, ( 12 foils / pkt ) ( 1 / 2 cir rb needle 40 mm, length 76 cm ) , needle , chromic size 1, 12 foils / pkt ( 1 / 2 cir rb needle 45 mm, length 100 cm ) , needle , insulin syringe / each ( graduation upto 100 units ) 30 g needle, 40 units / ml ( 30 g needle, 40 units / ml ) , syrings , intravenous set with airway and needle ( ( adult ) ) , surgical material , intravenous set with airway and needle ( children ) , surgical material , sterile hypodermic syring with needle 10 ml , sterile hypodermic syring with needle 20 ml , sterile hypodermic syring with needle ( 5 ml ) , syrings , sterile hypodermic syringe with needle, mfg by ph health care pvt ltd ( 20 ml ) , consumable , iv cannula , cannula fixer set consumable , i.v cannula with injection valve size : 18g , i.v. cannula with injection valve 20g , iv cannula ( two way ) size 20 , iv cannula ( two way ) size 22 , iv cannula ( two way ) size 24 , iv cannula size 26g ( ) , consumable , biomedical waste collection plastic bag small ( all colours ) , biomedical waste collection plastic bag medium ( all colours ) , biomedical waste collection plastic bag large ( all colours ) , mattress 5kg cotton 3 ft x 6 ft , pillow with 2kg cotton , tericot sharee , compunder dress ( male ) , bed sheet single bed ( white ) , bedsheet double bed ( white ) , bed sheet single bed ( coloured ) , bedsheet double bed ( coloured ) , baby diapers small ( 10 diaper per pkt ) , chair cushion box type , chair cushion box type , chair cushion cover , compounder coat / lab tec / xry tec std size , curtain green redymade , curton cloth rangeen , curton cloth rangeen design , dionised water 5 ltr cane ( each ) , front aprin , metresses 3x6 with raxine cover 4 density , napkin sup. quality std size ( white ) , napkin sup. quality std size ( coloured ) , peticote blauge cloth shuti rangeen , peticote / blauge cloth shuti bleach , pillow cover cloth bleach , rangeen baag print kapda , rangeen baag print kapda , rangeen design towel beev kapda , rangeen design weft stripe kapda , table cloth rangeen ( small ) , table cloth rangeen ( large ) , biomedical waste collection plastic dustbin small ( all colours ) , biomedical waste collection plastic dustbin medium ( all colours ) , biomedical waste collection plastic dustbin large ( all colours ) , others , azithromycin ( 250mg ) , tablet [ 110083 ] , azithromycin ( 500mg ) , tablet [ 110083 ] , adrenochrome inj , dexamethasone sodium phosphate ( 8mg / 2ml ( 2ml vial ) ) , injection [ 110037 ] , ascorbic acid ( vitamin c ) tab i.p. ( 500mg ) , tablet [ 120030 ] , ciprofloxacin ( 500mg ) , tablet [ 4350032 ] , diazepam ( 5 mg / ml ( 2 ml amp ) ) , injection [ 110366 ] , atropine sulphate 0.6 mg / ml sc / im / iv ( 2ml amp ) , injection [ 110012 ] , disposable syringe with needle ( 10ml each ) , needle , paracetamol ( 500mg ) , tablet [ 110027 ] , diclofenac sodium 25 mg / ml ( 3ml amp ) , injection [ 110024 ] , ranitidine ( 150mg ) , tablet [ 110277 ] , doxycycline ( 100 mg ) , capsule [ 110113 ] , zinc dispersible ( 20mg ) , tablet [ 110421 ] , alcohol based hand sanitizer ( 500 ml bottle ) , consumable , alcohol based hand sanitizer ( 100 ml bottle ) , consumable , alcohol based hand sanitizer ( 50 ml bottle ) , consumable , n 95 mask , disposable three layer mask , surgical gloves 7 , surgical gloves 7.5 , surgical gloves 6.5 , surgical gloves 6 , surgical gloves 8 , typhoid test card , malaria test card , syphilis test card , digital b.p. apparatus , finger pulse oxymeter , non contact thermometer , oxygen cylinder d type , oxygen cylinder b type , stethosocpe , postmartom box , digital x ray machine , a amylase 6x25 ml , a amylase 5x5 ml , acid phosphatase 1x40ml , alanine aminotransferase ( alt / gpt ) 1x50ml – biosystem / amalgum / aqurro , alanine aminotransferase ( alt / gpt ) 1x200ml– biosystem / amalgum / aqurro , alanine aminotransferase ( alt / gpt ) 1x500ml– biosystem / amalgum / aqurro , albumin 1x250ml – biosystem / amalgum / aqurro , albumin 2x250ml – biosystem / amalgum / aqurro , alkaline phosphatase ( amp ) 1x200ml– biosystem / amalgum / aqurro , alkaline phosphatase ( dea ) 1x200ml– biosystem / amalgum / aqurro , aspartate aminotransferase ( ast / got ) 1x50ml – biosystem / amalgum / aqurro , aspartate aminotransferase ( ast / got ) 1x200ml– biosystem / amalgum / aqurro , aspartate aminotransferase ( ast / got ) 1x500ml– biosystem / amalgum / aqurro , bilirubin ( direct ) 4x50ml– biosystem / amalgum / aqurro , bilirubin ( direct ) 2x500ml – biosystem / amalgum / aqurro , bilirubin ( total ) 4x50ml – biosystem / amalgum / aqurro , bilirubin ( total ) 2x500ml – biosystem / amalgum / aqurro , bilirubin ( total & direct ) 2+2x50ml – biosystem / amalgum / aqurro , bilirubin ( total & direct ) 500+500ml– biosystem / amalgum / aqurro , calcium az 1x200ml – biosystem / amalgum / aqurro , calcium az 1x500ml– biosystem / amalgum / aqurro , cholestrol 1x50ml – biosystem / amalgum / aqurro , cholestrol 1x200ml – biosystem / amalgum / aqurro , cholestrol 1x500ml– biosystem / amalgum / aqurro , cholestrol hdl direct 1x80ml – biosystem / amalgum / aqurro , cholestrol ldldirect 1x80ml – biosystem / amalgum / aqurro , cholestrol hdl 2x50+2x50ml– biosystem / amalgum / aqurro , cholestrol hdl ppt 1x50ml– biosystem / amalgum / aqurro , cholestrol ldl ppt1x20ml – biosystem / amalgum / aqurro , ck ifcc liq 1x50ml– biosystem / amalgum / aqurro , ck ifcc liq 4x50ml – biosystem / amalgum / aqurro , ck mb liq 1x50ml– biosystem / amalgum / aqurro , creatinine 2x50ml– biosystem / amalgum / aqurro , creatinine 4x50ml – biosystem / amalgum / aqurro , creatinine 1x1000ml– biosystem / amalgum / aqurro , fructosamine 2x50ml– biosystem / amalgum / aqurro , ggt 1x50ml – biosystem / amalgum / aqurro , glucose 1x500ml– biosystem / amalgum / aqurro , glucose 5x200ml – biosystem / amalgum / aqurro , iron ferrozine 4x50ml – biosystem / amalgum / aqurro , iron chromazurol4x50ml biosystem / amalgum / aqurro , iron binding capacity ( tibc ) 50test– biosystem / amalgum / aqurro , lactate dehydrogenase ( ldh ) ifcc 1x50ml – biosystem / amalgum / aqurro , lipase 1x60ml– biosystem / amalgum / aqurro , magnesium 4x50ml – biosystem / amalgum / aqurro , phosphorus 170 ml – biosystem / amalgum / aqurro , total protein 1x250ml – biosystem / amalgum / aqurro , total protein 2x250ml – biosystem / amalgum / aqurro , protein ( urine ) 4x50ml– biosystem / amalgum / aqurro , triglycerides 1x50ml – biosystem / amalgum / aqurro , triglycerides 4x50ml – biosystem / amalgum / aqurro , triglycerides 2x250ml – biosystem / amalgum / aqurro , urea ( bun colour ) 4x50ml – biosystem / amalgum / aqurro , urea ( bun uv ) 4x50ml – biosystem / amalgum / aqurro , urea ( bun uv ) 2x250ml– biosystem / amalgum / aqurro , uric acid 1x50ml – biosystem / amalgum / aqurro , uric acid 1x200ml – biosystem / amalgum / aqurro , fructose 1x50ml– biosystem / amalgum / aqurro , citrate 1x50ml – biosystem / amalgum / aqurro , micro albumin 1x20ml – biosystem / amalgum / aqurro , micro albumin 1x50ml– biosystem / amalgum / aqurro , apolipoprotein a1 1x50ml – biosystem / amalgum / aqurro , apolipoprotein b 1x50ml – biosystem / amalgum / aqurro , hs crp 1x50ml – biosystem / amalgum / aqurro , complement component c3 1x50ml – biosystem / amalgum / aqurro , complement component c4 1x50ml– biosystem / amalgum / aqurro , ferritin 1x15ml– biosystem / amalgum / aqurro , ferritin 1x45ml– biosystem / amalgum / aqurro , immunoglobilin a ( iga ) 1x50ml – biosystem / amalgum / aqurro , immunoglobilin a ( igg ) 1x50ml – biosystem / amalgum / aqurro , immunoglobilin a ( igm ) 1x50ml – biosystem / amalgum / aqurro , transferrin 1x50ml– biosystem / amalgum / aqurro , aso 1x50ml– biosystem / amalgum / aqurro , crp1x50ml – biosystem / amalgum / aqurro , rf 1x50ml– biosystem / amalgum / aqurro , prealbumin 1x50ml– biosystem / amalgum / aqurro , anti thermbin lll 1x50ml– biosystem / amalgum / aqurro , a1 acid glycoprotein 1x50ml– biosystem / amalgum / aqurro , b2 mircoglobulin 1x50ml– biosystem / amalgum / aqurro , anti streptolysin ( aso ) slide 50 test– biosystem / amalgum / aqurro , anti streptolysin ( aso ) slide 150 test– biosystem / amalgum / aqurro , c reactive protein ( crp ) slide 50test – biosystem / amalgum / aqurro , c reactive protein ( crp ) slide 150 test– biosystem / amalgum / aqurro , rheumatoid factor ( rf ) slide 50 test – biosystem / amalgum / aqurro , rheumatoid factor ( rf ) slide 150 test– biosystem / amalgum / aqurro , hba1c turbi 1x50ml – biosystem / amalgum / aqurro , bilirubin standard 1x5ml– biosystem / amalgum / aqurro , biochemistry calibrator 5x5ml – biosystem / amalgum / aqurro , apolipoprotein a1 standard 1x1ml– biosystem / amalgum / aqurro , apolipoprotein b standard 1x1ml – biosystem / amalgum / aqurro , protein calibrator 5x1ml– biosystem / amalgum / aqurro , hdl / ldl standard 1x1ml– biosystem / amalgum / aqurro , prealbumin standard 1x1ml – biosystem / amalgum / aqurro , heamoglobin a1c control normal 1x0.5ml– biosystem / amalgum / aqurro , heamoglobin a1c control elevated 1x0.5ml– biosystem / amalgum / aqurro , control urine 1x5ml – biosystem / amalgum / aqurro , micro albumin standard 1x1ml – biosystem / amalgum / aqurro , aso standard 1x1ml – biosystem / amalgum / aqurro , alpha 1 microglobulin standard 3ml– biosystem / amalgum / aqurro , ada control 2x1ml – biosystem / amalgum / aqurro , ada standard 1ml– biosystem / amalgum / aqurro , lipid control l 3x1ml – biosystem / amalgum / aqurro , lipid control ll 3x1ml – biosystem / amalgum / aqurro , biochemistry control serum ( human ) l1 5x5ml – biosystem / amalgum / aqurro , biochemistry control serum ( human ) l2 5x5ml – biosystem / amalgum / aqurro , biochemistry control serum l1 5x5ml – biosystem / amalgum / aqurro , biochemistry control serum l1 20x5 ml– biosystem / amalgum / aqurro , biochemistry control serum l2 5x5 ml– biosystem / amalgum / aqurro , biochemistry control serum l2 20x5ml – biosystem / amalgum / aqurro , rheumatoid control serum l1 3x1ml – biosystem / amalgum / aqurro , rheumatoid control serum l2 3x1ml – biosystem / amalgum / aqurro , crp / hs crp standard 1x1ml – biosystem / amalgum / aqurro , ferritin standard 1x3ml – biosystem / amalgum / aqurro , hba1c standard 1x2ml – biosystem / amalgum / aqurro , rf standard 1x3ml – biosystem / amalgum / aqurro , prevecal human control serum 12x5ml– biosystem / amalgum / aqurro , protein ( total ) 10x50ml – biosystem / amalgum / aqurro , protein ( urine ) 5x50m– biosystem / amalgum / aqurro , creatinine 10x50ml – biosystem / amalgum / aqurro , glucose 10x50ml – biosystem / amalgum / aqurro , cholestrol 10x50ml – biosystem / amalgum / aqurro , phosphorus 2x50ml – biosystem / amalgum / aqurro , iron ferrozine 5x50ml – biosystem / amalgum / aqurro , bilirubin total 5x50ml– biosystem / amalgum / aqurro , bilirubin direct 5x50ml– biosystem / amalgum / aqurro , magnesium 2x50ml– biosystem / amalgum / aqurro , alkaline phosphate dea 5x20ml– biosystem / amalgum / aqurro , urea / bun uv 5x50ml– biosystem / amalgum / aqurro , alkaline phosphate amp 5x20ml– biosystem / amalgum / aqurro , ggt 5x50ml– biosystem / amalgum / aqurro , uric acid 10x50ml – biosystem / amalgum / aqurro , triglycerides 10x50ml – biosystem / amalgum / aqurro , aspartate aminotransferase ( ast / got ) 5x50ml– biosystem / amalgum / aqurro , alanine aminotransferase ( alt / gpt ) 5x50ml– biosystem / amalgum / aqurro , albumin 5x50ml– biosystem / amalgum / aqurro , a amylase 5x20ml– biosystem / amalgum / aqurro , hdl direct 4x20ml – biosystem / amalgum / aqurro , ldl direct 4x20ml – biosystem / amalgum / aqurro , calcium az 10x50ml– biosystem / amalgum / aqurro , lactate dehydrogenase ( ldh ) 5x50ml– biosystem / amalgum / aqurro , ada 4x10ml – biosystem / amalgum / aqurro , ck 3x15ml – biosystem / amalgum / aqurro , ck mb 3x15ml – biosystem / amalgum / aqurro , lipase 3x15ml – biosystem / amalgum / aqurro , conc wash solution 100ml – biosystem / amalgum / aqurro , conc system liquid 1000ml– biosystem / amalgum / aqurro , sta neoplastine ci+5 6x5ml– edan / swelab / stago / sysmex , sta cephascreen 4 12x4ml edan / swelab / stago / sysmex , sta satellite cuvettes 6x200– edan / swelab / stago / sysmex , sta coag control n+p 12x2x1ml edan / swelab / stago / sysmex , sta system control n+p– 12x2x1 edan / swelab / stago / sysmex , sta liatest control n+p 12x2x1ml edan / swelab / stago / sysmex , sta thrombin 2 12x2 ml edan / swelab / stago / sysmex , sta liquid fib 12x4 ml – edan / swelab / stago / sysmex , sta liatest d dimer 6x6 ml – edan / swelab / stago / sysmex , sta – cacl2 0.025 m 24x15ml – edan / swelab / stago / sysmex , sta uniclibrator 6x1 ml – edan / swelab / stago / sysmex , ptt – la 6x2 ml – edan / swelab / stago / sysmex , sta dificient viii 6x1 ml – edan / swelab / stago / sysmex , sta dificient ix 6x1 ml–edan / swelab / stago / sysmex , sta difficient vii 6x1 ml– edan / swelab / stago / sysmex , sta difficient v 6x1 ml– edan / swelab / stago / sysmex , sta difficient ii 6x1 ml–edan / swelab / stago / sysmex , sta difficient xi 6x1 ml – edan / swelab / stago / sysmex , sta difficient ix 6x1 ml– edan / swelab / stago / sysmex , sta sifficient x 6x1 ml–edan / swelab / stago / sysmex , sta staclot protein c 3x1 ml– edan / swelab / stago / sysmex , sta staclot protein s 2x1ml –edan / swelab / stago / sysmex , sta stachrom at iii 3 4x3 ml– edan / swelab / stago / sysmex , sta owren koller 24x15ml – edan / swelab / stago / sysmex , sta cleaner solution 6x2500ml – edan / swelab / stago / sysmex , sta desorb u 24x15 ml – edan / swelab / stago / sysmex , white stirring bar 1 pc – edan / swelab / stago / sysmex , red stirring bar 1 pc – edan / swelab / stago / sysmex , sta micro cups 100 pc – edan / swelab / stago / sysmex , m 52 diff lyse 500ml – amalgum / aqurro / edan / swelab / stago / sysmex / mindray , m 52 lh lyse 100ml– amalgum / aqurro / edan / swelab / stago / sysmex / mindray , m 52 diluent 20 ltr –amalgum / aqurro / edan / swelab / stago / sysmex / mindray , m 52 probe cleaner 50 ml – amalgum / aqurro / edan / swelab / stago / sysmex / mindray , m 52 paper roll– amalgum / aqurro / edan / swelab / stago / sysmex / mindray , m 18 diluent 20 ltr – amalgum / aqurro / edan / swelab / stago / sysmex / mindray , m 18 cfl lyse 500ml – amalgum / aqurro / edan / swelab / stago / sysmex / mindray , m 18 rinse 20 ltr– amalgum / aqurro / edan / swelab / stago / sysmex / mindray , m 18 probe cleanzer 17ml – amalgum / aqurro / edan / swelab / stago / sysmex / mindray , m 18 e z cleaner 100ml – amalgum / aqurro / edan / swelab / stago / sysmex / mindray , paper roll 30 mtr , electrolyte pack 900ml sensacore / amalgum / aqurro / edan / swelab / stago / sysmex / mindray , hba1c analyzer biosystem / amalgum / aqurro / heidelco / edan / swelab / stago / sysmex , na, k+ analyzer sensacore / biosystem / aqurro / heidelco / edan / swelab / stago / sysmex , cbc machine biosystem / amalgum / aqurro / heidelco / edan / swelab / stago / sysmex , horizontal autoclave malgum / aqurro / p.l.tandon / yorco / sems / tanco / heidelco / sai engineerings , dual reordered pack biosystem / amalgum / aqurro / bio rad / heidelco / edan / swelab / stago / sysmex , cholestrol hdl calibrator biosystem / amalgum / aqurro , cholestrol ldl calibrator biosystem / amalgum / aqurro , ck mb calibrator biosystem / amalgum / aqurro , rf calibrator biosystem / amalgum / aqurro , crp calibrator biosystem / amalgum / aqurro , calcium chlorite ( cacl2 ) biosystem / amalgum / aqurro , desktop computer i3 , desktop computer i5 , laptop i5 , laptop i3 , air condition 1.5 ton , printer three in one , printer mfc , air condition 2 ton , nayi pahle kit , cord clamp , thermocal box for covid sampling , revolving office chair , revolving executive office chair , office table with racks 3*4 , computer table , s.s waiting chair , cooler , room heater , b.p aparatus digital , weigthing machine ( adult ) , weigthing machine ( adult ) digital , weighting machine neo natal , b.p aparatus professional , room heater with blower , parafilm...

Public Health And Family Welfare - Madhya Pradesh

30443234 bids are invited for acetonitrile lcms / hplc , n hexane ar , dimethyl sulfoxide ar , dimethyl farmamide ar , methonol lcms lcms , iso octane ar , cyclohexane lcms , diethylene glycol ar , hydrochloric acid ( 35% w / w ) ar , triphenyphosphine sr , methylene chloride gcms , p&t methanol p&t , methyl tetra butylether hplc , ethyl acetate extra pure ar , glacial acetic acid ar , formic acid ar / lcms , trifluoroacetic acid ar , orthophosphoric acid 85+%extra ar , dichloromethane99+%extra ar , ammonia solution ar , ammonium acetate lcms grade , ammonium formate lcms , sodium chloride anhydrous ar , sodium sulfate anhydrous ar , magnesium sulfate anhydrous ar , di ethyl either ar , chloroform ar , acetic acid ar , acetone ar , toluene ar , hydrochloric acid ar , ico propyl alcohol ar , n heptane ar , n pentane ar , n n di methyl forma mide ar , cyclohexane ar ar , benzene ar , naoh ar , koh ar , sodium hydrogen sulphate mono hydrate ar , boron trifluride reagent ar , sodium methoxide ar total quantity : 1...

Department of Higher Education - Madhya Pradesh

30317622 bids are invited for science equipment 1 jaeger’s apparatus to determine the surface tension , science equipment 2 barton’s apparatus to determine modulus of rigidity , science equipment 3 stock’s apparatus to determine coefficient of viscosity , science equipment 4 calendar and barne’s apparatus to determine the value of mechanical equivalent of heat , science equipment 5 complete apparatus to determine the heating efficiency of electrical kettle with variable voltages , science equipment 6 lee’s apparatus to determine the heat conductivity of bad conductors of different geometry , science equipment 7 searle’s apparatus to determine the coefficient of thermal conductivity , science equipment 8 joule calorimeter apparatus to determine mechanical equivalent of heat , science equipment 9 complete apparatus to study the oscillations of mass under different combinations of spring , science equipment 10 carey foster bridge apparatus to determine the temperature coefficient of a resistance , science equipment 11 variation of thermo emf with temp for thermo couple complete apparatus with all accessories , science equipment 12 study of various network theorems , science equipment 13 transistor characteristics apparatus with built in power supply and meters , science equipment 14 apparatus to study characteristics of zener diode , science equipment 15 apparatus to study characteristics of fet , science equipment 16 apparatus for determinecharging or discharging of capacitor , science equipment 17 complete apparatus for study of optical rotation , science equipment 18 crt mounted on wooden stand, power supply, a pair of bar magnet, compass box, a wodden stand with scale , science equipment 19 digital millimeter , science equipment 20 viscous liquid ( glycerin ) 800ml , science equipment 21 small steel balls of different diameter , science equipment 22 keysone way , science equipment 23 keystwo way , science equipment 24 grating , science equipment 25 quartz prism , science equipment 26 measuring cylinder100 ml , science equipment 27 spherometer2 , science equipment 28 electric weighing machine , science equipment 29 alluminium chloride , science equipment 30 alluminium pott. sulphate , science equipment 31 alluminium sulphate , science equipment 32 ammonium acetate , science equipment 33 ammonium carbonate , science equipment 34 ammonium chloride , science equipment 35 ammonium dicromate , science equipment 36 ammonium molyblade , science equipment 37 ammonium oxalate , science equipment 38 ammonium solution ( liquer ) , science equipment 39 ammonium sulphate , science equipment 40 ammonium thiocynate , science equipment 41 arsenic oxide , science equipment 42 di ammonium hydrozene phasphet , science equipment 43 barium chloride , science equipment 44 calcium oxide , science equipment 45 calcium chloride , science equipment 46 camphor , science equipment 47 cobalt chloride , science equipment 48 cobalt nitrate , science equipment 49 copper acetare , science equipment 50 copper carbonate , science equipment 51 copper sulphate , science equipment 52 ferric ammonium sulphate , science equipment 53 ferric chloride , science equipment 54 iron filings , science equipment 55 lead acetate , science equipment 56 lead nitrate , science equipment 57 magnesius sulphate , science equipment 58 magnesium carbonate , science equipment 59 manganese oxide , science equipment 60 pottassium chloride , science equipment 61 pottassium cromate , science equipment 62 pottassium dicromate , science equipment 63 pottassium iodide , science equipment 64 silver nitrate , science equipment 65 silica gel , science equipment 66 sodium carbonate , science equipment 67 sodium bicarbonate , science equipment 68 sodium hydroxide , science equipment 69 sodium thiocynate , science equipment 70 sodium thiosulphate , science equipment 71 sodium hypochloride , science equipment 72 sodium nitrate , science equipment 73 sodium nitrite , science equipment 74 sodium metal , science equipment 75 titan yellow , science equipment 76 zinc carbonate , science equipment 77 zink chloride , science equipment 78 zink oxide , science equipment 79 hydrochloric acidcon. , science equipment 80 sulphuric acidcon. , science equipment 81 nitric acidcon. , science equipment 82 acetamide , science equipment 83 acetic acid ( glacial ) , science equipment 84 acetone , science equipment 85 alizrine , science equipment 86 alpha napthol , science equipment 87 aniline , science equipment 88 anthracene , science equipment 89 benzamide , science equipment 90 benzene , science equipment 91 benzoic acid , science equipment 92 benzophinol , science equipment 93 b napthol , science equipment 94 boric acid , science equipment 95 bromine water , science equipment 96 chlorofarm , science equipment 97 dimethyle glyoxime , science equipment 98 ether , science equipment 99 ethyle acetate , science equipment 100 ethyle alcohal , science equipment 101 glucose , science equipment 102 glycerol , science equipment 103 iodine , science equipment 104 m dinitrobenzene , science equipment 105 methyle alchohol , science equipment 106 methyle red , science equipment 107 napthalene , science equipment 108 n butanol , science equipment 109 oxalic acid , science equipment 110 para di chlorobenzene , science equipment 111 paraffine liquid , science equipment 112 picric acid , science equipment 113 salicylic acid , science equipment 114 starch , science equipment 115 succinic acid , science equipment 116 tartaric acid , science equipment 117 urea , science equipment 118 beaker 100 ml , science equipment 119 beaker 250ml , science equipment 120 beaker500ml , science equipment 121 beaker 100 ml , science equipment 122 conical flask 100ml , science equipment 123 conical flask 150ml , science equipment 124 capillary tube , science equipment 125 fannlsglass , science equipment 126 thils tube for melting points / boiling point , science equipment 127 bottles regent with ground in dust proof flat stoppered n m , science equipment 128 bottles regent with ground in dust proof flat stoppered w m , science equipment 129 viscometer college patterns size 8þ , science equipment 130 burettes pinch cock type with rubber tube andnozzle 50 x 1 / 10 ml , science equipment 131 pipette volumatric with mark , science equipment 132 ingnition tubes in 5 gross packing , science equipment 133 glass rod , science equipment 134 glass tube , science equipment 135 thermameter duly alchohaly filled in case , science equipment 136 thermameter duly alchohaly filled in case , science equipment 137 polythine measuring cylinder with single graduated , science equipment 138 polythine fannls , science equipment 139 measuring cylinder polythine 50 ml , science equipment 140 measuring cylinder polythine 100 ml , science equipment 141 rubber pipette bulb , science equipment 142 tripod stand iron size 8 x 4 , science equipment 143 bunsen burner made of thick bross pipe with air regular and iron base , science equipment 144 sand both g.t.steel , science equipment 145 spetula metal , science equipment 146 pinch clip for burette , science equipment 147 tongs , science equipment 148 rubber tubing soft and red colour indian make 6mm , science equipment 149 rubber tubing soft and red colour indian make 8 mm , science equipment 150 rubber cork assorted size 1 to 10 no. , science equipment 151 rubber cork assorted size 1 to 10 no. , science equipment 152 rubber cork assorted size 1 to 10 no. , science equipment 153 filter paper sheet best kalpin make size 46x57 cms , science equipment 154 whatman filter paper sheetsno. 01 ( pkt ) , science equipment 155 nostoc sp. , science equipment 156 chara sp. ( veg ) t.s , science equipment 157 chara ( repd. ) v.s , science equipment 158 oedogonium t.s , science equipment 159 oedogoniumwith hold fast t.s , science equipment 160 oedogonium capcell v.s , science equipment 161 oedogonium ( antheridal ) v.s , science equipment 162 oedogonium ( repd ) t.s , science equipment 163 oedogonium ( macrandrous ) t.s , science equipment 164 oedogonium t.s , science equipment 165 oedogonium ( akinetes ) t.s , science equipment 166 spriogayar ( t.s ) , science equipment 167 spriogayar , science equipment 168 spriogayar ( scalariform conj t.s , science equipment 169 vaucheriya ( veg ) t.s , science equipment 170 vaucheriya ( rep.d ) v.s , science equipment 171 volvox ( veg. ) t.s , science equipment 172 volvox ( rep.d ) v.s , science equipment 173 volvox ( daughter colonies ) t.s , science equipment 174 volvox ( oogonial ) v.s , science equipment 175 volvox ( antheridial ) t.s , science equipment 176 volvox ( zygosporate ) v.s , science equipment 177 dictyota ( veg ) v.s , science equipment 178 dictyota ( rep.d ) t.s , science equipment 179 ectocarpus sp. ( veg ) t.s , science equipment 180 ectocarpus ( unilocular ) v.s , science equipment 181 ectocarpus ( plurilocular ) t.s , science equipment 182 batrachosparmum ( veg ) t.s , science equipment 183 batrachosparmum ( chantransia v.s , science equipment 184 batrachosparmum ( rep.d ) t.s , science equipment 185 polysiphonia ( sp. ) t.s , science equipment 186 polysiphonia ( rep.d ) t.s , science equipment 187 polysiphonia ( tetrasporic ) t.s , science equipment 188 polysiphonia ( antheridial ) t.s , science equipment 189 lichen ( sp. thallus ) v.s , science equipment 190 volvox ( oogonial ) v.s , science equipment 191 lichen ( fruticose ) v.s , science equipment 192 lichen ( crustose ) v. s , science equipment 193 lichen ( usnea ) v.s , science equipment 194 lichen ( parmelia ) v.s , science equipment 195 lichen ( cladonia ) t.s , science equipment 196 puccinia triticina ( acideo ) t.s , science equipment 197 puccinia triticina ( basideo ) t.s , science equipment 198 puccinia triticina ( pycnideo ) t.s , science equipment 199 puccinia triticina ( uredo ) t.s , science equipment 200 puccinia triticina ( teleuto ) v.s , science equipment 201 alternaria on tomato leaves v.s , science equipment 202 early blight on potato leaves v.s , science equipment 203 cercospora on potato leaves v.s , science equipment 204 cercospora personata ( tikka d.v.s , science equipment 205 cercospora rose leaves t.s , science equipment 206 cercospora sp. v.s , science equipment 207 collatotricum sp.t.s , science equipment 208 red rot of sugarcane v.s , science equipment 209 little leaf of brinjal v.s , science equipment 210 tomato wilt t.s , science equipment 211 leaf spot of turmeric t.s , science equipment 212 phyllactinia on dalbergia t.s , science equipment 213 penicilliumt.s , science equipment 214 aspergillus v.s , science equipment 215 peziza v.s or t.s , science equipment 216 rhizopus t.s , science equipment 217 mucor v.s , science equipment 218 anthocerosev.s thallus , science equipment 219 anthocerose ( female ) v.s , science equipment 220 anthocerose ( sporophyte ) l.s , science equipment 221 marchantia palmata ( veg ) v.s , science equipment 222 marchantia palmata ( gemma cup ) v.s , science equipment 223 marchantia palmate ( sporophyte ) l.s , science equipment 224 riccia frostii ( sporophyte l.s , science equipment 225 riccia fluitans v.s , science equipment 226 riccia himalayensi t.s , science equipment 227 polytrichum ( veg. ) t.s , science equipment 228 polytricham ( male ) , science equipment 229 polytrichum sp. ( female ) cone , science equipment 230 polytricham ( capsule ) t.s , science equipment 231 marsilea minuta ( sporocarps ) v.s , science equipment 232 marsilea minuta ( petiole ) t.s , science equipment 233 azolla .v.s , science equipment 234 azolla sp. ( sprocarps ) v.s , science equipment 235 equisetum l.s leaf , science equipment 236 equisetum defussum ( rhizome ) t.s , science equipment 237 equisetum defussum ( stem ) t.s , science equipment 238 selaginella ( steam ) v.s , science equipment 239 polystrichum squarcssum ( veg. ) , science equipment 240 lycopodium clavatum ( roots ) t.s , science equipment 241 lycopodium clavatum ( stem ) ) t.s , science equipment 242 lycopodium clavatum ( cones 8 ) v.s , science equipment 243 lycopodium cernum ( stem ) t.s , science equipment 244 lycopodium cernum ( cones35 ) v.s , science equipment 245 lycopodium cernum ( veg shoot ) t.s , science equipment 246 pinusl. s of male cone , science equipment 247 pinus l.s of female cone , science equipment 248 pinus slide of pollen grem , science equipment 249 pinus t . s ( ( needles ) , science equipment 250 pinus l.s of ovule , science equipment 251 cycas ( coralloid root ) , science equipment 252 cycas t.s of microsporophyll , science equipment 253 cycasv.s of ovule , science equipment 254 ephedraold l.s of ovule , science equipment 255 ephedra ( shoot ) , science equipment 256 pinus roxburghii ( male cones 60 ) , science equipment 257 pinus roxburghii ( female cone 2 year ) , science equipment 258 pinus roxburghii ( female cone 3 year ) , science equipment 259 asparagus.sp ( root ) t.s , science equipment 260 asparagus .sp ( stem ) t.s , science equipment 261 bigonia sp ( stem, leaves , each ) t.s , science equipment 262 bigonia sp ( stem, leaves root each ) v.s , science equipment 263 borerhavia ( steam, leaves each ) t.s , science equipment 264 boerhavia ( roots ) t.s , science equipment 265 ceratophyllum sp t.s , science equipment 266 cucurbita ( root , stem, leaves each ) t.s , science equipment 267 dracaena sp. ( stem ) t.s , science equipment 268 eichhornia sp. ( stem ) t.s , science equipment 269 eichhornia sp. ( petiole ) v.s , science equipment 270 hydrila sp t.s , science equipment 271 helianathus sp ( root ) t.s , science equipment 272 leptidinia sp. ( stem ) t.s , science equipment 273 nyctanthus sp. ( old stem ) t.s , science equipment 274 salvadora sp. ( leaves each ) v.s , science equipment 275 trapa sp. ( leaves ) v.s , science equipment 276 trapa sp. ( stem ) t.s , science equipment 277 zea mays ( roots, young, stem, ( t.s ) , science equipment 278 sunflower sp. ( roots, young, stemt.s , science equipment 279 t.s of mature anther , science equipment 280 v.s of hydrilla leaf , science equipment 281 t.s of potamogeton stem , science equipment 282 free central placentaton , science equipment 283 superficial placentation , science equipment 284 v.s of potamogeton leaf , science equipment 285 t.s of ceratophyllum stem , science equipment 286 v.s of ceratophyllum leaf , science equipment 287 v.s of trapa leaf , science equipment 288 v.s of eichhornia leaf , science equipment 289 marginal placentation , science equipment 290 axile placentatu , science equipment 291 axile placentation v.s , science equipment 292 v.s of amophilla leaf , science equipment 293 t.s of casurina , science equipment 294 v.s of casurina stem , science equipment 295 t.s of casurina root , science equipment 296 orthotropous , science equipment 297 anatropous , science equipment 298 hemianatropous , science equipment 299 camphlotropous , science equipment 300 amphitropous , science equipment 301 circinotropous , science equipment 302 l.s of ovule , science equipment 303 t.s of aunther , science equipment 304 pollinia , science equipment 305 chrysamoeba sld , science equipment 306 euglena sld , science equipment 307 volvox sld , science equipment 308 notiluca sld , science equipment 309 ceratium sld , science equipment 310 leishmania sld , science equipment 311 trypanosome sld , science equipment 312 amoea sld , science equipment 313 opalina , science equipment 314 sycon spec , science equipment 315 leucosolenia spc , science equipment 316 spongilla , science equipment 317 euspongia , science equipment 318 hydra , science equipment 319 obelia , science equipment 320 echinococcus granulossus , science equipment 321 acaris , science equipment 322 waucheria brancrofti , science equipment 323 trichinelia spirails , science equipment 324 dracnculus mendinensis , science equipment 325 aphrodite , science equipment 326 nereis , science equipment 327 pheretima , science equipment 328 hirudinaria granulosa , science equipment 329 peripatus replica , science equipment 330 limulus , science equipment 331 palamnaeus , science equipment 332 scacculina , science equipment 333 palaemon , science equipment 334 scolopendra , science equipment 335 bombyx mori , science equipment 336 pila , science equipment 337 mytilus , science equipment 338 sepia , science equipment 339 loligo , science equipment 340 octopus , science equipment 341 echinus , science equipment 342 asterias , science equipment 343 medusa of obeila , science equipment 344 nereis trochophore larva , science equipment 345 prawn t.s. of statocyst , science equipment 346 radula of pila , science equipment 347 chromatography paper , science equipment 348 nereis parapodia , science equipment 349 heterohereis parapodia , science equipment 350 trochophore larva w.m. , science equipment 351 megalopa larva , science equipment 352 zoea larva w.m. , science equipment 353 metazoea larva w.m. , science equipment 354 formalien solution liquid , science equipment 355 eosin powder , science equipment 356 benedict solution , science equipment 357 sodium citrate , science equipment 358 potassium iodide , science equipment 359 copper sulphate , science equipment 360 sodium hydroxide flakes , science equipment 361 nesslers reagent , science equipment 362 mercuric iodide , science equipment 363 mercuric chloride , science equipment 364 hydrochloric acid , science equipment 365 sulpuric acid , science equipment 366 nitric acid , science equipment 367 oleic acid , science equipment 368 starch powder , science equipment 369 urea powder , science equipment 370 urease powder , science equipment 371 phenopthalin , science equipment 372 sodium carbonate , science equipment 373 sodium thiosulphate , science equipment 374 sodium sulphate , science equipment 375 leishman stain , science equipment 376 methyl alcohol , science equipment 377 buffer solution , science equipment 378 potassium chromate , science equipment 379 silver nitrate , science equipment 380 lead nitrate , science equipment 381 edta solution , science equipment 382 erichrome black t indicator , science equipment 383 glycerine , science equipment 384 buffer tablet , science equipment 385 aceto carmine , science equipment 386 barium salphate , science equipment 387 cupric sulphate , science equipment 388 ninehydrine solution , science equipment 389 sudan iii , science equipment 390 amonia solution , science equipment 391 iodine solution , science equipment 392 bromine water , science equipment 393 d.p.x. mountant , science equipment 394 glacial acetic acid , science equipment 395 aceto arosine , science equipment 396 basic fuchasine , science equipment 397 mthyl orange , science equipment 398 acetone , science equipment 399 ph stips , science equipment 400 molish reagent , science equipment 401 alpha nephtol , science equipment 402 picric acid , science equipment 403 urea , science equipment 404 magnesium chloride , science equipment 405 r.b.c. diluting fluid. ( hayems soln. ) , science equipment 406 acetic acid glacial , science equipment 407 aceto orcein soln. , science equipment 408 hydrogen peroxide 6 % ( 20 volumes ) , science equipment 409 pila , science equipment 410 earthworm , science equipment 411 heteropnustes fossilies , science equipment 412 anabus , science equipment 413 calrius , science equipment 414 sepia , science equipment 415 prawn 4 5 , science equipment 416 mystus , science equipment 417 cytological : a ) mitosis cell div. set of 5 slides. , science equipment 418 cytological : a ) mitosis cell div. set of 5 slides. , science equipment 419 embryological : chick embryo w.m. 13 hrs. , science equipment 420 embryological : chick embryo w.m. 18 hrs. , science equipment 421 embryological : chick embryo w.m. 21 hrs. , science equipment 422 embryological : chick embryo w.m. 24 hrs. , science equipment 423 embryological : chick embryo w.m. 30 hrs. , science equipment 424 embryological : chick embryo w.m. 33 hrs. , science equipment 425 embryological : chick embryo w.m. 36 hrs. , science equipment 426 embryological : chick embryo w.m. 38 hrs. , science equipment 427 embryological : chick embryo w.m. 42 hrs. , science equipment 428 embryological : chick embryo w.m. 48 hrs. , science equipment 429 embryological : chick embryo w.m. 58 hrs. , science equipment 430 embryological : chick embryo w.m. 66 hrs. , science equipment 431 embryological : chick embryo w.m. 72 hrs. , science equipment 432 embryological : chick embryo w.m. 84 hrs. , science equipment 433 embryological : chick embryo w.m. 96 hrs. , science equipment 434 amphibian embryology : a ) v.s. / w.m. blastula , science equipment 435 amphibian embryology : b ) v.s. / w.m. blastula , science equipment 436 amphibian embryology : c ) tadpole w.m. , science equipment 437 dompilevel complete set , science equipment 438 thydo complete set , science equipment 439 prismatric compass , science equipment 440 enginering zareeb , science equipment 441 binocoular , science equipment 442 thermometer , science equipment 443 rain meter manual , science equipment 444 sprit level , science equipment 445 globe ( earth ) , science equipment 446 mineral ( 20 set in partion box ) , science equipment 447 crystal ( crystal set of 15 in wooden shwcase ) , science equipment 448 rocks ( rocks set of 20 in card box ) , science equipment 449 geographical model , science equipment 450 bhogolik naksha total quantity : 1...

Government Medical College - Madhya Pradesh

30306150 supply of lab reagents and consumables supply of lab reagents and consumables , glass slide ( microscope glass slides ( pack of 50 slides ) 75 x 25 x 1.4 mm in one carton ) , cover silp for haemocytometet 20mm×26mm×0.4mm ( 10 gm pkt in one box ) , gloves 6 .5 inch ( 100 pieces in one box ) , gloves 6 inch and 7 inch ( 100 pieces in one box ) , gloves 7 inch ( 100 pieces in one box ) , gloves7.5 inch ( 100 pieces in one box ) , syringe 5ml ( 1packet ×100 ) , syringe 10ml ( 1 packet ×100 ) , syringe 20ml ( 1 packet ×100 ) , aluminum tray for holding atleast 20 slides of25 x 75mm ( 1 x 3 ) microscope slides ( 1 ) , coplin jars allow for complete submersion of slides when staining with grooves || each staining jar features 4 grooves to separate each slide each groove allows for 2 slides to be placed back to back of size slides ( 75 x 26 x 1.3mm ) ( 1 ) , plastic test tube stand, capacity: 12 tubes ( 1 ) , plastic test tube stand, capacity: 18 tubes ( 1 ) , wooden, t est tube holder, ( 1 ) , stainless steel alcohol burner spirit lamp lab tubler ( 1 ) , tourniquet belt 20 inch 1 inch ( 1 ) , litmus paper litmus paper ph test strips, full range 0 14, red, blue, acid / base indicators ( 1 pack 8.6 x 6.4 x 0.8 cm; 40 grams ) , slide storage cabinets with lock ( capacity for 50000slides ) ?specifications for keeping 75x25mm slides made of crc steel. ( 50, 000 / 160 drawers ) capacity . keeps slide in vertical position with easily removable racks price appx 1.6 lacs ) ( 1 ) , block storage cabinets with lock ( capacity for 50000 blocks ) sp for keeping embedded blocks . cantains duly powder coated trays designed to keep blocks one after other in rows . each tray accommodating the block will be easily removable . ( ysi 165 by yorko price 4.0 lacs ) ( 1 ) , staining troughsof glass toholdsminimum 20 x slides ( 1 ) , bone saw with 16 inch stainless steel blade ( 1 ) , premium quality stainless steel dissection kit set with tools ( 1 ) , low density polyethylene made wash bottles ( 500 ml ) ( 1 ) , stainless steel biopsy sternal puncture needle with guardno 16 ( nos ) , stainless steel biopsy sternal puncture needle with guardno 14 ( nos ) , museum jarsmallleak proof acrylic jar with lid and acrylic sheets for mounting the specimen 5x5x5 inches ( 1 ) , museum jar mediumleak proof acrylic jar with lid and acrylic sheets for mounting the specimen 6x6x4 inches ( 1 ) , museum jar largeleak proof acrylic jar with lid and acrylic sheets for mounting the specimen 9x9x5 inches ( 1 ) , esrwintrobe tube ( 1 pack of 10 tubes ) , esrwintrobe tube stand holding 6 tubes ( 1 ) , waestergren tube esr pipette westergren graduated ( 1 ) , esr westergren stand steel holding 6 tubes ( 1 ) , disposable plastic dropper 5 ml ( 1 pkt 1000 dropper ) , brain knife ( 1 ) , edta vacutainers ( i pkt 100 containers ) , edta solution ( 500 ml ) , pt vacutainer ( i pkt 100 containers ) , 3.8% sodium citrate solution ( 500 ml ) , anti abd kit blood grouping kit 5 ml , urine strip protein / sugar ( 1 bottle 100 strips ) , urine strip 10 prameters ( 1 bottle 100 strips ) , whatman filer paper ( cicular ) grade ( 100 circles per box ) , capillary tube for clotting time 0.5x75 mm ( non heparinised ) ( 1 pack ) , tissue blotting paper 46 x 58 centimeters ( 1 rim ) , tissue paper , cotton roll ( 1 roll500gm ) , white absorbent gauze than, bandage size: 100cm, 120cm1m to 36m ( 1 than ) , urine container ( 1 pkt 50 ) , afb staining kit ( 1 kit 3x100 ml ) , chlorhexidine 0.5% hand rub ( 500 ml ×25 ) , afb staining kit 3x100 ml ( r 1 125 ml ) , afb staining kit 3x100 ml ( r 2 125 ml ) , afb staining kit 3x100 ml ( r 3 125 ml ) , india ink ( 100 ml bottle ) , methanol ( 1 ltr. ar ) , formaldehyde 40% ( 5 lit ) , thymol crystal ( 100 gm / pack ) , xylene ( 2.5 litre bottle ) , paraffin wax ( meelting point 58 60degree ) pellets ( 500 gm / pack ) , harris hematoxylene stain ready to use ( 125 ml / bottle ) , hematoxylene stain powder ( 250 gm / pack ) , eosin stain ( 125 ml / pack ) , ready to use retic stain ( 25 ml / pack ) , leishman stain ( 500 ml / pack ) , ethyl alcohol ( 500 ml / pack ) , glacial acetic acid ( 500 ml / bottle ) , dpx ( 250ml / bottle ) , potassium iodate ( 100 gm / pack ) , sodiumiodate ( 100 gm / pack ) , potassium alum ( 100 gm / pack ) , chloral hydrate ( 100 gm / pack ) , n / 10 hydrochloric acid ( 500 ml / bottle ) , lugol’s iodine ( 100 ml bottle ) , liquid hand wash solution ( 5 litre ) , semen diluting fluid ( 100 ml / bottle ) , fouchets reagent ( 500 ml / bottle ) , liquidammonia ( 500 ml / bottle ) , methyleneblue ( 100 ml / bottle ) , rbc dilution fluid ( 500 ml / bottle ) , rectified spirit ( 5 litre / can ) , 3% acetic acid ( 500 ml / bottle ) , 3 5% sulfosalicylic acid ( 500 ml / bottle ) , benedicts reagents ready tu use ( 500 ml / bottle ) , ammonium sulphate ( 500 gm / pack ) , sodium nitroprusside ( 100 gm / pack ) , conc nitric acid ( 500 ml ) , 10% barium chloride solution ( 500 ml / pack ) , sulphur granules ( 500 gm / pack ) , wbc diluting fluid ( 500 ml / pack ) , rapid giemsastain ( 250 test / pack ) , rapid pap stain kits ( 250 test / kit ) , sulphuric acid ( 500 ml / kit ) , potassium ferricyanide ( 500gm / pack ) , potassium frerrocyanide ( 500gm / pack ) , sodium dihydrogen orthophosphate ( monohydrate ) ( 1kg / pack ) , disodium hydrogen orthophosphate ( anhydrous ) ( 1kg / pack ) , csf diluting fluid 100 ml ( 100 125 ml / bottle ) , disposable tipsblue tips 1000 ul ( 1000 / pack ) , disposable tipsyellowtips 10 100 ul ( 1000 / pack ) , picric acid500 gm ( 500 gm / pack ) , toludine blue 100 gm ( 100gm / pack ) , blood collection needles vacuum with safety shield and pre attached holder 22g , 1.25” inches ( 32 mm ) needle, pack of 100 ( 1 pack of 100 ) , disposable neddles23 g ( 1 pack of 100 needles ) , disposable needles 21 g ( 1 pack of 100 nedles ) , urine pregnancy strips ( 1 packof 10 strips ) , sterile sample containers plastic container ( 30ml capacity ) wide open mouth, individually packed. ( 1 pack 50 ) , cotton ( 1 roll500gm ) , gram stain kit ( crystal violet ) ( r 1 125 ml ) , gram stain kit ( grams iodine ) ( r 2 125 ml ) , gram stain kit decolgar zar ( acetone / alchol ) ( r 3 125 ml ) , gram stain kit ( safranin ) ( r 4 125 ml ) , afb staining kit 3x100 ml ( carbol fuchsin 20% sulphuric acid methylene blue ) ( r 1 125 ml ) , afb staining kit 3x100 ml ( carbol fuchsin 20% sulphuric acid methylene blue ) ( r 2 125 ml ) , afb staining kit 3x100 ml ( carbol fuchsin 20% sulphuric acid methylene blue ) ( r 3 125 ml ) , india ink ( 100 ml bottle ) , albert stain kit ( stain a ) ( r 1 500 ml ) , albert stain kit ( stain b ) ( r 2 500 ml ) , lectophenol cotton blue ( 1ltr. ) , lugols iodine ( 1ltr. ) , nacl crystal ( 1 kg ) , methanol ( 1 ltr. ) , surgical spirit ( 1 ltr. ) , melachite green ( 1 ltr. ) , nigrosine ( 1 ltr. ) , h2so4 ( 1 ltr. ) , kmno4 crystal ( 1 kg ) , iodine ( 1 ltr. ) , hydrogen peroxide ( 1 ltr. ) , oxidase reagent ( tetramethyl p phenylenediaminedihydochloride ) / oxidase disk ( himedia ) ( 100 disk / vial ) , rabbit plasma ( 0.1 gm / vial ) , kovac’s reagent or ehrlich reagent ( para dimethyl amino benzaldehyde ) ( 100 ml / bottle ) , potassium nitrate ( kno3 ) ( 100 ml / bottle ) , sodium deoxycholate ( 10 ml / bottle ) , bacitracin disk ( 100 disk / vial ) , potassium iodide ( 500 gm ) , potassium hydroxide ( 100 gm / bottle ) , antisera salmonella , antisera shigella dysenteriae ( 1 kit ) , antisera shigella flexneri ( 1 kit ) , antisera shigella sonnei ( 1 kit ) , antisera shigella boydii ( 1 kit ) , antisera vibrio cholera ( 1 kit ) , atcc strain e. faecalis 29213 ( 1 kit ) , atcc strain e. coli 25922 ( 1 kit ) , atcc strain e. coli 35218 ( 1 kit ) , atcc strain p. aeruginosa 27853 ( 1 kit ) , atcc strain s. aureus 25923 ( 1 kit ) , atcc strain s. aureus 29213 ( 1 kit ) , wide mouth sterile / universal container , disposable syringe ( 5 ml ) ( nos ) , disposable syringe ( 10 ml ) ( nos ) , disposable syringe ( 3 ml ) ( nos ) , wooden applicator standard size ( nos ) , spatula ( standaed ) ( nos ) , inoculation loop and wire 2 mm ( nos ) , inoculation loop and wire4 mm ( nos ) , conical flask ( 100 ml ) ( nos ) , conical flask ( 250 ml ) ( nos ) , conical flask ( 500 ml ) ( nos ) , conical flask ( 1000 ml ) ( nos ) , measuring cylinder ( 50 ml ) ( nos ) , measuring cylinder ( 100 ml ) ( nos ) , measuring cylinder ( 1000 ml ) ( nos ) , beaker ( 50 ml ) ( nos ) , beaker ( 100 ml ) ( nos ) , beaker ( 250 ml ) ( nos ) , beaker ( 500 ml ) ( nos ) , test tube ( 5ml ) ( nos ) , test tube ( 10ml ) ( nos ) , test tube ( 20ml ) ( nos ) , test tube holder standard size ( nos ) , test tube rack ( 5ml ) ( nos ) , test tube rack ( 10 ml ) ( nos ) , test tube rack ( 20 ml ) ( nos ) , staining stand ( nos ) , slide box ( nos ) , petri dish ( 90 mm ) size 90 x 15 mm ( nos ) , petri dish ( 120 mm ) size 90 x 15 mm ( nos ) , cavity slide ( 100 slide / box ) , cover slip ( 100 per / box ) , wash bottles ( 500 ml ) ( 500 ml volume ) , tissue paper roll ( nos ) , staining rack ( nos ) , cotton thread for spirit lamp ( nos ) , blood culture bottles ( 100 ml ) bio merieux closed system ( aerobobic paediatric anaerobic ) ( 100 ml / bottle ) , spirit lamp , bacteriological peptone ( 100 gm / bottle ) , beef extract ( 100 gm / pack ) , yeast extract ( 100 gm / pack ) , malt extract ( 500 gm / bottle ) , nutrient agar ( 500 gm / bottle ) , blood agar base ( 500 gm / bottle ) , cled agar ( 500 gm / bottle ) , macconkey agar ( 500 gm / bottle ) , agar agar ( 500 gm / bottle ) , robertson cooked meat broth ( 500 gm / bottle ) , bile salt agar ( 500 gm / bottle ) , tcbs ( 500 gm / bottle ) , bile aesculin agar ( 500 gm / bottle ) , brain heart infusion broth ( 500 gm / bottle ) , mueller hinton agar ( 500 gm / bottle ) , pikes media ( h. inf. ) ( 500 gm / bottle ) , plet media ( b. anthracis ) ( 500 gm / bottle ) , pnf medium ( s. pyogenes ) ( 500 gm / bottle ) , l j medium ( 10 pcs / bottle ) , l j medium ( 50 pcs / bottle ) , l j medium ( 100 pcs / bottle ) , sda ( 500 gm / bottle ) , bile salt agar ( 500 gm / bottle ) , ss agar ( 500 gm / bottle ) , sorbotolmacconkey agar ( ehec ) ( 500 gm / bottle ) , tetrathionate broth ( 100 gm / bottle ) , selenite f broth ( 100 gm / bottle ) , stuart transport medium ( 100 gm / bottle ) , thayer martin medium ( 100 gm / bottle ) , triple sugar iron agar ( 50 gm / bottle ) , sim medium ( 100 gm / bottle ) , simmon’s citrate agar ( 100 gm / bottle ) , christensen urea agar ( 100 gm / bottle ) , dca ( 100 gm / bottle ) , pre reduced anaerobically sterilized media ( 100 gm / bottle ) , mannitol salt agar ( 100 gm / bottle ) , xld agar ( 100 gm / bottle ) , wilson blair brilliant green bismuth sulphite agar ( 100 gm / bottle ) , hoyle’s tellurite lysed blood agar ( 100 gm / bottle ) , mrvp broth ( 100 gm / bottle ) , glucose ( 100 gm / bottle ) , sucrose ( 100 gm / bottle ) , lactose` ( 100 gm / bottle ) , maltose ( 100 gm / bottle ) , mannitol ( 100 gm / bottle ) , inulin ( 100 gm / bottle ) , amikacin 30?g ( 50 disk / vial ) , amikacin 30?g ( 100 disk / vial ) , amoxicillin 25 ?g ( 50 disk / vial ) , amoxicillin 25 ?g ( 100 disk / vial ) , ampicillin / cloxacillin10 ?g ( 50 disk / vial ) , ampicillin / cloxacillin10 ?g ( 100 disk / vial ) , amoxicillin + clavulanic acid20+10 ?g ( 50 disk / vial ) , amoxicillin + clavulanic acid20+10 ?g ( 100 disk / vial ) , ampicillin +salbactam 10+10 ?g ( 50 disk / vial ) , ampicillin +salbactam 10+10 ?g ( 100 disk / vial ) , azithromycin 15 ?g ( 50 disk / vial ) , azithromycin 15 ?g ( 100 disk / vial ) , aztreonam 30 ?g ( 50 disk / vial ) , aztreonam 30 ?g ( 100 disk / vial ) , bacitracin 130 ?g / ?l ( 50 disk / vial ) , bacitracin 130 ?g / ?l ( 100 disk / vial ) , carbenicillin100 ?g ( 50 disk / vial ) , carbenicillin100 ?g ( 100 disk / vial ) , cefaclor30 ?g ( 50 disk / vial ) , cefaclor30 ?g ( 100 disk / vial ) , cefalexin30 ?g ( 50 disk / vial ) , cefalexin30 ?g ( 100 disk / vial ) , cefazolin30 ?g ( 50 disk / vial ) , cefazolin30 ?g ( 100 disk / vial ) , cefepime30 ?g ( 50 disk / vial ) , cefepime30 ?g ( 100 disk / vial ) , cefixime 5 ?g ( 50 disk / vial ) , cefixime 5 ?g ( 100 disk / vial ) , cefoperazone 75 ?g ( 50 disk / vial ) , cefoperazone 75 ?g ( 100 disk / vial ) , cefoparazone+ salbactam75+30 ?g ( 50 disk / vial ) , cefoparazone+ salbactam75+30 ?g ( 100 disk / vial ) , cefotaxime30 ?g ( 50 disk / vial ) , cefotaxime30 ?g ( 100 disk / vial ) , cefotetan 30 ?g ( 50 disk / vial ) , cefotetan 30 ?g ( 100 disk / vial ) , cefoxitin30 ?g ( 50 disk / vial ) , cefoxitin30 ?g ( 100 disk / vial ) , cefpirome30 ?g ( 50 disk / vial ) , cefpirome30 ?g ( 100 disk / vial ) , cefpodoxime10 ?g ( 50 disk / vial ) , cefpodoxime10 ?g ( 100 disk / vial ) , ceftazidime30 ?g ( 50 disk / vial ) , ceftazidime30 ?g ( 100 disk / vial ) , ceftriaxone30 ?g ( 50 disk / vial ) , ceftriaxone30 ?g ( 100 disk / vial ) , cefuroxime30 ?g ( 50 disk / vial ) , cefuroxime30 ?g ( 100 disk / vial ) , cephalotin30 ?g ( 50 disk / vial ) , cephalotin30 ?g ( 100 disk / vial ) , chloramphenicol 30 ?g ( 50 disk / vial ) , chloramphenicol 30 ?g ( 100 disk / vial ) , ciprofloxacin5 ?g ( 50 disk / vial ) , ciprofloxacin5 ?g ( 100 disk / vial ) , clarithromycin15 ?g ( 50 disk / vial ) , clarithromycin15 ?g ( 100 disk / vial ) , clindamycin2 ?g ( 50 disk / vial ) , clindamycin2 ?g ( 100 disk / vial ) , colistin 10 ?g ( 50 disk / vial ) , colistin 10 ?g ( 100 disk / vial ) , doripenem10 ?g ( 50 disk / vial ) , doripenem10 ?g ( 100 disk / vial ) , doripenem30 ?g ( 50 disk / vial ) , doripenem30 ?g ( 100 disk / vial ) , ertapenem10 ?g ( 50 disk / vial ) , ertapenem10 ?g ( 100 disk / vial ) , erythromycine15 ?g ( 50 disk / vial ) , erythromycine15 ?g ( 100 disk / vial ) , fosfomycin 200 ?g ( 50 disk / vial ) , fosfomycin 200 ?g ( 100 disk / vial ) , gentamicin 10 ?g ( 50 disk / vial ) , gentamicin 10 ?g ( 100 disk / vial ) , gentamicin ( high load ) 120 ?g ( 50 disk / vial ) , gentamicin ( high load ) 120 ?g ( 100 disk / vial ) , imipenem10 ?g ( 50 disk / vial ) , imipenem10 ?g ( 100 disk / vial ) , kanamycin30 ?g ( 50 disk / vial ) , kanamycin30 ?g ( 100 disk / vial ) , levofloxacin5 ?g ( 50 disk / vial ) , levofloxacin5 ?g ( 100 disk / vial ) , lincomycin15 ?g ( 50 disk / vial ) , lincomycin15 ?g ( 100 disk / vial ) , linezolid30 ?g ( 50 disk / vial ) , linezolid30 ?g ( 100 disk / vial ) , meropenem10 ?g ( 50 disk / vial ) , meropenem10 ?g ( 100 disk / vial ) , moxifloxacin5 ?g ( 50 disk / vial ) , moxifloxacin5 ?g ( 100 disk / vial ) , nalidixic acid30 ?g ( 50 disk / vial ) , nalidixic acid30 ?g ( 100 disk / vial ) , netilmicin 30 ?g ( 50 disk / vial ) , netilmicin 30 ?g ( 100 disk / vial ) , nitrofurantoin300 ?g ( 50 disk / vial ) , nitrofurantoin300 ?g ( 100 disk / vial ) , norfloxacin 10 ?g ( 50 disk / vial ) , norfloxacin 10 ?g ( 100 disk / vial ) , ofloxacin 5 ?g ( 50 disk / vial ) , ofloxacin 5 ?g ( 100 disk / vial ) , oxacillin1 ?g ( 50 disk / vial ) , oxacillin1 ?g ( 100 disk / vial ) , penicillin6 ?g / 10iu ( 50 disk / vial ) , penicillin6 ?g / 10iu ( 100 disk / vial ) , piperacillin100 ?g ( 50 disk / vial ) , piperacillin100 ?g ( 100 disk / vial ) , piperacillin+tazobactam100+10 ?g ( 50 disk / vial ) , piperacillin+tazobactam100+10 ?g ( 100 disk / vial ) , polymixin50 ?g / 300 ui ( 50 disk / vial ) , polymixin50 ?g / 300 ui ( 100 disk / vial ) , quinupristin dalfopristin15 ?g ( 50 disk / vial ) , quinupristin dalfopristin15 ?g ( 100 disk / vial ) , rifampicin5 ?g ( 50 disk / vial ) , rifampicin5 ?g ( 100 disk / vial ) , spectinomycin 100 ?g ( 50 disk / vial ) , spectinomycin 100 ?g ( 100 disk / vial ) , streptomycin10 ?g ( 50 disk / vial ) , streptomycin10 ?g ( 100 disk / vial ) , streptomycin ( high load ) 300 ?g ( 50 disk / vial ) , streptomycin ( high load ) 300 ?g ( 100 disk / vial ) , teicoplanin 30 ?g ( 50 disk / vial ) , teicoplanin 30 ?g ( 100 disk / vial ) , tetracycline 30 ?g ( 50 disk / vial ) , tetracycline 30 ?g ( 100 disk / vial ) , ticarcillin75 ?g ( 50 disk / vial ) , ticarcillin75 ?g ( 100 disk / vial ) , ticarcillin+clavulanic acid 75+10 ?g ( 50 disk / vial ) , ticarcillin+clavulanic acid 75+10 ?g ( 100 disk / vial ) , tigecycline15 ?g ( 50 disk / vial ) , tigecycline15 ?g ( 100 disk / vial ) , tobramycin10 ?g ( 50 disk / vial ) , tobramycin10 ?g ( 100 disk / vial ) , trimethoprim+sulfamethoxazole1.25+23.75 ?g ( 50 disk / vial ) , trimethoprim+sulfamethoxazole1.25+23.75 ?g ( 100 disk / vial ) , trimethoprim5 ?g ( 50 disk / vial ) , trimethoprim5 ?g ( 100 disk / vial ) , vancomycin 30 ?g ( 50 disk / vial ) , vancomycin 30 ?g ( 100 disk / vial ) , polymyxin b ( 50 disk / vial ) , polymyxin b ( 100 disk / vial ) , optochine disc ( 50 disk / vial ) , optochine disc ( 100 disk / vial ) , cedar wood oil ( 100 ml / bottle ) , absolute spirit ( 500 ml / bottle ) , serum glucose ( god / pod enzymatic end point ) ( 1×500 ml ) , serum urea ( urease / gldh ) ( 10×50 ml ) , serum creatinine ( enzymatic pap method ) ( 1×100 ml ) , serum total protein ( biuret method ) ( 1×50 ml ) , serum albumin ( bcg ene point ) ( 3×50 ml ) , serum bilirubin ( diazo method ) ( 4×40 ml ) , sgot ( kinetic ) ( 5×50 ml ) , sgpt ( kinetic ) ( 5×50 ml ) , alp ( kinetic ) ( 5×50 ml ) , ggt ( glupa c kinetic ) , serum amylase ( direct substrate kinetic method ) ( 2×20 ml ) , serum lipase ( turbidometric uv method ( 2×20 ml ) , total cholesterol ( chod / pod method ) ( 2×20 ml ) , triglycerides ( gpo / pod method ) ( 2×20 ml ) , serum calcium ( ocpc method ) ( 2×20 ml ) , serum phosphorous ( uv molybdate methed ) ( 2×20 ml ) , crp ( quantitative ) ( 1×50 ml ) , serum uric acid ( uricase ) ( 2×10 ml ) , serum ldh ( kinetic ) ( 1×25 ml ) , ck mb ( kinetic ) ( 1×25 ml ) , plain vials ( 5000 nos ) , fluoride vials ( 5000 nos ) , lab detergent liquid ( lab detergent ) ( 5 ltr ) , sta lia test d dimer ( for automated coagulation analyzer modal : sta compact max 3 make: diagnostica stago s.a.s ) ( 6×6ml ) , sta lia test control ( for automated coagulation analyzer modal : sta compact max 3 make: diagnostica stago s.a.s ) ( 12×2×1 ) , sta desorb u ( for automated coagulation analyzer modal : sta compact max 3 make: diagnostica stago s.a.s ) ( 24×15ml ) , sta coagulation control ( for automated coagulation analyzer modal : sta compact max 3 make: diagnostica stago s.a.s ) ( 12×2×1 ) , sta neo optimal ( for automated coagulation analyzer modal : sta compact max 3 make: diagnostica stago s.a.s ) ( 6×5ml ) , sta cleaner solution ( for automated coagulation analyzer modal : sta compact max 3 make: diagnostica stago s.a.s ) ( 6×2500ml ) , sta owren koller ( for automated coagulation analyzer modal : sta compact max 3 make: diagnostica stago s.a.s ) ( 25×15ml ) , cuvette for alliquote ( for automated coagulation analyzer modal : sta compact max 3 make: diagnostica stago s.a.s ) , sta compact cuvette ( for automated coagulation analyzer modal : sta compact max 3 make: diagnostica stago s.a.s ) , aspen 68 ds diluentmodal : bc6800 ( for five part fully automated cell counter ) , aspen 68 ld lyse modal : bc6800 ( for five part fully automated cell counter ) ( 1×1 l ) , aspen 68 fd dye modal : bc6800 ( for five part fully automated cell counter ) ( 1×12 ml ) , aspen 68 lb lyse modal : bc6800 ( for five part fully automated cell counter ) ( 1×1 l ) , aspen 68 lh lyse modal : bc6800 ( for five part fully automated cell counter ) ( 1×1 l ) , aspen 68 dr diluentmodal : bc6800 ( for five part fully automated cell counter ) ( 1×1 l ) , aspen 68 fr dye modal : bc6800 ( for five part fully automated cell counter ) ( 1×12 ml ) , aspen 68 ln lys modal : bc6800 ( for five part fully automated cell counter ) ( 1×1 l ) , aspen 68 fn dye modal : bc6800 ( for five part fully automated cell counter ) ( 1×12 ml ) , aspen bc 6 d control set modal : bc6800 ( for five part fully automated cell counter ) ( 6×4.5 ml ( 2l, 2n, 2h ) , aspen bc ret control set modal : bc6800 ( for five part fully automated cell counter ) ( 6×4.5 ml ( 2l, 2n, 2h ) , aspen sc cal plus calibratormodal : bc6800 ( for five part fully automated cell counter ) ( 2×3 ml ) , ldl ( direct ) ( 1×40ml ) , cba reagent ( dilute+lyse ) , hdl ( pvs / pegme direct ) ( 1×40ml ) , 40 % urea solution ( 5 ml / vial ) ...

Government Medical College - Madhya Pradesh

30268661 supply of medicine supply of medicine , injection, tablet, capsul, cream, oint, eye drop, syp, solution, ointment, iv fluid, power, gel, spary, inhaler, etc , 5 fluro uracil 250mg 10 ml amp , 5 fluro uracil 500mg 10 ml amp , actinomycin 0.5 mg inj , acycloir 250 mg inj , acycloir 500 mg inj , acycloir 750 mg inj , adenosine 3 mg / ml 2 ml amp , ado trastuzumab emtansine 100 mg inj , adrenalin inj 1mg / ml 1ml amp , alamine 8.2gm+l glutanic acid 13.46gm 100 ml bottle i / v , alteplase 50mg inj , amidotrizoate meglumine; sodium amidotrizoate ( 76% ) dye 50 ml , amikacin250mg / 2 ml 2 ml vial , amikacin500mg / 2 ml 2 ml vial , aminophylline 25 mg / ml , amiodarone 50 mg / ml 3 ml amp , amoxicillinmg + clavulanic acid mg 1.2 gm vial , amoxicillin 500 mg + clavulanic acid100mg, inj , amphotericine ( liposomal ) 50 mg inj , amphotericine b 50 mg inj , ampicillin500 mg vial , anti d. immunoglobulin ( monoclonal ) ( 150mcg / vial ) human anti d, , anti d. immunoglobulin ( monoclonal ) ( 300mcg / vial ) , human anti d , anti hemophillic factor viii 250 iu ( vial ) , vial , anti hemophillic factor viii 500 iu ( vial ) , vial , anti human thymocyte immunoglobulin 25 mg , anti rabies vaccine inj , anti scorpion venominj <120mg total protein and >150 ld50 , anti snake venom ( liquid form ) 10ml ( polyvalent ) , artesunate 60 mg / vial , ascorbic acid 500mg / ml 50ml vial ( vitamin c ) inj , atracurium25mg / ml 2.5ml amp , atropine sulphate 0.6mg / ml amp , azithromycin 100mg / 5ml inj , azithromycin 200mg / 5ml inj , bendamustin 100 mg vial , benfothiamine + folic acid + mecobalamin + pregabalin + vit b6 inj , benzathine penicilline 12 lac iu / vial vial , betamethasone sodium phosphate 4 mg / ml 1 ml amp , bevacizumab 100 iu vial , bleomycin 15 unit vial , bortezomib 2 .5 mg vial , bortezomib 2 mg / vial , bupivacaine hcl0.5% 20 ml vial , bupivacaine hcl for spinal anaesthesia , buprenorphine hydrochloride0.3mg base / ml 1ml amp inj , busulphan 60mg vial , butorphanol 1mg / ml 1ml amp , caffeine citrate 20 mg / ml 3 ml vial , calcium carbonate 10%10ml amp , calcium chloride 10% 100mg / ml 10ml vial , calcium gluconate 10% 10 ml vial , calcium leucovorin ( folinic acid ) 50 mg / vial 5 ml vial , carboplatin 150 mg inj vial , carboplatin 450 mg injvial , carboprost promithamin 250 mcg / ml 1ml amp , carmustin 100 mg inj vial , carmustine ( bcnu ) 100 mg vial , cefaparazone with salbactum , cefazoline 500 mg vial , cefepime 500 mgvial , cefepime 500mg +tazobactum 625 mg vial , cefoperazone + sulbactam 1000 mg +1000 mg vial , cefoperazone 1gmvial , cefotaxime + sulbactam 1000 mg + 500 mg vial , cefotaxime sodium 1 gm / vial , cefotaxime sodium 500mg vial , ceftazidime 1gm vial , ceftazidime 250 mg inj vial , ceftazidime 500mg vial , ceftriaxone + sulbactum 1.5gm vial , ceftriaxone + tazobactum inj 1.125gm vial , ceftriaxone 1 gm / vial , ceftriaxone 500 mg / vial , cetuximab 100mg vial , cetuximab 200mg / 100ml vial , cetuximab 50mg vial , chloroquine phosphate 40mg / ml 5ml amp , chlorpheniramine maleatevial , chlorpromazine ip 25mg vial , cisplatin 10 mg vial , cisplatin 50 mg vial , clindamycin 150 mg / ml 2 ml vial , clindamycin 600mg / 4ml solution for injection , clopixol acuphase 50 mg inj , clopixol deconate 200 mg inj , collistimate sod. 1iuvial , collistimate sod. 2iuvial , crystalline insulin 40 iu / 10ml regular insulin 10 ml amp , cyclophosphamide 200 mg / vial , cyclophosphamide 500 mg / vial , cyclophosphamide ip 1 gm vial , cytrabine 100 mg inj , dacarbazine 200 mg inj , dacarbazine 500 mg inj , dacarbazine 500 mginj , daunorubicin 20 mg / vial , daunorubicin 50 mg / vial , decitabine 50mg inj , dexamethasone 4mg vial , dexamethasone 4mg / 1mlinj , dexmedetomidine100 mg / ml amp ( 1 ml amp ) , diatrizoate meglumine & diatrizoate sodium ( 37% ) vial , diatrizoic acid 60% amp , diatrizoic acid 65% amp , diazepam5 mg / ml 2 ml amp , diazepam 2 ml amp , diclofenac sodium 25 mg / ml 3 ml amp , diclofenac sodium inj for intravenous use surfactant free 1 amp , dicyclomine 10mg / ml 2 ml vial , digoxin i.p. 0.5mg / 2 ml amp , diltiazem 25mg / 5ml vial , diphtheria antitoxin1000 iu vial , dobutamine 50 mg / ml 5 ml amp , docetaxel 120mg inj , dopamine hydrochloride 40 mg / ml 5 ml amp , doxorubicin ( lypholozed ) 10 mg / vial , doxorubicin 50 mg / vial , drotaverin 40mg / 2ml amp , edavarane60 mg inj , enalapril maleate inj 1.25 mg per ml 2ml vial , enoxaparin 40mg inj amp , enoxaparin 60mg inj amp , ephedrine 30mg / ml inj , epirubicin 100mg inj , epirubicin 50mg inj , erythropoetin 4 k inj , erythropoietin 10000iu inj 1ml pfs , erythropoietin 40000iu inj 1ml pfs , esmolol / 40mg / ml 5 ml vial , ethamsylate 125 mg inj , ethamsylate 2ml / 125mg / amp , etiophylline + theophylline inj 220mg / 2ml amp , etomidate 2 mg / ml emulsion with mct 10ml vial , etoposide 100 mg inj , fat emulsion 20% 250 ml bottle , fentanyl 100 microgran2 ml amp , fentanyl 50 microgran 2 ml amp , filgrastim 300 mcg 1ml pfs , fluanxol depot 25 mg inj , fludarabin 50 mg vial , fluorescein 20% 5 ml amp , flupenthioxl 20 mg inj , fluphenazine 25 mg / ml 1 ml amp , frusemide 10mg / 2ml amp , g.c.s.f. 300 unit inj , ganciclovir 500 mg vial , gas gangrene antitoxin 10, 000 iu / ml 40000 iu 4ml amp , gatifloxacin vial , gemcitabine 1 gm vial , gemcitabine 1.4 gm vial , gentamycin 80mg / 2ml amp , glargine 100iu / 3ml amp , glycopyrrolate 0.2 mg / ml 1 ml amp , glycopyrrolate 0.5mg + neostigmine 2.5mg 5ml amp , haemocoagulase 1 iu ( reptilase ) botropose inj , haloperidol 5 mg / iv / im inj , haloperidol 50 mg / ml 1 ml inj , heparin5000 iu ( 1000 iu / ml5 ml vial ) , heparin 25000 iu ( 5000 iu / ml5ml vial ) , hepatitis b vaccine / 1ml , hepatitis immunoglobulin 100iu vial , human albumin 20 % / 100ml bottle , hyaluronidase 1500 iu / 2ml amp , hydrocortisone dry powder 100 mg / vial ( hydrocortisone sodium , hydroxy progesterone caproate 250mg / ml vial , hydroxypropylmethylcellulose 2% inj pre filled syringe , hyoscine butyl bromide / 20mg / 2ml amp , ifosfamide1 gm vial , ifosfamide2 gm vial , ifosphamide + mesna 1gminj , imipenem 1g vial , imipenem 1gm+cilastatin sodium 500 mg vial , iohexol 350 mg i / ml ( non ionic contrast medium in sterile , irinotecan 100mg inj , irinotecan 40mg inj , iron sucrose , isoprenalin inj 1ml amp , isoxsuprine hcl5mg / ml 2ml amp , iv human immunoglobulin 5% iv ig ( 5gm / 100ml bottle, injection , ketamine hydrochloride 50 mg / ml 10 ml , labetalol 20 mg ( 5mg / 1 ml 4 ml amp ) , l asparaginase 5000iu inj , levetiracetam 100mg / ml 5ml amp , levosulpride inj amp , lignocaine ( preservative free ) 2% 50 ml vial , lignocaine for spinal anaesthesia , lignocaine hydrochloride + adrenaline , lignocaine hydrochloride 2% 21.3 mg / ml 30 ml vial , lignocaine / lidocaine 4%, 30 ml vial , liposomal doxorubicine 2mg / ml inj , lmwh low molecular weight heparin 40mg vial , lmwh low molecular weight heparin 60mg vial , lorazepam 2 mg / ml, 1 ml vial , lorazepam 2 mg / ml, 2 ml vial , l ornithine l aspartats10ml inj , low molecular weightdextran 40000 vial , magnesium sulphate inj50% w / v 10ml amp , meningococcal polysaccharide vaccine groupe a, c, y and w 135 , mephentermine 30 mg / ml 10 ml , meropenem 1 gm / vial , meropenem 500 mg / vial , metaclopromide 5mg / ml 2ml amp , methacarbamol 100 mg. / 10ml vial , methotrexate 15 ( preservative free ) inj , methotrexate 50 mg / 2 ml, 2 ml vial , methyl ergometrine maleate 0.2 mg / ml, 1 ml amp , methylcobalamine ( vitamin b12 ) 500 mcg / ml, 3 ml amp , methylene blue 1% 10ml inj , methylprednisolone125mg vial , methylprednisolone 1 gm vial , methylprednisolone 40 mg / vial , methylprednisolone sodium succinate 500 mg / vial , metoprolol 5mg / ml 5ml vial , micronised progesterone 50mg / ml 2mlamp , micronized progesterone 200 ml vial , midazolam 1mg / ml, 1 ml amp , midazolam 1mg / ml 5ml vial , milrinone 1mg / ml solution for injection / infusion , mitomycin c 10mg / 40mg inj , mitoxantrone 15 mg inj , mixed.25 / 75 ( 25% insulin lispro+75% lispro insulin protamin ) , mixed.30 / 70 insullin biphasic isophane40 iu / ml 10 ml vial , morphine supaphate 10mg / ml 1ml amp , multivitamin 10 ml amp , nabpaclitaxel 100mg / vial , n acetyl cysteine inj 200mg / ml 10 ml amp , naloxone 0.4 mg / ml, 1 ml , nekethamide amp , neostigmine 0.5 mg / ml, 1ml amp , nitroglycerine ( glyceryl tri nitrate ) 25 mg / 5 ml 5 ml amp , noradrenaline bitartrate2 mg base / 2 ml amp , octreotide 100microgram / ml solution for injection 1 ml amp , octreotide 50 microgram / ml solution for injection 1 ml amp , olanzapine10 mg inj , olenzapine depot inj , ondansetron 2 mg / ml 2 ml amp , ondansetron 2 mg / ml 4 ml amp , oxaliplatin 100mg inj , oxaliplatin 50mg inj , oxytocin 5 iu / ml, 1 ml amp , paclitaxel 100mg inj , paclitaxel 260mg inj , panitumumab 100mg / 5ml inj , pantoprazole 40 mg / vial , paracetamol 150mg / ml 2ml amp , paracetamol 2ml amp for i / v use , peg gcsf 6 mcg , pembrolizumab 100mg / 4ml ( 25mg / ml ) , pemetraxed 100 mg inj , pemetraxed 500 mg inj , penicillin v 125 mg inj , pentazocin lactate 30mg / ml 1ml amp. , pentoxiphylline 20 mg / ml , perinorm 2ml , pertuzumab 30mg / ml ( 420mg / 14ml ) , pheniramine maleate ip 22.75 mg, 2 ml amp , phenobarbitone100mg / ml 1ml amp. , phenobarbitone200mg / ml 1ml amp. , phenytoin sodium50mg / ml 2ml / amp , pilocarpine 0.5 % / 1ml amp , piperacillin 4 gm + tazobactum 500 mg, vial , piperacillin tazobactum 1.125 gm vial , pneumococcal vaccine 10 ml vial , potassium chloride inj. 150mg / 10ml amp , pralidoxime20 ml vial , pregabalin inj , progesterone b.p.100mg vial , prolution depot 250mg inj 1ml amp , promethazine 2 ml / 2.5% vial , propofol sodium with mct / lct 1% w / v 10 mg / ml, 20 ml vial , protamine sulphate 1%, 10mg / 5ml amp , quinine sulphate 300 mg / ml, 2 ml amp , rabeprazole 20 mg vial , ranitidine 50mg / 2ml amp , remdesivir inj 100mg / 20ml vial , rituximab 100mg inj , rituximab 500mg inj , ropivacaine hydrochloride0.2% 40mg / 20ml vial ( 2mg / ml ) , ropivacaine hydrochloride0.75% 150 mg / 20 ml vial ( 7.5mg / ml ) , ropivacaine 10mg / ml 2.5ml vial , ropivacaine 0.5% 20 ml vial , ropivacaine 0.75% 4ml amp , sargramostin 500 mg inj , soda bicarbonate 10ml, 7.5% inj , sodium thiopentone inj 0.5gm powder / vial 20ml vial , sodium valproate 100 mg / ml, 5 ml , streptokinase 150000iu ( 15 lac ) amp , streptomycin 0.75 mg vial , succinyl choline 50 mg / ml, 10 ml vial , surfactant bovine ( 135 mg phopholipid per 5 ml / 5ml vial ) , vial , tecoplanin 400mg vial , terbutalime 0.5mg / ml aml amp , teriparatide 600mcg 3 ml amp , terlipressin 1 mg / 10 ml amp , tetanus immunoglobulin usp 500 iu / vial , tetanus toxide 0.5ml ampoule , thiamine hydrochloride inj.100mg / ml 2ml vial multiple dose , thiopentone sodium 0.5gm powder / vial, 20 ml vial , thiopentone sodium 1 gm / vial , tigecycline, 50 mg, vial , tobramycine 80 mg vial , tocilizumab 400 mg inj , torsemide inj 2ml amp , tramadol 50 mg / ml, 2 ml amp , tramadol 50 mg inj , tranexamic acid 100mg inj , tranexamic acid 500 mg / 5 ml, 5 ml amp , trastuzumab 440mg inj , triamcinolone acetate 40 mg / ml 1 ml amp , trypan blue opthalmic solution 0.06% pre filled syringe , urokinase 500000 iu vial , vancomycin hydrochloride 1000 mg / vial , vancomycin hydrochloride 500 mg / vial , vasopressine40 iu / ml amp , vasopressine 20unit amp , vecuronium bromide 2 mg / ml, 2 ml amp , verapamil hydrochloride 2.5 mg / ml amp , vinblastine 10 mg / 10 ml, 10 ml , vincristine 1 mg / ml, 1 ml vial , vinorelbin 10 mg inj , vinorolbine 50mg inj , vit. cynocobalamin 500mcg +folic acid 15mg+niacinamide 200 mg , vit. cynocobalamin 500mcg +folic acid 15mg+niacinamide 200 mg , vit. methylcobalamin 1500 mcg +folic acid 0.7mg+niacinamide 12 , vitamin b complex inj , vitamin k 1ml, 10mg / ml , voriconazole 10 mg / ml, 200 mg / vial , water for injection 10 ml amp , zoledronic acid 4 mg / 100 ml vial , amino acid infusion 5 %100 ml , amino acids 10% w / vin glass bottle 500ml, , aminoacid ( essential ) 10% 100 ml ffs bottle , balanced crystalloid solution 500 ml bottle , ciprofloxacin100 mg / 50 ml 100 ml ffs bottle , dextrose 40% 100 ml bottle , dextrose 5 % with normal saline 0.45% , dextrose saline ( dns ) , dextrose, 25% 100 ml ffs bottle , dextrose, d 10 10% 500 ml ffs bottle , dextrose, d 5, 5% 500 ml ffs bottle , dextrose, d 50 50% 100 ml ffs bottle , electrolyte m ( multi electrolyte with 5% dextrose iv injection , electrolyte p ( multiple electrolytes & dextrose injection type i ip ) , fat emulsion 20% 0.2 ( 250 ) ml , fluconazole 100ml bottle. 2mg / ml. , glutamine dipeptide 100ml bottle , glycine irrigation solution ip 3000 ml bottle , hydroxyethylstarch 6% solution with sodium chloride 0.9% iv , levofloxacin 500 mg / 100 ml 100 ml ffs bottle , linezolid 200 mg / 100ml 300 ml bottle , mannitol20%100 ml ffs bottle , mannitol 20% 350ml , metronidazole 500 mg / 100 ml 100 ml ffs bottle , normal saline 0.9% 100 ml ffs bottle , normal saline 0.9% 3 ltrs bottle , normal saline 0.9% 500 ml ffs bottle , normal saline 1.6% 500 ml bottle , normal saline 3% 100 ml ffs bottle , normal saline glass bottle 100ml , normal saline glass bottle 500ml , ofloxacin 100 ml / 200mg bottle , omega 3 fatty acid 100 ml bottle , paracetamol1000 mg 100 ml ffs bottle , ringer lactatei / v 0.24 % v / v of lactic acid ( eq. to0.32% w / v of , ringer lactatei / v 0.24 % v / v of lactic acid ( eq. to0.32% w / v of , sodium chloride hyper tonicn / 2 ( 0.45% ) 500 ml ffs bottle , sodium chloride ( 1 / 2 n ) + dextrose , total parenteral nutrition 1000 ml with 763 kcal , tpn ( total parenteral nutrition ) including carbohydrate + proteins , budesonide respules 0.5mg , desflurane 240ml bottle , formeterol + budesonide 120 mdi respules , ipratropium bromide 250 mcg / ml amp , ipratropium bromide 40 mcg + levosalbutamol200 mcg respules , isofluran 250 ml bottle , salbutamol nebuliser solution bp sabutamol sulphate eq. to , salmeterol 25 mcg + fluticasone 250 mcg 120 mdi , sevoflorane 250ml. , 6 mercaptopurine , 50mg , acamprosate, 333 mg , aceclofenac 100mg tablet , aceclofenac 100mg+paracetamol 325mg , tablet , aceclofenac 100mg+paracetamol 325mg + chlorzoxazone 250mg , aceclofenac 100mg+paracetamol 325mg + serratiopeptidase 10mg , aceclofenac 100mg+paracetamol 500mg , tablet , acenocoumaro / nicoumalone 2 mg tab , acetazolamide 250 mg tab ( dimox ) , acyclovir400 mg , acyclovir800 mg , afatinib 40 mg , agomelantine 025 mg tab , albendazole 400 mg , albendazole 400 mg + ivermectin 6 mg tab , alendronate 70 mg , alfuzocin hcl 10mg , alfuzosin 10mg+dutasteride 0.5 mg , allopurinol 100 mg , alprazolam 0.25 mg , amiodarone 200 mg , amisulpride 100 mg , amisulpride 200 mg , amisulpride 50 mg , amitriptyline 25 mg , amitriptyline 50 mg , amitriptyline 75 mg , amlodipine 2.5 mg , amlodipine 5 mg , amlodipne 10 mg tab , amolodipine 5mg +atenolol 50mg , anastrozole1mg , aripiprazole 10 mg , aripiprazole 15 mg , aripiprazole 30 mg , artesunate 50 mg+sulphadoxine 500 mg+pyrimethamine 25 mg , aspirin 150 mg , aspirin 75 mg , atenolol 25 mg tab , atenolol 50 mg , atiomoxetin 10 mg tab , atiomoxetin 25 mg tab , atorvastatin 10 mg , atorvastatin 20 mg , atorvastatin 40 mg , axitinib 5mg , azathioprine 50 mg tab , azithromycin500 mg , azithromycin 250 mg tab , azithromycin+fluconazole+secnidazole ( 1gm+150mg+1gm ) tab , baclofen 10 mg , baclofen od 20 mg , baclofen od 30 mg , baclofen od 40 mg , betahistine 16 mg tab , betahistine 8 mg tab , betamethasone 0.5 mg , bicalutamide 50 mg , bisacodyl5 mg , blonameserire 2 mg , blonameserire 4 mg , buprinoprhin 4mg , buprinoprhin 8 mg , bupropion150 mg , buspirone 10 mg , buspirone 5 mg , cabargolin 0.25 mg , calcium acetate 667 mg tab , calcium carbonate tab , calcium d3 / 500mg , calithromycin 250 mg , capecitabine 500mg , carbamazepine200 mg , carbamazepine sr100 mg , carbamazepine sr200 mg , carbamazepine sr400 mg , carbimazole 5mg , carvedilol6.5 mg. , carvedilol 3.125 mg tab , cefixim 200 mg + clavulanic acid 125 mg , cefixime 100 mg , cefixime 200 mg , cefodoxime 200mg tab , cefpodoxime50 mg , cefuroxime 500 mg , cetirizine10 mg , chlordizepoxide 10mg , chlordizepoxide 25mg , chloroquine phosphatetab. 250 mg , chlorpheniramine maleate tab 4 mg , chlorpromazine50mg , chlorpromazine 100 mg , chlorthalidon 50 mg tab , chymotrypsin & trypsin tab , cinnarizine 25 mg tab , cinnarizine tab. 5mg , ciprofloxacin500 mg , clindamycin 600mg , clobazam 10 mg , clobazam 5 mg , cloimipramine 50mg , clonazepam 0.25 mg tab , clonazepam 0.5 mg tab , clonazepam 1 mg , clonazepam 2 mg , clonidine100 mcg , clonidine 100 mg tab , clopidogrel75 mg , clopidogrel aspirin , clotrimazole vaginal 500mg tab , clozapine 100 mg , clozapine 25 mg , clozapine 50 mg , crizotinib 250mg , cyclophosphamide 50 mg tab , deferasirox dispersible 500 mg tab , dexamethasone 4 mg tab , diazepam10 mg , diazepam5 mg , diclofenac 50mg + paracetamol 325mg + serratuioeotudase 10mg , diclofenac 50mg + paracitamole 500mg , diclofenac 50mg + serrtiopeptidase , diclofenac sodium 50 mg , dicyclomine tab 10 mg. , digoxin 0.25 mg , diltiazem 30mg , diphenylhydramine 50 mg , disulfiram 250 mg , divalproex sodium 250 mg , domperidone 10 mg tab , domperidone+ranitidine 150mg tab , donepezil10 mg , donepezil 5 mg , dosatinib 100mg / 50 mg , doxophylline400 mg , dudrogesterone 10mg , duloxetine 20 mg tab , duloxetine 30 mg tab , enalapril maleate 2.5 mg , enalapril maleate 5 mg , erlotinib 100mg , erlotinib 150mg , escitalopram 10 mg , escitalopram 20 mg , escitalopram 5 mg , ethamsylate 500 mg , etizolam 0.5mg , etophylline 77 mg+ theophyllin 23 mg , etoposide 50 mg , everolimus 2.5mg / 5mg / 10mg , famutaz 40 mg , ferrous ascorbate 100 mg tab ( elemental iron +folic acid 1.5 mg , ferrous sulphate tab. 200mg ( equivalent to 60mg elemental iron ) , flavoxate hcl 200mg , flebuxostat 40mg , fluconazole 150 mg , fludrocortisone 0.1mg tab , flunarizine 10 mg , flunarizine 5 mg , fluoxetine 40 mg , fluvoxamine 50 mg , folic acid 5 mg , frusemide40 mg , gabapentin 300 mg. , gabapentine 100 mg , gefitinib 250mg , glibenclamide 2.5mg tab , glibenclamide 5mg tab , gliclazide 80 mg , glimeperide2 mg , glimeperide 1 mg , glimipride 1mg+metformine 500mg , glyceryl trinitrate 0.5 mg sublingual tab , haloperidol 1.5 mg , haloperidol 10 mg , haloperidol 5 mg , hydrochlorothiazide 12.5 mg , hydrochlorothiazide 25 mg , hydrocortisone 10 mg , hydroxychloroquine sulphate 400 mg , hydroxychloroquine ( 200 mg ) , tablet , hyoscine butylbromide tab 10mg , ibuprofen400 mg , ibuprofen 400 mg + paracetamol 325 mg , imatinib 100mg , imatinib 400 mg , imipramine hcl 25 mg , imipramine hcl 75 mg , iron folic acid tab ferous sulphate dessicated ip 333 335mg , iso sorbitrate dinitrate sublingual5mg , isosorbide 5 mononitrate20 mg , ivermectin 12 mg , labetalol 100mg , lacosamide 50 mg tab , lactobacillus tab 60 million spores , lamotrigine 100 mg , lamotrigine dt 50 mg tab , lapatinib 250 mg , lenalidomide 10 mg , lenalidomide 10mg / 25mg , letrozole 2.5mg , levetiracetam 250 mg , levetiracetam 500 mg , levocetirizine 5mg tab , levocetirizine 5mg+ monteleukast 10 mg tab , levodopa + carbidopa 100+10mg , levofloxacin tab 500mg , linezolid600mg , lithium carbonate 300 mg , lithium carbonate 400 mg , lorazepam1 mg , lorazepam 2mg tab , lorcaserine 10 mg tab , losartan 50 mg tab , losartan 50 mg+hydroclorothiazide 12.5 mg tab , mag. oxide 200 mg , mebendazole 100 mg tab , mefenamic acid + dicyclomine tab ( 250 mg + 10 mg ) , tablet , mefenamic acid + drotaverine hcl tab ( 250 mg + 80 mg ) , tablet , megestrol acetate 40mg , memantine 10 mg , mesalamine ( 5 aminosalicylic acid ) 400 mg tab , metformin 500 mg , metformine 500 mg + glimipride 2 mg tab , metformine 500 mg+ gliclazide 80 mg tab , metformine 500 mg+glibenclamide 5 mg tab , methimazole 10 mcg tab , methocarbamol500 mg. , methotrexate10 mg , methotrexate2.5 mg , methotrexate7.5 mg , methyephendate 10 mg , methyephendate 20 mg , methyephendate 5 mg , methyl prednisolone16 mg , methyl prednisolone 4 mg tab , methyl prednisolone 8 mg tab , methylcobalamin500 mcg , methylcobalamin 1500 mcg+alpha lipoic acid 100 mg+folic acid1.5 , methyldopa 250 mg tab , metoclopramide05 mg , metoclopramide 10 mg , metolazone 5 mg , metoprolol tab 50 mg , metronidazol 400mg , mifepristone 200mg ( 1 tab ) +misoprostol 200mcg ( 4 , mirtazapine15 mg , mirtazapine30 mg , mirtazapine7.5 mg , misoprostol 200 mg , modafinil 100 mg tab , morphine 10 , multivitamin tab nfi formula sugar coated vita 2500 iu, vit b12 , , mycophenolate mofetil, 500 mg , n acetylcysteline 600 mg , naltrexone, 50 mg , nicorandil 5 mg tab , nifedepine 10mg , nifedepine r 20mg , nilotinib 200mg , nitazoxnide 200 mg , nitrofurantoin ip , 100 mg , norfloxacin400 mg , norfloxacine 400 mg + tinidazole 600 mg , ofloxacin 200mg +tinidazole 600mg tab , olanzapine 5 mg , olanzapine10 mg , olanzapine2.5 mg , olanzapine20 mg , olanzapine7.5 mg , olmesartan40mg , ondansetron 4 mg , ondansetron 8mg , orlistate 120 mg tab , orlistate 60 mg tab , ornidazole500 mg , oxcarbazapine 300mg tab , oxcarbazapine 600mg tab , oxcarbazepine 150 mg , pacitane 2mg tab , palbociclib 100 mg , palbociclib 125 mg , palbociclib 75 mg , paliperidone 1.5 mg , paliperidone 3 mg , pantoprazole 40 mg , pantoprazole 40 mg+ domperidon 10 mg , paracetamol 500 mg , paracetamol 650mg tab , paroxetine cr 12.5 mg , pazopanib 200mg / 400mg , penicillin v 250 mg tab ( phenoxymethyl penicillin potassium ) , pentoxifylline 400mg , phenobarbitone 30 mg. , phenobarbitone 60 mg. , phenytoin sodium100 mg , piogliatazone 15 mg tab , piogliatazone 30 mg tab , piracetam 400 mg , piracetam 800 mg , prazosin 5 mg , prednisolone 10 mg , prednisolone 5 mg , pregabalin 75 mg tab , primaquine7.5 mg , primaquine 15 mg tab , procyclidine 5 mg , promethazine 2 5 mg , propranolol la 40 mg , propranolol10 mg , propranolol20 mg , propylthiouracil , pyridoxine 40 mg tab , quetiapine 100 mg , quetiapine 200 mg , quetiapine 50 mg , quinine sulphate 300 mg , rabeprazole 20 mg tab , racecadotril 100mg , ramipril 2.5 mg tab , ramipril 5 mg tab , ranitidine 150 mg tab , resperidon 0.5mg , resperidon 2 mg , resperidon 4 mg , rivaroxaban 20 mg tab , rosuvastatin. 10 mg , sacubtril plus valsartan , secnidazole 500 mg tab , sertraline 100 mg , sertraline 50 mg , sildenafil 50 mg tab , sitagliptin 100 mg tab , sitagliptin 50 mg tab , sodium valporate 300 mg , sodium valproate200 mg , sodium valproate 500 mg , sorafinib 200mg , spironolactone 100 mg tab , spironolactone 25 mg , spironolactone+frusemide 20mg +50mg , sulfamethoxazole and trimethoprim ( 100mg+ 20mg ) tab , sulfamethoxazole and trimethoprim ( 800mg+ 160mg ) tab , sunitinib 50 mg , tadalafil 10 mg , tamoxifen 10 mg , tamoxifen 20mg , tamsulosin 0.4mg , tamsulosin$dutasteride 0.4mg+0.5mg , telmisartan40 mg. , telmisartan hydrochlorthiazide 40mg+12.5mg tab , terbutaline sulphate 2.5mg tab , tetrabenazine 20 mg tab , thiamine 100mg , thiamine 75mg , thyroxine sodium 100mg , thyroxine sodium 25 mg , thyroxine sodium 50mg , thyroxine sodium 75 mcg , tianeptine 12.5 mg , topiramate 100 mg tab , topiramate 25 mg , topiramate 50 mg , topotecan 1 mg , torasemide10 mg , tramadol – 100 mg tab , tramadol – 50 mg , tranexamic acid500 mg , trifluoperazine5 mg , trihexyphenidyl 2 mg , ursodeoxycolic acid300 mg , venlafaxine sr 150 mg , venlafaxine sr 75 mg , verapamil40 mg , vildagliptin 50 mg +metformin 500 mg tab , vildagliptin 50 mg tab , vit b complex tab. nfi ( prophylactic ) b1 2mg, b2 2mg, b6 0.5mg, , vit d3 60000 k tab , vitamin c 500 mg ( ascorbic acid ) , voglibose 0.3 mg tab , voriconazole 200 mg , warfarin 5 mg tab , zinc sulphate ( dispersible ) 20 mg , zolpidem 10 mg tab , zonisamide 100 mg tab , zonisamide 50 mg tab , zyloric acid 100 mg , aceborophylline 100 mg , amoxicillin 250 mg cap , amoxycilline – 500 mg , amoxycilline + clavulanic acid 625 mg cap. , ampicillin 250mg+ cloxacillin250mg , ampicilline – 500 mg , cyclosporine 100 mg , cyclosporine 50 mg , doxycycline 100 mg , fluoxetine bp 20 mg , hydroxy urea 500 mg cap. , imatinib mesylate 100 mg , itraconazole 100 mg , ivabradin 5mg , omeprazole 20 mg , oseltamivir ( 45mg ) , capsule , oseltamivir ( 75mg ) , capsule , pregabalin 75 mg + methylcobalamin 750 mcg , rifaximine 400 mg , temozolamide 100 mg , temozolamide 250 mg , sildenafil 20mg , vit. e400 mg , acyclovir 3% , atropine sulphate 1% 5 ml vial , carboxymethylcellulose solu. eye drop 1% , carboxymethylcellulose solu. eye drop 0.5% , ciprofloxacin eye drop 0.3% , fluromethanol eye drop , gentamycin eye drop , homotropine drop 2% eye drop , hypersol s ( 5% ) , lignocaine hcl 4% eye drop , loteprednol eye drop , natamycin eye drop , nepafenac ophthalmic solution , methyl cellulose / visco elastic , moxifloxacin 0.5% eye drop , moxifloxacin +prednisolone eye drope , ofloxacin 0.3% 5 ml vial , polyethelene glycol 400 & propylene glycol ophthalmic solution , pilocarpine eye drops 2% , polyvinyle alcohol 1.4% 5 ml , prednisolon eye / drop. , proparacaine , sodium chloride 5% eye drop ( nacl 5% ) , timolol maleate 0.5% 5 ml vial , tobramycin 0.3% 5ml eye drop , tropicamide 1% 5 ml vial , topicamide +phenylephrine eye drop , olopatidine hydrochloride ophthalmic solution 0.1% , benzocaine 2.7 w / v + chlorbutol 5% w / v +paradichlorobenzene 2% w / v+ , tobramycin eye oint.3gm tube , acyclovir 3% eye oint.5 gm tube , atropine eye oint. 3gm tube , chloramphenicol eye ointment 5 gm tube , ciprofloxacin eye ointment 5 gm tube , hydroxypropylmethylcellulose 2% w / v ophthalmic solution ocular , diclofenac gel 1% 30 gm , ecg gel 250ml bottle , lignocain jelly 2% , oxetacaine 10mg + aluminium hydroxide 291mg + milk of , prostaglandin e2 , ultra sonograph gel 250ml bottle , white petroleum jelly kg , acyclovir5%, 5 gm , beclomethasone+ clotrimazole +neomycin sulphate cream , betamethasone valerate ointment 0.1%, 15 gm tube , betamethosome valerate cream 0.05% 15gm , clobetasol propionate 0.05%, 15 gm tube , clotrimazole 2%w / w 15 gm , fusidic acid 2%, 15 gm , human placental extract , mupirocin 2%, 15 gm , magnesium sulphate, sulphacetamide, urea, proflavin ( in glycerine , neomycin sulphate 5 mg + bacitracin zinc 500 iu / gm, 15 gm , papin urea 15 gm tube , povidone iodine 5 % w / w + metronidazole 1 % w / w, 15 gm tube , povidone iodine 5%, 250 gm , povidone iodine 7.5%, 500 gm , salicylic acid 2%, 30 gm , silver sulphadiazine cream usp 1% w / w 250gm , mct oil 100ml bottle , lactobacillus, 150 million spores, , arginine sachet 10gm , hmf lactocex plus sachet , orodispersible probiotic sachet , ors who powder glucose anhydrous 13.5g / l, sodium chloride , formula milk for infants 500gm , potassium permegnet powder 400 gm pkt , neomycin sulphate powder 5gm , povidone iodine powder 5% , framycetin sulphate 1% w / w 30 gm tube , permethrin5% w / v 30gm , permethrin 5% 60 ml lotion , calamini lotion 50 ml bottle , alcoholic handrub with triple action:50%2 , antiseptic hospital concentrate contdaining 20% chlorohexidine , citric acid 500 ml bottle , compound benzointincture, benzoin, aloe, storax, tolu balsam , formaldehyde ( formalin ) 37% acq. 450 ml bottle , glutaral dehyde solution 2% w / v stabilized 5 ltr cans , glycerine 500ml bottle , glycerine enima , hand wash.sol . ( sol.isoprapanol, propanol, mecetronium, skin care , hydrogen peroxide soln 20% 500 ml bottle , hypo solution 5% 5 ltr , liquid paraffin ip 500ml bottle , povidone iodine ( surgical scrub ) , 7.5%, 500 ml bottle , povidone iodine, 5 %, 500 ml bottle , surface & environmental disinfectant , aluminium hydro gel syp ( antacid ) 100ml bottle , ambroxol 15mg + terbutaline 1.25mg+ guaiphenesin 50mg, , amoxicillin 125mg / 5ml 30ml bottle syp , amoxicillin and clavulanic acid 200+28.5mg suspension 30 ml , azithromycin 200mg / 5ml suspension 15 ml bottle , bromhexine hydrochloride syp. 4 mg / 5ml ( bottle ) , calcium carbonate with vitamin d3 and minerals like phosphorus, , calcium phosphate, 2:1 ratio, 100 ml bottle , cefixime , 100 mg / 5 ml, 30 ml bottle , cetirizine, 5 mg / 5 ml , 60 ml bottle , chloroquine phosphate , 160 mg / 10 ml ( 50 mg / 5 ml base ) , 60 ml , ciprofloxacin 125mg / 5ml syp 60 ml bottle , co trimoxazole 30 ml , cyclosporine 50 ml syp , cyproheptadine hcl 2 mg + tricholine citrate 275 mg, 200 ml , dextromethorphan 100 mg ( bottle ) , diphenhydramine 14.08mg+ammonium chloride 138mg +sodium , di sodium hydrogen citrate 200ml bottle , domperidon suspension 1mg / ml 30 ml bottle , etiophylline + theophylline pediatric syp. ( 46.5+14mg / 5ml ) 60 ml , glycerol 100ml , ibuprofen+paracetamol 60ml , iron200ml , lactulose , 3.35 gm / 5 ml , 100 ml bottle , levetiracetam 100 ml bottle , metronidazole 200mg / 5ml suspension 60ml bottle , milk of megnasia + liquid paraffine 100 ml , nitazoxanide 100mg / 5ml 30 ml bottle , norfloxacine suspension ( 30 ml bottle ) , ofloxacin suspension 50mg / 5ml 60ml , ondenstrone 30ml. 2mg / 5ml. , paracetamol oral solution 150mg / ml 15 ml bottle with dropper , phenobarbitone syp 30ml. 20mg / 5ml. , phenytoin sodium suspension 30mg / 5ml , potassium chloride syp 100 ml bottle , salbutamol sulphate , 2 mg / 5 ml , 60 ml bottle , sodium valproate , 200 mg / 5 ml , 100 ml bottle , sucralfate100 ml , sulfamethoxazole and trimethoprim suspension ( 200mg+ , vitamin a syp 100000 unit / ml ( 100 ml bottle ) , vitamin b complex, nfi formula, 100 ml bottle , zinc 20mg / 5ml 30 ml bottle , multivitamin multimineral with antioxidant syp200 ml , budesonide nasal spray , fluticasone nasal spray , lignocaine spray 10% , xylometazolin 0.1% nasal drop 10 ml vial , nasoclear nasal mist spray 20 ml spray , nasoclear nasal gel 15 gm tube , nasoclear nasal wash 3gm kit , chlorhexidine mouth wash 50 ml bottle , mouth wash 0.2% 50 ml , mouth paint clotrimazole 1%15 ml , absorable cotton roll, net 500gm , abdominal binder no 34 , abdominal drain set 28 no. , abdominal drain set 32 no , absorbable gelatine spangstron ip 80mmx50mmx10mm , accessory spikes , adhesive plaster 7.5 cm x 10 mtrs , ag ion impregnated central venous double lumen , ag ion impregnated central venous triple lumen , ag ion impregnated triple lumen catheter for haemodialysis, fr 12, , air bed matterses with complete set , airway size 3, 4, 5, 5.5 , airway size 6, 7.5 , alcohal based hand sanitizer 500ml bottle with dispenser ) , ambu bag adult , ambu bag pediatric , antimicrobial incise drape 3 m , artery catheter , av blood lines with av pressure transducer ( acceptable for fitting , barium sulphate powder susp 95% w / v powder ( hd ) 95% 400gm , bionet connector , biopsy forceps , biopsy gun , bipap mask , biploar forceps cable , bipolar cable , bis monitor electrode , black thread ( stitching ) big , bleaching powder gr ii 25 kg bag , blood administration ( transfussion ) set , blood bag double 350 ml , blood bag double 350 ml cpd solu , blood bag double 350 ml with sagam , blood bag quadruple 350 ml top bottom with cpd sagam solu , blood bag quadruple 450 ml top bottom with cpd sagam solu , blood bag single 350 ml , blood bag transfer 350 ml , blood bag triple 350 ml , blood bag triple 350 ml sagam , blood collection tube clot activator with rubber cap , blood culture bottles , blood transfusion set , bone marrow aspiration needles ( 14 ) ( medevolution ltd ) , bone marrow aspiration needles ( 15 ) ( medevolution ltd ) , bone marrow aspiration needles ( 16 ) ( medevolution ltd ) , bone marrow aspiration needles13 g ( medevolution ltd ) , bone marrow biopsy needle , bone wax , bp cuff adult & pead. , camera cover , cannula fixer set , carbolic acid 500 ml , c arm cover , catheter mount adult size , catheter mount peadiatric size , cautery pencil , cautery plate ( reusable ) , central line double luman 16g , central line singal luman , cerebral catheter reservoir 12mm dia chamber , cerebral catheter reservoir 18mm dia chamber , chest drainage catheter size: fg20 to fg40 , chest drainage catheter size: fg20 to fg40 with trocar , chlorhexidine gauze dresssing b.p antiseptic tulle gas dressing , collagen patch 30x30 , colostomy kit , computer radiography x ray film ( fuji ) 10x12 pkt , computer radiography x ray film ( fuji ) 14x17 pkt , computer radiography x ray film ( fuji ) 8x10 pkt , condom catheter , card clamp , craniotomy cutter blade , craniotomy drape ( 1.6 x 3.2 mtrs ) , crape bandage 2 , crape bandage 4 , crape bandage 6 , cvc line double lumen polyurethane catheter ( flexon , cvc line triple lumen polyurethane catheter ( flexon material ) with , cvp manometer , cylinder connection nut , cylinder key , cylinder spanner , d.j.stent 5 fr, 6 fr , 3fr, 4fr , dengue card test 100 test kit , dialyser 1.5 / 1.6 dialyzers multiple use made of polysulphone or , disp paper gloves , dispo cap , dispo face mask triple layer ( standard ) , dispo hivfull protecatin kit , dispo. n95 mask , disposable needle 18g ( single use ) , disposable needle 20g ( single use ) , disposable needle 22g ( single use ) , disposable needle 23g ( single use ) , disposable needle 24g ( single use ) , disposable needle no 26gx1 / 2 , disposable spinal needle 18 , disposable spinal needle 22 , disposable spinal needle 23 , disposable spinal needle 24 , disposable spinal needle 25 , disposable sterile gown , disposable suction catheter all size , distilled water 5 lit. , double lumen peripherally inserted central venous silicon , double lumen peripherally inserted central venous silicon , drap sheeth 120cm x 210cm sterile , ear buds , ecg disposabile electrode , ecg paper ( wax coated ) 50mmx30 mtr roll , ecg paper computerized triple channel 20m , edta tube , elastic adhesive bandage 10cm x 4 , elastic adhesive bandage 10cm x 6 , elastomeric pump for post operative analgesia , endotracheal tube cuffed 3.0 , endotracheal tube cuffed 3.5 , endotracheal tube cuffed4 , endotracheal tube cuffed5 , endotracheal tube cuffed 5.5 , endotracheal tube cuffed6 , endotracheal tube cuffed6.5 , endotracheal tube cuffed7 , endotracheal tube cuffedsize7.5 , endotracheal tube cuffed size 8 , endotracheal tube cuffed size8.5 , endotracheal tube cuffed size 9 , endotracheal tube cuffedsize 9.5 , endotracheal tubes plain without cuff size 2, , endotracheal tubes plain without cuff size2.5, , endotracheal tubes plain without cuff size3 , endotracheal tubes plain without cuff size3.5, , endotracheal tubes plain without cuff size 4 , endotracheal tubes plain without cuff size 4.5 , endotracheal tube with secondary lumen for , epidural kit ( needle & catheter 16g, ) , epidural kit ( needle & catheter 18g ) , epidural kit ( needle & catheter 19g, ) , epidural needle , examination glovesmedium pair , examination glovessmall pair , examination gloves large pair , exchange transfusion catheter with four way adaptor size 4cm, l , extention line 10cm , extention line 50cm , extention line 100cm , extention line 150cm , extention line 200 cm , extra ventricular drain ( evd ) , feeding tube size 3, 4, 5, , feeding tube size 6, 7, 8, 9, 10 , flexo metallic tube no 6, 6.5, 7, 7.5, 8, 8.5 , fluroscein strips pkt , fogharty cathetor 5fr , foley balloon catheter three way ( a ) fg 16, 18, 20, 22 , foley catheter size 12 2 way , foley catheter size 14 two way , foley catheter size 16 two way , foley catheter size 18 two way , foley triway no 20 two way , foley urinary catheter size 8 10 pediatrics , gigli saw wire , glass slide , glass tube 125x150 , glucometer strips , gudel airway all size soft and smooth , guide wire 0.35 no , guide wire 0.38 no , guide wire 150cm staight tip , guide wire 80cm. , halogen bulb holder ( heavy duty ) , hemodialysis fluid for bicarb made ( part a 10 ltr + part b , hernia flat mesh size: 10x15 , hernia flat mesh size: 15x15 , hernia flat mesh size: 15x20 , hernia flat mesh size: 3x5 , hernia flat mesh size: 6x6 , hickman catheter double lumen7.7 no , hickman catheter single lumen4.7 no , hickman catheter single lumen6.6 no , hickman catheter single lumen7.7 no , hme filter , humbeysknife disposable blade , hydrocephalus shunt medium pressur ( vp shunt ) , icd bag , implantable pain port with epidural catheter for long term pain , insulin syringe , intravenous drip set adult size , intravenous drip set pediatric size , iv .regulator set ( control drop set ) , iv cannula size 16 g , iv cannula size18g , iv cannula size20g , iv cannula size22g , iv cannula size24g , iv cannula size26g , j r c bag 1.5 ltr , 1 ltr , j r c bag 1 / 2 ltr 500ml , juglarcatheter 12 fr ( adult ) , juglar catheter 8fr ( pediatric ) , k 90 catheter , kallis pad disposable , liga clip 200, 300, 400 , long length quincke spinal needle for pain management, size – g , lung excersizer , lysol ( cresol with soap solution ) 5ltr jar , mackintosh double colour water proof , malecot rubber catheter no 12 , malecot rubber catheter no 16 , malecot rubber catheter no 20 , malecot rubber catheter no 22 , malecot rubber catheter no 24 , mesure volume set soft chamber, with bulb latex 110ml , micro drip set with bulb latex , micropore 6” , monopolar coutry wire , mucous extractor with connector for bronchoscope capacity 70 ml , mucus extractor , nebulazation mask ( set ) adult & pediatric , neonatal urine collection and measurement bag , niv mask venti cpap ( large & medium ) , non sterile surgical rubber gloves 6.5 no. ( pair ) made of natural , non sterile surgical rubber gloves 7 no. ( pair ) made of natural , non sterile surgical rubber gloves 7.5 no. ( pair ) made of natural , o maya large / small , oxygen catheter , oxygen connection for central line , oxygen connection for cylinder , oxygen high pressure hose pipe , oxygen mask adult & pediatric , paediatric double lumen polyurethan cvc line, 3 fr, l , paediatric double lumen polyurethane cvp catheter, 4.5 fr, g , paediatric triple lumen polyurethan cvc line with nitinol j guide , paper adhesive plaster microporous surgical tape 2inch x 10mt , paper adhesive plaster microporous surgical tape 3inch x 10mt , paper adhesive plaster microporous surgical tape 4inch x 10mt , pediatric diapers , pediatric ventilator circuit complete set , peripheral inserted central catheter 4 fr , peripheral inserted central catheter 5 fr , peritonial dialysis catheter 200mm peadiatric , peritonial dialysis catheter 280mm adult , peritonial dialysis fluid 1ltr. , pigtail catheter no 10 , pigtail catheter no 14 , plain vial with screw cap12x75 , plaster of paris bandage 3 , plaster of paris bandage 4 , plaster of paris bandage 6 , plaster of paris powder ip 1 kg pkt , plastic apron , plastic nozel cap , plastic test tube 3 , post exposure prophylaxis kits ( pep kits ) , probe for oxygen , pt vial / tube ( prothrombin vial / tube ) , radial a catheter , rectified sprit 4.5 ltr. , ryles tube size 10, 12, 14, 16, 18 , schirmer strips , short catheter with straight / j tip guide wire ( l 20, fr 2, g 22 ) , short pencil point spinal needle g 25 / 22, l 38mm. , sics kit ( small incision cataract surgery ) , silicon / double nasal prong with universal connector. all sizes. , silicon cautery plate , silicon mask size 0, 1, 2, 3, 4 & 5 , soda lime for anesthesia workstation 5kg , soft roll 15cm x 3 meter , spatula for papsmear , sterilant cold disinfectant for dialysis containing peraetic acid , sterile adhesive iodine drape large , sterile alcohol swabs , sterile disposable syringe 1ml , sterile gauze swab / pad packets , sterile hypodermic syringe with needle 03 ml , sterile hypodermic syringe with needle 10ml , sterile hypodermic syringe with needle 20ml , sterile hypodermic syringe with needle 2ml , sterile hypodermic syringe with needle 50ml / 60ml , sterile hypodermic syringe with needle 5ml , sterile luerlock syringe 10 ml , sterile luerlock syringe 5 ml , sterile leurlock syringe 20ml , sterile leurlock syringe 50ml , sterlie gloves isi 6.5 made of natural latex, micro rough finish , sterlie gloves isi size7.5 made of natural latex, micro rough , sterlie gloves isi size8 made of natural latex, micro rough , sterlie gloves isi size 7 made of natural latex, micro rough , sterlie powder free glovessize6.5 made of natural latex, micro , sterlie powder free glovessize7 made of natural latex, micro , sterlie powder free glovessize7.5 made of natural latex, micro , sterlie powder free glovessize8 made of natural latex, micro , surgical blade size 11 , surgical blade size 15 , surgical blade size 22 , surgical blade size 24 , t.piece circuit with oxygen tubing set ( complete set ) , tegaderm ( cvl dressing ) 10 cm*12 cm , tegaderm ( cvl dressing ) 7 cm* 8.5 cm , tegaderm ( samll ) i / v , thermometer , thomas splint , transducer set for invasive b.p. , three way stop cock , tmt paper , tounge depresser , tracheostomy tube cuffed plastic 5, 5.5, 6, 6.5, 7, 7.5, 8, 8.5 , triway with extention 10, 50, 100, 150, , turp set , twin nasal cannula adult , twin nasal cannula paed. , urine collecting bag , urine collecting bag with urometer , urine sugar diagnostic stick , vaccum jar 1000 ml , vaccum jar 2000 ml , vaccum pump belt , vaccum pump oil , vaccum regulator , vaporizer , ventilator catheter mount , ventilator circuit , ventilator circuit ( heated wire ) , ventilator circuit ( neonatal ) , ventilator circuit full kit ( tubing+hmf+filter+catheter , ventilator mask , ventilator nebulization kit with t piece , ventilator single tubing circuit ( adult ) , water bed , wipes , wound suctionset no 11 / 12 / 14 / 16 / 18 , x ray casset12x15 , x ray casset 10x12 , x ray casset 8x10 , x ray developer 22.5 lit. , x ray films size 10x12 50film per pkt , x ray films size 12x15 50film per pkt , x ray films size 8x10 50film per pkt , x ray fixer 22.5 lit , x ray hangers ( clip type ) 10x12 , x ray hangers ( clip type ) 12x15 , x ray hangers ( clip type ) 8x10 , x ray screen high speed 12x15 , x ray screen high speed 8x10 , x rayscreen highspeed 10x12 , yankar suction catheter ( complit set ) , pacing leads 6 fr , introducer sheath 6fr , pigtail catheter 6 fr ( 150 cm ) , j tip 0.035 mm guidewire , black braided silk eyeless needled suture usp, code 5036 size 2 , black braided silk eyeless needled suture usp, code 5082 size 4 , black braided silk eyeless needled suture usp, code 5333 size 2 , blackbraided silk eyeless needled suture usp, size 5 0 , blackbraided silk eyeless needled suture usp, size 6 0 , blackbraided silk eyeless needled suture usp, code 5049 size 4 0 , blackbraided silk eyeless needled suture usp, code 5070 size 3 0 , blackbraided silk eyeless needled suture usp, code 5087 size 3 0 , blackbraided silk eyeless needled suture usp, code 5334 size 1 0 , braided synthetic absorbable eyeless needled suture usp code , braided synthetic absorbable eyeless needled suture uspbraided , braided synthetic absorbable polyglactin 910 eyeless needled , braided synthetic absorbable polyglactin 910 eyeless needled , braided synthetic absorbable polyglactin 910 eyeless needled , braided synthetic absorbable polyglactin 910 eyeless needled , braided synthetic absorbable polyglactin 910 eyeless needled , oxidized regenerated cellulose ( absorbable hemostat fibrillar ) 1 in , oxidized regenerated cellulose based topical absorbable hemostar , oxldlzed regenerated cellulose; rayon fiber with 18% to 21% w / w , oxldlzed regenerated cellulose; rayon fiber with 18% to 21% w / w , polyamide black size 10 / 0 3 / 8 circle spachula needle 6mm , polyamide black size 8 / 0 3 / 8 circle revers cutting needl 6mm , sterlizedabsorbable eyeless needled suture usp, code , sterlizedabsorbable eyeless needled suture usp, code , sterlizedabsorbableeyeless needled suture usp, code , sterlizedabsorbableeyeless needled suture usp, code , sterlizedabsorbableeyeless needled suture usp, code , sterlizedabsorbableeyeless needled suture usp, code , sterlizedabsorbable polyglycolic acid eyeless needled suture , sterlizedabsorbable polyglycolic acid eyeless needled suture , sterlized monofilament polyamide eyeless needled suture , sterlized monofilament polyamide eyeless needled suture , sterlized monofilament polyamide eyeless needled suture , sterlized monofilament polyamide eyeless needled suture , sterlized monofilament polyamide eyeless needled suture , sterlized monofilament polyamide eyeless needled suture , sterlized monofilament polyamide eyeless needled suture , sterlized monofilament polypropyleneeyeless needled suture , sterlized monofilament polypropyleneeyeless needled suture , sterlized monofilament polypropyleneeyeless needled suture , sterlized monofilament polypropylene eyeless needled suture , sterlized monofilament polypropylene eyeless needled suture , sterlized monofilament polypropylene eyeless needled suture , sterlized monofilament polypropylene eyeless needled suture , sterlized monofilament polypropylene eyeless needled suture , sterlized monofilament polypropylene eyeless needled suture , sterlized surgical chromic gutsutue eyeless needied usp, code , sterlized surgical chromic gutsutue eyeless needied usp, code , sterlized surgical chromic gutsutue eyeless needied usp, code , sterlized surgical chromic gutsutue eyeless needied usp, code , sterlized surgical chromic gutsutue eyeless needied usp, code , sterlized surgical chromic gutsutue eyeless needied usp, code , sterlized surgical chromic gutsutue eyeless needied usp, code , sterlized surgical chromic gutsutue eyeless needied usp, code , surgical silk braded ( sutupack ) sterile foilover wrappack code 213 , surgical silk braded ( sutupack ) sterile foilover wrappack code 214 , surgical silk braded ( sutupack ) sterile foilover wrappack code 215 , vicryl 2.0 round body needle , 20g round body cutting needle 1 / 2 circle , copolymer of glycolied and e caprolactone, 1 0 ct 1 needle and , copolymer of glycolied and e caprolactone, 3 0 rb 1 needle and , monofilament glycomer 631* 3 0 75cm, undyed24mm3 / 8 , monofilament glycomer 631* 3 0 75cm, violet22mm1 / 2 , monofilament glycomer 631* 1 , 90cm, violet40mm1 / 2 circle , monofilament glycomer 631* 2 0 , 75cm, violet27mm1 / 2 , monofilament glycomer 631* 0, 90cm, violet40mm1 / 2 circle , ( coated braided polyglctin 910 with triclosan coating sut. ) with 1 / 2 , ( coated braided polyglctin 910 with triclosan coating sut. ) with 1 / 2 , ( coated braided polyglctin 910 with triclosan coating sut. ) with 1 / 2 , ( coated braided polyglctin 910 with triclosan coating sut. ) with 1 / 2 , ( coated braided polyglctin 910 with triclosan coating sut. ) with 1 / 2 , poliglecaprone 25 undyed with irgcare mp3 0, 3 / 8 circle reverse , polydioxanone lrgacare mp coated 150cm usp1 0 rb ctx, 1 / 2 , suture dyed polyester poly ( p dioxxanone ) 1 0, 24x4cm, 1 / 2 circle , 180 absorbablepolyglyconate knotless wound closure device with , 180 absorbablepolyglyconate knotless wound closure device with , 90 glycomer 631knotless wound closure device with , 90 glycomer 631knotless wound closure device with , copolymer of glycolied and e caprolactone, 2 0 ct 1 needle and , copolymer of glycolied and e caprolactone, 3 0 rb 1 needle and , synthetic absorbable surgical suture , polyglactin 910 with irgacare , synthetic absorbable surgical suture irgacare coated monofilament , absorbable unidirectional barbed device symmetric anchoring , absorbable adhesion barrier in the form of off white knitted fabric , polyster braided polybutylatecodated 1 / 2 circle tapercut double , triclosan antibacterial coated polyglactin 910 with 23 mm needle , protective disk with chg hydrophilic polyurethane absorptive foam , protective disk with chg hydrophilic polyurethane absorptive foam , self gripping polyester monofilament mesh pre cut with pla grips , self grippingpolyester monofilament mesh pre cut with pla grips , self grippingpolyester monofilament mesh pre cut with pla grips , self grippingpolyester monofilament mesh pre cut with pla grips , absorbable intraperitoneal umbilical patch of polyester mesh with , absorbable intraperitoneal umbilical patch of polyester mesh with , ada kit , aluminium ammonium sulphate powder 500gm , ana 96 well , anti a lactin 05ml , anti ab sera 10ml , anti d igg+ igm 10ml , anti d igm 10ml , anti hlactin 05ml , anti human globulin ( ahg ) 05ml , anti a sera , anti ab sera , anti a lactin , anti b sera , banded use in blood bank , benedict reagent5 lit cane , blotting paper sheet , blue tip 2ml , bovine albumin 22%05ml , buffer solution for hiv 50ml , ca 125 , calcium chloride 05ml / vail , capillary tube , couplin jar , cover slips size 18x18mm , cover slips size 22x22mm , cyto fix spray , diagnostic strip for urine ( sugar and albumin ) , diamond pencil , dpx mount 250ml ( urgent ) , ehlrich aldehyde reagent 125 , fouchet reagent 250ml , glass slide iso mark no 12mm , haematoxylene 5gm ( urgent ) , hbsag elisa test kit 4th generation 96 test , hbsag rapid test kit50 test , hbv elisa test kit 4th generation96 test , hbv rapid test kit , hcv elisa test kit 4th generation 96 test , hcv rapid test kit , hiv elisa test kit 4th generation 96 test , hiv rapid test kit , i.d. microtyping abd card , i.d. microtyping gel card ahg , immersion oil , iso propyl alcohol , leucoreductionfilter ( bed side ) , liss diluent for gel card , m .p elisa , mercuri oxide 25gm , methanol 2.5lit , mgg 480ml , mp antigen test kit rapid , n / 10 hcl 500ml , nitrile gloves size small / medium / large , p t tubes 3.8% sodium citrate , pandys reagent 125ml , papanicalou ea 125ml pea 030 , papanicalou og 6 125ml pea 010 , paraffin wax 58 60c , pasture pipette , polythene gloves , retic stain 125ml , slide tray , steel cassets for tissue processing , sulpho salicylic acid 500ml , tissue paper roll , vdrl elisa test kit , vdrl rapid test strip , vdrl rpr test kit , wafers cutting blade for tube welders , xylene , yellow gel tube vaccum blood collection tube , yellow tip plastic , massons trichrome stain , acetone detection kit , acetic acid solution 3%100ml , barium chloride 10 %500 ml , glacial acetic acid 100 ml , glucose kit god / pod , h2so4 25 % 500 ml bottle , leishman stain 500 ml , sharp collection containers disposable 1.5 ltrs , sharp collection containers disposable5 ltrs , total protein kits 100 ml , field stain a 500 ml , field stain b 500 ml , multi parameter urine strips ( 100 in 1 box ) , bismark brown stain 100 gm , light green stain 100 gm , disposable microtome blade ( 50 blades in one ) , csf protein kit , filter paper 12.5 cm 0.1 micron ( 50 per pkt ) , tips for auto pippets ( 2 to 100 micron yellow 1000 / pkt ) , tips for auto pippets ( 200 to 1000 micron blue 500 / pkt ) , surgical blade 22 no carbon steel , sugar albumin uristics ( bi parameter ) , sulpgar powder 500 gm , liquid ammonia 500 ml , nitric acid 500 ml , blotting paper 50 / pkt , pas stain , blood culture media aerobic for pediatric ( bac t / alert pf , blood culture media anaerobic for pediatric ( bac t / alert , ki67 / mib 106 ml antibody kit , glial fibrillary acidic protein ( gfap ) , s 100 , ae 1 / ae 3 , ema , nfp , synaptophysin , estrogen receptor epi monoclonal , progestron receptor monoclonal , anti her / erbb2 monoclonal , myogenin , sma , cd34 , bcl 2 , cyclin d 1 , cox 2 , p 53 , nkx 3 1 , amacr , vimentin , desmin , tris buffer gr , titriplexiii pure ( edta ) , sodium chloride for analysis , tween 20 for synthesis , hydro chloride acid about 36.46% , poly l ltsin solution p8920 , pap pen , hpr polymerr kit with dab chromogen , pricking lancet , leucoreductionfilter ( lab side ) , haemoglobin strip , single donor platelet kit make haemonotics / terumo penpol ( close , disposable circular stapler 26mm diameter , disposable circular stapler 29mm diameter , disposable circular stapler 31mm diameter , disposable circular stapler – 32mm diameter , disposable circular stapler33mm diameter , disposable circular stapleriii rows , disposable linear stapler with fixed staple height 55mm 60mm , disposable linear stapler with fixed staple height 75mm , reload 55 60mm for thin / vascular tissue white compatible , reload 55 60mm for medium thick tissue blue compatible , reload 75 80mm for medium thick tissue blue compatible , reload 75 80mm for thick tissue green compatible with , disposable hemorrhoidal stapler , disposable hemorrhoidal stapler iiirows , disposble skin stapler with pins , disposable hemorrhoidal stapler with detachable anvil. , reload for linear stapler with fixed staple height 35mm 45mm , reload for linear stapler with fixed staple height 35mm 45mm , reload for linear stapler with fixed staple height 55mm 60mm , reload for linear stapler with fixed staple height 55mm 60mm , disposable curved cutter stapler , polycearbonte bladeless frocar with reducer seal 5mm , polycearbonte bladeless frocar with reducer seal 10mm , polycearbonte bladeless frocar with reducer seal 12mm , reload for linear cutter 55mm 60mm size blue , reload forlinear cutter 55mm 60mm size green , reload forlinear cutter 75mm 80mm size blue , reload forlinear cutter 75mm 80mm size green , reload for linear cutter 90mm 100 mm size blue , reload forlinear cutter 90mm 100 mm size green , reusable laparoscopic clip applicator for medium large titanium , reusable laparoscopic clip applicator for large titanium clips with , mesh fixation device with non absorbable titatinum tacks , mesh fixation device with non absorbable titatinum tacks 15 , mesh fixation device with non absorbable titatinum tacks 20 , mesh fixation device with non absorbable titatinum tacks 30 , mesh fixation device with 30 poly ( lactide co glycolide ) , mesh fixation device with 15 poly ( lactide co glycolide ) , partially absorbable mesh with absorable & semi , partially absorbable mesh with absorable & semi absorbable , polyprplene with polyglecaprone 25 partially absorbable mesh , polyprplene with polyglecaprone 25 partially absorbable mesh , skin staple remover with plastic handle , distal tip closure titanium ligation clip small size , distal tip closure titanium ligation clip medium size , distal tip closure titanium ligation clip medium large size , distal tip closure titanium ligation clip large size , reusable laparoscopic clip applicator for large titanium , reusable laparoscopic clip applicator for medium large , reusable laparoscopic clip applicator for large titanium , dispoable trocar 05mm , dispoable trocar 10mm , dispoable trocar 12mm , dispoable trocar 15mm , disposable curved cutter stapler , reload compatible with curved cutter , endoscopic cutter & staplter60mmlong , endoscopic cutter & staplter60mm , reload endoscopic cutter & staplter60mm white / , reload endoscopic cutter & staplter60mm gold , reload endoscopic cutter & staplter60mm green , reload endoscopic cutter & staplter60mm blue , reload endoscopic cutter & staplter60mm / black , reload endoscopic cutter & staplter45mm green , reload endoscopic cutter & staplter45mm blue , endosuturing device 10mm with toggle lever , absorbable 2 0 endo suture cartridge 48 length , non absorbable 2 0 endo suture cartridge 48 length , disposable clip applier medium 5mm with 16 clips , disposable clipapplier medium 10mm with 20 clips , multifire clip applier small size 20 clip , multifire cliip applier long size 15 clips , reusable linear cutter 55 60mm with 200 firing , reusable linear cutter 75 80mm with 200 firing , suture locking , plastic locking clip applicator medium / large , locking clip cartridge medium / large , open clip appkicator 100 lt / 200 lt / 300 lt / 400 lt , titanium clip 100 lt / 200 lt / 300 lt / 400 , instrument tray 8×6 inch , instrument tray 9×6 inch , instrument tray 10×8 inch , instrument tray 11×7 inch , instrument tray 12×10 inch , instrument tray 14×10inch , instrument tray 15×12 inch , instrument tray 18×12 inch , instrument / dressing drum 9×5 inch , instrument / dressing drum 9×9 inch , instrument / dressing drum 10×8 inch , instrument / dressing drum 11×9 inch , instrument / dressing drum 14×9 inch , instrument / dressing drum 15×12 inch , formalin chamber 20 inch ( 20x8x8 ) 3 tray , formalin chamber 14inch 3 tray , formalin chamber 10 inch 2 tray , kidney tray set ( 150mmx200mmx250mmx300 mm ) , stainless steel cidex box with lid 10 lits ( 27x6x5 “ ) , ulv fogging machine , sanishieldsolution , ot slipper orthopedic soft , s.s sterilization autoclave , square box 20cmx20cm , s.s sterilization autoclave , square box 20cmx10cm , ent surgical micromotor drill system , micro ear burr tungsten carbide cutting 70mm , micro ear burr tungsten carbide cutting 0.5 mm , micro ear burr tungsten carbide cutting 0.60mm , micro ear burr tungsten carbide cutting 1 mm , micro ear burr tungsten carbide cutting 1.50 mm , micro ear burr tungsten carbide cutting 2.00 mm , micro ear burr tungsten carbide cutting 2.50 mm , micro ear burr tungsten carbide cutting 3.00 mm , micro ear burr tungsten carbide cutting 3.50 mm , micro ear burr tungsten carbide cutting 4.00 mm , micro ear burr tungsten carbide cutting 4.50 mm , micro ear burr tungsten carbide cutting 5.00 mm , micro ear burr tungsten carbide cutting 5.50 mm , micro ear burr tungsten carbide cutting 6.00 mm , micro ear burr tungsten carbide cutting 6.50 mm , micro ear burr tungsten carbide cutting 7.00 mm , micro ear burr tungsten carbide diamond / polishing 70mm length 0.50 mm , micro ear burr tungsten carbide diamond / polishing 70mm length 0.60 mm , micro ear burr tungsten carbide diamond / polishing 70mm length 1 mm , micro ear burr tungsten carbide diamond / polishing 70mm length1.50 mm , micro ear burr tungsten carbide diamond / polishing 70mm length 2.00mm , micro ear burr tungsten carbide diamond / polishing 70mm length2.50 mm , micro ear burr tungsten carbide diamond / polishing 70mm length3.00 mm , micro ear burr tungsten carbide diamond / polishing 70mm length 3.50 mm , micro ear burr tungsten carbide diamond / polishing 70mm length 4.00 mm , micro ear burr tungsten carbide diamond / polishing 70mm length 4.50 mm , micro ear burr tungsten carbide diamond / polishing 70mm length 5.00mm , micro ear burr tungsten carbide diamond / polishing 70mm length 5.50 mm , micro ear burr tungsten carbide diamond / polishing 70mm length 6.00 mm , micro ear burr tungsten carbide diamond / polishing 70mm length 6.50 mm , micro ear burr tungsten carbide diamond / polishing 70mm length 7.00 mm , bulls lampstand &100watt bulbs , head mirror , otoscope ( heine fibro optic ) , thudicum nasal speculum , lac’s tongue depressor ( metalic reuseable ) , in direct laryngoscopy mirrors , st clairs tompsons posterior rhinoscopy mirrors , hartmann aural speculum , shea aural speculum , tumarkin aural speculum , verhoeven micro ear suction tip , ear microsuction tip adapter , nasal suction tip , suction apparatus , siegles speculum , tuning fork ( 256hz, 512hz, 1024hz ) , bayonet forceps , jobson horne probe , steilizer ( boiler ) , bp apparatus , stethoscope , tilleys nasal dressing forcep , hartman nasal packing forcep , loop vectix wire , instrument tray 10inch x 15 inch , ent opd led head light , metalic washerless aural syringe ( simpson’s ) , tilley lichwitz s trocar&canula , tongue tie release butterfly forcep all size , sprit lamp , barany noise box , ear vectis with cerumen spud , hartmann aural forceps , trocltsch aural forceps , lucas curved aural forceps , eustachian tube catheter , mac ewen cell seeker and curette , alligator forceps , nasal foreign body hook , higginson syringe , tilleys antral harpoon , myle nasoantral perforator , st clair thompson quinys forceps , cidex box 45 cm and 35 cm and 24 cm , formalinchamber ( 35 cm & 45 cm ) , cheatle sterilizerforceps , cheatle forceps jar , bandage cutting scissors , x ray view box , opd sterlizing fogger machine , ultrasonic instrument cleaner , curved scissor 6 inch , formalin chamber 24 cm , savalon solution , bowl , romposon suction tube , nasal suction tip , tilleys forcep , lidocaine 4% solution 30 ml , gauze cloth 91 cm / 20 m , macintos 20×1 mtr , surgical mopping pad , adk drain 24 no , adk drain 28 no , chest tube with trocar 20 no , chest bag under waterseal 26 no , romovac suction drain 16 no , romovac suction drain 14 no , romsons corrugated drain , harnia mesh kit 3×6 inch , intraoclar lens ( 15 no to 27 no ) , viscoelastic substance , balanced salt solution , formalin solution , acetone solution , inj. hylase ( hyluronidase ) , lignocaine 2%+ adrenaline , inj.gentamicin , inj. phenylephrine 10 mg / 1 ml , cuticell10*10 cm , cuticell 10*30 cm , hand wash soln 500 ml , microgen d 125 , iv ns3 % 100 ml , iso p 500 ml , iv ns 0.45% 500 ml , guedal airway size 000, , guedal airway size 00, , silicon mask adult size 00 with connection tube, reservoir bag and valve, high concentration, ( bains circuit ) , ansthesia work station disposable circuit ( adult ) , laryngoscope ( paedeatric ) a machintosh size 00, , laryngoscope ( paedeatric ) b miller blade size , 0, , laryngoscope ( paedeatric ) a machintosh size , 1, , laryngoscope ( paedeatric ) b miller blade size size , 1, , laryngoscope ( paedeatric ) b miller blade size , 2 , laryngoscope ( adult ) with bladesize , 3, , laryngoscope ( adult ) with bladesize , 4 , maccoy laryngoscope with bladesize 3, , maccoy laryngoscope with bladesize , 4 , maccoy laryngoscope with bladesize 5 , lma ( proseal ) size 1, , lma ( proseal ) size , 1.5, , lma ( proseal ) size , 2, , lma ( proseal ) size , 2.5 , lma ( proseal ) size , 3, , lma ( proseal ) size , 4, , lma ( proseal ) size , 5 , lma ( i gel ) size 1 , lma ( i gel ) size 1.5 , lma ( i gel ) size 2 , lma ( i gel ) size 2.5 , lma ( i gel ) size 3 , lma ( i gel ) size 4 , lma ( i gel ) size 5 , intubating lma ( i lma ) fastrac 6 , intubating lma ( i lma ) fastrac 6.5 , intubating lma ( i lma ) fastrac 7 , intubating lma ( i lma ) fastrac 7.5 , intubating lma ( i lma ) fastrac 8 , intubating bougie , ventilating bougie , ansathesia face mask silicone transparentsize 00 , ambu bag ( padeatric ) 150 ml , micropore 0.5inch , micropore 1 inch , magill forcep ( adult ) , magill forcep ( padeatric ) , video laryngoscope with blade 2 ( c mac ) , video laryngoscope with blade 3 ( c mac ) , video laryngoscope with blade 4 ( c mac ) , centralvenous catheterkit ( paedeatric ) , pressure bag 1000 ml , pressure bag 500 ml , nebulizer machine , head ring ( peadia ) , head ring ( adult ) , hot air warmer , 3 way extension 25 cm , needle cutter , 3 way extension 100 cm , electric surgical instrument boiler ( 24*8*8 ) inch , electric surgical instrument boiler ( 20*8*7.5 ) inch , tee oxygenator ( t piece ) , tub big50 litr , detergent powder 500 gm , rubber sheet macintos20m roll , capmask / cloth based , towels ( small ) , towels ( large ) ) , shoe cover / cloth based , disposablesurgical gown , combined epidural spinal set ( 18g ) , hernia mes ( polypropylene ) 3*6 inch , north & southpole indotracheal tube ( rate tube ) size 3.5, ( ring adair elwiny ) , north & southpole indotracheal tube ( rate tube ) size 04 ( ring adair elwiny ) , north & southpole indotracheal tube ( rate tube ) size 4.5, ( ring adair elwiny ) , north & southpole indotracheal tube ( rate tube ) size 05, ( ring adair elwiny ) , north & southpole indotracheal tube ( rate tube ) size 5.5, ( ring adair elwiny ) , north & southpole indotracheal tube ( rate tube ) size 06, ( ring adair elwiny ) , north & southpole indotracheal tube ( rate tube ) size 6.5, ( ring adair elwiny ) , north & southpole indotracheal tube ( rate tube ) size 07, ( ring adair elwiny ) , north & southpole indotracheal tube ( rate tube ) size 7.5, ( ring adair elwiny ) , north & southpole indotracheal tube ( rate tube ) size 08 ( ring adair elwiny ) , betadine scrub ( 500 ml ) , betadine solution ( 500 ml ) , nylon 2.0 ( cutting needle ) suture , ethilone 2.0 , condom , g bone , mirena 50 , bupevacine inj ( 20 ml ) , pregnancy kit , infrared thermometer gun , nebuliser mask ( paedia ) , needle cutter electrical , steam disinfectant system, ( fumigation machine ) , surgical poly wrap , tripple lumen central line adult , uroflometer , pulse oxymeter , nasopharyngealairway size 5.5 , nasopharyngealairway size 6 , nasopharyngealairway size 7 , nasopharyngealairway size6.5 , nasopharyngealairway size7.5 , steel scissor 10 no , steel tray ( small ) , steel tray ( large ) , steel tray ( medium ) , bb splint , disposable catheter mount , tooke corneal knife ( num ) , inj. adenosine 6 mg / 2 ml , inj. adrenaline 1 mg / ml , inj. adrenaline 1 mg , inj. alamine 200 ml , inj. albumin iv 20% 100 ml , inj. amikacin500 mg , inj. amikacin ( 250mg / 2ml ) , inj. amiodarone 150 mg , inj. amoxycillin + clav. acid1.2 g , inj. amoxycillin + clavulanic acid 1.2 gm , inj. amoxycillin 500 + clavulanic acid 100 mg , inj. amphotericin b 50 mg , inj. anti rabis immunoglobulin ( inj. arv ) , inj. antisnake venom 10 ml , inj. artemether 80 mg , inj. artesunate 60 mg , inj. artesunate 60mg , inj. arv / antirabies vaccine , inj. atracurium50 mg ( 5 ml ) , inj. atracurium 10 mg ( 2.5ml ) , inj. atropin 1 ml / 0.6 mg , inj. atropine 0.6 mg , inj. bupivacaine 0.5 % 20 ml , inj. bupivacaine 0.5 % 4 ml ( heavy ) spinal , inj. bupivacaine hydrochloride 0.25% 20 ml , inj. calcium gluconate 10% ( 10 mg ) , inj. calcium gluconate 10% 10ml , inj. carboprost 250 mg , inj. cefazolin1 gm , inj. cefoperazone 1000mg + sulbactam 1000mg , inj. cefotaxime sodium500 mg , inj. cefotaxime sodium500 mg / vial , inj. cefotaxime sodium 1 gm , inj. ceftriaxone500mg vial , inj. ceftriaxone ( 250mg vial ) , injection , inj. ceftriaxone+ sulbactam , inj. chlorpheniramine 25 mg , inj. ciprofloxacin 200 mg , inj. clindamycin 600 mg , inj. clindamycin 300 mg , inj. clindamycin 900 mg , inj. colistin3 miu , inj. colistin4.5miu , inj. colistin 2miu , inj. colistin 9miu , inj. deriphyline , inj. dexamethasone 8 mg , inj. dexmeditomidine 100 mcg / 1 ml , inj. diazepam 10mg , inj. diazepam 5mg , inj. diclofenac 25 mg , inj. dicyclomin 10 mg , inj. dicyclomine 10 mg , inj. digoxin 0.5 mg / 2 ml , inj. dilitiazemiv 25 mg , inj. dobutamine 250 mg , inj. dobutamine 250 mg ( 5ml ) , inj. dopamine 40 mg , inj. dopamine 5ml , inj. enoxaparine 40 mg , inj. enoxaparine 60 mg , inj. ephedrine30 mg / 1 ml , inj. esmolol 100 mg , inj. ethamsylate250mg , inj. etomidate 10 ml ( 2 mg / ml ) , inj. fentanyl 2 ml ( 50 mg / ml ) , inj. flumazenil 0.5 mg , inj. fortwin ( pentazocin ) 30mg , inj. frusemide 10 mg , inj. furosemide 40 mg , inj. gentamicin 80 mg , inj. gentamicin40 mg / ml , inj. gentamicin 40 mg , inj. gentamycin 80 mg / 2 ml , inj. glargin insulin 100 iu / ml , inj. glucagon 1 mg , inj. glycopyrrolate 1 ml / 0.2 mg , inj. haloperidol 2mg / ml , inj. hydralazine 10 mg , inj. hydrocortisone 100 mg , inj. hyoscine 20 mg / ml , inj. hyoscine butyl bromide 20 mg , inj. hyydrocortisone 100mg , inj. insulin nph , inj. insulin regular , inj. iron sucrose 100 mg iv 5 ml , inj. iron sucrose 50 mg / ml iv , inj. kcl 10 ml / 150 mg , inj. ketamine10 ml ( 50 mg / ml ) , inj. labetalol20 mg , inj. levetiracetam 500 mg , inj. levofloxcillin100 ml , inj. lignocaine 2 % ( 21.3 mg / ml 30 ml vial , inj. lignocaine 2%iv ( 30 ml ) , inj. linezolid 600 mg , inj. linezolid 600 mg 300 ml , inj. l orithine l asportate 5 gm , inj. loxicard 2% 20 ml iv , inj. mannitol 100 ml , inj. mannitol 100 ml , inj. mephentermine 30 mg / 1 ml , inj. meropenam + sulbactam1 gm , inj. methargine 0.5 mg , inj. methotrexate 100mg / ml , inj. methylcobalamin 500 mcg / 3ml , inj. methylprednisdone 500 mg , inj. methylprednisolone 1 gm , inj. metoclopramidehcl 5 mg / ml , inj. metoclopramide 5 mg / ml , inj. metoprolol 1 mg / ml ( 5 ml ) , inj. metoprolol 1mg / 5mliv , inj. metrogyl 100 ml , inj. mgso4 1 gm / ml ( 50% ) , inj. midazolam 1 mg / ml ( 5ml ) , inj. midazolam 1mg / 5ml , inj. mixtard insulin 100 iu / 10 ml , inj. morphine 1 ml / 10 mg , inj. moxiflox 400 mg iv , inj. multivitamin iv , inj. nalaxone 400 mg , inj. nefenamic acid 500 mg , inj. neostigmine +glycopyrrolate ( 2.5mg + 0.5mg ) 5 ml , inj. neostigmine 1 ml / 0.5 mg , inj. nitroglycerin25 mg / 5 ml , inj. noradrenaline 1ml , inj. noradrenaline 2 mg , inj. ondansetron2 mg / ml , inj. ondensetrone 8 mg / 2 ml , inj. oxytocine 10 iu , inj. pantaprazole 40 mg , inj. paracetamol 150 mg , inj. pheniramine 75mg ( 2ml ) , inj. phenylephrine 10 mg / 1 ml , inj. phenytoin 50mg , inj. phenytoin 50mg / ml , inj. pilocarpine nitrate ip 0.5 % w / v ( 1 ml ) , inj. piperacillin +tazobactam4.5 gm , inj. potassium chlorideiv 150 mg / 10 ml , inj. promethazine25 mg / 7.84 ml , inj. promethazine 25mg , inj. propofol 20 ml ( 10 mg / ml ) , inj. protamine sulfate 10 mg , inj. quinine 600 mg , inj. regular insulin 100 iu , inj. ropivacaine 0.7 % / 20 ml , inj. sodabicarbonate 10 ml , inj. streptokinase 1.2 mu , inj. succynyl choline 10 ml ( 50 mg / ml ) , inj. tecoplanin 200 mg , inj. tecoplanin 400 mg , inj. terlipressiniv 1 mg / 10 ml , inj. tetanns toxcid 5 ml , inj. thiopentanil sodium 500 mg , inj. tramadol 50 mg , inj. tranexamic acid 500 mg , inj. tranexamic acid injection bp / ip ( 100mg / ml ( 5ml amp ) ) , inj. triamcinolone acetate 40mg / ml , inj. triamcinolone acetate 40mg / ml , inj. valethamate 10 mg , inj. vancomycin 1 gm , inj. vecuronium 10 mg , inj.botropase ( ( haemocoagulase 1cu ) 1ml ) , inj. verapamil 5 mg , inj. vit d33 l , inj. vit d3 6l , inj. vitamin k 10 mg , inj. xylocaine 2% intravenous , inj.adrenaline 1 ml , inj.dmpa 150 mg , tabmethyl prednisolone 16 mg , tab deriphylline ( etophylino 77mg + theophyline 23mg ) , tab fluconazole150 mg , tab fluconazole 100 mg , tab fluconazole 200 mg , tab fluconazole 300 mg , tab fluconazole400 mg , tab fluconazole 50 mg , tab hydroxyzine25mg , tab hydroxyzine 10 mg , tab.acebrophyllin + n acetyl cystine , tab.aceclofanc + paracetamol , tab.aceclofenac 100 mg , tab.amlodipine2.5 mg , tab.amlodipine5 mg , tab.amoxycillin + clavulanic acid625 mg , tab.amoxycillin 500mg , tab.aspirin 75 mg , tab.atorvastatin20 mg , tab.azithromycin 500 mg , tab.azithromycin 500mg , tab.buscopan 10 mg , tab.carvedilol 3.125 mg , tab.cefixime 200mg , tab.cepodoxime 200mg , tab.cepodoxime+clavulanic acid 325 mg , tab.cinnarizine + dimehydrate , tab.cinnarizine 25 mg , tab.clopidogrel 75 mg , tab.diclofanac+ paracetamol , tab.diclofenac 50 mg , tab.digoxin0.25 mg , tab.ethamsylate 250 mg , tab.fluconazole 150 mg , tab.furazolidone100mg , tab.glimeperide2mg , tab.glimeperide 1mg , tab.iron folic acid 400 mg , tab.lefulonamide10mg , tab.lefulonamide20 mg , tab.levocetrizine + montelukast , tab.levofloxacin 500 mg , tab.metformin 500 mg , tab.metoprolol 50 mg , tab.metronidazole 400mg , tab.nifedipine 10 mg , tab.nitrofurantoin 100 mg , tab.ofloxacine + ornidazole , tab.ofloxacine 200mg , tab.paracetamol 500mg , tab.paracetamol 650mg , tab.pheniramine maleate4 mg , tab.rabeprazole 20 mg , tab.telmisartan 40 mg , tab.thyroxine 25mg , tab.thyroxine 50mg , tab.thyroxine 75mg , tab.vildagliptin 50 mg , tab. acebrophyllin 100 , tab. acetazolamide 250mg , tab. acetylcysteine ( mucinac ) 600 mg , tab. acyclovir 800mg , tab. alprazolam0.5mg , tab. alprazolam 0.25 mg , tab. alprzolam 0.25mg , tab. amiodarone 100 mg , tab. amitriptyline 10 mg , tab. amitriptyline 25 mg , tab. amlodipin 5 mg , tab. amoxycillin + clavulanic acid625 mg , tab. arltemrthev+ lumefantrine , tab. ascorbic acid ( vitamin c ) 500mg , tab. asprin 150 mg , tab. asprin 75 mg , tab. atorvastatin 40mg , tab. azathioprine 100 mg , tab. azithromycin 500mg , tab. betahistine 8mg , tab. cabergoline 0.5 mg , tab. calcium + vit d3 500 mg , tab. carbamazepine 400mg , tab. carbimazole 10 , tab. cefelexin 500 mg , tab. cefixime 200 mg , tab. cefpodoxime200 mg , tab. cetrizine5mg , tab. cetrizine 10 mg , tab. chlordiazepoxide 10 mg , tab. chloroquine 500 mg , tab. cinnarizine ( 25 mg ) , tab. ciprofloxacin500 mg , tab. ciprofloxacin 250 mg , tab. clonazepam 0.5 mg , tab. clonazepam 0.25 mg , tab. cyclophosphamide 50 mg , tab. dapsone 100 mg , tab. dexamethasone 2 mg , tab. dexamethasone 4 mg , tab. dexamethasone 8 mg , tab. diclofenac + serratiopeptidase 10 mg , tab. dicyclomine 10 mg , tab. dicylomine 20 mg , tab. diltiazem 30 mg , tab. divalprox sodium 250 , tab. domperidone 10 mg , tab. drotaverine 40 mg , tab. escitalopram 10 mg , tab. etiophyllin + theophyllin 50 mg , tab. etizolam0.5mg , tab. etizolam 0.25 mg , tab. fexofenadine 120 mg , tab. fexofenadine 180 mg , tab. fluconazole 150mg , tab. furosemide 10 mg , tab. haloperidol 0.5mg , tab. hydrocortisone 100 mg , tab. hyoscine butyl bromide 10 mg , tab. ibuprofen 400 mg , tab. iron folic acid ( 100 mg +5 mg ) , tab. ivabradin 5mg , tab. labetalol 100 mg , tab. labetalol 200 mg , tab. levetriacetam 500 , tab. levocetrizine 10 mg , tab. levocetrizine 5 mg , tab. levocetrizine 5mg , tab. levofloxacin 250 mg , tab. levofloxacin 500 mg , tab. linezolid 600 mg , tab. mala n , tab. metformin 500mg , tab. methargine 0.2mg , tab. methotrexate 10mg , tab. methotrexate5mg , tab. methotrexate7.5 mg , tab. methotrexate 2.5 mg , tab. methyl prednisolone 32mg , tab. methylcobalamin / mecobalamin 500 mcg , tab. metoclopramide 10 mg , tab. metoprolol 25 mg , tab. metoprolol 50 mg , tab. metorolol 25mg , tab. metronidazole 200 mg , tab. misoprostol200 mg , tab. misoprostol 25 mg , tab. mv / b complex , tab. nefenamic acid&diclocylomine ( 500mg+ 20 mg ) , tab. nifidipin10 mg , tab. nintedanib 100 mg , tab. nintedanib 150 mg , tab. nitrofurantion 100 mg , tab. norethisterone 5mg , tab. norfloxacin 400 mg , tab. ofloxacin 200 mg , tab. olanzapine10 mg , tab. olanzapine 10mg , tab. olanzapine 5 mg , tab. ondensetron 4 mg , tab. oremeloxifene ( chhaya ) 30 mg , tab. oseltamivir 30mg , tab. oseltamivir75mg , tab. oseltamivir 45 mg , tab. pantaprazole+ domperidone , tab. pantaprazole 40 mg , tab. pheniramine 25mg , tab. phenytoin 100 mg , tab. pirfenidone200 mg , tab. pirfenidone400 mg , tab. prednisolone20 mg , tab. prednisolone 10mg , tab. prednisolone 10 mg , tab. prednisolone 5 mg , tab. prednisolone 5mg , tab. pregabatin + methylcobalamin 75 / 1500 , tab. pregasterone susline 200 mg , tab. propanolol 40 mg , tab. pyoridoxine sr 100 mg , tab. pyroxicame 10 / 20 mg , tab. pyroxicame 20 mg , tab. ramipril 2.5 mg , tab. ramipril 5 mg , tab. ranitidine 150 mg , tab. roflumilast 250 mg , tab. roflumilast 500 mg , tab. sodium valproate 500 , tab. thyrox12.5mg , tab. thyrox 100 mg , tab. thyrox 25 mg , tab. thyrox 75mg , l arginine + proanthocinidin ( argipreg ) sachet granules , tab. tramadol 100 mg , tab. toclizumab5 mg , tab. torsemide 10 mg , tab. tramadol50mg , tab. trypsin / chymotrypsine colloidal / sessatiopeptidase 100000 au , tab. ursodeoxycholic acid 300 mg , tab. verapamil 40 mg , tab. vitd3 60 k , tab. vitamin. b complex ( nfi ( prophylactic ) ) , tab. zinc oxide 20 mg , tab.doxyllamine+pyridoxine , tab.dydrogesterone 10 mg , tab.misoprostol 600 mcg , tab.ofloxacin+ornidazole , tab.thyrox 50mg , betadine pessary 200mg , tab. mtp kit ( mifepristone 200 mg+misoprostol 200 mg ) , tab.trenexa+ethamsylate , ors sachet , chlorhexidine gluconate mouthwash 0.2% w / v solution ( 50ml bottle ) , glucose powder , hiv kit / hbs ag ( surgical ppe kit ) , ketopatch , diclofenac patch , cholecalciferol granules 60000 iu , cap. ampicillin ( 250 mg ) , cap. b complex minerals with zinc , cap. doxycycllin 100 mg , cap. itraconazole200 mg , cap. methylcobalamin + alpha lipoic acid ( 1500 mcg + 100 mg , cap. itraconazole 100 mg , cap. vit e 200 , cap. vit e 400 , cap. vitamin a 1 lakh iu , creamliquidparaffin , cream clotrimazole 1% 30 gm tube , cream soframycin , creambeclomethasone 30 gm tube , creambetamethasone20 gm tube , creamfusidic acid 15 gm tube , creamketoconazole 15 gm tube , cream clobetasol propionate0.5 % , cream acyclovir 5% ( 5gm ) , cream estriol 1% ( 1.5 gm ) , diclofenacgel 30 gm tube , dinoprostron gel 0.5 mg , neomycin sulphate+bacitracin zinc5mg+500 iu / gm ointment15gm tube , neomycin sulphate+bacitracin zinc ( 5mg+500 iu / gm ointment 15gm tube , oint. choline salicylate + benzalkonium chloride9% + 0.02% ( 10 gm ) , oint acyclovir. 5g , oint soframycin 10 gm , oint. chloramphenicol +dexamethasone ( 1%+0.1% ) , oint. choline salicylate + lidocaine , oint. clobectasol + salycylic acid 3 % , oint. mupirocin 2% , oint. neosporin5 gm tube , oint. povidone15 gm tube , oint. silver nitrate 15g , oint.mupirocin ( 2% w / w ( 5 gm tube ) , oint. mupirocin ( 2% w / w ( 5 gm tube ) , oint. lignocaine hydrochloride ( 2% w / v ( 30 gm tube ) , ointment betadine 2% 5gm , placenta extract gel 20g , eye ointment ciprofloxacin0.3% ( 3gm tube ) , oint. clindamycin gel 5 gm , oint. gentamycin sulphate 0.1% ( 15gm tube ) , , ointment metrogyll p 2% , xylocaine spray 10 % , eye drop cyclopentolate 1% w / v ( 5 ml ) , , eye drop dexamethasone + gentamycin 0.1%+0.3% , eye drop carboxymethylcellulose sodium 0.5% ( 10ml ) , eye drop sodium chloride ( ophthalmic ) 5% ( 10 ml ) , eye drop timolol maleate0.5 %w / v ( 5 ml vial ) , eye drop gatifloxacin 0.3% 5ml , eye drop. phenylepherine hcl & tropicamide 5% + 1% 5 ml , eye drop tobramycin ( 0.3% 5ml ) , eye drop proparacaine 0.50% 5 ml / vial , eye drop. carboxymethylcellulose ip 1% w / v 10ml vial , hydroxypropyl methylcellulose ophthalmic solution 2% , hydroxypropyle methyle cellulose opthalmic solution ( 2% 2ml pfs ) , eye drop , eye drop olopotadine antiallergic ( 0.1% w / v ( 5 ml vial ) ) , , eye drop providone iodine 1% ( 5 ml ) , eye drop fluconazole 3 mg ( 10 ml vial ) , eye drops pilocarpine 4% , eye drops pilocarpine hydrochloridebp 2% , eye drop ciprofloxacin+ dexamethosone ( 0.3%+0.1% ) , eye drop ofloxacin 0.3% w / v ( 5 ml vial ) , eye drop. lignocaine hydrochloride ( 4% ( 5 ml vial ) , eye dropmoxifloxacin + prednisolone 5 mg + 3 mg / 5 ml , eye dropmoxifloxacin 0.5% w / v ( 5 ml ) , , ear wax cerumenolyticeach 10 ml , nasal drop xylometazoline ( 0.1%w / v 10 ml vial , nasal spray calcitonin30 mcg , bss solution for opthalmic use ( 500ml ) , solution , eye drop atropine sulphate 1% ( 5 ml vial , ear drops gentamycin + hydrocortisone 0.3% + 1% , eye drophomatropine 2 % ( 5 ml ) , , eye drop ciprofloxacin 0.3% ( 5ml vial ) , ciprofloxacin eye ointment 0.3% ( 3gm tube ) , syp.b complex 100 ml , syp. alkacitral ( disodium hydrogen citrate ) 1.4g / ml , syp. cyproheptadine 100 ml , syp. dextrometharphin 100 ml , syp. lactulose 150 ml , syp. liv 52250 ml , syp. prednisolone 10 mg , syp. prednisolone 20 mg , syp. prednisolone 5 mg , syp. vitamin a ( 10000o iu ) 100 ml , syrp. paracetamol 125 mg ( 60ml bottle ) , syringe 50 ml , syrp. alkalizer100 ml , syrp. anti oxidant lycopen 200 ml , syrp. dextromethorphan + chlorpheniramine , syrp. dextromethorphan 10mg / 5ml ( 100ml bottle , syrp. lactulose 60 ml , syrp. potassium chloride 100mg / ml , syrp. potassium chloride 200 ml , syrp. sucralfate + oxetacaine , syrp. ambroxol hcl 15mg+terbutaline sulphate 1.25mg+guaiphenesin 50mg 5ml 100ml , syrp. amoxicillin and clavulanic acid i.p. ( 200+28.5mg ( 30 ml bottle ) , syrup antacid , clotrimazole pessary 100 mg , clotrimazole pessary 500 mg , budecort inhaler200 mcg , budesonide inhaler ( foracort ) 0.5 mg , budesonide respules 0.5 mg , buprenorphine patch , tiotropium 18ugmdi / dpi , tiotropium 9ugmdi / dpi , xylocaine viscoussolution 4% , total parentral nutrition ( tpn ) 1 litr. , total parentral nutrition ( tpn ) 500mlperiferal , sporolac sachet ( 5 millions lactobacillus ) , soda lime granule5 kg , sodium phosphateenema 100 ml , hydrogen peroxide 3% ( 500 ml ) , surgical spirit500 ml , sevoflurane inhalation , salbutamol respules 5ml ( asthalin ) , sanitizer 500 ml , savlon solution500 ml , povidonelotion10 % 500 ml , povidonelotion5 %500 ml , povidonelotion7.5% 500 ml , peglec sachet , nebul.levosalbutamol+ipratopium bromide , liquid paraffin500 ml, bottle ) , solution , lignocaine 2% + adrenaline 5 mcg / ml ( 30 ml ) , vial , lignocaine 2% jelly , iv d10% 500 ml , iv d25% 100 ml , iv ns3 % 100 ml , iv ns 0.45% 500 ml , iv. fluiddns 500ml , iv. fluidringer lactate500ml , iv fluid normal saline 500 ml , iv infusion volulyte 6 % ( hestarch ) 500 ml , iv. normal saline 0.9 % 100 ml , iv isolyte m 500 ml , iv isolyte p 500 ml , iv intralipid 20 % 100 ml , iv. intraocular irrigating solution sodium chloride 0.49 % w / v, potassium chloride 0.075 % w / v, calcium chloride 0.048 %, magnesium chloride 0.03 % w / v, sodium acetate 0.39 % w / v, sodium citrate 0.17 % w / v. 500 ml ffs , isoflurane refiller 250 ml , insulin syring 40 iu 1 ml , hydrogen peroxide soln 100 ml , iv. hexa starch / voluvin 500 ml , hand sanitizer 1 ltr. , glutraldehyde 2.45 % , iv glycerine ip ( 100ml bottle ) , iv. glycerine / acriflaxin 100 ml , formetrol6 mcg + budesonide400 mcgmdi / dpi , formetrol6 mcg + budesonide 200 mcgmdi / dpi , formalin soln37 to 41 % ( 5 litr ) , enterogermina , disposable syringe 10 ml , disposable syringe 20 ml , disposable syringe 5 ml , disposablesyringe2 ml , disposable syringe50 ml , disposable needles26g , disposable needles24g , disposable needles22g , disposable needles20g , disposable needles18g , disposable needles16g , double arm nylon monofilament with 8 0 ( 3 / 8circle taper point needle ) , , disposable surgicalgloves6 no , disposable surgicalgloves6.5 no , disposable surgicalgloves 7no , disposable surgicalgloves 7.5no , disposable surgicalgloves 8no , latex examination gloves large , latex examination gloves medium , dynaplast 2 inch adhesive bandage , dynaplast 3 inchadhesive bandage , dynaplast bandage 10 cm * 4 m , disposable surgical mask , dustbin big 60 litr ( red / blue / black ) , dustbin small 30 litr ( red / blue / black ) , cotton cloth guaze than , cotton crape bandage 10cm x 4m , cotton crape bandage 15cm x 4m , cotton khadi curtain, 1.75 mt, , cotton khadi matress, 3x6 feet, 10.0kg, , cotton roll 500 gm , chadar check rangeen 84 inch x 48 inch , chadar rangeen 60 inch x 90 inch , blanket jammu woolen plane, 54x90 inch, , endotracheal cuff pressure manometer , endotracheal tube introducer ( stylet ) adult , endotrachial tube ( protex ) size 6, ( cuffed ) , endotrachial tube ( protex ) size 6, ( uncuffed ) , endotrachial tube ( protex ) adult size , 7 ( cuffed ) , endotrachial tube ( protex ) adult size , 6.5 ( cuffed ) , endotrachial tube ( protex ) adult size 7.5 ( cuffed ) , endotrachial tube ( protex ) adult size 8, ( cuffed ) , endotrachial tube ( protex ) adult size 8.5 ( cuffed ) , endotrachial tube ( protex ) padeatric size 5.5 ( cuffed ) , endotrachial tube ( protex ) padeatric size , 3 ( uncuffed ) , endotrachial tube ( protex ) padeatric size 2.5, ( uncuffed ) , endotrachial tube ( protex ) padeatric size 5 ( uncuffed ) , endotrachial tube ( protex ) padeatricsize 3.5 ( uncuffed ) , endotrachial tube ( protex ) padeatricsize 4, ( uncuffed ) , endotrachial tube ( protex ) padeatricsize 4.5 ( uncuffed ) , endotrachial tube ( protex ) padeatricsize 5, ( cuffed ) , epidural needle with catheter ( mini pack ) size 18 g , et tube ( cuffed ) 7no , et tube ( cuffed ) 6.5 no , et tube ( cuffed ) 7.5 no , et tube ( cuffed ) 8no , et tube ( cuffed ) 8.5 no , et tube 6 no. uncuffed , et tube 7 no. uncuffed , ethibond ( polyster suture ) 1 0 round body 1 / 2 circle 75 cm , ethibond ( polyster suture ) 2 0 round body 1 / 2 circle 75 cm , ethibond ( polyster suture ) 3 0 round body 1 / 2 circle 75 cm , ethibond ( polyster suture ) 5 0 round body 1 / 2 circle 75 cm , nylon clear monofilament 1 024 mm reverse cutting 75 cm , nylon clear monofilament 2 0 24 mm reverse cutting 75 cm , nylon clear monofilament 3 0 24 mm reverse cutting 75 cm , nylon suture, macrofilment spatulated, micropoint double armed size 10 0 ( 12 foils / pkt ) , poly propylene monofilament 0, 30mm 1 / 2 circle75 cm , poly propylene monofilament 1, 30mm 1 / 2 circle75 cm , polyamide size 8 / 0, 12 foils / pkt ( 3 / 8 cir micro point spatulated 6 mm, length 38 cm ) , polyglactin 0, 31mm 1 / 2 circle 70 cmreverse cutting , polyglactin 1 0, 31mm 1 / 2 circle 70 cm round bodied , polyglactin 2 0, 31mm1 / 2 circle 90 cm round bodied , polyglactin 2 0, 31mm 1 / 2 circle 70 cm reverse cutting , polyglactin 3 0, 31mm 1 / 2 circle 70 cm round bodied , polyglactin 4 0, 31mm 1 / 2 circle 70 cm round bodied , polyglecaprone with curved 5 / 0 reverse cutting needle ( 16 mm ) , catgut 1 0 round bodied 1 / 2 circle 76 cm , catgut 2 0 round bodied 1 / 2 circle 76 cm , polypropylene monofilament sterile precut cd reverse ( cutting needle 6 0 ) , b.b silk with 1 / 2 cir rb needle size:4 / 0 20 mm length 75 cm, 12 foils per packet , b.b. silk 6 reels x 25 mts length 25 mts.black braided silk without needle in reels non absorbable surgical suture , synthetic absorbable suture 4 / 0 with 1 / 2 cir rb needle size:4 / 0 20mm length 70cm poly glycolic acid ( pga ) ( 12 foils / pkt ) , silk suture 1 01 / 2 round circle black braided 24 mm 76 cm , silk suture 2 01 / 2 round circle black braided 24 mm 76 cm , silk suture 3 01 / 2 round circle black braided 24 mm 76 cm , absorbable ( 6 0 ) braided coated polyglactin aw violet 8mm 1 / 2 circle spatulated micro point doublw arm ( 45 , silk suture 4 01 / 2 round circle black braided 24 mm 76 cm , roll bandage 05 cm x 05 m , roll bandage 10 cm x 05 m , roll bandage 15 cm x 05 m , roll bandage 7.5 cm x 05 m , ryles tube10 no. , ryles tube 12 no. , ryles tube size 14 , ryles tube size 16 , ryles tube size 18 , schantz pin 4 mm , schantz pin 4.5 mm , schantz pin 5mm , romo vac set 14 , romo vac set 16 , rubber sheet ( small ) , rubber sheet ( large ) , silicon mask adult size 0 with connection tube, reservoir bag and valve, high concentration ( bains circuit ) , silicon mask adult size 01 with connection tube, reservoir bag and valve, high concentration ( bains circuit ) , silicon mask adult size 02 with connection tube, reservoir bag and valve, high concentration, ( bains circuit ) , silicon mask adult size 03with connection tube, reservoir bag and valve, high concentration, ( bains circuit ) , silicon mask adult size 04with connection tube, reservoir bag and valve, high concentration, ( bains circuit ) , silicon mask adult size 05 with connection tube, reservoir bag and valve, high concentration, ( bains circuit ) , silicon mask paediatric size 00 with connection tube, reservoir bag and valve, high concentration, ( bains circuit ) , silicon mask size 0 paediatric with connection tube, reservoir bag and valvepaediatric ( jackson rees circuit ) , silicon mask size 1 paediatric with connection tube, reservoir bag and valve, paediatric ( jackson rees circuit ) , , oxygen mask adult , non rebreathing mask , sics blade cresent ( 15 degree ) , simcoe i / a cannula, direct , skeletal traction kit , skin grafting blade ( downys blade ) , skin traction kit , spinal needle size 25 g , spinal needle size 26 g , spinal needle size 27 g , ss wire20g , ss wire 18 g , ss wire 22g , st pin 4 mm , st pin5 mm , st pin 4.5 mm , suction catheter 10 no , suction catheter 12 no , suction catheter 14 no , suction catheter 16 no , suction catheter 18 , suction tube10no , suction tube12no , suction tube14no , suction tube 8no , surgical steel drum 11*9inch , surgical steel drum 12*10inch , surgical steel drum 15*12 inch , surgical steel drum 6*6inch , surgical steel drum 6*9inch , surgical steel drum 9*9inch , surgical bladesize 15 , surgical blade , size 22 , surgical bladesize 23 , surgical blade , size 24 , surgical blade, size 11 , surgical cap disposable , ultrasoundjelly 250 gm , ecg jelly 250 gm , echo cardiography250 gm , view box size 14x17 , view box size 8x17 , weighingmachine mechenical , white ( sharp container ) 10 litr , whole sheet 35 inch x 35 inch , wound suction catheter ( no 18 ) , each , laryngoscope ( adult ) with bladesize , 3, , laryngoscope ( adult ) with bladesize , 4 , laryngoscope ( adult ) with bladesize 2, , laryngoscope ( paedeatric ) a machintoshb miller blade size , 1, , laryngoscope ( paedeatric ) a machintoshb miller blade size , 0, , laryngoscope ( paedeatric ) a machintoshb miller blade size , 2 , laryngoscope ( paedeatric ) a machintoshb miller blade size 00, , laryngoscope ( paedeatric ) a machintosh blade size 0, , laryngoscope ( paedeatric ) a machintosh blade size , 1, , lma ( i gel ) size 1.5 , lma ( i gel ) size 2.5 , lma ( i gel ) size 3 , lma ( i gel ) size 4 , lma ( i gel ) size 5 , lma ( i gel ) size 1 , lma ( i gel ) size 2 , lma ( proseal ) size , 1.5, , lma ( proseal ) size , 2, , lma ( proseal ) size , 2.5 , lma ( proseal ) size , 3, , lma ( proseal ) size 1, , lma ( proseal ) size , 4, , lma ( proseal ) size , 5 , maccoy laryngoscope with bladesize 3, , maccoy laryngoscope with bladesize , 4 , ( c mac ) video laryngoscope with complete blade set , maccoy laryngoscope with bladesize 5 , magill forcep ( adult ) , magill forcep ( padeatric ) , iv cannula ( two way ) size 24 , iv cannula 16 no. , iv cannula 18 no. , iv cannula 20 no. , iv cannula 22 no. , k wire1.6mm , k wire2mm , k wire2.5 mm , k wire 1 mm , k wire 3mm , kit 1 , kit 2 , kit 6 , intubating lma ( i lma ) fastrac 6 , intubating lma ( i lma ) fastrac 7 , intubating lma ( i lma ) fastrac 7.5 , intubating lma ( i lma ) fastrac 8 , intubating lma ( i lma ) fastrac 6.5 , intubating bougie , hernia mesh 15x15 , hernia mesh 3x6 , head ring ( adult ) , head ring ( peadia ) , guedalsairway size , 0, , guedalsairway size , 2, , guedalsairway size , 5 , guedalsairway size 00, , guedalsairway size 000, , guedalsairway size 1, , guedals airway size , 4, , guedals airway size 3, , glucometer , glucometer strips , hmef, filter, heat and moisture exchanger with viral filter ( hmef ) , formalin chamberthree tray ( 24*8*8 ) inch , formalin chamber three tray ( 20*8*8 ) inch. , formalin chamber two tray ( 16*8*8 ) inch. , foley catheter 20 no. 3 way , foley catheter 22 no. 3 way , foley’s catheter 16 no. , foley’s catheter12 no. , foley’s catheter14 no. , foleys catheter size10 , foleys catheter size18 , foldable iol sterile lens + 19.5d , foldable iol sterile lens + 19d , foldable iol sterile lens + 20.5d , foldable iol sterile lens + 20d , flexometallictube ( armored tube ) , 6.5 , flexometallictube ( armored tube ) , 7 , flexometallictube ( armored tube ) , 7.5 , flexometallictube ( armored tube ) , 8 , flexometallictube ( armored tube ) 6, , flexometallictube ( armored tube ) 8.5 , electric surgical instrument boiler ( 20*8*7.5 ) inch , electric surgical instrument boiler ( 24*8*8 ) inch , ecg paper a4 size , echo cardiography rollpaper , 3 way cannula ( triway ) , 3 way extension 100 cm , 3 way extension 25 cm , abdominaldrain adk drain no. 28 , abdominaldrain adk drain no. 30 , ansathesia face mask silicone transparentsize , 4 , ansathesia face mask silicone transparentsize , 5 , ansathesia face mask silicone transparentsize 0 , ansathesia face mask silicone transparentsize 00 , ansathesia face mask silicone transparentsize 1 , ansathesia face mask silicone transparentsize 2 , ansathesia face mask silicone transparentsize 3 , ansthesia work station disposable circuit ( adult ) , ansthesia work station disposable circuit ( paedeatric ) , centralvenous catheterkit ( adult ) , centralvenous catheterkit ( paedeatric ) , ambu bag ( padeatric ) 150 ml , ambu bag ( padeatric ) 250 ml , stethograph , analytical digital balance , perimeter ( priestley smith ) s / lp.984 b & t , long knee brace , knee cap , finger splint , wrist hand stabillizer , cock up splint , thumb spica splint , arm pouch , universal shoulder immobillzer , clavicular brace , neck collar soft , nack collar hard , l s belt , forearm brace , anklet , crepe bandage 4 inch , crepe bandage 6inch , dynaplast , stockinette / soft roll , walker , sodium borate 1 kg , sodium citrate 1 kg , pipracelline+tezobactum inj ( 4.5 gm ) , inj. tranexamic acid 500 mg , inj. lebetalol 5 ml , inj. magnesium sulfate , kelleys pad , povidone solution 5% 500 ml , inj methergine 0.2 mg , inj mgso4 50% , catgut 1 no suture , vicryl 1 no ( round bodied needle ) suture , inj epidosin , inj drotaverine , urine for albumin strip , cerviprime gel 0.5 mg , inj anti d ( 300 microgram ) , edta vial , b.p. instumanet with all size cuf , anterior vaginal wall retractor , ovum forceps ( medium size 05 ) ( small size 05 ) , blakes uterine curette , karmans cannula set ( 05 no ) , karmans cannula set ( 06 no ) , karmans cannula set ( 08 no ) , karmans cannula set ( 12 no ) , hegars cervical dilator set , mva syringe along with cannula , uterine sound , vullselum , tab. tranexa , tab. misopristol , cotton guaze pad , nylon suture 3 0 , nylon suture 4 0 , suction catheter 06 no , suction catheter 07 no , suction catheter 08 no , iv metronidazole 100 ml , iv ringer lactate 500 ml , iv normal saline 100 ml , mackintosh sheet , laryngo scope neonate blade size 0 / 1 , cidex solution 5 ltr , surgical drum 12×15 , surgical drum 11×13 , surgical drum 9×11 , surgical tray medium , surgical tray large , povidone onitment 250 gm , digital fuji x ray film 8*10 ( 1×150 ) , posterior chamber intra ocular lens ( pciol ) ( pmma, single piece, size 6mm optics total 13mm ) 10 d , pciol / / 12 d , pciol / / 14 d , pciol / / 16 d , pciol / / 17 d , pciol / / 17.5 d , pciol / / 18 d , pciol / / 18.5 d , pciol / / 19 d , pciol / / 19.5 d , pciol / / 20 d , pciol / / 20.5 d , pciol / / 21 d , pciol / / 21.5 d , pciol / / 22 d , pciol / / 22.5 d , pciol / / 23 d , pciol / / 23.5 d , pciol / / 24 d , pciol / / 25 d , pciol / / 26 d , pciol / / 27 d , pciol / / 28 d , pciol / / 29 d , pciol / / 30 d , anterior chamber intra ocular lens ( aciol ) , kelman multiflex model ( pmma, single piece, size 6mm optics total 13mm ) 16 d , aciol / / 17 d , aciol / / 18 d , aciol / / 19 d , aciol / / 20 d , viscoelastic substance ( pre filled syringe ) , trypan blue dye , hylase injection , lignocaine 4% drops , pilocarpine injection , epitrate injection , virgin silk suture6 0 , monofillanent nylon suture ( double ended ) , surgical blade 15 number , vicryl suture 6 0 , keratome blade , crescent blade , side port , tab. diamox , spirit lamp , r.o. machine for washing and scrubings , formiline chamber , white and green cloth , uv sterilizer , color vision chart – original ishihara , near vision chart with different languages , torch with yellow light , maddoxrod , maddox wing , diplopia goggles , bipolar wetfield cautry , placido disc , prism bar , cryo unit , non contact tonometer , multi media projector with screen , hess screen chart , usg –a scan , corneal loupe , indirect ophthalmoscope with +20 and +30 volk lenses , direct ophthalmoscope , snellen’s chart / snellen drum with or without remote control , trial set with trial frame ( adult and children ) , streak retinoscope , keratometer , synaptophore , chalazion set , autoclave , drum ( large, medium, small ) , kidney tray ( large , medium , small ) , bowl , infrared thermometer , chittle forceps , boiler ( small and large ) , stainless steel traywith cover ( small and large ) , schiotz tonometer , intraocular lens 15 no to 27 no , intraocular lens 27 no , methylene blue dye , balancde salt solution , dextrose 5 % , dextrose 10 % , inj. epitate , inj.derriphyline , inj.botroclot , xylocaine jelly , inj.mitomycin c , thread ( 100 no ) , ethilon suture ( 4 0 ) , ethilon suture ( 6 0 ) , i / v set , needle ( 26.5 ) , syringes ( 5 ml ) , syringes ( 10 ml ) , syringes ( 20 ml ) , syringes ( 5 ml ) , n 95 mask , disposable eye drape , eye towel , intracatheter , inj mannitol , inj avil , chlorine solution 500 ml , betadene solution , ppe kit , betadene scrub , hydrogen peroxide solution , inj. betamethasone 4 mg , inj oxytocin 10 iu , drotaverine 40 mg / 2ml , inj. vit k , inj. dizepam , inj iron sucrose , tab. misoprostol 200 mg ( 4 tab. pack ) , baby tag , tab. tranexamic acid 500 mg , umblical cord clamp large size , rubber catheter plain , yankurs suction tube , weight machine neonatal , weight machine adult , dressing steel tray 12×15 , dressing steel tray medium , dressing steel tray small , dressing drum 12×15 , dressing drum 13×11 , electric sterlizer 20×8×6 , dettol shop 20 gm , polyglycolic acid absorbable surgical suture ( 12 foils / pkt ) ( 1 / 2 cir rb needle 40 mm length 90 cm size 1 ) vicryl , prolene 1 rb 1 / 2 circle 30 mm l 70 cm ( 12 foils / pkt ) needle , ethicon 2 0 black clear monofilament rc 45 mm 75 cm needle ( 12 foils / pkt ) , ethicon 3 0 black clear monofilament rc 45 mm 75 cm needle ( 12 foils / pkt ) , b.b silk ( 12 foils / pkt ) ( 1 / 2 rcut needle 45 mm length 76 cm size 2 / 0 ) , stylet ( adult ) , stylet ( paedia ) , enema port , phosphate enema , methanol ( 50 ltr. per container packing ) , glycerin ( 50 ltr. per container packing ) , phenol , thymol crystals , 1 % eosin , winter green perfume ( oil of winter green ) ,