Directorate Of Medical Education - Madhya Pradesh

39769516 supply of e injection, iv fluid, tablet, capsul, srup, solution, eye drop, ointment, cream, powder, gel, spray, inhaler , injection, iv fluid, capsul, syrup, solution, eye drop, ointment, cream, powder, gel, spray, inhaler , aceborophylline 100 mg , amoxicillin 250 mg cap , amoxycilline – 500 mg , amoxycilline + clavulanic acid 375 mg cap. , amoxycilline + clavulanic acid 625 mg cap. , ampicillin 250mg+ cloxacillin250mg , ampicilline – 500 mg , aprepitant 125 mg+aprepitant 80 mg capsule kit , calcitriol 0.25mcg soft geletine capsule , chloramphenicol 250 mg capsule , chloramphenicol 500 mg capsule , cholecalciferol ( vitamin d3 ) capsules 60000 iu , clindamycin 300mg capsule / tab ( 10x10 ) , tablet capsule , clindamycin 600mg capsule / tab ( 10x10 ) , tablet capsule , crizotinib capsules 250mg , cyclosporine 100 mg , cyclosporine 50 mg , deferiprone 500 mg cap. , doxycycline 100 mg , fluoxetine 40 mg , fluoxetine bp 20 mg , hydroxy urea 500 mg cap. , imatinib mesylate 100 mg , itraconazole 100 mg , ivabradin 5mg , lenalidomide ( 10mg ) , capsule , lenalidomide ( 25mg ) , capsule , methylcobalamin 1500 mcg+alpha lipoic acid 100 mg+folic acid 1.5 mcg thiamine mononitrate 10 mg ( pyridoxine hcl 3 mg ) cap. , omeprazole 20 mg , orlistat capsule usp 120 mg , orlistat capsule usp 60 mg , oseltamivir ( 45mg ) , capsule , oseltamivir ( 75mg ) , capsule , palbociclib 100 mg cap , palbociclib 125 mg cap , palbociclib 75 mg cap , pancreatic enzymes 20000 iu capsule , pancreatic enzymes 25000 iu capsule , pancreatic enzymes 8000 iu capsule , pregabalin 75 mg + methylcobalamin 750 mcg , rabeprazole 20mg , tablet or capsule , racecadotril capsules ip 100mg , rifaximine 400 mg , sildenafil 20mg , sunitinib malate capsules 50 mg , temozolamide 100 mg , temozolamide 250 mg , tetracycline 250 mg capsule , tetracycline 500 mg capsule , topotecan hydrochloride capsules 1 mg , vitamin e usp ( 400 mg ) , capsule , acyclovir 3%w / w 5 ml vial , atropine sulphate 1% 5 ml vial , beclomethasone ( 0.025% ) + clotrimazole 1% + neomycin sulphate 0.5%5 ml ear drop , benzocaine 2.7% w / v + chlorbutol 5% w / v +paradichlorobenzene 2% w / v + turpentine oil 15% w / v ear drop , carboxymethylcellulose solu. eye drop 0.5% , carboxymethylcellulose solu. eye drop 1% , ciprofloxacin eye drop 0.3% 10 ml , fluromethanol eye drop , gatifloxacin ophthalmic solution 0.3% w / v 5ml vial , gentamycin eye drop , homatropine hydrobromide 2 %w / v 10ml eye drops , homatropine hydrobromide 2 %w / v 5ml eye drops , lignocaine hcl 4% eye drop , loteprednol eye drop , methyl cellulose / visco elastic , moxifloxacin +prednisolone eye drope , moxifloxacin 0.5% eye drop , natamycin eye drop , nepafenac ophthalmic solution , ofloxacin 0.3% 5 ml vial , olopatidine hydrochloride ophthalmic solution 0.1% , pilocarpine eye drops 2% , polyethelene glycol 400 & propylene glycol ophthalmic solution 10ml , polyvinyl alcohol 1.4% 5 ml , povidone iodine 5% solution eye drop 5ml , prednisoloneeye / drop. , proparacaine , sodium chloride opthalmic solution 5% eye drop , timolol maleate 0.5% 5 ml vial , tobramycin 0.3% 5ml eye drop , topicamide +phenylephrine eye drop , tropicamide 1% 5 ml vial , acyclovir 3% eye oint.5 gm tube , atropine eye oint. 3gm tube , chloramphenicol eye ointment 5 gm tube , ciprofloxacin eye ointment 5 gm tube , hydroxypropylmethylcellulose 2% w / v ophthalmic solution ocular lubricant 5gm ointment , tobramycin eye oint.3gm tube , medical nitrous oxide gas , benzocaine gel usp 20% w / w 15gm tube , chlorhexidine gluconate 1.0% w / w 15gm tube , choline salicylate and lignocaine hydrochloride 10 gm tube , diclofenac gel 1% 30 gm , dinoprostone 0.5 mg 3 gm pre filled syringe gel , ecg gel 250ml bottle , lignocaine hydrochloride 2% w / v gel , oxetacaine 10mg + aluminium hydroxide 291mg + milk of magnesia 98 mg per 5ml 200 ml bottle , triamcinolone acetonide dental paste usp, 0.1% 5gm tube , ultra sonograph gel 250ml bottle , white petroleum jelly kg , amino acid infusion 5 %100 ml , amino acids 10% w / vin glass bottle 500ml, , aminoacid ( essential ) 10% 100 ml ffs bottle , balanced crystalloid solution 500 ml bottle , ciprofloxacin200 mg / 100 ml ffs bottle , dextrose 40% 100 ml bottle , dextrose 5 % with normal saline 0.45% 500 ml glass bottel with rubber cork , dextrose saline ( dns ) 5% + 0.9% 500 ml ffs bottle , dextrose with saline ( 5% + 0.45% ( 500ml ffs bottle ) ) , injection , dextrose, 25% 100 ml ffs bottle , dextrose, d 10 10% 500 ml ffs bottle , dextrose, d 5, 5% 500 ml ffs bottle , dextrose, d 50 50% 100 ml ffs bottle , electrolyte m ( multi electrolyte with 5% dextrose iv injection type iii ip ) , type iii ip 500 ml ffs bottle , electrolyte p ( multiple electrolytes & dextrose injection type i ip ) type i ip 500 ml ffs bottle , fluconazole 100ml bottle. 2mg / ml. , glutamine dipeptide 100ml bottle , glycine irrigation solution ip 3000 ml bottle , hydroxyethylstarch 6% solution with sodium chloride 0.9% iv infusion 500 ml ffs bottle , levofloxacin 500 mg / 100 mlffs bottle , linezolid 200 mg / 100ml 300 ml bottle , mannitol20%100 ml ffs bottle , mannitol 20% 350ml , metronidazole 500 mg / 100 mlffs bottle , normal saline 0.9% 100 ml ffs bottle , normal saline 0.9% 3 ltrs bottle , normal saline 0.9% 500 ml ffs bottle , normal saline 1.6% 500 ml bottle , normal saline 3% 100 ml ffs bottle , normal saline glass bottle 100ml , normal saline glass bottle 500ml , ofloxacin 200mg / 100 ml bottle , ornidazole iv 500mg / 100ml ( 100ml bottle ) , infusion , paracetamol1000 mg 100 ml ffs bottle , ringer lactatei / v 0.24 % v / v of lactic acid ( eq. to0.32% w / v of sodium lactate ) , 0.6 % w / v sodium chloride, 0.04 %w / v potassium chloride and 0.027 % w / v calcium chloride 500 ml ffs bottle , ringer lactatei / v 0.24 % v / v of lactic acid ( eq. to0.32% w / v of sodium lactate ) , 0.6 % w / v sodium chloride, 0.04 %w / v potassium chloride and 0.027 % w / v calcium chloride 500 ml glass bottle , sodium chloride hyper tonicn / 2 ( 0.45% ) 500 ml ffs bottle , sodium chloride ( 1 / 2 n ) + dextrose 0.45% + 5% 500 ml ffs bottle , total parenteral nutrition 1000 ml with 763 kcal dextrose 15% w / v, amino acids 10% w / v with electrolytes & intravenous fat emultion triglycerides 20% w / v ) ( all in one inthree chamber bag ) , 1000ml , total parenteral nutrition ( including carbohydrate + proteins + fats solution 2000 ml ) , infusion , budesonide nebulising suspension containing budesonide ( 0.5 mg / 2 ml, 2ml amp ) , suspension , sevoflurane usp inhalation anesthetic 250 ml ( 250 ml ) , bottle , desflurane 240ml bottle , formoterol + budesonide ( 6 mcg + 100 mcg / puff ( 120 mdi ) ) , inhaler , ipratropium bromide ( 250 mcg / ml respules / ampoule ) , inhalation , isoflurane inhalation 250 ml bottle , levosalbutamol ( 1.25mg ) , ipratropium ( 500mcg ) respule ( 3ml ) , ampule , salbutamol nebuliser solution bp sabutamol sulphate eq. to salbutamol 1mg per ml ( 2.5 ml amp ) , ampule , sterile acetylcysteine solution usp 20% w / v 2ml respules , salmeterol 25 mcg + fluticasone 125 mcg ( 120mdi ) , inhaler , 5 fluro uracil 250mg 10 ml amp , 5 fluro uracil 500mg 10 ml amp , actrapid penfill 100iu / 3 ml injection , acyclovir inj ( 250 mg / vial ) , injection , acyclovir inj ( 750 mg / vial ) , injection , acyclovir intervenous infusion i.p ( 500mg / vial ) , injection , adalimumab ( 20 mg / 0.4 ml vial ( pfs / vial / ampule ) ) , ampule , adalimumab ( 40 mg / 0.8 ml vial ( pfs / vial / ampule ) ) , ampule , adenosine ( 6 mg / 2ml ) , injection , ado trastuzumab emtansine 100 mg inj , adrenaline ( 1 mg / ml ( 1 ml amp ) ) , injection , aflibercept injection for intravitreal 2mg / 0.05ml vial , alamine 8.2gm+l glutamic acid 13.46gm 100 ml bottle i / v , alteplase for injection 50mg vial , amidotrizoate meglumine; sodium amidotrizoate ( 76% ) dye 50 ml bottle , amikacin250mg / 2 ml 2 ml vial , amikacin ( 500mg / 2ml ( 2ml vial ) ) , injection , aminophylline ( 25 mg / ml 10 ml vial ) , injection , amiodarone 50mg / ml ( 3ml vial / amp ) , injection , amoxycillin +clavulanic acid ( ( amoxycillin 500 + clavulanic acid 100 mg ) / vial ) , injection , amoxycillin and potassium clavulanate i.p. ( 1 gm + 0.2 gm / 10 ml vial ) , injection , amphotericin b inj ip 50 mg ( liposomal amphotericin b also acceptable ) , injection , ampicillin ( 500 mg / vial ) , injection , ampicilline 1000mg + sulbactam 500mg, injection , anti d immunoglobulin for iv / im use ( monoclonal ) ( 150mcg ( 1ml vial ) ) , injection , anti rabies vaccine i.p. inj. human ( tissue culture ) for i / d and i / m route 2.5 iu with ( 1ml diluents ) , vial , anti scorpion venominj <120mg total protein and >150 ld50 [ mouse ] neutralizing units / vial , anti snake venom polyvalent inj 10ml ( lyophilized ) ( 10 ml vial ) , injection , anti thymocyte globulin ( 250mg / 5ml ) , injection , anti thymocyte immunoglobulin ( rabbit ) ( 5mg / ml ( 25mg vial ) ) , injection , artesunate ( 60 mg / vial ) , injection , ascorbic acid 100mg / ml 5ml amp ( vitamin c ) inj , atracurium ( 10mg / ml ) , injection , atropine sulphate 0.6 mg / ml sc / im / iv ( 2ml amp ) , injection , azithromycin 100mg / 5ml inj , azithromycin 500mg / 5ml inj , bendamustine ( 100mg vial ) , injection , benfotiamine7.5mg +folic acid ip 0.75mg +methylcobalamin jp 750mcg +pregabalin ip 75mg +vitamin b6 ( pyridoxine hcl ip 1.5mg ) injection , benzathine penicilline 12 lac iu / vial ( vial ) , injection , betamethasone sodium phosphate ( ml contain betamethasone sodium phosphate equal to 4mg of betamethasone ( 1ml amp ) ) , injection , bevacizumab 100 mg ( 4 ml vial ) , injection , bleomycin ( 15 units / vial ) , injection , bortezomib ( 2.5mg ) , injection , bortezomib ( 2mg ) , injection , bortezomib ( 3.5mg ) , injection , botulinum toxin type a injection 100units / vial , botulinum toxin type a injection 200units / vial , brilliant blue g solution 0.05% w / v , brolucizumab solution for injection 120mg / ml , bupivacaine hcl for spinal anaesthesia 0.5% ( heavy ) amp 4 ml amp , bupivacaine hydrochloride ( 0.5% ( 20 ml vial ) ) , injection , buprenorphine hydrochloride0.3mg base / ml 1ml amp inj , busulfan ( 6mg / ml ( 10ml vial ) ) , injection , butorphanol 1mg / ml 1ml amp , c3r dye riboflavin hypotonic , c3r dye riboflavin isotonic , caffeine citrate inj. ( 20mg / ml 1 ml vial ) , injection , caffeine citrate inj. ( 20mg / ml 3 ml vial ) , injection , calcium carbonate 10% 10ml amp , calcium chloride 10% 100mg / ml 10ml vial , calcium gluconate 10% ( 10ml vial / amp ) , injection , calcium leucovorin ( 50 mg / vial inj ) , injection , carboplatin ( 150mg 15 ml vial ) , injection , carboplatin ( 450mg 45ml multidose vial ) , injection , carboprost ( 250 mcg ( 1 ml amp / vial ) ) , injection , carmustine injection ip 100 mg vial , cefazolin inj ( 500mg vial ) , injection , cefepime 500mg and tazobactam 125 mg inj ( vial ) , injection solution for , cefepime ( 500mg injection ) , injection , cefoperazone + sulbactam 1000 mg +500 mg vial , cefoperazone 1000mg + sulbactam 500mg inj ( vial ) , injection , cefoperazone 1gmvial , cefotaxime + sulbactam 1000 mg + 500 mg vial ( 1000 mg + 500 mg ) , injection , cefotaxime sodium 1 gm / vial , cefotaxime sodium 500mg vial , ceftazidime 1gm vial , ceftazidime inj ( 500mg / vial ) , injection , ceftazidime ( 250mg / vial ) , injection , ceftriaxone 1 gm / vial , ceftriaxone 1000 mg+disodium edetate 37 mg+sulbactam 500 mg powder for solution for infusion , ceftriaxone 1000mg + sulbactam 500mg ( vial ) , injection , ceftriaxone ( 500mg vial ) , injection , ceftriaxone+tazobactum ( 1gm+125mg, vial ) , injection , cefuroxime ( 1.5 gm ) , injection , cefuroxime ( 1000 mg ) , injection , cefuroxime ( 500 mg ) , injection , cetuximab 2mg / ml 100mg / 50ml vial , cetuximab 2mg / ml 200ml / 100 ml vial , cetuximab ( 500 mg ) , injection , chloramphenicol sodium succinate 500 mg, injection , chloroquine phosphate ( 40mg / ml ( 5 ml amp ) ) , injection , chlorpheniramine maleate ( 10mg / ml inj 10 ml ) , vial , chlorpromazine injection ip 25mg / ml 1 ml vial , cholecalciferol 600000 iu / 2ml ( 2ml amp ) , injection , cholecalciferol 600000 iu / ml ( 2ml amp ) , injection , cis atracurium 2mg / ml ( 5ml vial ) solution for injection , cisplatin ( 10 mg ) , injection , cisplatin ( 50 mg ) , injection , cladribine injection 1mg / ml 10ml vial , clindamycin 600mg ( 150mg / ml ) , injection , clindamycin ( 150mg / ml ( 2 ml vial / amp ) ) , injection , clonidine100 mcg / ml 10 ml vial , colistimethate sodium for injection ip ( 2 m iu vial ) , injection , colistinethate sodium inj bp ( 1 million iu ) , injection , cyanoacrylate glues 120mg / ml , cyclophosphamide inj ( 1000 mg / vial ) , injection , cyclophosphamide inj ( 200 mg / vial ) , injection , cyclophosphamide inj ( 500 mg / vial ) , injection , cynocobalamin 500mcg +folic acid 15mg+niacinamide 200 mg + ascorbic acid 100mg inj , cynocobalamin 500mcg +folic acid 15mg+niacinamide 200 mg inj , cytarabine 1000 mg / ml 1ml vial , cytarabine ( 100mg ) , vial , dacarbazine 200 mg inj , dacarbazine 500 mg inj , dactinomycin 0.5 mg inj , daunorubicin hydrochloride 20 mg / vial , daunorubicin hydrochloride 50 mg / vial , decitabine for injection 50mg / vial , desferioxamine , desferioxamine , dexamethasone intravitreal implant 0.7mg , dexamethasone sodium phosphate ( 4mg / 2ml ( 2ml vial ) ) , injection , dexamethasone sodium phosphate ( 8mg / 2ml ( 2ml vial ) ) , injection , dexmedetomidine 100 mg / ml ( 1 ml amp ) , dextran injection ip 10%w / v 500ml bottle , diatrizoate meglumine 809.13 mg+diatrizoate sodium 635.90 mg 76% 20ml, injection , diatrizoic acid 60% 20ml amp , diatrizoic acid 65% 20ml amp , diazepam ( 5 mg / ml ( 2 ml amp ) ) , injection , diclofenac sodium 25 mg / ml ( 3ml amp ) , injection , diclofenac sodium 75mg intended to use iv aqueous formulation ( 1ml amp ) , injection , dicyclomine ( 10mg / ml ( 2 ml amp ) ) , injection , digoxin i.p. 0.5mg / 2ml amp inj , diltiazem 25mg ( 5ml vial ) , injection , diphtheria antitoxin 10000 iu ( 10ml vial ) , injection , dobutamine hcl 50 mg / ml ( 5ml amp ) , injection , docetaxel ( 120mg vial ) , injection , dopamine hydrochloride 40 mg / ml 5 ml amp , doxorubicin ( lyophilised ) ( 50mg vial ) , injection , doxorubicin ( lyophilized ) ( 10 mg / vial ) , injection , drotaverine ( 40mg / 2ml ( 2ml amp ) ) , injection , edaravone injection jp 1.5mg / ml ( 20ml amp ) inj , enalapril maleate inj 1.25 mg per ml 2ml vial , enoxaparin ( 40mg equivalent to 4000 iu vial / pfs ) , injection , enoxaparin ( 60mg equivalant to 6000 iu vial / pfs ) , injection , ephedrine 30 mg / ml ( 1 ml amp ) , injection , epirubicin ( 100mg / vial ) , injection , epirubicin ( 50mg / vial ) , injection , erythropoietin ( 10000iu inj ) , injection , erythropoietin ( 4000 iu inj vial / pfs ) , injection , esmolol 100 mg / vial ( 10mg / ml ) , injection , etanercept 25mg / vial ( pack of 2 vials ) , injection , etanercept 50mg / vial ( pack of 2 vials ) , injection , ethamsylate inj ( 125mg ( 2ml amp ) ) , injection , etiophylline and theophylline ( 220 mg / 2ml ) , injection , etomidate vial ( 2mg / ml ) ( 10ml vial ) , injection , etoposide injection ip 100 mg / 5 ml , fat emulsion 20% 250 ml bottle , fentanyl citrate inj 100 mcg / ml ( 2ml ampoule ) , ampule , fentanyl citrate inj 50 mcg / ml ( 2ml ampoule ) , ampule , filgrastim 300 mcg ( prefilled syrings ) , vial , filgrastim injection pfs 300 mcg recombinant human granulocyte colony stimulating factor ( rhu g csf ) , fludarabine phosphate 50mg ( each ) , injection , fluorescein 20% 5 ml amp , flupentixol 25 mg inj , flupentixol injection ip 20 mg / ml , fluphenazine 25 mg / ml 1 ml amp , frusemide ( 10 mg / ml ( 2 ml amp ) ) , injection , ganciclovir 500 mg vial , gas gangrene antitoxin 10, 000iu / ml ( 4ml amp ) , gemcitabine ( 1.4 gm vial ) , injection , gemcitabine ( 1000mg vial ) , injection , gentamicin inj ( 40 mg / ml 2 ml amp ) , injection , glargine 100 iu / ml, 3ml cartridge inj. ( firm has to supply one compatible pen with every 20 cartridges as and when required without any extra cost ) ( 100 iu / ml ) , cartridges , glutathione 600mg vial, injection , glycopyrrolate 0.5mg + neostigmine 2.5mg 5ml amp , glycopyrrolate inj. 0.2 mg / ml ( 1 ml amp ) , injection , granulocyte colony stimulating factor ( g csf ) 300mcg vial , haemocoagulase 1 iu ( 1ml amp ) inj , haemophilus influenzae type b vaccine 0.5ml , haloperidol inj ( 50mg / ml ) , injection , haloperidol inj ( 5mg / ml ( 1 ml amp ) ) , injection , heparin inj ( 5000iu / ml 5ml vial ) , injection , heparin ( 1000iu / ml 5ml vial ) , injection , hepatitis b immunoglobulin ( 100 iu / vial ) , vial , hepatitis b vaccine / 1ml ( 1ml ) , ampule , human albumin solution i.p. 20%w / v ( 100 ml ffs bottle / glass bottle ) , bottle , human anti d. immunoglobulin ( monoclonal ) ( 300mcg / vial ) , injection , human insulin regular / soluble ( 40iu / ml ( 10ml vial ) ) , injection , hyaluronidase 1500 iu / 2 ml ( 2 ml amp / vial ) , injection , hydrocortisone sodium succinate ( 100 mg / vial ) , injection , hydroxy propyl methyl cellulose injection 2% ( 3ml prefilled syringe ) , syrings , hydroxyprogesterone caproate inj i.p. 250mg / ml , hyoscine butylbromide 20mg / ml ( 1ml vial / amp ) , injection , i / v polysacchride or conjugate pneumococcal ( 0.5 ml ) , vaccine , ifosfamide for injection1 gm vial , ifosfamide for injection1 gm with mesna injection vial , ifosfamide for injection2 gm vial , imipenem 1000 mg vial / amp, injection , imipenem 500 mg with cilastatin 500mg ( vial / amp ) , injection , infliximab powder for concentrate for solution for infusion ( r dna origine ) 100mginj , insulin lispro ( insulin lispro 25% and insulin lispro protamine 75% ) ( rdna origin ) 100iu / ml , iohexol ( non ionic contrast medium in sterile aqueous solution ) 300 mg iodine / ml ( 100 ml ) , bottle , iohexol injection 350 mg iodine / ml ( 20 ml vial ) , consumable , irinotecan hydrochloride ( 100 mg ) , injection , irinotecan ( 40mg / vial ) , injection , iron sucrose usp ( 100 mg / 5 ml ( 5 ml amp ) ) , injection , isobaric levobupivacaine ( 0.5% ) , injection , isoprenaline 2 mg / ml ( 1 ml ) , injection , isoxsuprine hcl5mg / ml 2ml amp , iv human immunoglobulin 5% iv ig ( 5gm / 100ml bottle, injection , ketamine hydrochloride ( 50mg / ml ( 10 ml vial ) ) , injection , ketorolac trometamol 30 mg / ml 1ml solution for injection , l ornithine and l aspartate ( 5mg / 10 ml ) , injection , labetalol ( 20 mg / 4 ml ( 4ml amp ) ) , injection , l asparaginase 10000iu / vial, injection , l asparaginase 5000 iu lyophilized ( vial ) , injection , leuprolide acetate for injection 3.75mg depot , leuprolide acetate for injection 6.25mg depot , levetiracetam ( 100mg / ml ) , injection , levobupivacaine hyperbaric ( 0.5% ) , injection , levosulpiride injection ( 12.5 mg / ml ) amp , lidocaine hydrochloride topical solution usp 4% ( 40mg / ml ) , injection , lignocaine ( preservative free ) ( 2 % 50 ml vial ) ) , injection , lignocaine 10% ( 10mg / ml ( 30 ml vial ) ) , injection , lignocaine 2 % ( 21.3 mg / ml ( 30 ml vial ) ) , injection , lignocaine 2% + adrenaline 5 mcg / ml ( 30 ml ) , injection , lignocaine for spinal anaesthesia lignocaine 5% +destrose 7.5% 2 ml amp heavy , lignocaine hydrochloride inj ip 1% 2ml vial , liposomal amphotericin b suspension in saline 10mg , liposomal amphotericin b suspension in saline 50mg , liposomal amphotericin b ( 50 mg ) , injection , liposomal doxorubicin 20 mg or pegylated liposomal doxorubicin ( 2 mg / ml 10ml vial ) , injection , lorazepam ( 2 mg / ml 1 ml vial ) , injection , lorazepam ( 2 mg / ml 2 ml vial ) , injection , low molecular weight dextran 40000iu vial , magnesium sulphate injection ( i.p.50 % w / v 10 ml amp ) , injection , meningococcal polysaccharide vaccine groupe a, c, y and w 135 combined vial , meningococcal vaccine ( group a, c, y, w ) 0.5 ml vaccine , mephentermine inj 30mg / ml ( 10 ml vial ) , injection , meropenem ( 1000 mg ( vial ) ) , injection , meropenem ( 500 mg / vial ) , injection , mesna 200mg / 2ml ( 2ml amp ) , injection , methacarbamol 100 mg. / 10ml vial , methotrexate 15 mg / ml ( preservative free ) inj , methotrexate 50 mg / 2 ml, 2 ml vial , methotrexate 500mg / 5ml ( 5ml in 1 vial ) , injection , methyl ergometrine inj meleate ( 0.2 mg / ml ( 1ml amp ) ) , injection , methyl prednisolone sodium succinate inj ( usp 125mg ) , vial , methyl prednisolone sodium succinate inj. 40mg vial , methyl prednisolone sodium succinate inj.1000mg vial , methyl prednisolone ( 500mg ) , injection , methylcobalamin 1500 mcg +folic acid 0.7mg+ niacinamide 12 mg inj , methylcobalamine ( vitamin b12 ) 500 mcg / ml, 3 ml amp , methylene blue injection usp 1% ( 10mg / ml ) 10 ml amp , metoclopramide 5mg / ml ( 2 ml amp ) , injection , metoprolol inj 5 mg / ml ( 5ml vial ) , injection , micafungin sodium 100 mg / vial, injection , micronised progesterone 50mg / ml 2ml amp , micronized progesterone 100mg / ml2ml amp , midazolam 1mg / ml, 1 ml amp , midazolam 1mg / ml, 5 ml amp , milrinone 1mg / ml solution for injection / infusion , mitomycin c for injection 40mg inj , mitoxantrone 2 mg / ml inj , mixed.30 / 70 insullin biphasic isophane40 iu / ml 10 ml vial , morphine sulphate 10mg / ml 1ml amp , moxifloxacin opthalmic solution 0.5ml pfs , multivitamin 10ml ( amp inj ) , injection , n acetyl cysteine inj 200mg / ml 10 ml amp , naloxone inj. 0.4 mg / ml ( 1ml ampoule ) , injection solution for , neostigmine ( 0.5mg / ml ( 1ml amp ) ) , injection , nikethamide injection 1mg / ml ip 10 ml amp , nitrofurantoin 300mcg injection , nitroglycerine inj. 25 mg / 5ml ( 5ml ) , ampule , noradrenaline bitartrate 2 mg base / 2 ml amp injection ( 2 ml amp ) , injection , novomix 30 penfill 100 iu inj 3 ml cartridge , octreotide 100microgram / ml solution for injection 1 ml amp , octreotide 50 microgram / ml solution for injection 1 ml amp , olanzapine10 mg / vial inj , olanzapine depot inj , ondansetron ( 2 mg / ml ( 2 ml amp ) ) , injection , ondansetron ( 2 mg / ml ( 4 ml amp ) ) , injection , oxaliplatin ( 100mg ) , injection , oxaliplatin ( 50mg inj 25 ml vial ) , injection , oxytocin inj ( 5 iu / ml ( 1ml amp ) ) , injection , paclitaxel 260mg ( 43.34ml vial ) , injection , paclitaxel inj ( 100mg ) , injection , paclitaxel nanoparticle / protein bound particles inj. ( 100mg vial ) , vial , panitumumab 100mg / 5ml inj , paracetamol amp for i / v use ( 2ml ) , ampule , paracetamol inj ( 150mg / ml 2ml amp ( 2ml amp ) ) , injection , parenteral nutrition two chamber bags without lipid 2000ml , peg gcsf 6 mcg , pembrolizumab 100mg / 4ml ( 25mg / ml ) , pemetrexed ( 100mg ) , injection , pemetrexed ( 500mg ) , injection , penicillin v 125 mg inj , pentaprazole inj vial ( 40 mg ) , injection , pentazocin lactate 30mg / ml 1ml amp. , pentoxifylline 20 mg / ml , perfluoro n octane liquid , pertuzumab 30 mg / ml ( 420mg / 14ml ) , injection , pheniramine maleate ( 22.75 mg / ml ( 2 ml amp ) ) , injection , phenobarbitone100mg / ml 1ml amp. , phenobarbitone200mg / ml 1ml amp. , phenytoin sodium ( 50 mg / ml ( 2ml amp ) ) , injection , pilocarpine nitrate inj. ip 0.5 % w / v ( 1 ml ) , injection , piperacillin + tazobactam 1000 mg + 125 mg vial 10 ml vial ( ) , injection , piperacillin + tazobactam ( 2000 mg + 250 mg 20ml vial ) , injection , piperacillin + tazobactum ( 4.5 g ) , injection , potassium chloride inj. 150mg / 10ml amp ( 150mg / 10ml amp ) , ampule , pralidoxime chloride injection i.p. 1gm ( 20 ml ) , injection , preservative free lidocaine tropicamide phenylephrine hydrochloride inj , progesterone b.p.100mg / 2ml ( 2 ml vial ) , injection , promethazine 25 mg / ml ( 2 ml amp ) , injection , propofol sodium 1%w / v ( 10mg / ml ( 20ml vial ) ) , injection , protamine sulphate 1%w / v ( 10mg / 5ml ( 5ml amp ) ) , injection , quinine dihydrochloride ( 300mg / ml ( 2ml amp ) ) , injection , rabeprazole 20 mg injection , rabies immunoglobulin inj 300 iu ( ( 2ml vial pfs ) ) , injection , ranitidine ( 50mg / 2ml , 2ml amp ) , injection , recombinant anti hemophilic factor viii ( 250 iu inj / vial ) , injection , recombinant anti hemophilic factor viii ( 500 iu inj / vial ) , injection , remdesivir inj 100mg / vial , rh erythropoetin ( 2000 i.u ) , injection , rituximab ( 100mg ) , injection , rituximab ( 500mg ) , injection , ropivacaine 0.5% 20 ml vial , ropivacaine 0.75% 4ml amp , ropivacaine 10mg / ml 2.5ml vial , ropivacaine hydrochloride0.2% 40mg / 20ml vial ( 2mg / ml ) , ropivacaine hydrochloride0.75% 150 mg / 20 ml vial ( 7.5mg / ml ) , sargramostim 500 mcg / ml inj , sildenafil 10mg i.v. 12.5ml , sildenafil citrate 10mg / ml 10ml vial , silicone oil 1500 cst , silicone oil 5000 cst , sodium bicarbonate inj. 7.5% w / v ( 10ml ) , ampoule , sodium thiopentone 0.5 gm powder / vial ( 20ml vial ) , injection , sodium thiopentone 1 gm powder / vial ( 20ml vial ) , injection , sodium valproate 100 mg / ml, 5 ml amp , somatropin 1.33mg 4iu injection , streptokinase inj 15 lac iu ( vial / amp ) , injection , streptomycin inj ( 0.75g ) , injection , succinyl choline ( 50mg / ml ( 10 ml vial ) ) , injection , surfactant ( porcine lung surfectant extract 80mg / ml ) , surfactant bovine ( 135 mg phopholipid per 5 ml, 5ml vial ) , suspension for intratracheal instillation ( 80mg / ml ( pack size as licensed ) ) , suspension , teicoplanin ( 200 mg / vial ) , injection , terbutaline suplhate 0.5 mg / ml ( injection 1 ml amp ) , injection , teriparatide injection ip 600mcg / 2.4 ml amp , terlipressine inj. 1mg / 10ml vial ( 1 each ) , injection , tetanus immunoglobulin usp / ip ( 500 iu / vial ) , vial , tetanus toxide 0.5ml ampoule ( 0.5ml amp ) , ampule , thiamin ( 200mg 2ml ) , 4 ml amp, injection , thiamine ( vitamin b1 ) hcl 100mg / 2ml 4ml amp, injection , tigecycline 50mg ( each ) , injection , tobramycin sulphate injection ip 80 mg / 2ml ( 2 ml vial ) , tocilizumab ( 400mg ) , injection , torsemide injection ( 10 mg / ml, 2 ml amp ) , tramadol ( 100mg / ml ( 2 ml amp ) ) , injection , tramadol ( 50mg / ml ( 2ml amp ) ) , injection , tranexamic acid injection bp / ip ( 100mg / ml ( 10ml vial ) ) , injection , tranexamic acid injection bp / ip ( 100mg / ml ( 5ml amp ) ) , injection , trastuzumab 440 mg injection ( vial ) , injection , triamcinolone ( ( 40 mg / ml ) 1ml vial ) , injection , trypan blue opthalmic solution ( 0.06% 1 ml ) pre filled syringe , ulinastatin ( 1 lac iu ) , vial , urokinase ( 5 lac iu ) , vial , vancomycin hydrochloride ( 1000mg vial ) , injection , vancomycin hydrochloride ( 500mg ) , injection , vasopressin ( 20 iu / ml ) , injection , vasopressin ( 40 iu / ml ) , injection , vecuronium bromide ( 2mg / ml ( 2ml amp ) ) , injection , verapamil hydrochloride 2.5 mg / ml amp , vinblastine ( 10 mg / 10 ml ( 10ml amp ) ) , injection , vincristine sulphate ( 1mg / ml ( 1 ml vial ) ) , injection , vinorelbine ( 10 mg ) , injection , vinorelbine ( 50 mg ) , injection , vitamin b complex injection ( nfi formula 30ml / vial ) , injection , vitamin k1 ( 10mg / 1ml ( 1 ml amp ) ) , injection , vitamin k1 ( 1mg / 0.5ml ( 0.5 ml amp ) ) , injection , voriconazole ( 200 mg / vials ) , injection , water for injection 10 ml amp , zoledronic acid ( 4mg vial ) , injection , zuclopenthixol acuphase 50 mg inj , zuclopenthixol decanoate 200 mg inj , abo / rh ( d ) ahg neonate group card , acetic acid solution 3% v / v100ml , acetone detection kit , acetone solution 05 litre pack , ada kit , ahg coombs test gel card , aluminium ammonium sulphate powder 500gm , amacr , ana test kit , anhydrous cuso4 powder , anti a lactin 05ml , anti ab sera 10ml , anti d igg+ igm 10ml , anti d igm 10ml , anti hlactin 05ml , anti her / erbb2 monoclonal , anti human globulin ( ahg ) 05ml , anti a sera 10 ml , anti b sera 10 ml , banded use in blood bank , barium chloride 10 %500 ml , bcl 2 , benedict reagent5 lit cane , bismark brown stain 100 gm , blood culture media aerobic for adult ( bac t / alert pf plus ) , blood culture media anaerobic for pediatric ( bac t / alert pf plus ) , blotting paper 50 / pkt , blotting paper sheet , blue tip 2ml , bovine albumin 22%05ml , buffer solution for hiv 50ml , ca 125 , calcium chloride 05ml / vail , capillary tube , cd 41 pc7 , cd34 , cd42b pe , cd61 pc5.5 , cd62p fitc , combined spinal epidural ( cse ) kit , coombs sera ( igg + c3d ) , coombs sera c3d , coombs sera igg , couplin jar , cover slips size 18x18mm , cover slips size 22x22mm , cox 2 , csf protein kit , cyclin d 1 , cyto fix spray , cytoflex daily qc , cytokeratin ae1 / ae3 , dengue card test , desmin , disposable microtome blade ( 50 blades in one ) , disposable test tube with screw cap , dpx mount 250ml , ehlrich aldehyde reagent 125 , ema , estrogen receptor epi monoclonal , field stain a 500 ml , field stain b 500 ml , filter paper 12.5 cm 0.1 micron ( 50 per pkt ) , flow count bead , fluorospheres 2ml , forward & reverse grouping auto control gel card , fouchet reagent 250ml , glacial acetic acid 100 ml , glass pasture pippett with rubber , glial fibrillary acidic protein ( gfap ) , glucose kit god / pod , h2so4 25 % 500 ml bottle , haematoxylene 5gm , hbsag elisa test kit 4th generation 96 test , hbsag rapid test kit50 test , hbv elisa test kit 4th generation96 test , hbv rapid test kit , hcv elisa test kit 4th generation 96 test , hcv rapid test kit , hemoglobin test strips , hiv elisa test kit 4th generation 96 test , hiv rapid test kit , hpr polymerr kit with dab chromogen , hydro chloride acid about 36.46% , i.d. microtyping abd card , i.d. microtyping gel card ahg , immersion oil , immunotrol , immunotrol low , iso propyl alcohol , ki67 / mib 1 06 ml antibody kit , leishman stain 500 ml , leucoreductionfilter ( bed side ) , leucoreductionfilter ( lab side ) , light green stain 100 gm , liquid ammonia 500 ml , liss diluent for gel card , malaria parasite antigen test kit rapid , malaria parasite elisa test kit , massons trichrome stain , mercuri oxide 25gm , methanol 2.5lit , mgg 480ml , multi parameter urine strips ( 100 in 1 box ) , myogenin , n / 10 hcl 500ml , neutral gel card , nfp , nitric acid 500 ml , nkx 3 1 , p 53 , pandys reagent 125ml , pap pen , papanicalou ea 125ml pea 030 , papanicalou og 6 125ml pea 010 , paraffin wax 58 60c , pas stain , pasture pipette , poly l lysine solution p8920 0.1%w / v 100 ml bottle , polythene gloves , pricking lancet , progestron receptor monoclonal , retic stain 125ml , rh phelotype card with anti k , rpr test kit , s 100 , sharp collection containers disposable5 ltrs , sharp collection containers disposable 1.5 ltrs , sheath fluid , single donor platelet kit make haemonotics / terumo penpol ( close system ) , slide tray , sma , sodium chloride for analysis , steel cassets for tissue processing , stem trol , sugar albumin urine sticks ( bi parameter ) 100 strips / bottle , sulpgar powder 500 gm , sulpho salicylic acid 500ml , synaptophysin , test tube , tetrachrome , tips for auto pippets ( 2 to 100 micron yellow 1000 / pkt ) , tips for auto pippets ( 200 to 1000 micron blue 500 / pkt ) , tissue paper roll , titriplex iii pure ( edta ) , total protein kits 100 ml , tris buffer gr 500gm , tween 20 for synthesis 500ml , vdrl elisa test kit , vdrl rapid test kit , versa lyse solution , vimentin , wafers cutting blade for tube welders , xylene lr 2.5l, packaging size: 2.5 lits. , yellow gel tube vaccum blood collection tube , yellow tip plastic , calamine lotion ( ( contains per 1000 ml: calamine 150 gm, zinc oxide 50 gm, bentonite 30 gm, sodium citrate 5gm, liquified phenol 5ml, glycerin 50 ml ) 50 ml bottle ) , lotion , permethrin lotion 5% w / v ( 60 ml bottle ) , lotion , hydrogen peroxide 3% w / v mouth gargle 100 ml bottle , povidine iodine ( gargle 2% w / v 100 ml bottel ) , bottle , clotrimazole 1% w / v ( 15ml ) , mouth paint , clotrimazole, baclomethasone, benzocaine mouth paint 15ml , triamcinolone acetonide paste bp 0.1 %w / w, 5gm , triamcinolone oromucosal paste bp 0.1 %w / w, 5gm , chlorhexidine gluconate mouthwash 0.2% w / v solution ( 50ml bottle ) , solution , potassium permanganate ( kmno4 ) 25 mg ( 100ml bottle ) mouth wash , xylometazoline nasal ( 0.1%w / v ( 10 ml vial ) ) , drop , saline ( sodium chloride 6.5 mg ) nasal gel 15 gm tube , saline ( sodium bicarbonate 700mg + sodium chloride 2.3gm ) nasal wash 3 gm kit , sterile haemocoagulase solution 0.2cu 10ml drop , turpentine oil 100 ml bottle , mct oil and permitted anti oxidant ( tocopheryl acetate ) 100 ml bottle , acyclovir 5%w / w ( 5gm ) , ointment or cream , amorphous hydrogel wound dressing with colloidal silver 15gm , beclomethasone dipropionate, clotrimazole, neomycine sulphate, chlorocresol ( 0.025% + 1% + 0.5% + 0.1% w / w ( 5gm tube ) ) , ointment or cream , betamethasone 0.5mg +gentamicin 1mg 20gm cream , betamethasone valerate cream 0.05% ( 15gm tube ) , ointment , betamethasone valerate oint 0.1% ( 15 gm tube ) , ointment , centella asiatica extract based skin moisturization and antiscar gel 50gm , clindamycin phosphate gel usp 1% 30gm tube , clobetasol propionate 0.05% ( 15 gm tube ) , cream , clotrimazole i.p. 2%w / w ( 15gm tube ) , cream , fluconazole ointment 0.5% w / w 15 gm tube , framycetin sulphate 1% w / w 30 gm tube , fusidic acid cream / sodium fusidic ointment 2% ( 15gm tube ) , tube , heparin and benzyl nicotinate 20gm ointment , ketoconazole cream 2% 30gm cream , lidocaine hydrochloride ip 3%w / w + hydrocortisone ip 0.25% w / w + allantoin ip 0.5% w / w + zinc oxide 5% w / w, 15gm tube , luliconazole ( 1% w / w ) , cream 20gm , magnesium sulphate, sulphacetamide, urea, proflavin ( in glycerine base ) ointment 75 gm , mupirocin ( 2% w / w ( 5 gm tube ) ) , ointment , neomycin sulphate+bacitracin zinc ( 5mg+500 iu / gm ointment ( 15gm tube ) ) , tube , papain urea and silk protein based debriding ointment and cream 100 gm , papain urea and silk protein based debriding ointment and cream 25 gm , papain urea and silk protein based debriding ointment and cream 50gm , papain urea debriding ointment 15 gm tube , permethrin cream 5% w / v ( 60 gm ) , tube , placenta extract gel 20 gm tube , povidone iodine 5 % w / w + metronidazole 1 % w / w, 15 gm tube , povidone iodine and silk protein based topical antiseptic and wound healing ointment 100 gm , povidone iodine and silk protein based topical antiseptic and wound healing ointment 250gm , povidone iodine and silk protein based topical antiseptic and wound healing ointment 25gm , povidone iodine and silk protein based topical antiseptic and wound healing ointment 50 gm , povidone iodine ointment 5% 250gm jar , povidone iodine ointment 7.5% 500gm jar , salicylic acid 6 %, 30 gm ointment , silk protein based antimicrobial wound healing ointment loaded with asiaticoside and silver 100 gm , silk protein based antimicrobial wound healing ointment loaded withasiaticoside and silver 25 gm , silk protein based antimicrobial wound healing ointment loaded withasiaticoside and silver 250 gm , silk protein based antimicrobial wound healing ointment loaded withasiaticoside and silver 50 gm , silver nitrate hydrogel wound dressing 0.2% w / w 25 gm tube , silver sulphadiazine cream usp 1% ( 500 gm jar ) , cream , bacitracin zinc 400 u+neomycin sulphate 3400 u+polymyxin b sulphate 5000 u ( 10 gm powder ) , clotrimazole ( 1% 100 gm ) , powder , formula milk for infants 500gm , polyethylene glycol with electrolytes for oral solution 137gm , potassium permegnet powder 400 gm pkt , povidone iodine powder 5% w / w 10 gm powder , protien powder ( 200 gm 1x1 ) , powder , silk protein andnano silver based microbicidal sterile wound dressing dusting powder 100 gm , silk protein andnano silver based microbicidal sterile wound dressing dusting powder 50 gm , silk protein and antimicrobial nano silver based surgical particle wound dressing 10ml vial , silk protein and antimicrobial nano silver based surgical particle wound dressing 5ml vial , formoterol 12 mcg+tiotropium bromide 18 mcg / cap powder for inhalation , collagen granules 10 ml , fosfomycin trometamol powder ( sachet of 3 gm granules ) , human milk fortifiers ( hmf sachets ) ( 1x1gm ) , sachet , l arginine 3gm + proanthocyanidin 75mg ( 10gm sachet ) , sachet , lactic acid bacillus ( 150 million spores ) , sachet , orodispersible probiotic sachets ( 2 gm sachet ) , ors who powder glucose anhydrous 13.5g / l, sodium chloride 2.6g / l, potassium chloride 1.5g / l, trisodium citrate 2.9g / l ( as per attached pack specification ) , powder , acyclovir 5% ( 5gm ) , ointment or cream , alcoholic handrub with triple action:50%2 propano+25%1.propanol+2.5% chx+0.5 triclosan.500 ml , antiseptic hospital concentrate contdaining 20% chlorohexidine soln ip 7.5% v / v cetrimide ip 15%w / v iso peopyl alchohol 6 8% 1000ml. , beclomethasone dipropionate lotion 0.05% w / v 100ml bottle , caffeine citrate 20mg / ml 1.5 ml oral solution , caffeine citrate 20mg / ml 3 ml oral solution , citric acid 500 ml bottle , compound benzointincture, benzoin, aloe, storax, tolu balsam and enough alcohol to make a tincture ( 74 80% alcohol ) , 100 ml , feracrylum 1% 100 ml solution , formaldehyde solution37% acq. 450 ml bottle , gentian violet solution 30ml bottle , gluteraldehyde solution 2% ( 5 litre can ) , solution , glycerine + sodium chloride enema ( 15% + 15% 20 30 ml / pack ) , enema , glycerine ip 500ml bottle , hand wash solution ( sol.isoprapanol, propanol , mecetronium, skin care additives ) 500 ml bottle , hydrogen peroxide 6% solution ( who gmp certification exempted for this item ) ( 400 ml ) , bottle , liquid paraffin ( 500 ml, bottle ) , solution , povidone iodine 10% , povidone iodine solution 5% ( 500 ml ) , bottle , povidone iodine surgical scrub solution. 7.5% ( 500 ml bottle ) , solution , sodium hypochlorite solution 5% ( 500 ml bottle ) , consumable , solution heparin topical 1000iu / ml ( each ) , 5 ml vial , surface & environmental disinfectant each 100 gm contains: ( 1.6 dihydroxy, 2 5 dioxahexane 11.2 g. glutaraldehyde 5.0 g. benzalkonium chloride ip 5.0 g ) , solution , benzocaine ( 0.36% w / w ) , cetrimide ( 0.50% w / w ) 1 packet ( s ) ( 100 gm spray each ) , saline ( benzalkonium chloride 0.01%w / v + sodium chloride 0.65%w / v ) nasal spray 20 ml , methylcobalamin nasal spray 250 mcg / spray ( 5 ml bottle of nasal spray ) , budesonide nasal spray 32 mcg per spray 120 sprays 8.43 ml nasal spray , fluticasone 50mcg / spray ( 70 120 meter dose nasal ) , spray , lignocaine spray 10% ( 100ml ) , spray , absorbable 2 0 endo suture cartridge 48 length , advance rf energy hand instrument of 5 mm shaft diameter for open procedures with shaft length 14 cm and should be both hand and foot activated. compatible with ultrasonic vessel sealing dissector system installed in myh , advance rf energy hand instrument of 5 mm shaft diameter for laproscopicprocedures with shaft length 35 cm and should be both hand and foot activated. compatible with ultrasonic vessel sealing dissector system installed in myh , disposable circular stapler 25 / 26mm diameter , disposable circular stapler 28 / 29mm diameter , disposable trocar 05mm , disposable trocar 10mm , disposable trocar 12mm , disposable trocar 15mm , disposable circular stapler 31mm diameter , disposable circular stapler – 32mm diameter , disposable circular stapler33mm diameter , disposable circular stapleriii rows , disposable clipapplier medium 10mm with 20 clips , disposable clip applier medium 5mm with 16 clips , disposable curved cutter stapler 1.44 mm , disposable curved cutter stapler 2.0 mm , disposable hemorrhoidal stapler 32 mm , disposable hemorrhoidal stapler iii rows , disposable hemorrhoidal stapler stapler 33 mm diameter with detachable anvil ( staple height 3.5 mm ) , disposable linear stapler with fixed staple height 75mm 90mm size , disposable linear stapler with fixed staple height 55mm 60mm size , disposble skin stapler ( 35 pins high quality medical grade plastic, cartridge with ss rectangular design pins with wire diameter 0.60 mm and size after closure ( 7.2 x 4.3 mm ) , consumable , distal tip closure titanium ligation clip large size , distal tip closure titanium ligation clip medium size , distal tip closure titanium ligation clip small size , endoscopic cutter & stapler60mmregular length , endoscopic cutter & stapler60mmlonglength , endosuturing device 10mm with toggle lever , handpiece ( blue ) compatible with ultrasonic vessel sealing dissector system installed in myh , handpiece ( transducer ) compatible with ultrasonic vessel sealing dissectorinstalled in myh , hemorrhoid stapler 33.5 mm diameter with detachable anvil, bridged anoscope, housing of 20 cc , locking clip cartridge medium / large , mesh fixation device with 15 poly ( lactide co glycolide ) absorbable tacks , mesh fixation device with 30 poly ( lactide co glycolide ) absorbable tacks , mesh fixation device with non absorbable titanium tacks 15mm , mesh fixation device with non absorbable titanium tacks 20mm , mesh fixation device with non absorbable titanium tacks 30mm , multifire clip applier long size 15 clip , multifire clip applier small size 20 clip , non absorbable 2 0 endo suture cartridge 48 length , open clip applicator 100 20cm length , open clip applicator 200 20cm length , open clip applicator 300 20cm length , open clip applicator 400 20cm length , partially absorbable mesh with absorable & semi absorbable sides 15cm x 15cm , partially absorbable mesh with absorable & semi absorbable sides 10cm x 15cm , plastic locking clip applicator medium / large , polycearbonte bladeless trocarwith reducer seal 10mm , polycearbonte bladeless trocarwith reducer seal 12mm , polycearbonte bladeless trocar with reducer seal 5mm , polyproplene with polyglecaprone 25 partially absorbable mesh 10cmx 15cm , polyproplene with polyglecaprone 25 partially absorbable mesh 7.6cmx 15cm , reload 55 60mm for medium thick tissue blue compatible with linear cutter. , reload 55 60mm for thin / vascular tissue white compatible with linear cutter. , reload 75 80mm for medium thick tissue blue compatible with linear cutter. , reload 75 80mm for thick tissue green compatible with linear cutter. , reload compatible with curved cutter 40mmx3.5mm , reload endoscopic cutter & stapler45mm purple , reload endoscopic cutter & stapler60mm purple , reload endoscopic cutter & staplter45mm blue , reload endoscopic cutter & staplter45mm green , reload endoscopic cutter & staplter60mm / black , reload endoscopic cutter & staplter60mm blue , reload endoscopic cutter & staplter60mm gold , reload endoscopic cutter & staplter60mm green , reload endoscopic cutter & staplter60mm white , reload forlinear cutter 55mm 60mm size green , reload forlinear cutter 75mm 80mm size blue , reload forlinear cutter 75mm 80mm size green , reload forlinear cutter 90mm 100 mm size green , reload for linear cutter 55mm 60mm size blue , reload for linear cutter 90mm 100 mm size blue , reload for linear stapler with fixed staple height 35mm 45mm size blue , reload for linear stapler with fixed staple height 35mm 45mm size green , reload for linear stapler with fixed staple height 55mm 60mm size blue , reload for linear stapler with fixed staple height 55mm 60mm size green , reusable laparoscopic clip applicator for large titanium clips with 15cm 20cm length , reusable laparoscopic clip applicator for large titanium clips with non detachable jaw assembly , reusable laparoscopic clip applicator for large titanium clips. , reusable laparoscopic clip applicator for medium large titanium clips with28cm 30 cm length , reusable laparoscopic clip applicator for medium large titanium clips with non detachable jaw assembly , reusable linear cutter 55 60mm with 200 firing , reusable linear cutter 75 80mm with 200 firing , skin staple remover with plastic handle , suture locking autolock , titanium clip 100mm , titanium clip 200mm , titanium clip 300mm , titanium clip 400mm , universal reload cartridge for 55 mm / 75mm new linear cutter for tissue thickness ranging from 1 mm to 2 mm with 6 rows of staples 3 on either side of cut line, 440 grade stainless steel knife integrated in the cartridge , 88 titanium staples / 118 titanium staples. , universal stapler 55mm / 75mm new linear cutter along with staple height selector and 3d staple technology with ambidextrous firing with 6 rows of stapler height range of 1.5 mm to 2.00 m. , hemorrhoid stapler 29 34 mm diameter with detachable anvil, bridged anoscope, housing of 20 cc , 11 cell panels for antibody screening & identification , 1pc pedia stoma kit: colostomy / lleostomy 1pcsystem flat transparent open paediatric stoma bag with spiral adhesive, and clip locking drainage. cutablesize 10 to 35mm 5 pc, c shaped hydrocolide elastic tape with bevelled edges 10 pc, water base gaur gum and alcohol free adhesive paste 60gm 1 pc, contain magnesium citrate, glycerine, petrolatum, citric acid skin barrier cream to maintain 5.5 skin ph 1pc, cmc guar gum and xanthan gum base stoma powder 25gm 1pc, hexamethyldisiloxane cyclonentasiloxane and silicone base adhesive remover spray 1pc, silicon based non alcoholic skin barrier spray contain hexamethyldisiloxane cyclonentasiloxane to avoid residues building up by creating theam breathable film on the skin 50ml, cleanser to clean skin exposed to intestinal secretions consist of isopropyl alcohol, allantoin, natural coconut oil 5 pc , 2.2 mm disposable keratome blade , 3 cell panels for antibody screening & identification , 3d hydrocellular microbicidal, composite dressing anti microbial chronic wound dressing, 3d hydrocellular dressing for exudate and moisture management, non adherent for easy removal size: 10cmx10cm , 3d hydrocellular microbicidal, composite dressing anti microbial chronic wound dressing, 3d hydrocellular dressing for exudate and moisture management, non adherent for easy removal size: 15cmx15cm , 3d hydrocellular microbicidal, composite dressing anti microbial chronic wound dressing, 3d hydrocellular dressing for exudate and moisture management, non adherent for easy removal size: 7.5cmx7.5cm , 3d microbicidal composite dressing broad spectrum anti microbial, transparent water proof dressing, non adherent for easy removal size: 10 x 15 cm , 3d microbicidal composite dressing broad spectrum anti microbial, transparent water proof dressing, non adherent for easy removal size: 10 x 20 cm , 3d microbicidal composite dressing broad spectrum anti microbial, transparent water proof dressing, non adherent for easy removal size: 10 x 25 cm , 3d microbicidal composite dressing broad spectrum anti microbial, transparent water proof dressing, non adherent for easy removal size: 10 x 30 cm , 3d microbicidal composite dressing broad spectrum anti microbial, transparent water proof dressing, non adherent for easy removal size: 10 x 35 cm , 3d microbicidal composite dressing broad spectrum anti microbial, transparent water proof dressing, non adherent for easy removal size: 6 x 7 cm , abdominal belt ( 34 inch each ) , consumable , abdominal drain kit sizes :14fg, 16fg, 20fg, 22fg, 24fg , abdominal drain set 28 no. , abdominal drain set 32 no , absorbable gelatine sponge ( ip 80mm x 50mm x 10mm ) , consumable , absorbent cotton wool ip 500 grms ( each ) roll ( iso:13485:2016 ) , consumable , accessory spikes ( 1x1 pis ) , consumable , adhesive plasters usp 7.5 cm x 10 mts / roll , adult diaper size l ( each ) , consumable , ag ion impregnated central venous double lumen polyurethane catheter, 7.5 fr, g 16x18 length 16cm , ag ion impregnated central venous triple lumen polyurethane catheter, 7.5 fr, g 14x18x18 length 16cm , ag ion impregnated triple lumen catheter for haemodialysis, fr 12, l 15cm, with polyurethan extention tube, flow rate per lumen –320 ml / min , ahmed valve drainage device for glaucoma surgery , air bed mattress ( with complete set ) , consumable , air blanket compatible with bair hugger , alcohal based hand sanitizer ( 500ml bottle with dispenser ) , consumable , ambu bag ( silicon type ) paediatrics each 300 500 ml with oxygen connecting tube, should be supplied with a carry pouch, ambu bag should be complete with required autoclavable valves and other accessories ( should have silicon rubber bellow to withstand autoclave at 134 degree c, should be autoclavable upto 40 times ) , consumable , ambu bag / adult each 1000 1700ml, with oxygen connecting tube , should be supplied with a carry pouch , ambu bag should be complete with required autoclavable valves and other accessories, ( ( should have silicon rubber bellow to withstand autoclave at 134 degree c ) should be multiple times autoclavable ) , consumable , anesthesia kit spinal & epidural with balloon indicator lor syringe type 16g / 25g ( 80mm*113mm / 90mm*123mm ) , 18g / 27g ( 80mm*113mm / 90mm*123mm ) , anterior vitrectomy pack for centurion gold phaco machine , anti bacterial coated double lumen central line paediatric , anti bacterial coated foleys catheter 12f , 14f , anti bacterial coated triple lumen central line adult , antibacterial impregnated evd cathetor evd cathetor set and csf collection bag , antimicrobial , liquid parafin based silver sulphate antiseptic tulle 10cmx12cm , antimicrobial double lumen polyurethane cvc catheter kit with rollerson syringe, fr 3 5, g 18x18, l 15 / 16cm. peadiatric , antimicrobial double lumen polyurethane cvc catheter kit with rollerson syringe, fr 5 7, g 18x18, l 15 / 16cm. , anti microbial gloves sterile disposable latex surgical gloves pre powdered conformity surgical rubber gloves meets all the requirements of international and national std.astm d 3577, en 455, iso 10282 & 13422 standard size available 6 , anti microbial gloves sterile disposable latex surgical gloves pre powdered conformity surgical rubber gloves meets all the requirements of international and national std.astm d 3577, en 455, iso 10282 & 13422 standard size available 6.5 , anti microbial gloves sterile disposable latex surgical gloves pre powdered conformity surgical rubber gloves meets all the requirements of international and national std.astm d 3577, en 455, iso 10282 & 13422 standard size available 7 , anti microbial gloves sterile disposable latex surgical gloves pre powdered conformity surgical rubber gloves meets all the requirements of international and national std.astm d 3577, en 455, iso 10282 & 13422 standard size available 7.5 , anti microbial gloves sterile disposable latex surgical gloves pre powdered conformity surgical rubber gloves meets all the requirements of international and national std.astm d 3577, en 455, iso 10282 & 13422 standard size available 8 , antimicrobial incise drape 3 meter , antimicrobial triple lumen polyurethane cvc catheter kit with rollerson syringe, fr 3 5, g 16*18x18, l 15 / 16cm. peadiatric , antimicrobial triple lumen polyurethane cvc catheter kit with rollerson syringe, fr 5 7, g 16*18x18, l 15 / 16cm. , antimicrobial, liquid paraffin based chlorhexidien antiseptic tulle 10cmx12cm , aquacel dressing size 4x4 / 10cmx10xm , armored cuffed tube made of 100% silicon, radio opaque, should have prefilled stylet mounted connector, piot balloon with universal port. size. fr 2, 2.5, 3, 3.5, 4, 4.5, 5, 5.5, 6, 6.5, 7, 7.5, 8, 8.5, 9 should be fda / ce approved , av blood lines with av pressure transducer ( acceptable for fitting to all standard dialyzer ) with side tubing ( for heparinization and av pressure monitorig ) blood tubing set dialysis , baby diapers small ( 10 diaper per pkt ) , consumable , baby drape sheets , backflush blunt tip needle 23 g , backflush soft tip needle 23 g , backflush soft tip needle 25 g , bandage contact lens , barium sulphate powder susp 95% w / v powder ( hd ) 95% 400gm , bhex ring with forcep ( flexible hexagonal plastic ( polyimide ) ring with 75 micron profile having notches at corner and flanges at sides, size 6.5 mm, providing pupillary expansion 5.5 mm ) , bicanalicular ( jacks on ) lacrimal intubation set , bio flat reel 25cmx200 mtr , bionet machine connector , biopsy forceps type with / without spike / hot biopsy, length : 110cm / 160 cm / 210 cm, sterile for single use only, diameter – 1.8 mm / 2.5 mm as ordered , biopsy gun ( 16 20 gauge ) , consumable , bipap mask size large , bipap mask size medium , bipap mask size small , bipolar cable , bipolar cable 12 ft silicone constellation vitrectomy , bipolar cable 12 ft silicone for centurion gold phaco , bipolar cable 12 ft. silicone , bipolar cord with bipolar electyrocautery pencil , bipolar forceps cable , bipolar forceps su coap.steril , bis monitor electrode , black thread ( stitching ) big , bleaching powder gr ii 25 kg bag , blood administration ( transfussion ) set , blood bag double 350 ml cpd solu , blood bag double 350 ml with sagam , blood bag double 350ml ( as per attached specification ) , each , blood bag quadruple 350 ml top bottom with cpd sagam solu , blood bag quadruple 450 ml top bottom with cpd sagam solu , blood bag single 350 ml , blood bag top to bottom quadruple 450 ml , blood bag transfer 350 ml , blood bag triple 350ml as per attached specification ( each ) , bag , blood bag triple sagam 350ml ( each ) , bag , blood collection tube clot activator with rubber cap 13x75 , blood culture bottle ( glass autoclavable 100ml ) , consumable , blood pressure cuff adult 25cm 40cm , blood pressure cuff pediatric 19cm 27.5cm , blood transfusion set double moldedchamber without airway , blood transfusion set single molded chamber without airway , bone marrow aspiration needles ( 13g ) , bone marrow aspiration needles ( 14g ) , bone marrow aspiration needles ( 15g ) , bone marrow aspiration needles ( 16g ) , bone marrow biopsy needle 13g , bone marrow biopsy needle size 11gx10cm , bone wax sterilised ( 2.5 gm / packet ) , consumable , calcium hypochlorite containing not less than 0.25% w / v of available chlorine buffered with boric acid ( 1:1 ) to a ph of 7.5 8.5 solution , cannula fixer set , carbolic acid 500 ml , cardiovascular angiographic catheter 100cm, 4fr ( 1.35mm ) , c arm cover disposable , catheter double lumen7.7 no , catheter mount ( adult size ) , consumable , catheter mount ( pediatric size ) , consumable , catheter single lumen4.7 no , catheter single lumen6.6 no , catheter single lumen7.7 no , cautery pencil disposable ( each ) , consumable , cautery plate disposable ( each ) , consumable , central line double lumen 16 fr , central line single lumen , central venous catheter 4fr , cerebral catheter reservoir 12mm dia chamber , cerebral catheter reservoir 18mm dia chamber , cerebral catheter reservoir large 18mm diameter chamber , cerebral catheter reservoir small 12mm diameter chamber , cervical collar soft , chemical enzyme based cleaner non ionic, amphoteric surfactants, solvents, complexing agents, amino acid derivative, corrosion inhibitors, anti foaming agent , chest drainage catheter size: fg20 to fg40 , chest drainage catheter size: fg20 to fg40 with trocar , chlorhexidine antiseptic sterile gauze dressing 10 cm x 10 cm ( 10 pouches ) gauze , chlorhexidine gluconate dressing material , circular stapler for end to end anastomosis with 31 mm diameter having varied staple height of 3.5 4 4.5mm , circular stapler for end to end anastomosis with 31 mm diameter having varied staple height of 4 4.5 5mm , circular stapler for end to end anastomosis with 33 mm diameter having varied staple height of 3.5 4 4.5mm , circular stapler for end to end anastomosis with 33 mm diameter having varied staple height of 4 4.5 5mm , cling drape drape size: 15 x 500 cm. , closed suction tracheostomy suction tube with pros , collagen patch , collagen sheet , colostomy kit , combined pack of iol , keratome2.2 / 2.8 mm , sideport blade 1.2 mm, balanced salt solution, viscoat, disposable cassette with 45 degrees flared phacotip with sleeve , iol cartridge , condom catheter , contured titanium mesh for cranioplasty 15x12cm , cord clamp , corrugated drainage sheet , cotton crape bandage 05cm x 4m ( box of 10 bandages ) ( no. ) , consumable , cotton crape bandage 10cm x 4m ( box of 10 bandages ) ( no. ) , consumable , cotton crape bandage 15cm x 4m ( box of 10 bandages ) ( no. ) , consumable , cr system digital film ( size 10x12 ) carestream, consumable , cr system digital film ( size 14x17 ) carestream, consumable , cr system digital film ( size 8x10 ) carestream, consumable , craniotomy cutter blade , craniotomy drape ( 1.6 x 3.2 mtrs ) , craniotomy drape sheet size 2.6x3.6 m, 50gsm , cresol with soap solution ip ( 5 liter jar ) , consumable , cvc line double lumen polyurethane catheter ( flexon material ) with bls introducer and nitinol j guide wire, 7fr, g 16x16 length 15cm , cvc line triple lumen polyurethane catheter ( flexon material ) with bls introducer and nitinol j guide wire, 7.5 fr, g 14x18x18, length 15cm, 20cm ( anti microbial coated ) , cvl dressing07 cm x 8.5 cm for central line , cvl dressing10 cm x 12 cm pad for central line , cvp ( central venous pressure ) manometer , cylinder connection nut , cylinder key , cylinder spanner , d.j. stent ( 3 fr ) , ( 4 fr ) , ( 5 fr ) , ( 6 fr ) , consumable , dermatome blades 50 mm , dialyzers 1.5 / 1.6 multiple use made of polysulphone or polyethersulfone low / middle flux, hi performance dialyser performance enhanced technology with hi biocompatibility housed in medical grade polycarbonate openable ends for easy cleaning caps ( for dialysate inlet utlet for safer storage openable caps ( red and blue ) hi quality sterilisation procedure using gamma radiation and should meetings standards of european ce / iso13485:2003sterlised ) , consumable , diathermy probe 25 g constellation vitrectomy , differential pressure flow sensor for savina 300 drager ventilator , dispoable raney clip strelized pack of 10 nos , disposable c arm cover , disposable camera cover , disposable curved scissor 23 g , disposable endgrasping forcep 23 g , disposable eye drape 120x120 nonwooven precut with drainage pouch , disposable eye drape 70x70 nonwooven precut with drainage pouch , disposable eye shield u / v light protector for infants & neonates. sterile single pack. , disposable haemorrhoidal circular stapler with dual safety with transparent housing size 34 , disposable hiv kit sterile:full gown 1 ( wrap around gown made water ressistant ) ( disposable bag 1, 120x210 cm plain sheet large 1, water proof lagging 1 pair, cap 1, mask 1, sterile rubber gloves 1 pair, goggle 1pc. ) , consumable , disposable ilm forcep 23 g , disposable ilm forcep 25 g , disposable iris retractor , disposable membrane scraper 23 g , disposable membrane scraper 25 g , disposable microscope cover , disposable n 95 mask , disposable needle 18g ( single use ) , disposable needle 18g x 1 1 / 2 ( single use ) , disposable needle 20g ( single use ) , disposable needle 22g ( single use ) , disposable needle 23g ( single use ) , disposable needle 24g ( single use ) , disposable needle no 26g x 1 1 / 2 , disposable needle no 26g x 1 / 2 , disposable paper gloves size 7, 7.5, 8 , disposable perforator with hudson end 12 mm , disposable phaco set for cnturion gold phaco machine , disposable phaco set with phaco tip and sleevefor cnturion gold phaco machine , disposable plastic appron ( full size ) , consumable , disposable plastic apron material 25 microne polyethylene , disposable shoe cover , disposable shunt drepe size 120x210 cm, incise area 70x15 cm , disposable soft tip needle 23 g , disposable spinal needle 18 , disposable spinal needle 22 , disposable spinal needle 23 , disposable spinal needle 24 , disposable spinal needle 25 , disposable sterile gloves bis specification gloves, surgical rubber, made of hypoallergic latex 100%, electronically tested sterilized by gamma irradiatio eto is no:13422:1992 as amended upto , 7 inch / pair ( pair ) , consumable , disposable sterile gloves bis specification gloves, surgical rubber, made of hypoallergic latex 100%, electronically tested sterilized by gamma irradiatio eto is no:13422:1992 as amended upto , 7.5 inch / pair ( pair ) , consumable , disposable sterile gloves bis specification gloves, surgical rubber, made of hypoallergic latex 100%, electronically tested sterilized by gamma irradiatio eto is no:13422:1992 as amended upto , 8 inch / pair ( pair ) , consumable , disposable sterile gloves bis specification gloves, surgical rubber, made of hypoallergic latex 100%, electronically tested sterilized by gamma irradiatio eto is no:13422:1992 as amended upto , 6.5 inch / pair ( pair ) , consumable , disposable sterile gloves isi marked surgical rubber made of hypoallergic latex 100% , electronically tested sterilized by gamma irradiation / eto is no:13422:1992 as amended upto, powder free 7 inch / pair ( pair ) , consumable , disposable sterile gloves isi marked surgical rubber made of hypoallergic latex 100% , electronically tested sterilized by gamma irradiation / eto is no:13422:1992 as amended upto, powder free 8 inch / pair ( pair ) , consumable , disposable sterile gloves isi marked surgical rubber made of hypoallergic latex 100% , electronically tested sterilized by gamma irradiation / eto is no:13422:1992 as amended upto, powder free6.5 inch / pair ( pair ) , consumable , disposable sterile gloves isi marked surgical rubber made of hypoallergic latex 100% , electronically tested sterilized by gamma irradiation / eto is no:13422:1992 as amended upto, powder free7.5 inch / pair ( pair ) , consumable , disposable sterile gown , disposable suction catheter all size , disposable surgeon cap ( box of 100 caps ) , consumable , disposable three layer surgical mask , disposable trolly drape 18x120 cm , disposable trphine 10 , disposable trphine 10.5 , disposable trphine 11 , disposable trphine 11.5 , disposable trphine 12 , disposable trphine 13 , disposable trphine 3 , disposable trphine 6 , disposable trphine 6.5 , disposable trphine 7 , disposable trphine 7.5 , disposable trphine 8 , disposable trphine 8.5 , disposable trphine 9 , disposable trphine 9.5 , disposable wrap around ot gown with 2 nos hand towel , distilled water 5 litre ( each ) , consumable , dj stent / double j stents size 3fr 7fr, 10 26cm , dome valve hydrocephalous shunt system bacterial resistant high pressure , dome valve hydrocephalous shunt system bacterial resistant low pressure , dome valve hydrocephalous shunt system bacterial resistant medium pressure , dome valve hydrocephalous shunt system high pressure , dome valve hydrocephalous shunt system low pressure , dome valve hydrocephalous shunt system medium pressure , double lumen peripherally inserted central venous silicon catheter ( 7fr, 9fr, 11fr, 14fr ) length 90cm, with subcutaneous cuff for long term venous access , double lumen peripherally inserted central venous silicon catheter ( 3fr, 4fr, 4.5fr, 5fr ) length 60cm , drap sheeth 120cm x 210cm sterile , draw sheet ( each ) , consumable , dry collagen patch , non adhesive absorbalbe porus lyophilized fish origin collogen 10x10cm. , dry collagen patch , non adhesive absorbalbe porus lyophilized fish origin collogen 30x30cm. , dura repair patch made of poly propylene non woven extra large 15x20cm , dura repair patch made of poly propylene non woven large 10x12cm , dura repair patch made of poly propylene non woven small 8x10cm , ear buds ( plastic one ) , ear cotton swab ( each ) , consumable , ecg electrodes ( each ) , consumable , ecg paper computerized triple channel 20m , ecg paper roll 210 mm x 20 mtr ( each ) , consumable , ecg paper roll 80 mm x 20 mtr ( each ) , consumable , elastic adhesive bandage 10cm x 4 , elastic adhesive bandage 10cm x 6 , elastomeric pump for post operative analgesia , electrocautery plate , emg ( electromyography ) needle , endo stich lap suturing device 10 mm , endo stitching / suturing instrument, endo suturing instruments for endoscopic suturing and knot tying, with one handed operation along with easy needle transfer between jaws. maximum jaw opening of 19 mm with an option to hold different sutures. should fit through a 10 mm trocar , endocapsular ring ( capsular tensionring ) 11mm , endocapsular ring ( capsular tensionring ) 12mm , endocapsular ring ( capsular tensionring ) 13mm , endoscopic suture product endo stitch 10 mm cartidges, disposable suture loading units for endostitch instrument with sizes of 2 0 endostitch and 2 0 , endotracheal tube cuffed size 3 , endotracheal tube cuffed size 3.5 , endotracheal tube cuffed size 4 , endotracheal tube cuffed size 5 , endotracheal tube cuffed size 6 , endotracheal tube cuffed size 6.5 , endotracheal tube cuffed size 7 , endotracheal tube cuffed size 7.5 , endotracheal tube cuffed size 8 , endotracheal tube cuffed size 8.5 , endotracheal tube cuffed size 9 , endotracheal tube cuffed size 9.5 , endotracheal tube introducer ( bougie ) adult 5 , endotracheal tube with secondary lumen for surfactant therapy, size 2, 2.5, 3, 3.5, 4, 4.5 , endotracheal tubes plain without cuff size 2, 2.5, 3, 3.5, 4, 4.5 , epidural kit ( needle & catheter 16g, ) , epidural kit ( needle & catheter 18g ) , epidural kit ( needle & catheter 19g, ) , epidural needle 16g, 18g ( each ) , consumable , eto chemical indicator , eto gas cartridges , eto tape indicator , examination gloves size large ( 100 pcs / pkt ) , examination gloves size medium ( 100 pcs / pkt ) , examination gloves size small ( 100 pcs / pkt ) , exchange transfusion catheter with four way adaptor size 4 cm, l 40 cm , extarnal lumber cfs drainage system , extarnal ventricular cfs drainage system , extention line ( 10 cm ) , consumable , extention line ( 100 cm ) , consumable , extention line ( 150 cm ) , consumable , extention line ( 200 cm ) , consumable , extention line ( 50 cm ) , consumable , extra ventricular drain ( evd ) , eye shield transperant , feeding tube size 3, 4, 5, 6, 7, 8 , feeding tube size 9, 10, 12, 14 , fibrin glue , films of size 10x12 inches compatible films to dr system ( 10x12 inches ) , prognosys medical systems film , films of size 11x14 inches compatible films to dr system ( 11x14 inches ) , prognosys medical systems film , films of size 14x17 inches compatible films to dr system ( 14x17 inches ) , prognosys medical systems film , films of size 8x10 inches compatible films to dr system ( 8x10 inches ) , prognosys medical systems film , flexo metallic tube no. 6, 6.5, 7, 7.5, 8, 8.5 , flourescein strips , flow sensor for bellavista ventilator , fluorescein strips pkt , foam sclerotherapy fibre , fogarty embolectomy catheter, size: 4fr , fogharty catheter ( size 20 two way ) , consumable , foleys catheter 3 way 22 size , foleys catheter latex based baloon capacity ( 30 50ml ) three way ( a ) fg 16, 18, 20, 22 , foleys catheter size 12 2 way ( 10 each ) , consumable , foleys catheter size 14 2 way , foleys catheter size 16 2 way ( 11 each ) , consumable , foleys catheter size 18 2 way , foleys catheter size 20 2 way ( 12 each ) , consumable , foleys urinary catheter pediatrics ( size 8 10 ) , each , forcep for raney clip , fuji digital film ( size 10x12 ) , consumable , fuji digital film ( size 11x14 ) , consumable , fuji digital film ( size 14x17 ) , consumable , fuji digital film ( size 8x10 ) , consumable , gasket forvaccume jar 1000 ml , gasket forvaccume jar 600 ml , gasket for humidifier bottel , gigli saw wire , glass slide iso mark no 12mm , glass tube 125x150 , glucometer strips pkt ( 50 strip / pkt ) , guedel airway all size soft and smooth , guide wire 0.35 no , guide wire 0.38 no , guide wire 150cm staight tip , guide wire 80cm. , guidewire lengths: 50 cm 0.035? ( 0.89 mm + 0.01 mm ) * / 0.038? ( 0.97 mm + 0.02 mm ) * , h2o2 catridge , halogen bulb holder ( heavy duty ) , hemodialysis fluid for bicarb made ( part a 10 ltr + part b 500gm ) , hernia flat mesh size: 10x15 , hernia flat mesh size: 15x15 , hernia flat mesh size: 15x20 , hernia flat mesh size: 3x5 , hernia flat mesh size: 6x6 , hip u drape * hygiene sheet * adhesive, size 180 x160 , hme filter , humbysknife disposable blade , hydrocephalous shunt system bacterial resistant high pressure , hydrocephalous shunt system bacterial resistant low pressure , hydrocephalous shunt system bacterial resistant medium pressure , hydrocephalous shunt system high pressure , hydrocephalous shunt system low pressure , hydrocephalous shunt system medium pressure , hydrocephalus shunt medium pressur ( vp shunt ) , hyperextension bracemedium size , icd bag 1000 ml with trocar adult size , icd bag 1000 ml with trocar pediatric size , implantable pain port with epidural catheter for long term pain management , impregnated antimicrobial latex two way foleys catheter with silicon coated.it should be impregnated with silver nano particles to prevent catheter associated uti and catheter blockage should have strong drainage funnel, double fixed non return valve for free inflation and deflation. size 14 balloon capacity between 1ml to 30ml, 50ml , impregnated antimicrobial latex two way foleys catheter with silicon coated.it should be impregnated with silver nano particles to prevent catheter associated uti and catheter blockage should have strong drainage funnel, double fixed non return valve for free inflation and deflation. size 16 balloon capacity between 1ml to 30ml, 50ml , impregnated antimicrobial latex two way foleys catheter with silicon coated.it should be impregnated with silver nano particles to prevent catheter associated uti and catheter blockage should have strong drainage funnel, double fixed non return valve for free inflation and deflation. size 18 balloon capacity between 1ml to 30ml, 50ml , impregnated antimicrobial latex two way foleys catheter with silicon coated.it should be impregnated with silver nano particles to prevent catheter associated uti and catheter blockage should have strong drainage funnel, double fixed non return valve for free inflation and deflation. size 20 balloon capacity between 1ml to 30ml, 50ml , impregnated antimicrobial latex two way foleys catheter with silicon coated.it should be impregnated with silver nano particles to prevent catheter associated uti and catheter blockage should have strong drainage funnel, double fixed non return valve for free inflation and deflation. size 22 balloon capacity between 1ml to 30ml, 50ml , impregnated antimicrobial latex two way foleys catheter with silicon coated.it should be impregnated with silver nano particles to prevent catheter associated uti and catheter blockage should have strong drainage funnel, double fixed non return valve for free inflation and deflation. size 24 balloon capacity between 1ml to 30ml, 50ml , impregnated antimicrobial latex two way foleys catheter with silicon coated.it should be impregnated with silver nano particles to prevent catheter associated uti and catheter blockage should have strong drainage funnel, double fixed non return valve for free inflation and deflation. size 26 balloon capacity between 1ml to 30ml, 50ml , infant mucus extractor sterile pvc ( each ) , surgical material , insulin syringe sterile disposable each ( graduation upto 100 units ) 30g needle ( 40 units / ml ( 30 g needle, 40units / ml ) ) , syrings , intraocular lens 14 30d dioptre , intravenous set with airway and needle ( ( adult ) ) , surgical material , intravenous set with airway and needle ( ( pediatric ) ) , surgical material , intrepid i / a tip bent , intrepid i / a tip straight , introducer sheath 0.97mm, 7 fr, ( 2.3mm ) , 11cm , introducer sheath 6fr , iodine drape with frame size 30x25 cm , iodine drape with frame size 35x35 cm , iodine drape with frame size 60x45 cm , iris claw iol ( pmma lens optic size 5 5.5mm overall size 8 9mm without any dialing hole, biconvex ) , iv cannula size with injection valve ( port ) ( 16g ) , consumable , iv cannula size with injection valve ( port ) ( 18g ) , consumable , iv cannula size with injection valve ( port ) ( 20g ) , consumable , iv cannula size with injection valve ( port ) ( 22g ) , consumable , iv cannula size with injection valve ( port ) ( 24g ) , consumable , iv cannula size with injection valve ( port ) ( 26g ) , consumable , iv regulator set ( control drop set each ) , consumable , j r c bag 1 ltr , j r c bag 1.5 ltr , j r c bag 500 ml , j tip 0.035 mm guidewire , jugular catheter ( 12fr ( adult ) ) , consumable , jugular catheter ( 8fr ( pediatric ) ) , consumable , k3 blood vaccutainer ( edta 100 tubes / pkt ) , consumable , k 90 catheter ( each ) , consumable , kellys pad disposable , lamino spinal drape sheet size 1.5x3 m, 50 gsm , laryngeal mask airway ( lma ) ( no. 4 ) , consumable , laryngeal mask airway ( lma ) ( no. 5 ) , consumable , laryngeal mask airway classic size 1, 1.5, 2, 2.5, 3, 4, 5 , laser radial fibre 600 micron and 400 micron , liga clip 200mm, 300mm, 400mm , lissamine green strip , litmus paper strip , liver biopsy gun size 19g , lma reusable pro seal second generation with gastric drain tube and reinforcement airway tube. size 1, 1.5, 2, 2.5, 3, 4, 5. , long length quincke spinal needle for pain management, size – g 22, length – 120mm & 150mm , loop nylon suture black monofilament 1 ( 4.0 metric ) 96 ( 244 cm ) tp 1 65mm 1 / 2c taper , low adherent absorbent wound dressing with a polyester perforated wound contact layer size 50cm 7mtr roll , lung exersizer ( each ) , consumable , mackintosh double colour water proof roll ( 20 meter per roll ) , malecot rubber catheter no 12 , malecot rubber catheter no 16 , malecot rubber catheter no 20 , malecot rubber catheter no 22 , malecot rubber catheter no 24 , medical dry imaging film size 10x12 , medical dry imaging film size 14x17 , medical dry imaging film size 8x10 , megil forcep with stylet adult size 5 set , mesure volume set soft chamber, with bulb latex 110ml , methacrylate based oxygen permeable non adherent 3 dimensional transforming powder dressing size 4 x 4 , micro drip set with bulb latex , micro vitreo retinal blade 20 g , microlaryngeal surgery tube no 5 , microsensor basic kit for icp monitor , mio 1 pc flat base colostomy ki: colostomy / lleostomy 1pc system flat transparent stoma bag with body fit additional elastic adhesive technology ( elastic modulus 0.34 n / mm ) , bag consists one barier foil a oekotex certified and a woven water repellent textile grey colour material. triple layer filter with full circle pre filter and three times fold velcro locking drainage. one side transparent for inspection cutable size 10 to 55mm 5 pc, c shaped hydrocolide elastic tape with bevelled edges 10pc, water base gaur gum and alcohol free adhesive paste 60gm 1 pc, contain magnesium citrate, glycerine, petrolatum, citric acid skin barrier cream to maintain 5.5 skin ph 1pc, cmc guar gum and xanthan gum base stoma powder 25gm 1pc, hexamethyldisiloxane cyclonentasiloxane and silicone base adhesive remover spray 1pc, silicon based non alcoholic skin barrier spray contain hexamethyldisiloxane cyclonentasiloxane to avoid residues building up by creating theam breathable film on the skin 50ml, cleanser to clean skin exposed to intestinal secretions consist of isopropyl alcohol, allantoin, natural coconut oil 5 pc , mio 2pc system convex base colostomy kit: colostomy / lleostomy 60 mm aperture light convex with integrated flex line base plate with body fit technology additional elastic adhesive ( triple layer ) and with 4 ears belt lock 5 pc, woven water repellent textile material neutral grey colour for optimal discretion 60 mm stoma transparent bag consists one barrier foil and a oekotex certified with full circle filter and wave shaped locking with highlighted colour lock button 5 pc, neutral grey colour standard size ostomy belt compatible for bags having 4 ear hooks 1 pc, c shaped hydrocolide elastic tape with bevelled edges 10 pc, waterbase gaur gum and alcohol free adhesive paste 60gm 1 pc. contain magnesium citrate, glycerine, petrolatum, citric acid skin barrier cream to maintain 5.5 skin ph 1pc, cmc guar gum and xanthan gum base stoma powder 25gm 1pc, hexamethyldisiloxane cyclonentasiloxane and silicone base adhesive remover spray 1pc, silicon based non alcoholic skin barrier spray contain hexamethyldisiloxane cyclonentasiloxane to avoid residues bulding up by creating theam breathable film on the skin 50ml, cleanser to clean skin exposed to intestinal secretions consist of lsopropyl alcohol, allantoin, natural coconut oil 5 pc , mio 2pc system convex base colostomy kit: colostomy / lleostomy 70 mm aperture light convex with integrated flex line base plate with body fit technology additional elastic adhesive ( triple layer ) and with 4 ears belt lock 5 pc, woven water repellent textile material neutral grey colour for optimal discretion 60 mm stoma transparent bag consists one barrier foil and a oekotex certified with full circle filter and wave shaped locking with highlighted colour lock button 5 pc, neutral grey colour standard size ostomy belt compatible for bags having 4 ear hooks 1 pc, c shaped hydrocolide elastic tape with bevelled edges 10 pc, waterbase gaur gum and alcohol free adhesive paste 60gm 1 pc. contain magnesium citrate, glycerine, petrolatum, citric acid skin barrier cream to maintain 5.5 skin ph 1pc, cmc guar gum and xanthan gum base stoma powder 25gm 1pc, hexamethyldisiloxane cyclonentasiloxane and silicone base adhesive remover spray 1pc, silicon based non alcoholic skin barrier spray contain hexamethyldisiloxane cyclonentasiloxane to avoid residues bulding up by creating theam breathable film on the skin 50ml, cleanser to clean skin exposed to intestinal secretions consist of lsopropyl alcohol, allantoin, natural coconut oil 5 pc , mio 2pc system convex base urostomy kit: urostomy 50mm 2pc system 6 mm aperture light convex plate with integrated flex line base plate with body fit technology additional elastic adhesive ( triple layer ) and with 4 ears belt lock 5 pc, 50 mm transparent bag, consists one barrier foil and a non woven water repellent textile grey colour material. soft locking drainage. audible click sound locking system with highlighted colour lock button. coupling with wave shaped locking bag. one side transparent for inspection. size 50mm 5 pc, neutral grey colour standard size ostomy belt compatible for bags having4 ear hooks 1pc, c shaped hydrocolide elastic tape with bevelled edges 10 pc, water base gaur gum and alcohol free adhesive paste 60gm 1 pc, contain magnesium citrate, glycerine, petrolatum, citric acid skin barrier cream to maintain 5.5 skin ph 1pc, cmcguar gum andxanthan gum base stoma powder 25gm 1pc, hexamethyldisiloxane cyclonentasiloxane and silicone base adhesive remover spray 1pc, silicon based non alcoholic skin barrier spray contain hexamethyldisiloxane cyclonentasiloxane to avoid residues building up by creating theam breathable film on the skin 50ml, cleanser to clean skin exposed to intestinal secretions consist of isopropyl alcohol, allantoin, natural coconut oil 5 pc , monopolar cautry wire disposable , monopolar electrocautery pencil with cord , mucus extractor with connector for bronchoscope capacity 70 ml , multienzymatic instrument cleaner concentrate with protease, lipase, amylase, cellulase disinfection solution ( 1 litre solution ) , multifocal / trifocal foldable iol , multifunctional mask with the attachment of nebulizer mask, venture mask, oxygen mask, aerosol mask, with 7 oxygen tube.adult and paediatric. , naso pharyngeal airway adult all size , naso pharyngeal airway paediatric all size , natural hydrowxyapatite wirh natural collagen block size 30x15x6mm , natural hydrowxyapatite wirh natural collagen block size 30x15x7mm , natural hydrowxyapatite wirh natural collagen block size 30x15x8mm , nebulization mask kit ( pediatrics ) , consumable , nebulization mask kit ( adult ) , consumable , needle 30g 1 / 2 inch bd , neonatal urine collection and measurement bag 100 ml , nitrile gloves size small / medium / large ( each ) , consumable , non absorbalble surgical suture , sterilised surgical needled suture ( coated braded polyster green ) 45cm oph 5 0 8mm 1 / 4 circle spatulated micropoint double , non oxidized, non regenarated cellulose hemostat 10x10cm , non oxidized, non regenarated cellulose hemostat 5x10cm , non oxidized, non regenarated cellulose hemostat 5x7.5cm , non oxidized, non regenarated cellulose hemostat 8x100cm , non oxidized, non regenarated cellulose hemostat 8x20cm , non rebreathing mask ( oxygen mask with reservoir bag ) , consumable , non sterile surgical rubber gloves 6.5 no. ( pair ) ( made of natural latex micro rough finish for better grip ) , consumable , non sterile surgical rubber gloves 7 no. ( pair ) ( made of natural latex micro rough finish for better grip ) , consumable , non sterile surgical rubber gloves 7.5 no. ( pair ) ( made of natural latex micro rough finish for better grip ) , consumable , ommaya resrvoir small , ommaya reswervoir large , one piece flat colostomy trp bag: one piece flat colostomy bag body fit additional elastic adhesive technology ( elastic modulus 0.34 n / mm ) , bag consists one barrier foil and a oekotex certified water repellent textile neutral grey colour material. triple layer filter with full circle pre filter and three times fold velcro locking drainage. one side transparent. experience of managing stoma care clinic. , open disposable clip applier for medium clip size 9.75 having 20 clips , open linear cutter reload with 3 rows of staple line having varied satple height of 3.5 4 4.5 mm in reload having 60mm length , open linear cutter reload with 3 rows of staple line having varied satple height of 4 4.5 5 mm in reload having 60mm length , open linear cutter stapler compatible with 3 rows of staple line having varied satple height of 3.5 4 4.5 mm in reload having 60mm length , open linear cutter stapler compatible with 3 rows of staple line having varied satple height of 4 4.5 5 mm in reload having 60mm length , ophthalmic mvr blade 20 g , ophthalmic mvr blade 23 g , oxygen adaptor 5 type , oxygen catheter , oxygen connection with flow meter for central line , oxygen connection with flow meter for cylinder , oxygen high pressure hose pipe , oxygen mask adult ( standard size ) , mask , oxygen mask pediatrics ( standard size ) , mask , oxygen penal regulator for oxygen liquied tank ( 1 25 kg ) , oxygen regulator for control penal board ( oxygen pipe line ) , oxygen regulator for jambo cylender , oxygen tailpipe ( flexible metalic ) , p t tubes 3.8% sodium citrate ( prothrombin tube ) , pacing leads 6 fr , paediatric double lumen polyurethan cvc line, 3 fr, l 10cm, 15cm, , paediatric double lumen polyurethane cvp catheter, 4.5 fr, g – 20x20 length – 6cm, 12.5cm , paediatric epidural set ( with 19g needle with matel stylet 22g catheter 0.22 micron epidural catheter andsyringes , paediatric triple lumen polyurethan cvc line with nitinol j guide wire, 4.5 fr, g 20*23*23, l 6cm, 8cm, 10cm, 12.5cm , paper adhesive plaster microporous surgical tape 2inch x 10mt roll , paper adhesive plaster microporous surgical tape 3inch x 10mt roll , paper adhesive plaster microporous surgical tape 4inch x 10mt roll , paper adhesive plaster microporous surgical tape 6inch x 10mt roll , paraffin gauze dressing 10cms x10cms , pec haemostatic patch for post renal dialysis size 5cm x 7cm , pediatric ventilator circuit complete set , peripheral inserted central catheter 4 fr , peripheral inserted central catheter 5 fr , peritonial dialysis catheter 200mm pediatric , peritonial dialysis catheter 280mm adult , peritonial dialysis fluid 1ltr. , pigtail catheter 6 fr ( 150 cm ) , pigtail catheter no 10 , pigtail catheter no 14 , plain sheet material 25 micron thick pe hygiene film size 210x120 cm , plain vial with screw cap size 12x75 , plaster of paris bandage 10 cm x 2.7 mtr / roll ( roll ) , bandage , plaster of paris bandage 15cm x 2.7mtr / roll ( roll ) , bandage , plaster of paris powder ( 1 kg ) , consumable , plastic nozel cap , plastic test tube 3 , post exposure prophylaxis kits ( pep kits ) , presbyopic correcting iol , pressure regulated v p shunt , probe for oxygen , programable valve with variable pressure settings ranges from 30 m h20 to 200 cm h20 and having interval of10 cm h20. should supply ventricular cathetor 14 cm long and distal cathetor 120 cm long , proseal lma ( plma ) size 1, 1.5, 2, 2.5, 3, 4, 5 , pulmonary artery catheter , punctual plug large , punctual plug medium , punctual plug small , pva sheets , radial a catheter , rectified sprit 4.5 ltr. , reinforced epidural wired polyurethane catheter kit with stainless steel needle. size catheter 19g, needle 17g. , reservoir large size , retina laser pack 23 g straight constellation vitrectomy , rose bengal dye strip 500 , ryles tube size 10, 12, 14, 16, 18 , scar free silicon nasal pad , scleral buckle no 276 , scleral buckle no 277 , scleral buckle no. 240 , scleral fixated iol , scrotal support size: ?xl ( 46 52 ) inches adult , self adhering silicon external catheter should be built in band, clear odorless single sterilized pack, 100% latex free. size 25 / 29 / 32 / 36 / 41mm. , semi automatic core biopsy instrument set with 2 throw length of 10 mm and 20 mm in a single device along with a throw length indicator window and a fire ready indicator mark compatible adjustable coaxial and a blunt tip stylet. should be usfda approved 18g*10cm, 18g*16cm & 18g*20cm, 20g*10cm, 20g*16cm , shirmers strip , short catheter with straight / j tip guide wire ( l 20, fr 2, g 22 ) , short pencil point spinal needle g 25 / 22, l 38mm. , should have dual hook for zero migration post deployment should have the option of repositioning after deployment should have dustable twisted wire construction for durability. 20g*107mm , sics kit ( small incision cataract surgery ) , silicon / double nasal prong with universal connector. all sizes , silicon cautery plate , silicon drain tube / chest tube securement device all size , silicon mask size 0, 1, 2, 3, 4 & 5 , silicone foley catheter 2 way 12 fr , silicone foley catheter 2 way 14 fr , silk protein and antimicrobial nano silver based sterile surgicalwound dressing sheet 10 cmx 25 cm , silk protein and antimicrobial nano silver based sterile surgicalwound dressing sheet 20 cmx 25 cm , silk protein and antimicrobial nano silver based sterile surgicalwound dressing sheet 20 cmx 40 cm , silk protein and antimicrobial nano silver based sterile surgical mesh wound dressing 10 cmx 25 cm , silk protein and antimicrobial nano silver based sterile surgical mesh wound dressing 20 cmx 25 cm , silk protein and antimicrobial nano silver based sterile surgical mesh wound dressing 20 cmx 40 cm , silk protein and antimicrobial nano silver based sterile surgical pu foam dressing 10 cmx 10 cm , silk protein and antimicrobial nano silver based sterile surgical pu foam dressing 20 cmx 20cm , silk protein based sterile surgicalwound dressing sheet20 cmx 40 cm , silk protein based sterile surgical pu foam dressing 20cmx20cm , silkolatex nasopharyngeal airway, with adjustable flange and widen end. sterilizedsizes 20, 22, 24, 26, 28, 30, 32, 34, 36 fr , single piece aspheric foldable iol hydrophobic acrylic hydrophobic acrylic, aspheric, single piece foldable, uv absorbing with blue light filter, 13mm length, 6.0mm optic diameter anterior asymmetric biconvex optic, l shape stable force planar haptic 0.04% covalently bonded yellowchromophore refractive index 1.46 1.55 compatible injector system a constant 118 118.8 , single piece hydrophobic acrylic foldable iol uv absorbing posterior chamber iol with haptic 13.0mm, biconvex6.00mm optic, refractive index 1.46 1.55, a constant 118 118.8 , single piece preloaded foldable iol preloaded with 2 2.2mm delivery port and depth guard controlled by tension glide plunger with hydrophobic acrylic foldable, aspheric , single piece , uv absorbing with blue light filter , 13mm length , 6.0mm optic diameter anterior asymmetric biconvex optic, l shape stable force planar haptic, 0.04% covalently bonded yellowchromophore, refractive index 1.46 1.55, us fda approved. a constant 118 118.8 , single use clip applier with 16 clips, 5mm diameter having display counter instrument u shaped clip , skin protective sheet 20mx20m: skin barrier for healthy peristomal skin or risk of skin damage due to badly secretions or skin damage already developed consist of polyethylene, plasticizer, polyamide, artificial resin, cmg, sis ( 20cm20cm ) , soda lime for anesthesia workstation 5kg , soft roll 15cm x 3 meter , spatula for papsmear , spring loaded automatic biopsy gun one handed cocking machanism with non roll handle design. angle sample notch for enhance needle action choice of two firing buttons.should be usfda approved 16g* 10cm, 16g* 16 cm, 18g* 10cm, 18g* 16cm, 18g* 20cm, 18g* 25cm , stellate for e.t. tube , sterilant cold disinfectant for dialysis containing peraetic acid hydrogen peroxide acetic acid 5 ltr. , sterile adhesive iodine drape size: 35x44 cm , sterile adhesive iodine drape size: 45x66 cm , sterile alcohol swabs , sterile disposable syringe 1ml , sterile disposable syringe with needle 2ml , sterile disposable syringe with needle 3 ml , sterile disposable syringe with needle 5ml , sterile gauze swab / pad , sterile hypodermic syringe with needle 10ml , sterile hypodermic syringe with needle 20ml , sterile hypodermic syringe with needle 50ml , sterile leur lock syringe 20ml , sterile leur lock syringe 50ml , sterile luer lock syringe 10 ml , sterile luer lock syringe 5 ml , sterile wet eye wipes , sterlization roll for plasma sterlizer 100 mm , sterlization roll for plasma sterlizer 150 mm , sterlization roll for plasma sterlizer 250 mm , subcutaneous catheter passer adult , subcutaneous catheter passer pediatric , suction pro kit for closed suction of tracheostomy with 12f catheter , supreme lma ( slma ) , surgical blade isi marked, size 11 ( 100 per packet ) , surgical material , surgical blade isi marked, size 15 ( 100 per packet ) , surgical material , surgical blade isi marked, size 22 ( 100 per packet ) , surgical material , surgical blade isi marked, size 24 ( 100 per packet ) , surgical material , surgical eye sponge spear , surgical kitdrape gown , surgical spirit ip ( 500 ml ) , bottle , sutureless dural substitute 4*6 cm , sutureless dural substitute 8*8 cm , t.piece circuit with oxygen tubing set ( complete set ) , tear test strip ( 100 strips in box ) , terumo guide wire m 0.035” 260cm j angled tip , thermometer digital , thomas splint , three piece iol with acrylic optic and pmma heptic acrylic multipiece sterile pcl ( iol / pc ) , 13.0mm length, 6.0mm optic diameter anterior asymmetric biconvex optic, 10 degree haptic, refractive index 1.46 1.55, a constant 118 118.8 , three way foley catheter, 10 fr , three way stop cock , tissue adhesives , titanium curved cranial mesh 100x100mm , titanium curved cranial mesh 120x120mm , titanium curved cranial mesh 120x150mm , titanium curved cranial mesh 120x180mm , titanium curved cranial mesh 60x60mm , titanium curved cranial mesh 60x80mm , titanium mesh for cranioplasty mesh 40x40mm curved , titanium self tapping screw 4 / 5mm , tmt graph paper , tounge depresser wooden , tracheostomy filter ( each ) , consumable , tracheostomy tube cuffed plastic size 5, 5.5, 6, 6.5, 7, 7.5, 8, 8.5 , tracheostomy tube with suction aid size: 8 and 8.5 , transbronchial needle aspiration , transducer set for invasive b.p. , translucent soft polyfilm surgery drape size 120x120 cm, incise area 25x20cm , triway with extention size 10, 50, 100, 150 , t tube size: 10, 12, 14, 16 &18 , turp set , twin nasal cannula adult , twin nasal cannula padiatric , ureteral catheter set , urine collecting bag 2 ltr. , urine collecting bag with urometer 1 ltr. , urine sugar diagnostic stip , vaccum adaptor 5 type , vaccum jar 1000 ml with regulator , vaccum jar 2000 ml with regulator , vaccum pump belt , vaccum pump oil , vaccum regulator , vaporizer , vascular haemostatic pad to stop external bleeding and catheterization site bleeding, chitosin material size 5x5 single pack. sterilized , vdrl rpr test kit , ventilator catheter mount , ventilator circuit , ventilator circuit ( heated wire ) , ventilator circuit ( neonatal ) , ventilator circuit full kit ( tubing+hmf+filter+catheter mount+bacteria filter ) , ventilator mask , ventilator nebulization kit with t piece , ventilator single tubing circuit ( adult ) , vfc ( viscous fluid control ) pack constellation vitrectomy , video camera cable cover length 2.5m width 15cm , vitrectomy set 23 g 10 k valve std total plus constellation vitrectomy , vitrectomy set 25 g 7.5 valve std total plus constellation vitrectomy , water bed , wipes , wound manager: large, diameter 208x297mm self adhesive, with flexible lid, which contain a drain port to remove the effluent from the bag, antireflux valve & inflatable ring which can be filled with air so that the lid should not touch the wound, unique daisy flower shaped base plate for better fit to body contours. one transparent window for easy inspection which can be remove time and again for inspection. the system should contain one transparent marking sheet so as to mark the required shap and size for cutting area 1pc, water base gaur gum and alcohol free adhesive paste 60gm 1 pc, contain magnesium citrate, glycerine, petrolatum, citric acid skin barrier cream to maintain 5.5 skin ph 1pc, cmc guar gum and xanthan gum base stoma powder 25gm 1pc, hexamethyldisiloxane cyclonentasiloxane and silicone base adhesive remover spray 1pc, silicon based non alcoholic skin barrier spray contain hexamethyldisiloxane cyclonentasiloxane to avoid residues building up by creating theam breathable film on the skin 50ml, cleanser to clean skin exposed to intestinal secretions consist of isopropyl alcohol, allantoin, natural coconut oil 5 pc , wound manager: medium, diameter 156x228mm self adhesive, with flexible lid, which contain a drain port to remove the effluent from the bag, antireflux valve & inflatable ring which can be filed with air so that the lid should not touch the wound, unique daisy flower shapedbase plate for better fit to body contours. one transparent windowfor easy inspection which can be remove time and again for inspection. the item should contain one transparent markingsheet so as to mark the required shap and size for cuting area 1pc, water base gaur gum and alcohol free adhesive paste 60gm 1pc, contain magnesium citrate, glycerine, petrolatum, citric acid skin barrier cream to mairntain 5.5 skin ph 1pc. cmc guar gum and xanthan gum base stoma powder 25gm 1pc, hexamethyldisiloxane cyclonentasiloxane and silicone base adhesive remover spray 1pc, silicon based non alcoholic skin barrier spray contain hexamethyldisiloxane cyclonentasiloxane to avoid residues building up by creating theam breathable film on the skin 50ml, cleanser to clean skin exposed to intestinal secretions consist of isopropyl alcohol, allantoin, natural coconut oil 5 pc , wound manager: small, diameter 104x159mm self adhesive, with lexible lid, whichcontain adrain port to remove the effluent from the bag, antirefluxvalve &inflatable ring which can be filled with alr so that the lidshould not touch the wound, unique daisy flower shaped base platefor better fit to body contours, one transparent window for easyinspection which can be remove time and again for inspection. thesystem should contain one transparent marking sheet so as tomark the required shap and size for cutting area 1pc, water basegaur gum and alcohol free adhesive paste 60gm 1 pc, containmagnesium citrate, glycerine, petrolatum, citric acid skin barriercream to maintain 5.5 skin ph 1pc. cmc guar gum and xanthangum base stoma powder 25gm 1pc, hexamethyldisiloxanecyclonentasiloxane and silicone base adhesive remover spray 1pc, silicon based non alcoholic skin barier spray contain hexamethyldisiloxane cyclonentasiloxane to avoid residuesbuilding up by creating theam breathable film on the skin 50ml, cleanser to clean skin exposed to intestinal secretions consist of isopropyl alcohol, allantoin, natural coconut oil 5 pc , wound protector extra small incision size 2 4 cm , wound protector large incision size 9 14 cm , wound protector large incision size 9 14 cm with retraction ring , wound protector medium incision size 5 9 cm , wound protector small incision size 2.5 6 cm , wound suctionset no 11 / 12 / 14 / 16 / 18 , x ray cassets ( 10x12 ) , consumable , x ray cassets ( 12x15 ) , consumable , x ray cassets ( 8x10 ) , consumable , x ray developer ( 22.5 ltr ) , consumable , x ray film fixer ( powder to make 22.5 liters pkt ) , consumable , x ray film ( blue sensitivity ) 50 sheet packet ( size 10x12 ) , consumable , x ray film ( blue sensitivity ) 50 sheet packet ( size 12x15 ) , consumable , x ray film ( blue sensitivity ) 50 sheet packet ( size 8x10 ) , consumable , x ray hangers ( clip type ) size 10x12 , x ray hangers ( clip type ) size 12x15 , x ray hangers ( clip type ) size 8x10 , x ray screen high speed size 12x15 , x ray screen high speed size 8x10 , x rayscreen high speed size 10x12 , y connector with extra long ventricular catheter , yankauer suction catheter ( complet set ) , 180 absorbablepolyglyconate knotless wound closure device with unidirectional 1 0 30cm, green 37mm 1 / 2 circle taper point , 180 absorbablepolyglyconate knotless wound closure device with unidirectional 2 0 30cm, green 37mm 1 / 2 circle taper point , 20g round body cutting needle 1 / 2 circle , 3 dimentional polyester mesh with micro porosity, x stich macro porosicty and multidirectional elasticity with optimesed atello collagen 1 absorbable anti adhesive barrier 12cm , 3 dimentional polyester mesh with micro porosity, x stich macro porosicty and multidirectional elasticity with optimesed atello collagen 1 absorbable anti adhesive barrier 15cm , 3 dimentional polyester mesh with micro porosity, x stich macro porosicty and multidirectional elasticity with optimesed atello collagen 1 absorbable anti adhesive barrier 20cm , 5 mm helical shaped non absorbable titanium tacker for laproscopic mesh fixation device with 30 tacks , 5 mm screw shaped polyglycolic lactic acid absorbable tacker for laproscopic mesh fixation fevice with min 30 tacks , absorbable adhesion barrier in the form of off white knitted fabric prepared by oxidized regenerated cellulose indicated for both open and laparoscopic procedures , absorbable gelatin based topical absorbable flowable hemostat with 6cc syringe pre filled with hemostatic matrix. with 14.3 cm white applicator tip & 14.6 cm blue flexible applicator tip , absorbable intraperitoneal umbilical patch of polyester mesh with collagen barrier and having absorbable pgla expanders with size 6 cm circle fda approved , absorbable intraperitoneal umbilical patch of polyester mesh with collagen barrier and having absorbable pgla expanders with size 8 cm circle fda approved , absorbable polycryl suture 7 0 3 / 8 circle spatulated micropoint needle polyglactin 910 usp , absorbable surgical suture ( synthetic ) sterilised surgicalneedled suture ( monofilament polydioxanone violet ) 70cm , absorbable unidirectional barbed devicepolydioxanone size 1, 40 mm 1 / 2 circle taper point needle 45 cm , absorbable unidirectional barbed device symmetric anchoring pattern, triclosan coated polydioxanone size 1, 40 mm 1 / 2 circle taper point needle 45 cm , absorbable unidirectional barbed device, symmetric anchoring pattern, triclosan coated polydioxanone, size 1, 36mm 1 / 2 circle taper point needle, 45 cm , black braided silk eyeless needled suture usp, size 8 0 suture length 76cm, needlelength & description 3 / 8 circle round bodied 30mm , black braided silk eyeless needled suture usp, code 5036 size 2 0 suture length in cm 76cm, needle length & description 3 / 8 circle reverse cutting 45mm , black braided silk eyeless needled suture usp, code 5082 size 4 0 suture length76cm, needle length & description 3 / 8 circle round bodied 16mm , black braided silk eyeless needled suture usp, code 5333 size 2 0 suture length 76cm, needle length & description 1 / 2 circle round bodied 30mm , blackbraided silk eyeless needled suture usp, size 5 0 suturelength 76cm, needlelength & description 1 / 2 circle round bodied 30mm , blackbraided silk eyeless needled suture usp, size 6 0 suturelength 76cm, needlelength & description 1 / 2 circle round bodied 30mm , blackbraided silk eyeless needled suture usp, code 5049 size 4 0 suturelength 76cm, needlelength & description 1 / 2 circle round bodied 16mm , blackbraided silk eyeless needled suture usp, code 5070 size 3 0 suturelength 76cm, needlelength & description 1 / 2 circle round bodied 25mm , blackbraided silk eyeless needled suture usp, code 5087 size 3 0 suture length76cm, needle length & description 1 / 2 circle round bodied 20mm , blackbraided silk eyeless needled suture usp, code 5334 size 1 0 suturelength 76cm, needlelength & description 1 / 2 circle round bodied 30mm , bovine collagen and glycosaminoglycan ( chondroitin 6 sulfate ) and silicone layer ( bilayer ) dermal regeneration template 2 in x 2 in , bovine collagen and glycosaminoglycan ( chondroitin 6 sulfate ) and silicone layer ( bilayer ) dermal regeneration template 4 in x 10 in , bovine collagen and glycosaminoglycan ( chondroitin 6 sulfate ) and silicone layer ( bilayer ) dermal regeneration template 4 in x 5 in , bovine collagen and glycosaminoglycan ( chondroitin 6 sulfate ) and silicone layer ( bilayer mashed ) mashed dermal regeneration template 2 in x 2 in , bovine collagen and glycosaminoglycan ( chondroitin 6 sulfate ) and silicone layer ( bilayer mashed ) mashed dermal regeneration template 4 in x 10 in , bovine collagen and glycosaminoglycan ( chondroitin 6 sulfate ) and silicone layer ( bilayer mashed ) mashed dermal regeneration template 4 in x 5 in , braided synthetic absorbable eyeless needled suture usp code 2423, size 1 0 suture ( os ) , braided synthetic absorbable eyeless needled suture uspbraided ab. suture 6 0 rc 1 / 4 circle 45cm needle 8 mm , braided synthetic absorbable polyglactin 910 eyeless needled suture size 6 0 round body needle , braided synthetic absorbable polyglactin 910 eyeless needled suture usp code 2341, size 2 0 suture length in 70cm 1 / 2 circle round bodied 30mm , braided synthetic absorbable polyglactin 910 eyeless needled suture usp code 2346, size 1 0 suture length in 90cm 1 / 2 circle40mm heave , braided synthetic absorbable polyglactin 910 eyeless needled suture usp code 2347, size 1 suture length in 90cm 1 / 2 circle40mm heave , braided synthetic absorbable polyglactin 910 eyeless needled suture usp code 2421, size 1 suture length in 90cm 1 / 2 circle rc 40mm os needle , braided synthetic absorbable polyglactin 910 eyeless needled suture usp code 2534, size 1 0 suture 90cms, 1 / 2 circle rc 36mm, os6 needle , coated braided polyglctin 910 with triclosan coating sut. ) with 1 / 2 cir rb needle 20mm length 75cm size 3 / 0. , coated braided polyglctin 910 with triclosan coating sut. ) with 1 / 2 cir rb needle 30mm length 100cm size 2 / 0. , coated braided polyglctin 910 with triclosan coating sut. ) with 1 / 2 cir rb needle 36mm length 90cm size 3 / 0 , coated braided polyglctin 910 with triclosan coating sut. ) with 1 / 2 cir rb needle 40mm length 100cm size 1 , coated braided polyglctin 910 with triclosan coating sut. ) with 1 / 2 cir rb needle 40mm length 100cm size 1 / 0 , complete absorbable mesh fixation device with minimum strap length 7.0 mm2 point fixation to hold the mesh and device with 25 tacks only. , copolymer of glycolied and e caprolactone, 1 0 ct 1 needle and 45cm suture length unidirectional spiral. , copolymer of glycolied and e caprolactone, 2 0 ct 1 needle and 45cm suture length unidirectional spiral. , copolymer of glycolied and e caprolactone, 3 0 rb 1 needle and 20cm suture length unidirectional spiral. , copolymer of glycolied and e caprolactone, 3 0 rb 1 needle and 45cm suture length unidirectional spiral. , disposable sterile perforator 14mm , knotless wound closure device with unidirectional 2 0 45cm, undyed24mm3 / 8 circlereverse cutting , knotless wound closure device with unidirectional 3 0 58cm, undyed24mm3 / 8 circlereverse cutting , macro porus partially absorbable mesh made up of approximately equal parts of polypropylene monofilament fiber ( 6 0 ) and poliglecaprone 25 monofilament fiber ( 5 0 ) with pore size 2.7 mm having a weight of 39 g / m2 and containing blue orientation stripes of polypropylene. 15cmx15cm , monofilament glycomer0, 90cm, violet40mm1 / 2 circletaper point , monofilament glycomer1, 90cm, violet 40mm 1 / 2 circle taper point , monofilament glycomer2 0 , 75cm, violet27mm1 / 2 circletaper point , monofilament glycomer3 0 75cm, undyed24mm3 / 8 circle reverse cutting , monofilament glycomer3 0 75cm, violet22mm1 / 2 circletaper point , non absorbable 4 0 polyester green braided 76cm , non absorbable pre shaped polypropylene mesh large size , non absorbable pre shaped polypropylene mesh medium size , non absorbable pre shaped polypropylene mesh small size , non absorbable prolene suture 6 0 polypropylene blue monofilament 3 / 8 round body needle 60cm , non absorbable surgical suture polypropylene 5 0 suture with reverse cutting needle 3 / 8 circle, 13.1mm, blue monofilament for scleral buckle , non absorbable surgical suture usp sterilised surgical suture ( braided silk black ) 38 cm 6 0 ( 0.7 metric ) 8mm 1 / 4 circle reverse cutting micropoint , non absorbable surgical suture usp sterilised surgical suture ( braided silk black ) 90 cm 5 0 ( 1 metric ) 12mm 3 / 8 circle reverse cutting , non absorbable suture polyester green 4 0 suture with 8mm 1 / 4 circle round body micropoint needle , non absorbable suture polyester green 4 0 suture with 8mm 1 / 4 circle spatulated micropoint needle , non absorbalble surgical suture usp sterilised surgical needled suture ( braided silk black ) 2 0 ( 3 metric ) 30mm 1 / 2 circle reverse body 90cm , non absorbalble surgical suture usp sterilised surgical needled suture ( braided silk black ) 2 0 ( 3 metric ) 30mm 1 / 2 circle round bodied 90cm , non absorbalble surgical suture usp sterilised surgical needled suture ( braided silk black ) 5 0 ( 3 metric ) 30mm 1 / 2 circle reverse body 90cm , oxidized regenerated cellulose ( absorbable hemostat fibrillar ) 1 in x 2 in ( 2.5cm x 5.1cm ) , oxidized regenerated cellulose based topical absorbable hemostar thicker weave 4x8 , oxidized regenerated cellulose based topical absorbable hemostat, fibrillar / layer form, with bactericidal property. fibril material ( 7layers ) for broad surface area coverage. size 2x4 inch , oxidized regenerated cellulose based topical absorbable hemostat, structured non wovenmaterial, with bactericidal property. ease of use in both open and minimally invasive procedures. size 2x4 inch , oxidized regenerated cellulose based topical absorbable hemostat, structured non wovenmaterial, with bactericidal property. ease of use in both open and minimally invasive procedures. size 4x4 inch , oxldlzed regenerated cellulose; rayon fiberas per us phrmcopela standards enforceable by us fda with bactericidal property 2x3 , oxldlzed regenerated cellulose; rayon fiber as per us phrmcopela standards enforceable by us fda with bactericidal property 3x4 , patient return electrode with current limiting nature & hence eliminate patient pad site burns based on capacitive coupling principle & made of akton polymer can be used for all patient’s weight >350 grams, radiolucent & latex free, no adhesive related irritation to patient skin.can be used any side up for easy handling in or andus fda approved compatible to any electrosurgical generator, size: 36” l x 20”w x 1 / 8”thickness. , pigtail catheter with needle length: 30cms size: 10fr, 12fr., 14fr, 16fr, 18fr , pistol grip curved coagulating shears with ergonomic handle in the following shaft length 36cm. can seal blood vessel up to and including 5mm in diameter compatible with ultrasonic vessel sealing dissector system , poliglecaprone 25 undyed 3 0, 3 / 8 circle reverse cutting26mm 70cm. , polyamide black size 10 / 0 3 / 8 circle spachula needle 6mm , polyamide black size 8 / 0 3 / 8 circle revers cutting needl 6mm , polydioxanone122cm, no 1 size loop sgle with 65 mm needle and 1 / 2 circle tp needle. , polydioxanone150cm usp1 0 rb ctx, 1 / 2 circle, 48mm , polydioxanone suture violet monofilament 1 ( 4.0 metric ) 96 ( 244 cm ) tp 1 65mm 1 / 2c taper , polydioxanone suture violet monofilament 2 0 ( 3.0 metric ) 27 ( 70 cm ) double armed trocar point stp 10 ( 10 ) needle straight 254mm , polydioxanone suture violet monofilament 3 0 ( 2.0 metric ) 36 90cm sh 26mm 1 / 2c taper , polydioxanone suture violet monofilament 4 ( 1.5 metric ) 36 90cm v 5 17mm 1 / 2c taper , polydioxanone suture violet monofilament 4 0 ( 1.5 metric ) 36 90cm v 5 17mm 1 / 2c taper , polyester suture no. 2 x 100 45mm hc tc , polyester suture no. 5 x 75 55mm hc tc , polyglactin 910 1 x 100 45mm hc rb , polyglactin 910 fast und 0 x 110 40mm hc rb , polyglactin 910 fast und 2 0 x 100 36mm hc rb , polyglactin 910 suture violet braided 4 0 ( 1.5 metric ) 18 ( 45cm ) tf 13mm 1 / 2c taper , polyglactin 910 with triclosan no. 0 x 90 36mm hc rb , polyglactin 910 with triclosan no. 0 x 90 40mm hc rb , polyglactin 910 with triclosan no. 1 x 100 55mm hc rb , polyglactin 910 with triclosan no. 1 x 90 36mm hc tc , polyglactin 910 with triclosan no. 1 x 90 40mm hc rb , polyglactin 910 with triclosan no. 1 x 90 40mm hc rc , polyglactin 910 with triclosan no. 2 x 90 40mm hc rb , polyglactin 910 with triclosan no. 2 x 90 40mm hc rc , polyglactin 910 with triclosan no. 2 0 x 90 30mm hc rb , polyglactin 910 with triclosan no. 2 0 x 90 40mm hc rb , polyglactin 910 with triclosan no. 3 0 x 90 20mm hc rb , polyglactin 910 with triclosan no. 3 0 x 90 36mm hc tc , polyglactin 910 with triclosan no. 4 0 x 70 20mm hc rb , polyglactin 910 with triclosan no. 5 0 x 45 16mm hc rb , polyglactin 910 with triclosan no.1 0x 90 36mm hc rc , polyglactin 910 with triclosan no.1 0x 90 40mm hc rb , polyglactin 910 with triclosan no.1 0x 90 40mm hc tc , polyglycolic acid no. 1 x 180 50 / 40mm cu rb hc tc dn , polypropylene 6 0x60 10mm hcrb dntp3 , polypropylene 7 0x60 09mm hcrb dntp3 , polypropylene 9 0 suture double arm reverse cutting straight needle color blue 8in , polypropylene blue monofilament p 3 13mm 3 / 8c reverse cutting 6 0 ( 0.7 metric ) 18 ( 45cm ) , polypropylene clear monofilament non absorbable cp 2 reverse cutting 1 / 2 circle 26mm 1 0 ( 4.0 metric ) 14cmx14cm bi directional, suture , polyster braided1 / 2 circle tapercut double needle with 17 mm needle and suture lenght 90cm , progrip self fixating mesh 12*08cm , progrip self fixating mesh 14*9cm , progrip self fixating mesh 15*15cm , progrip self fixating mesh 20*15cm , progrip self fixating mesh 30*15cm , protective disk with chg hydrophilic polyurethane absorptive foam with 92 g chlorhexidine gluconate ( chg ) 1 disk ( 2.5 cm ) 7mm center hole with radial slit usfda approved , protective disk with chg hydrophilic polyurethane absorptive foam with 92 g chlorhexidine gluconate ( chg ) 1 disk ( 2.5 cm ) 4.0 mm center hole with radial slit usfda approved , scissor grip curved coagulating shears with curved tapered tip for precise dissection and with 240 degree activation triggers that support multiple hand position in the following shaft length 17cm. can seal blood vessels up to & including 5mm in diameter with ultrasonic vessel sealing dissector . , self grippingpolyester / polypropylene monofilament mesh pre cut with pla grips with size 14 x 09 cm for left side , fda approved , self grippingpolyester / polypropylene monofilament mesh pre cut with pla grips with size 14 x 09 cm for right side, fda approved , self grippingpolyester / polypropylene monofilament mesh pre cut with pla grips with size 12 x 08 cm for left side, fda approved , self gripping polyester / polypropylene monofilament mesh pre cut with pla grips with size 12 x 08 cm for right side, fda approved , sterlizedabsorbable eyeless needled suture usp, code 2341, size 2 0 suture length in cm 70cm needle length & description 1 / 2 circle round bodied 30mm , sterlizedabsorbable eyeless needled suture usp, code 2345, size 2 0 suture length in cm 70cm needle length & description 1 / 2 circle round bodied 40mm , sterlizedabsorbableeyeless needled suture usp, code 2304, size 4 0 suture length in cm 70cm needle length & description 1 / 2 circle round bodied 20mm , sterlizedabsorbableeyeless needled suture usp, code 2317, size 2 0 suture length in cm 90cm needle length & description 1 / 2 circle round 30mm , sterlizedabsorbableeyeless needled suture usp, code 2437, size 3 0 suture length in cm 70cm needle length & description 1 / 2 circle round bodied 20mm , sterlizedabsorbable polyglycolic acid eyeless needled suture usp, code 2303, size 5 0 suture length in cm 45cm needle length & description 1 / 2 circle round bodied 16mm , sterlizedabsorbable polyglycolic acid eyeless needled suture usp, code 2442, size 5 0 suture length in cm 45cm needle length & description 3 / 8 circle cutting 16mm , sterlized monofilament polyamide eyeless needled suture usp, code 3318, size 4 0 suture length in cm 70cm needle length & description 3 / 8 circlecutting cutting 16mm , sterlized monofilament polyamide eyeless needled suture usp, code 3328, size 3 0 suture length in cm 70cm needle length & description 3 / 8 circlereverse cutting cutting 26mm , sterlized monofilament polyamide eyeless needled suture usp, code 3336, size 2 0 suture length in cm 70cm needle length & description 3 / 8 circlereverse cutting cutting 45mm , sterlized monofilament polyamide eyeless needled suture usp, code 3347, size 1 suture length in cm 100cm needle length & description 1 / 2 circleround bodied 40mm heavy , sterlized monofilament polyamide eyeless needled suture usp, code 7003, size 10 0 suture length in cm 30cm needle length & description 3 / 8 circledouble arm 6mm heavy , sterlized monofilament polyamide eyeless needled suture usp, code 3317, size 5 0 suture length in cm 70cm needle length & description 3 / 8 circle reverse cutting cutting 12mm , sterlized monofilament polyamide eyeless needled suture uspsize 6 0 suture length in cm 70cm needle length & description 3 / 8 circle reverse cutting cutting 12mm , sterlized monofilament polypropyleneeyeless needled suture usp, code 829, size 6 0 suture length in cm 70cm needle length & description 3 / 8 circle round bodied 13mm double armed. , sterlized monofilament polypropyleneeyeless needled suture usp, code 841, size 2 0 suture length in cm 70cm needle length & description 1 / 2 circle round bodied 30mm , sterlized monofilament polypropyleneeyeless needled suture usp, code 842, size 1 0 suture length in cm 70cm needle length & description 1 / 2 circle round bodied 30mm , sterlized monofilament polypropylene eyeless needled suture usp, code 823, size 6 0 suture length in cm 70cm needle length & description 3 / 8 circle slim blade cutting 15mm. , sterlized monofilament polypropylene eyeless needled suture usp, code 843, size 1 suture length in cm 70cm needle length & description 1 / 2 circle round bodied 40mm heavy , sterlized monofilament polypropylene eyeless needled suture usp, code 849, size 4 0 suture length in cm 70cm needle length & description 1 / 2 circle round bodied 16mm , sterlized monofilament polypropylene eyeless needled suture usp, code 870, size 4 0 suture length in cm 70cm needle length & description 3 / 8 circle cutting 16mm , sterlized monofilament polypropylene eyeless needled suture usp, code 881, size 5 0 suture length in cm 70cm needle length & description 3 / 8 circle round bodied 16mm. , sterlized monofilament polypropylene eyeless needled suture usp, code 882, size 5 0 suture length in cm 70cm needle length & description 3 / 8 circle round bodied 16mm.double 16mm armed , sterlized surgical chromic gutsutue eyeless needied usp, code 4201, size3 / 0, suture length in cm 76cm, needle length & description 3 / 8 circle cutting 22mm. , sterlized surgical chromic gutsutue eyeless needied usp, code 4216, size2 / 0, suture length in cm 76cm, needle length & description 3 / 8 circle round bodied 30mm. , sterlized surgical chromic gutsutue eyeless needied usp, code 4217, size1 / 0, suture length in cm 76cm, needle length & description 3 / 8 circle round bodied 30mm. , sterlized surgical chromic gutsutue eyeless needied usp, code 4221, size1 / 0, suture length in cm 76cm, needle length & description 3 / 8 circle round bodied 40mm. , sterlized surgical chromic gutsutue eyeless needied usp, code 4227, size 1, suture length in cm 100cm needle length & descriptio 1 / 2 circle round bodied 45mm heavy. , sterlized surgical chromic gutsutue eyeless needied usp, code 4237, size3 / 0, suture length in cm 76cm, needle length & description 1 / 2 circle round bodied 20mm. , sterlized surgical chromic gutsutue eyeless needied usp, code 4259, size1, suture length in cm 76cm, needle length & description 1 / 2 circle round bodied 40mm heavy. , sterlized surgical chromic gutsutue eyeless needied usp, code 4268, size5 / 0, suture length in cm 76cm, needle length & description 3 / 8 circle reverse cutting 12mm. , surgical silk bradedsterile foilover wrappack code 213 size 2 0 suture length in 2 x 75cm , surgical silk bradedsterile foilover wrappack code 214 size 1 0 suture length in 2 x 75cm , surgical silk bradedsterile foilover wrappack code 215 size 1 suture length in 2 x 75cm , suture dyed polyester poly ( p dioxxanone ) 1 0, 24x4cm, 1 / 2 circle 36mm rb 20 anchors / inch bidirctional. , synthetic absorbable surgical suturetriclosancoated violet monofilament polydioxanone suture with 70 cm size 2 0 with 1 / 2 circle taper point sh, 25mm to 26 mm needle usfda approved , synthetic absorbable surgical suture , polyglactin 910 with triclosan coated, undyed 3 0, 3 / 8 circle cutting ps1 prime, multi pass ethalloy, 24mm, 70 cm undyed , synthetic absorbable surgical suture , polyglactin 910 with triclosan coated undyed 2 0, 1 / 2 circle round body taper point ct 1 36 mm , 90 cm undyed , synthetic absorbable surgical suture triclosan coated monofilament poliglecaprone 25 suture, length 70 cm, size 2 0 with 3 / 8 circle oval round body visi black jb needle 26 mm , synthetic absorbable surgical suture triclosan coated violet monofilament polydioxanone suture with 90 cm size 1 with 1 / 2 circle taper point ct 1 40 mm needle usfda approved , synthetic absorbable surgical suture, polyglactin 910 with triclosan coated undyed1, 1 / 2 circle round body taper point ct 1 36mm, 90cm undyed. , transducer with unlimited counts compatible with ultrasonic vessel sealing dissector system , triclosan antibacterial coated polyglactin with 23 mm needle suture length 70cm, reverse cutting portt heavy needle size 1 no. , v shape clip applicators large , v shape clip applicators medium , v shape clip applicators medium large , v shape clip applicators small , v shape ligation clip large , v shape ligation clip medium , v shape ligation clip medium large , v shape ligation clip small , aciclovir 200mg / 5ml oral suspension 100ml bottle , albendazole suspension 200mg / 5ml ( 10 ml bottle ) , syrup , ambroxol hcl 15mg+terbutaline sulphate 1.25mg+guaiphenesin 50mg 5ml ( ( additional composition of menthol also acceptable ) 100ml bottle ) , syrup , ammonium chloride+ diphenhydramine+sodium citrate+menthol ( 138mg+14.08mg+57.03mg+2.5mg each 5ml cough syrup ) 100 ml, syrup , amoxicillin and clavulanic acid i.p. ( 200+28.5mg ( 30 ml bottle ) ) , syrup , amoxicillin ( 125 mg / 5ml ( 30 ml bottle ) ) , suspension , azithromycin ( 200mg / 5ml ( 15 ml bottle ) ) , syrup , baclofen 5 mg / 5ml ( 100 ml bottle ) , bromhexine hcl 4 mg+ guaiphensin 50 mg + terbutaline sulphate 1.25 mg / 5ml syp ( 100 ml bottle ) , syrup , calcium carbonate 625 mg, vitamin d3 125 iu / 5 ml ( 100 ml syrup ) , syrup , calcium phosphate ( 2 : 1 ratio ( 100 ml bottle ) ) , syrup ( each 5 ml contains : calcium 82 mg + vitamin d3 ( cholecalciferol ) 200 iu + vitamin b12 ( cynocobalamin ) 2.5 mcg ) , syrup , carbamazepine 100 mg / 5 ml oral suspension 100ml bottle , cefixime oral suspension ( 100 mg / 5 ml ( 30 ml bottle ) ) , suspension , cetirizine ( 5mg / 5ml ( 60 ml bottle ) ) , syrup , chloramphenicol 125 mg / 5ml 60ml syrup , chloroquine phosphate suspension equivalent to chloroquine ( 50mg / 5ml ( 60 ml bottle ) ) , suspension , ciprofloxacin 125mg / 5ml syp 60 ml bottle , co trimoxazole oral suspension i.p. 50 ml bottle , cyanocobalamin 7.5 mcg+ferrous ammonium citrate 160 mg+folic acid 0.5 mg / 10ml 200ml bottle , cyclosporine oran solution usp 100mg / ml 50 ml bottle, syrup , cyproheptadine hcl + tricholine citrate ( 2mg + 275 mg / 5 ml ( 200ml bottle ) ) , syrup , cyproheptadine hcl l lysine multivitamin syrup 200 ml syrup , dextromethorphan 10mg / 5ml ( 100ml bottle ) , syrup , disodium hydrogen citrate 1.25gm / 5ml 100 ml ( 100 ml ) , syrup , domperidone suspension 1mg / ml ( 30ml bottle ) , suspension , etiophylline +theophylline ( ( 46.5+14 ) mg / 5ml ( 100 ml bottle ) ) , syrup , glycerin ( glycerol ) oral liquid ip ( 100 ml bottle ) , ibuprofen 100mg + paracetamol 125mg per 5 ml syrup ( 60 ml bottle ) , syrup , ibuprofen syrup 100mg / 5ml ( 60 ml bottle ) , syrup , iron 40 mg, ammonium citrate 200 mg, cyanocobalamin 7.5 mg, folic acid 0.5 mg, zinc sulphate 7 mg ( per 5ml ) ( iron syrup 200 ml ) , bottle , lactulose ( 10gm / 15ml ( 100 ml bottle ) ) , solution , levetiracetam 100mg / ml syrup / solution ( 100ml bottle ) , syrup , magnesium hydroxide + aluminium hydroxide simethecon 250 mg + 250 mg + 50 mg / 5 ml 170 ml bottle ( syrup ) , syrup , metronidazole oral suspension ( 200 mg / 5ml ( 60 ml bottle ) ) , suspension , milk of magnesia+liquid paraffin 11.25ml+3.75ml ) 15ml ) , syrup ( 200ml bottle ) , syrup , multivitamin multimineral with antioxidant ( ascorbic acid 40 mg+cyanocobalamin 1 mcg+d panthenol 5 mg+folic acid 0.1 mg+l isoleucine 6.195 mg+l leucine 19.21 mg+l lysine 26.25 mg+l phenylalanine 5.25 mg+l threonine 4.41 mg+l valine 7.035 mg+methionine 9.66 mg+niacinamide 12 mg+pyridoxine 1.5 mg+riboflavine 1.1 mg+thiamine mononitrate 1 mg+tryptophan 5.25 mg / 15ml ) 200 ml syrup , nitazoxanide ( 100mg / 5ml ) 30 ml bottle , norfloxacin suspension ( 100 mg / 5 ml 30ml syrup ) , syrup , ofloxacin suspension 50mg / 5 ml ( 60 ml bottle ) , suspension , omega 3 fatty acid with vitamin d3 emulsion 150 ml bottle , ondansetron ( 2mg / 5ml 30ml bottle ) , syrup , paracetamol 150 mg / ml ( 15 ml bottle with dropper ) , drop , paracetamol syrup / suspension 125 mg / 5ml ( 60ml bottle ) ( syrup ) , syrup , phenobarbitone ( 20 mg / 5ml 100 ml bottle ) , syrup , phenytoin sodium oral suspension 30mg / 5ml 100 ml bottle , potassium chloride oral solution 100mg / ml ( 200ml bottle ) , bottle , prednisolone 5 mg / 5ml 60 ml syrup , salbutamol sulphate ( 2mg / 5ml 60ml ) ( 60ml bottle ) , syrup , sodium valproate oral solution ( 200 mg / 5 ml ) 200 ml bottle, solution , sodium valproate oral solution ( 200 mg / 5 ml ) , solution 100ml syrup , sorbitol 7.15 gm+tricholine citrate 0.55 gm 200ml bottle , sucralfate ( 1gm / 5ml ) 100 ml bottle, syrup or suspension , sulfamethoxazole +trimethoprim suspension ( 200 mg + 40 mg ) / 5 ml suspension ( 50 ml bottle ) , suspension , vitamin a syrup ( 100000 iu / ml with 1ml and 2 ml ( 100 ml bottle ) ) , syrup or solution , vitamin b complex nfi formula ( 100ml bottle ) , syrup , zinc sulphate syrup 20mg / 5ml ( 50 ml bottle ) , syrup , 6 mercaptopurine tablets ip 50mg , acamprosate ( 333 mg ) , tablet , acarbose 25 mg tablet , aceclofenac +thiocolchicoside ( 100mg+8mg ) , tablet , aceclofenac 100 mg +paracetamol 325 mg +chlorzoxazone 250 mg ( 100mg+325mg+250mg ) , tablet , aceclofenac 100mg+paracetamol 325mg + serratiopeptidase 15mg ( 10x10 ) , tablet , aceclofenac 100mg+paracetamol 325mg tab ( ) , tablet , aceclofenac 100mg+paracetamol 500mg , tablet , aceclofenac 100mg+serratiopeptidase 10mg ( 10x10 ) , tablet , aceclofenac ( 100mg ) , tablet , acenocoumarol 1mg , acenocoumarol ( 2 mg ) , tablet , acetazolamide tab ( 250mg ) , tablet , aciclovir tab 400 mg, tablet , acyclovir tab. ip 200mg ( dt tablets also acceptable ) , tablet , acyclovir ( 800mg ) , tablet , ademetionine ( 400mg ) , tablet , afatinib 40 mg tablet , agomelatine 25 mg tab , albendazole + ivermectin ( 400mg + 6mg ) , tablet , albendazole ip ( 400mg ) , tablet , alendronate ( 70 mg ) , tablet , alfuzocin hcl 10mg tablet , alfuzosin 10mg+dutasteride 0.5 mg , allopurinol 100 mg , alpha lipoic acid 100 mg+folic acid 1.5 mg+mecobalamin 1.5 mg+vitamin b6 3 mg , alprazolam 0.25 mg , amantadine hydrochloride 100 mg tablet , ambroxyl 30mg tab , amiodarone 200 mg , amisulpride 100 mg , amisulpride 200 mg , amisulpride 50 mg , amitriptyline tab. ip ( 25 mg ) , tablet , amitriptyline ( 10 mg ) , tablet , amitryptiline tab ( 50 mg ) , tablet , amitryptiline ( 75 mg ) , tablet , amlodipin tab ( 10mg ) , tablet , amlodipin tab ( 2.5mg ) , tablet , amlodipin tab ( 5mg ) , tablet , amlodipine ( 5 mg ) + metoprolol ( 50 mg ) , amlodipine ( 5 mg ) + telmisartan ( 40 mg ) , amolodipine 5mg +atenolol 50mg , anastrozole1mg , aripiprazole 10 mg , aripiprazole 15 mg , aripiprazole 30 mg , armodafinil 50 mg tablet , artemether 80mg lumefantrine 480mg tablets. packing 10x1x6 , artesunate 50 mg ( 3 tab ) + sulphadoxine 500 mg + pyrimethamine 25 mg ( 1 tab ) ( age group between 1 4 year ) , combi blister pack , ascorbic acid ( vitamin c ) tab i.p. ( 500mg ) , tablet , aspirin 75 mg+clopidogrel 75 mg+rosuvastatin 10 mg , aspirin 75 mg+prasugrel 10 mg , aspirin low dose ( 150mg tab ) , tablet , aspirin low dose ( 75mg tab ) , tablet , atenolol ( 25 mg ) , tablet , atenolol ( 50 mg ) , tablet , atomoxetine 10 mg tab , atomoxetine 25 mg tab , atorvastatin 10 mg , atorvastatin 10 mg+aspirin 75 mg. , atorvastatin 20 mg , atorvastatin 40 mg , axitinib 5mg , azathioprine 50 mg tab , azithromycin500 mg , azithromycin 250 mg tab , azithromycin+fluconazole+secnidazole ( 1gm+150mg+1gm ) tablet combikit , baclofen ( 10 mg tab ) , tablet , baclofen ( 20 mg tab ) , tablet , baclofen ( 30 mg tab ) , tablet , baclofen ( 40 mg tab ) , tablet , baclofen ( 5 mg tab ) , tablet , benfothiamin 150mg , betahistine ( 16 mg ) , tablet , betahistine ( 4 mg ) , tablet , betahistine ( 8 mg ) , tablet , betamethasone ( 0.5 mg ) , tablet , bicalutamide 50 mg, tablet , bisacodyl ( 5mg tab ) , tablet , bisoprolol 2.5 mg+hydrochlorothiazide 6.25 mg , bisoprolol 5 mg+amlodipine 5 mg , blonanserin 2 mg , blonanserin 4 mg , bosentan 62.5 mg tab , briveracetum 50mg tab , bromocriptine 2.5mg tab , buprinorphine 4mg , buprinorphine 8 mg , bupropion150 mg , bupropion300 mg , buspirone 10 mg , buspirone 5 mg , cabergoline tablets ip 0.25 mg , cabergoline tablets ip 0.5 mg , calcitriol 0.25mcg + calcium carbonate 500mg + zinc sulfate 7.5 mg , tablet , calcium acetate 667 mg tab , calcium carbonate ( 500 mg ) , tablet , calcium with vitamin d3 tablets usp calcium carbonate 1.25g eq. to elemental ( calcium 500mg and cholecalciferol ip 250 iu ) , tablet , capecitabine ( 500mg ) , tablet , carbamazepine sr100 mg, tablet , carbamazepine sr200 mg, tablet , carbamazepine sr400 mg, tablet , carbamazepine ( 200 mg ) , tablet , carbimazole 20 mg tablet , carbimazole ( 5 mg ) , tablet , carvedilol ( 3.125 mg ) , tablet , carvedilol ( 6.250 mg ) , tablet , cefadroxil 500 mg , cefixime 200 mg + clavulanic acid 125 mg ( tab ) , tablet , cefixime tab ip ( 100mg ) , tablet , cefixime tab ip ( 200mg ) , tablet , cefodoxime 200mg tab , cefpodoxime50 mg , cefuroxime 250 mg 10 x 10 ( 250 mg ) , tablet , cefuroxime 500 mg 10 x 10 ( 500 mg ) , tablet , cetirizine10 mg , chlordiazepoxide ( 10 mg ) , tablet , chlordiazepoxide ( 25 mg ) , tablet , chloroquine phosphate tab. ( 250mg ) , tablet , chlorpheniramine maleate 2 mg+phenylephrine 10 mg+nimesulide 100mg +caffeine 30 mg , chlorpheniramine maleate ( 4mg ) , tablet , chlorpromazine50mg , chlorpromazine 100 mg , chlorthalidone ( 50mg ) , tablet , chymotrypsin + trypsin ( 20000 iu + 100000 iu ) , tablet , cilostazole 100 mg tablets , cilostazole 200 mg tablets , cinnarizine 20 mg and dimenhydrinate 40 mg , cinnarizine ( 25 mg ) , tablet , cinnarizine ( 5 mg ) , tablet , ciprofloxacin ( 500mg ) , tablet , citicoline ( 500mg ) , tablet , clarithromycin ( 250 mg ) , tablet , clobazam ( 10 mg ) , tablet , clobazam ( 5 mg ) , tablet , clomipramine 50 mg, tablet , clonazepam 0.25 mg tab , clonazepam 0.5 mg tab , clonazepam 1 mg , clonazepam 2 mg , clonidine 100 mcg tablet , clopidogrel75 mg , clopidogrel 150mg+ aspirin 75 mg , clopidogrel 75 mg+aspirin 75 mg , clopidogrel 75 mg+atorvastatin 20 mg , clotrimazole antifungal 400mg tablet , clotrimazole vaginal tablet i.p. 500mg , clozapine ( 100 mg ) , tablet , clozapine ( 25 mg ) , tablet , clozapine ( 50 mg ) , tablet , coenzyme q 10 120 mg , cyanocobalamin 2 mg with folic acid 2.5 mg tablets , cyclophosphamide 50 mg tab , dapagliflozin 5 mg tablet , dapsone 100 mg tablet , dasatinib 50 mg , deferasirox dispersible 250 mg tab , deferasirox dispersible 500 mg tab , deflazacort 30 mg tab , deflazacort ( 6mg ) , tablet , desmopressin acetate 0.5mg tablet , dexamethasone 4 mg tab , diazepam10 mg , diazepam5 mg , diclofenac + seratopeptidase ( 50mg + 10mg ) , tablet , diclofenac sodium + paracetamol +serratiopeptidase ( 50 mg +325 mg + 10 mg ) , tablet , diclofenac sodium 50mg + paracetamol ( 500mg ) , tablet , diclofenac sodium ( 50 mg ) , tablet , dicyclomine ( 10mg ) , tablet , digoxin 0.25 mg , diltiazem 30mg , diphenylhydramine 50 mg , disulfiram 250 mg , divalproex sodium 250 mg , domperidone 10 mg + ranitidine 150mg tablets , domperidone 10 mg tab , donepezil10 mg , donepezil 5 mg , doxophylline400 mg tablet , drotaverine ( 40 mg ) , tablet , drotaverine ( 80 mg ) , tablet , duloxetine 20 mg tab , duloxetine 30 mg tab , duloxetine ( 40 mg ) , tablet , dydrogesterone 10mg , eltrombopag olamine 50 mg tablet , empagliflozin 25mg tablet , enalapril maleate 2.5 mg , enalapril maleate 5 mg , entecavir ( 0.5 mg tablet / capsule ) , tablet or capsule , entecavir ( 1 mg tablet / capsule ) , tablet or capsule , eplerenone 25mg , erlotinib 100mg , erlotinib 150mg , escitalopram 10 mg , escitalopram 20 mg , escitalopram 5 mg , esomeprazole 40mg , ethambutol tablets 400 mg , ethambutol tablets 800 mg , ethamsylate 500 mg , etizolam 0.25 mg+propranolol 20 mg, tablets , etizolam ( 0.5mg ) , tablet , etophylline ( 77 mg ) + theophylline ( 23 mg ) , tablet , etoposide 50 mg , etoricoxib 90mg , everolimus 5 mg tablets , farmalin 1gm tab ( 100 tab per box ) , febuxostat 40 mg , fenofibrate 160 mg tablets , ferrous ascorbate 100mg ( elemental iron ) +folic acid 1.5mg ( tablet ) , tablet , ferrous sulphate ip equivalent to 60 mg elemental iron & 500 mcg folic acid ip ( 60 mg + 500 mcg ) , tablet , flavoxate hcl 200mg , fluconazole 150 mg , fludrocortisone 100 mcg tablet , flunarizine 10 mg , flunarizine 10 mg+propranolol 40 mg , flunarizine 5 mg , fluvoxamine 50 mg , folic acid 5 mg , folic acid 800 mcg , formalin 1000 mg tablet , frusemide40 mg , fungal diastase 100 mg+papain 60 mg , gabapentin 400 mg+nortriptyline 10 mg , gabapentin ( 100mg ) , tablet , gabapentin ( 300mg ) , tablet , ganciclovir 1000 mg tablet , gefitinib 250mg , glibenclamide 2.5mg tab , glibenclamide 5mg tab , gliclazide 60mg , gliclazide 80 mg , glimepiride + metformin hydrocloride sr ( 1 mg + 500 mg ) , tablet , glimepiride 2 mg + metformin 500 mg + pioglitazone 15 mg , glimepiride 2 mg+metformin 500 , glimepiride ( 1 mg ) , tablet , glimepiride ( 2 mg ) , tablet , glipizide 5 mg+metformin 500 mg , glucosamine and chondroitin sulfate ( 750 mg tablet ) , haloperidol 1.5 mg , haloperidol 10 mg , haloperidol 5 mg , hydrochlorothiazide 12.5 mg , hydrochlorothiazide 25 mg , hydrocortisone 10 mg tablet , hydrocortisone tablets for usp, 20mg , hydroxychloroquine ( 200 mg ) , tablet , hydroxychloroquine ( 400 mg ) , tablet , hydroxyzine hcl 10 mg tablet , hyoscine butylbromide tab 10mg , ibuprofen 400mg+ paracetamol 325mg tablet ( ) , tablet , ibuprofen ( 400mg ) , tablet , imatinib ( 100 mg tab ) , tablet , imatinib ( 400 mg tab ) , tablet , imipramine ( 25mg ) , tablet , imipramine ( 75mg ) , tablet , indapamide hemihydrate 1.5mg , iron folic acid tab ferrous sulfate desiccated ip 333 335 mg equivalent to 100mg of elemental iron +folic acid ip 0.5mg tab ferrous sulphate of elemental iron +folic acid ip 0.5tab ferrous sulphate dessicated ip equivalent to 20mg , isoniazid 300mg tablet , isosorbide dinitrate tab ip ( 5mg ) , tablet , isosorbide mononitrate 30 mg , isosorbide 5 mononitrate ( tab.20 mg ) , tablet , itopride 150mg , itopride hydrochloride 25 mg tablets , itopride hydrochloride 50 mg tablets , ivermectin 12 mg , labetalol 100mg , lacosamide 50 mg tab , lactic acid bacillus ( 120m ) , lactic acid bacillus ( 60 million spores ) , tablet , lamotrigine dt tab ( 100 mg ) , tablet , lamotrigine dt tab ( 50 mg ) , tablet , lamotrigine dt ( 25 mg ) , tablet , lansoprazole 15 mg, tablet , lapatinib 250 mg , l carnosine 200 mg tablet , letrozole ( 2.5 mg ) , tablet , levetiracetam 250 mg , levetiracetam 500 mg , levetiracetam 750 mg tablet , levocetirizine 5mg tab , levocetirizine 5mg+ monteleukast 10 mg tab , levodopa 100 mg + carbidopa 25mg, tablets , levofloxacin tab 500mg , levofloxacin ( 750mg ) , tablet , linezolid tab ( 600 mg ) , tablet , lithium carbonate 300 mg , lithium carbonate 400 mg , loperamide hydrochloride 8 mg tablet , lorazepam ( 1 mg ) , tablet , lorazepam ( 2 mg ) , tablet , lorcaserine hydrochloride tablets ip 10 mg , losartan ( 50 mg ) + chlorthalidone ( 12.5 mg ) , losartan 50 mg tab , losartan 50 mg+hydroclorothiazide 12.5 mg tab , lurasidone hydrochloride 20mg tablet , lurasidone hydrochloride 40mg tablet , magnesium oxide 200 mg , magnesium valproate 400 mg , mebendazole 100 mg tab , meclizine hydrochloride 25 mg tablet , mefenamic acid + dicyclomine tab ( 250 mg + 10 mg ) , tablet , mefenamic acid + drotaverine hcl tab ( 250 mg+80 mg ) , tablet , megestrol acetate 40mg tablets , melatonin 3mg , melatonin 6mg , memantine 10 mg , mesalamine ( 5 aminosalicylic acid ) 400 mg tab , metformin ( 1000 mg ) + vildagliptin ( 50 mg ) , metformin + glimepiride ( 500 mg + 2 mg tablet ( sr form also acceptable ) ) , tablet , metformin 500 mg+voglibose 0.3 mg , metformin ( 1000mg ) , sr tablet , metformin ( 500 mg ) , tablet , metformine 500 mg+ gliclazide 80 mg tab , metformine 500mg + glibenclamide 5mg ( tab ) , tablet , methimazole 10 mg tab , methocarbamol500 mg tablet , methotrexate ( 10 mg ) , tablet , methotrexate ( 2.5 mg ) , tablet , methotrexate ( 5 mg ) , tablet , methotrexate ( 7.5 mg ) , tablet , methyl prednisolone ( 16mg ) , tablet , methyl prednisolone ( 4mg ) , tablet , methyl prednisolone ( 8mg ) , tablet , methylcobalamin ( 1500 mcg ) , tablet , methylcobalamin ( 1500 mcg ) + folic acid 5 mg , tablet , methylcobalamin / mecobalamin ( 500 mcg ) , tablet , methyldopa 250 mg tablet , methylphenidate 10 mg , methylphenidate 20 mg , methylphenidate 5 mg , metoclopramide ( 10mg ) , tablet , metoclopramide ( 5mg ) , tablet , metolazone 5 mg tablet , metoprolol 12.5 mg , metoprolol 50 mg+ramipril 5 mg , metoprolol ( 50mg ) , tablet , metronidazole tab ( 400mg ) , tablet , mifepristone 200mg ( 1 tab ) +misoprostol 200mcg ( 4 tab ) ( combipack ) , tablet kit , mirtazapine ( 15 mg ) , tablet , mirtazapine ( 30 mg ) , tablet , mirtazapine ( 7.5 mg ) , tablet , misoprostol ( 200mcg ) , tablet , modafinil100 mg tablet , modafinil200 mg tablet , morphine sulphate ( 10 mg ) , tablet , moxonidine 0.3 mg , multivitamin tab nfi formula sugar coated vit a 2500 iu, vit b12, vit b 6, 0.5 mg, vit c 50mg, vit d3 250iu, niacinamide 25mg, folic acid 0.2mg ( with approximateoverages ) , mycophenolate mofetil ( 250mg ) , tablet , mycophenolate mofetil ( 500mg ) , tablet , n acetyl cysteine 600 mg tablet , n acetylcysteine 300 mg , naltrexone ( 50 mg ) , tablet , naproxen 250 mg tablet , naproxen 500 mg tablet , naproxen 500mg domperidone 10mg tablets , nebivolol 5mg , nicorandil 5 mg tab , nicotinamide ( tablet 25 mg ) , tablet , nicotinamide ( tablet 50 mg ) , tablet , nicoumalone 1 mg , nicoumalone 2mg tablet , nifedepine 10mg , nifedepine r 20mg , nilotinib 200mg , nimesulide 100 mg , nimodipine 30 mg tablet , nitazoxanide 500mg tablet , nitazoxanide dispersible 200 mg tablet , nitrocontin 2.6mg , nitrofurantoin ( 100mg ) , tablet / capsule , nitroglycerin 2.5 mg , nitroglycerine ( glyceryl trinitrate ) ( sublingual tab 0.5 mg ) , tablet , norfloxacin tab. 400mg , norfloxacine 400mg and tinidazole 600mg ( tab ) , tablet , ofloxacin + ornidazole ( 200mg and 500mg ) , tablet , ofloxacin 200mg +tinidazole 600mg ( tab ) , tablet , ofloxacin tab 400 mg , olanzapine ( 10 mg ) , tablet , olanzapine ( 2.5 mg ) , tablet , olanzapine ( 20 mg ) , tablet , olanzapine ( 5 mg ) , tablet , olanzapine ( 7.5 mg ) , tablet , olmesartan 10 mg , olmesartan 20mg , olmesartan medoxomil 20 mg+amlodipine 5 mg+hydrochlorothiazide 12.5 mg , olmesartan medoxomil 40 mg+amlodipine 5 mg , olmesartan medoxomil ( 40 mg ) , tablet , ondansetron ( tab 4 mg ) , tablet , ondansetron ( tab 8 mg ) , tablet , ornidazole tab ( 500 mg ) , tablet , oxcarbazepine ( 150 mg ) , tablet , oxcarbazepine ( 300 mg ) , tablet , oxcarbazepine ( 600 mg ) , tablet , oxybutynin hydrochloride 2.5mg tablets , paliperidone extended release 1.5 mg tablet , paliperidone extended release 3 mg tablet , pantaprazole ( 40mg tab ) , tablet , pantoprazole 40 mg, domperidone 10 mg ( tab ) , tablet , pantoprazole 40 mg+domperidone 30 mg , paracetamol suppositories 250mg , paracetamol ( 500mg ) , tablet , paracetamol ( 650mg ) , tablet , paroxetine cr ( 12.5 mg ) , tablet , pazopanib 200 mg tablet , penicillin v ( phenoxymethyl penicillin potassium ) ( 250 mg ) , tablet , pentoxyfylline ( 400 mg ) , tablet , pentoxyfylline ( 400 mg ) , tablet , perampanel film coated tablets 4mg , phenobarbitone ( 30 mg ) , tablet , phenobarbitone ( 60 mg ) , tablet , phenytoin sodium ( 100mg ) , tablet , pioglitazone ( 15 mg ) , tablet , pioglitazone ( 30 mg ) , tablet , piracetam ( 400mg ) , tablet , piracetam ( 800mg ) , tablet , posaconazole 100 mg tablet , pramipexol 0.50 mg tablet , pramipexole prolonged release 0.26 mg tablet , prazosin tab ( 10 mg ) , tablet , prazosin tab ( 5 mg ) , tablet , prednisolone ( 10 mg ( dt also acceptable ) ) , tablet , prednisolone ( 5 mg ( dt also acceptable ) ) , tablet , pregabalin ( 75mg ) , capsule , primaquin ( 15mg ) , tablet , primaquin ( 7.5mg ) , tablet , procyclidine hydrochloride 5 mg tablet , promethazine 25 mg tablet , propranolol ( 10 mg ) , tablet , propranolol ( 20 mg ) , tablet , propranolol la ( 40 mg ) , tablet , propylthiouracil tablets ip 50mg , prucalopride 2 mg film coated tablets , pyridoxine ( 40 mg ) , tablet , quetiapine ( 100 mg ) , tablet , quetiapine ( 200 mg ) , tablet , quetiapine ( 50 mg ) , tablet , quinine sulphate ( 300mg ) , tablet , ramipril ( 2.5 mg ) , tablet , ramipril ( 5 mg ) , tablet , ranitidine ( 150mg ) , tablet , ranolazine er 500 mg tablet , rifaximin 550 mg tablets , risperidone ( 0.5 mg ) , tablet , risperidone ( 2 mg ) , tablet , risperidone ( 4 mg ) , tablet , rivaroxaban 10 mg tablet , rivaroxaban 15 mg tablet , rivaroxaban 5 mg tablet , rivaroxaban film coated tablets 20 mg , rosuvastatin 20 mg , rosuvastatin ( 10 mg ) , tablet , sacubitril 24 mg+valsartan 26 mg , secnidazole film coated tablets 500 mg , sertraline ( 100 mg ) , tablet , sertraline ( 50 mg ) , tablet , sevelamer ( 400 mg ) , tablet , sevelamer ( 800 mg ) , tablet , sildenafil 25 mg , sildenafil ( 50 mg ) , tablet , silodosin ( 4 mg ) , tablet or capsule , silodosin ( 8 mg ) , tablet or capsule , sitagliptin 50 mg+metformin 500 mg , sitagliptin ( 100 mg ) , tablet , sitagliptin ( 50 mg ) , tablet , sodium bicarbonate 500 mg , sodium valproate ( 200mg ) , tablet , sodium valproate ( 300mg ) , tablet , sodium valproate ( 500mg ) , tablet , solifenacin succinate 5 mg , sorafenib ( 200mg ) , tablet , spironolactone 50mg + frusemide 20mg ( tablet ) , tablet , spironolactone ( 100mg ) , tablet , spironolactone ( 25mg ) , tablet , sulfamethoxazole and trimethoprim ( 100mg + 20mg ) , tablet , sulfamethoxazole and trimethoprim ( 800mg + 160mg ) , tablet , sulfasalazine 500 mg tablet , sulphamethoxazole 800mg + trimethoprim 160mg , tadalafil tablets ip 10 mg , tadalafil tablets ip 20 mg , tamoxifen ( 10 mg ) , tablet , tamoxifen ( 20 mg ) , tablet , tamsulosin + dutasteride 0.4 mg + 0.5 mg, tablet , tamsulosin ( 0.4mg ) , tablet , tapentadol 50 mg tablet , telmisartan 40 mg+amlodipine 5 mg , telmisartan 80 mg+amlodipine 5 mg , telmisartan 80 mg+hydrochlorothiazide 12.5 mg , telmisartan ( 40 mg ) , tablet , telmisartan, hydrochlorthiazide ( 40 mg + 12.5 mg ) , tablet , teneligliptin 20 mg , tenofovir disoproxil fumarate 300 mg , terbutaline sulphate 2.5 mg tablet , tetrabenazine 12.5mg tablet , tetrabenazine 20 mg tablet , tetrabenazine 25mg tablet , thiamine hydrochloride 200 mg tablet , thyroxine sodium tab 100 mcg ( 100 tab bottle ) , tablet , thyroxine sodium tab 12.5 mcg ( 100 tab bottle ) , tablet , thyroxine sodium tab 125 mcg ( 100 tab bottle ) , tablet , thyroxine sodium tab 137 mcg ( 100 tab bottle ) , tablet , thyroxine sodium tab 150 mcg ( 100 tab bottle ) , tablet , thyroxine sodium tab 25 mcg ( 100 per bottle ) , tablet , thyroxine sodium tab 50 mcg ( 100 tab bottle ) , tablet , thyroxine sodium tab 62.5 mcg ( 100 tab bottle ) , tablet , thyroxine sodium tab 75 mcg ( 100 tab bottle ) , tablet , thyroxine sodium tab 88 mcg ( 100 tab bottle ) , tablet , tianeptine sodium tablets 12.5 mg , tofacitinib 5mg tablet , tofacitinib extended release 11mg tablet , tolperisone hydrochloride 150 mg tablets , tolvaptan 15 mg , topiramate 100 mg , tablet , topiramate 25 mg , tablet , topiramate 50 mg , tablet , torsemide 10 mg+spironolactone 50 mg , torsemide ( 10mg ) , tablet , tramadol hydrochloride 37.5 mg / acetaminophen 325 mg tablets , tramadol ( 100mg ) , tablet , tramadol ( 50mg ) , tablet , tranexamic acid ( 500 mg tab ) , tablet , trifluoperazine tablets ip5 mg , trihexyphenidyl ( 2mg ) , tablet , trypsin 48 mg+bromelain 90mg+rutoside trihydrate 100mg tablet , ulipristal acetate 5 mg , ursodeoxy cholic acid 300 mg tablet , valganciclovir usp 450 mg tablet , valganciclovir usp 500 mg tablet , valganciclovir usp 900 mg tablet , valsartan 40 mg , venlafaxine er / pr ( 37.5 mg ) , tablet or capsule , venlafaxine hydrochloride extended release 150 mg capsule , venlafaxine hydrochloride extended release 75 mg capsule , venlafaxine ( 75 mg ) , capsule , verapamil hydrochloride prolonged release 120 mg , verapamil ( 40 mg ) , tablet , vilazodone hydrochloride tablets 20 mg , vilazodone hydrochloride tablets 40 mg , vildagliptin + metformin ( 50mg + 500mg ) , tablet , vildagliptin 100 mg tablet , vildagliptin 80mg , vildagliptin tab ( 50 mg ) , tablet , vitamin b complex nfi ( prophylactic ) ( b12 mg, b22mg, b6 0.5 mg, niacinamide 25 mg, calcium pantothenate 1 mg ) , tablet , vitamin b1 ( thiamine 100 mg ) , tablet , vitamin b1 ( thiamine 75 mg ) , tablet , voglibose ( 0.2 mg ) , tablet , voglibose ( 0.3 mg ) , tablet , voriconazole ( 200mg ) , tablet , voriconazole ( 100mg ) , tablet , voriconazole ( 50mg ) , tablet , vortioxetine hydrobromide tablets 10 mg , vortioxetine hydrobromide tablets 20 mg , vortioxetine hydrobromide tablets 5 mg , warfarin sodium ( 5 mg ) , tablet , zinc sulphate dispersible ( 20mg ) , tablet , zolpidem 10 mg, tablet , zonisamide 100 mg tablets , zonisamide 50 mg tablets...

Directorate Of Health Services - Madhya Pradesh

39504419 local purchase of medicine material and equipment , tender for supply of medicine, material and equipmentsunder local purchase , 1 dhar cs 5 fluro uracil(500mg) tab , 2 dhar cs abacavir(tablet 300 m , 3 dhar cs aceclofenac(100mg)tab , 4 dhar cs acetazolamide tab(250mg) , 5 dhar cs acetylsalicylic acid(150 mg)tab , 6 dhar cs acetylsalicylic acid (aspirin)*(tablet 25 mg) , 7 dhar cs activated charcoal(400mg)tab , 8 dhar cs acyclovir(800mg)tab , 9 dhar cs acyclovir inj(250 mg/vial) , 10 dhar cs acyclovir tab. ip 200mg(dt tablets also acceptable) tab , 11 dhar cs adenosine(6 mg/ 2ml ) , 12 dhar cs adrenaline(1 mg / ml (1 ml amp)) , 13 dhar cs albendazole ip(400mg)tab , 14 dhar cs albendazole suspension 200mg/5ml(10 ml bottle) , 15 dhar cs allopurinol(100mg)tab , 16 dhar cs allopurinol(300 mg)tab , 17 dhar cs alprazolam(tab 0.25mg) , 18 dhar cs ambroxol hcl 15mg+terbutaline sulphate 1.25mg+guaiphenesin 50mg 5ml((additional composition of menthol also acceptable) 100ml bottle) , 19 dhar cs amikacin(100mg / 2ml vial) , 20 dhar cs amikacin(500mg/2ml (2ml vial)) , 21 dhar cs aminophylline(25 mg/ml 10 ml vial) , 22 dhar cs amiodarone(100mg tab) , 23 dhar cs amiodarone 50mg/ml(3ml vial/amp) , 24 dhar cs amlodipine(10 mg)tab , 25 dhar cs amlodipin tab(5mg) , 26 dhar cs amoxicillin(125 mg/5ml (30 ml bottle)) , 27 dhar cs amoxicillin and clavulanic acid i.p.(200+28.5mg (30 ml bottle)) , 28 dhar cs amoxicillin cap(250 mg) , 29 dhar cs amoxycillin and clavulanic acid i.p.(500mg + 125mg) tab , 30 dhar cs amoxycillin +clavulanic acid((amoxycillin 500 + clavulanic acid 100 mg)/vial) , 31 dhar cs amoxycilline(500mg)cap , 32 dhar cs amphotericin b inj ip 50 mg(liposomal amphotericin b also acceptable) , 33 dhar cs ampicillin(500 mg/vial) , 34 dhar cs ampicillin trihydrate capsules(500mg 10x10) , 35 dhar cs anti d immunoglobulin for iv/im use (monoclonal)(150mcg (1ml vial)) , 36 dhar cs anti rabies vaccine i.p. inj. human (tissue culture) for i/d and i/m route 2.5 iu with(1ml diluents) , 37 dhar cs anti snake venom polyvalent inj 10ml (lyophilized)(10 ml vial) , 38 dhar cs artemether + lumefantrine(20mg+120mg)tab , 39 dhar cs artesunate 150mg (3tab) + sulphadoxine 500mg + pyrimethamine 25mg ( 2 tab )(age group 9 to 14 years combi) , 40 dhar cs artesunate 200 mg (3tab) + sulphadoxine 750 mg + pyrimethamine 37.5 mgip (2 tab)(age group 15 or above) , 41 dhar cs artesunate 50 mg (3 tab) + sulphadoxine 500 mg + pyrimethamine 25 mg (1 tab)(age group between 1 4 year) , 42 dhar cs artesunate(60 mg /vial) , 43 dhar cs artesunate powder for injection 120 mg(vial of 1 powder injection with appropriate diluents) , 44 dhar cs ascorbic acid(vitamin c)(100 mg)tab , 45 dhar cs aspirin low dose(75mg tab) , 46 dhar cs atenolol(100mg)tab , 47 dhar cs atenolol(50mg tab)tab , 48 dhar cs atorvastatin(40mg)tab , 49 dhar cs atorvastatin(ip 10 mg)tab , 50 dhar cs atracurium(10mg/ml ) , 51 dhar cs atropine sulphate 0.6 mg/ml sc/im/iv(2ml amp) , 52 dhar cs atropine sulphate 1%(5 ml vial)eye drop , 53 dhar cs atropine sulphate eye ointment(1%) , 54 dhar cs azithromycin(200mg/5ml (15 ml bottle)) , 55 dhar cs azithromycin(250mg)tab , 56 dhar cs azithromycin(500mg tab) , 57 dhar cs baclofen(40 mg tab) , 58 dhar cs bendamustine(100mg vial) , 59 dhar cs benzathine penicillin(6 lakh iu/vial) , 60 dhar cs benzathine penicilline 12 lac iu / vial(vial) , 61 dhar cs benzoyl peroxide gel 5%(15 gm tube) , 62 dhar cs betahistine(8 mg tab) , 63 dhar cs betamethasone(0.5 mg)tab , 64 dhar cs betamethasone dipropionate(0.05% (15gm) tube) , 65 dhar cs betamethasone sodium phosphate(ml contain betamethasone sodium phosphate equal to 4mg of betamethasone (1ml amp)) , 66 dhar cs bicalutamide(50mg )tab , 67 dhar cs biphasic isophane insulin(30/70 40iu/ml (10 ml vial)) , 68 dhar cs bisacodyl(5 mg)suppository , 69 dhar cs bisacodyl(5mg tab) , 70 dhar cs bleaching powder containing not less than 30% w/w of available chlorine(as per i.p) , 71 dhar cs bleomycin(15 units / vial) , 72 dhar cs boro spirit ear drops (0.183 gm boric acid in 2.08 ml of alcohol 10 ml vial) , 73 dhar cs bortezomib(2mg)inj , 74 dhar cs bromhexine hydrochloride(4mg/5ml syrup (50ml bottle)) , 75 dhar cs budesonide nebulising suspension containing budesonide(0.5 mg/2 ml , 76 dhar cs bupivacaine hydrochloride(0.5% (20 ml vial)) , 77 dhar cs caffeine citrate inj. 20mg/ml (3 ml vial)(20mg/ml 3 ml vial) , 78 dhar cs calaminelotion((contains per 1000 ml: calamine 150 gm zinc oxide 50 gmbentonite 30 gmsodium citrate 5gm liquified phenol 5mlglycerin 50 ml purified waterfreshly boiled and cooled to produced 1000ml) 50 ml bottle) lotion , 79 dhar cs calamine lotion ip (contains per 1000 ml: calamine 150 gm zinc oxide 50 gm bentonite 30 gm sodium citrate 5gm liquified phenol 5mlglycerin 50 ml purified waterfreshly boiled and cooled to produced 1000ml) 50 ml bottle(50 ml bottle) bottle , 80 dhar cs calcium carbonate(500 mg)tab , 81 dhar cs calcium gluconate 10%(10ml vial/amp) , 82 dhar cs calcium gluconate(10% (10 ml vial)) , 83 dhar cs calcium leucovorin(50 mg/vial inj) , 84 dhar cs calcium with vitamin d3 calcium equivalent to 500 mg & vit. d3 250 iu(calcium equivalent to 500 mg & vit. d3 250 iu) tab , 85 dhar cs calcium with vitamin d tablets usp calcium carbonate 1.25g eq. to elemental(calcium 500mg and cholecalciferol ip 250 iu) , 86 dhar cs capecitabine(500mg)tab , 87 dhar cs carbamazepine(100 mg / 5 ml100 ml bottle) , 88 dhar cs carbamazepine(200 mg)tab , 89 dhar cs carbimazole(10 mg)tab , 90 dhar cs carboplatin(450mg 45ml multidose vial) , 91 dhar cs carboprost(250 mcg (1 ml amp/vial)) , 92 dhar cs carboxymethylcellulose sodium eye drop 0.5%(10ml) , 93 dhar cs cefixime(200 mg tab (dt tablet also acceptable) ) , 94 dhar cs cefixime(50 mg dab , 95 dhar cs cefixime oral suspension(100 mg / 5 ml (30 ml bottle)) , 96 dhar cs cefotaxime sodium(1 gm vial) , 97 dhar cs cefotaxime sodium(250 mg vial) , 98 dhar cs cefotaxime sodium(500 mg/vial) , 99 dhar cs cefpodoxime(200 mg (dispersible tab also accepted)) , 100 dhar cs ceftazidime 1gm/vial inj(1 gm/vial) , 101 dhar cs ceftazidime powder for injection 250 mg(vial of 1 powder injection with appropriate diluents) , 102 dhar cs ceftriaxone(250mg vial) , 103 dhar cs ceftriaxone(500mg vial) , 104 dhar cs ceftriaxone(inj 1 gm/vial vial of 1 inection) , 105 dhar cs ceftrioxone usp(1gm/vial) , 106 dhar cs cephalexine(250mg)cap , 107 dhar cs cephalexine(each 5ml contains 125mg (30ml bottle)) , 108 dhar cs cetirizine(10 mg)tab , 109 dhar cs cetirizine syrup (5mg/5ml 30 ml bottle)(30ml bottle) , 110 dhar cs cetrimide cream solution 20% concentrative for dilution(0.2 mg) , 111 dhar cs charcoal activated (powder)(100 gm box/pouch) , 112 dhar cs chloramphenicol eye ointment(0.5%) , 113 dhar cs chloroquine phosphate(40mg/ml (5 ml amp)) , 114 dhar cs chloroquine phosphate suspension equivalent to chloroquine 160mg/10ml(160mg/10ml (60ml bottle) , 115 dhar cs chloroquine phosphate suspension equivalent to chloroquine(50mg/5ml (60 ml bottle)) , 116 dhar cs chloroquine phosphate tab.(250mg) , 117 dhar cs chlorpheniramine maleate(10mg/ml inj 10 ml ) , 118 dhar cs chlorpheniramine oral liquid 2 mg/5 ml(30 ml bottel) , 119 dhar cs chlorpromazine(100 mg)tab , 120 dhar cs chlorthalidone(12.5mg tab) , 121 dhar cs chlorthalidone(25mg)tab , 122 dhar cs cinnarizine(25 mg)tab , 123 dhar cs ciprofloxacin 0.3%(5ml vial)eye and ear drop , 124 dhar cs ciprofloxacin 0.3%(5ml vial)eye drop , 125 dhar cs ciprofloxacin(250mg)tab , 126 dhar cs ciprofloxacin(500mg)tab , 127 dhar cs ciprofloxacin eye ointment 0.3% ( 3gm tube) , 128 dhar cs ciprofloxacin inj 200 mg/100 ml(100 ml ffs bottle) , 129 dhar cs cisplatin(50 mg)inj , 130 dhar cs clarithromycin(250 mg)tab , 131 dhar cs clindamycin(150 mg)cap , 132 dhar cs clofazimine cap(100 mg) , 133 dhar cs clofazimine(tablet 50 mg 4) , 134 dhar cs clomiphene citrate(50 mg tab) , 135 dhar cs clonazepam(0.5mg)tab , 136 dhar cs clopidogrel(75 mg)tab , 137 dhar cs clotrimazole i.p. 2%w/w(15gm tube) , 138 dhar cs clotrimazole (vaginal tab) 500 mg(with applicator) , 139 dhar cs cloxacillin(500mg)cap , 140 dhar cs cloxacillin(capsule 125 mg) , 141 dhar cs clozapine(25 mg)tab , 142 dhar cs clozapine(50 mg)tab , 143 dhar cs codeine(oral solution 15 mg/5 ml 60 ml bottle) , 144 dhar cs combo ear drop(chloramphenicol 5% w/v + clotrimazole 1% + lignocaine hydrochloride 2%) , 145 dhar cs cycloserine(capsule 125 mg) , 146 dhar cs dacarbazine(200 mg per vial) , 147 dhar cs deferasirox dispersible(250mg)tab , 148 dhar cs deferasirox dispersible(500mg)tab , 149 dhar cs deferiprone(500 mg)cap , 150 dhar cs deriphylline tablet(sustained release) , 151 dhar cs dexamethasone(0.5mg)tab , 152 dhar cs dexamethasone eye drop(0.1% 5ml) , 153 dhar cs dexamethasone sodium phosphate(8mg/2ml (2ml vial)) , 154 dhar cs dextromethorphan 10mg/5ml(100ml bottle) , 155 dhar cs dextromethorphan syrup(60ml bottle)(10mg/5ml) , 156 dhar cs dextrose(10% inj 500 ml ffs btl) , 157 dhar cs dextrose(25% 100 ml ffs bottle) , 158 dhar cs dextrose 25%(500ml ffs bottle) , 159 dhar cs dextrose 5%(500ml ffs bottle) , 160 dhar cs dextrose with saline(5% + 0.9% (500ml ffs bottle)) , 161 dhar cs diazepam(5 mg/ml (2 ml amp)) , 162 dhar cs diazepam(5 mg)tab , 163 dhar cs diclofenac(1%)gel , 164 dhar cs diclofenac sodium 25 mg/ml(3ml amp) , 165 dhar cs diclofenac sodium(50 mg)tab , 166 dhar cs dicyclomine(10mg/ml (2 ml amp)) , 167 dhar cs dicyclomine(10mg)tab , 168 dhar cs dicyclomine hydrochloride(20 mg)tab , 169 dhar cs diethylcarbamazine(oral liquid 120 mg/5 ml 100 ml bottel) , 170 dhar cs diethylcarbamazine tab(100mg) , 171 dhar cs digoxin tab(0.25mg) , 172 dhar cs diloxanide furoate(tablet 500 mg) , 173 dhar cs diltiazem(30 mg)tab , 174 dhar cs diltiazem(sr tablet 90 mg 10x10) , 175 dhar cs diltiazem tablet(60 mg) , 176 dhar cs diphenylhydantoin(tab 30 mg 10x10) , 177 dhar cs diphenylhydantoin tablet(100 mg) , 178 dhar cs dispersable tablet hydroxyurea (100 mg 10x10) , 179 dhar cs disulfiram(250 mg)tab , 180 dhar cs dobutamine hcl 50 mg/ml(5ml amp) , 181 dhar cs docetaxel(120mg vial) , 182 dhar cs domperidone(10mg)tab , 183 dhar cs domperidone suspension 1mg/ml(30ml bottle) , 184 dhar cs donepezil(5 mg)tab , 185 dhar cs dopamine hcl 40 mg/ml(5ml amp) , 186 dhar cs doxorubicin (lyophilised)(50mg vial) , 187 dhar cs doxycycline(100 mg)cap , 188 dhar cs doxycycline dry syrup(50 mg/5 ml) , 189 dhar cs drotaverine(40mg/2ml (2ml amp)) , 190 dhar cs drotaverine(40 mg)tab , 191 dhar cs electrolyte p (multi electrolytes and dextrose injection type i ip) i/v fluid (each 100ml contains: anhydrous dextrose 5gm potassium chloride 0.13gmsodium acetate 0.32gm dibasic potassium phosphate 0.026gm)(500 ml ffs bottle) injection , 192 dhar cs empagliflozin(25mg tab) , 193 dhar cs enalapril maleate(tab 10 mg) , 194 dhar cs enalapril maleate tab(2.5mg)tab , 195 dhar cs enoxaparin(40mg equivalent to 4000 iu vial/pfs) , 196 dhar cs epirubicin(100mg/vial) , 197 dhar cs erlotinib(150 mg)tab , 198 dhar cs erythropoietin(10000iu inj) , 199 dhar cs escitalopram 10 mg tab(10 mg)tab , 200 dhar cs esmolol 100 mg/vial(10mg/ml) , 201 dhar cs ethamsylate tab(250 mg) , 202 dhar cs ethinylestradiol (a) + levonorgestrel (b)(tablet 0.03 mg (a) + 0.15 mg (b) 10x10) , 203 dhar cs ethinylestradiol(tablet 0.01 mg) , 204 dhar cs ethinylestradiol(tablet 0.05 mg 10x10) , 205 dhar cs etiophylline and theophylline(220 mg/2ml) , 206 dhar cs etiophylline +theophylline((46.5+14)mg / 5ml (100 ml bottle)) , 207 dhar cs etophylline (77 mg) + theophylline (23 mg) tab(tablet) , 208 dhar cs etophylline + theophylline sr tablet 231mg + 69mg tab , 209 dhar cs fentanyl citrate inj 50 mcg/ml(2ml ampoule) , 210 dhar cs ferric carboxymaltose 50mg/ml(10ml vial) , 211 dhar cs ferric carboxymaltose 50mg/ml(20ml vial) , 212 dhar cs ferrous ascorbate 100mg (elemental iron)+folic acid 1.5mg(tablet) , 213 dhar cs finofibrate(160 mg)tab , 214 dhar cs finofibrate(tablet 40 mg) , 215 dhar cs fluconazole(150 mg)tab , 216 dhar cs fluconazole eye drop 3 mg/ml(10 ml vial) , 217 dhar cs flunarizine(5 mg)tab , 218 dhar cs fluoxetine(10 mg)tab , 219 dhar cs fluoxetine cap(20 mg) , 220 dhar cs fluphenazine 1 ml amp(25 mg / ml) , 221 dhar cs folic acid ip(5 mg)tab , 222 dhar cs folic acid tab(400 mcg) , 223 dhar cs formoterol 6mcg + budesonide 200mcg(30 cap x 6 pack with 1 dispensing device) , 224 dhar cs framycetin sulphate 1% cream(30 gm tube) , 225 dhar cs frusemide(10 mg/ml (2 ml amp)) , 226 dhar cs fulvestrant(inj 500 mg vial of 10 ml) , 227 dhar cs furazolidone(100mg)tab , 228 dhar cs furosemide tab(40mg)tab , 229 dhar cs fusidic acid cream/sodium fusidic ointment 2%(5gm tube) , 230 dhar cs gamma benzene hexachloride solution/lotion 1%((100 ml)) , 231 dhar cs gefitinib(250mg)tab , 232 dhar cs gemcitabine(1.4 gm vial) , 233 dhar cs gentamicin 0.3% eye/ear drops(5ml ffs squeeze vial) , 234 dhar cs gentamicin inj(40 mg/ml 2 ml amp) , 235 dhar cs glibenclamide(5 mg)tab , 236 dhar cs gliclazide(80 mg)tab , 237 dhar cs glimepiride(1 mg)tab , 238 dhar cs glimepiride(2 mg)tab , 239 dhar cs glucose pouch(75 gm)(powder) , 240 dhar cs glycerin oral liquid ip (repacking license is also eligible)(30 ml bottel) , 241 dhar cs glycopyrolate(inj 0.2 mg/ ml 1 ml vial) , 242 dhar cs glycopyrrolate inj. 0.2 mg/ml(1 ml amp) , 243 dhar cs gum paint (tannic acid)(2% w/v 15 ml bottle) , 244 dhar cs haloperidol(5mg)tab , 245 dhar cs haloperidol inj(5mg/ml (1 ml amp)) , 246 dhar cs halothane bp 250ml , 247 dhar cs halothane inhalation(250ml bottle) , 248 dhar cs heparin(1000iu/ml 5ml vial) , 249 dhar cs hepatitis b immunoglobulin(100 iu/vial) , 250 dhar cs human albumin solution 5%(250 ml bottel ) , 251 dhar cs human anti d. immunoglobulin (monoclonal)(300mcg/vial) , 252 dhar cs human chorionic gonadotropin(injection 10000 iu vial of 1 ml injection) , 253 dhar cs human chorionic gonadotropin(injection 5000 iu vial of 2 ml injection) , 254 dhar cs human insulin regular/soluble(40iu/ml (10ml vial)) , 255 dhar cs hydrochlorothiazid(12.5 mg)tab , 256 dhar cs hydrochlorothiazide(50 mg)tab , 257 dhar cs hydrochlorothiazide tab(25 mg) , 258 dhar cs hydrocortisone 1% ointment(15 gm tube) , 259 dhar cs hydrocortisone(ointment 0.5% 15 gm) , 260 dhar cs hydrocortisone sodium succinate(100 mg/vial) , 261 dhar cs hydrogen peroxide 6% solution (who gmp certification exempted for this item)(400 ml ) , 262 dhar cs hydroxychloroquine(200 mg)tab , 263 dhar cs hydroxyethyl(6% saline solution for infusion)(starch 6%ip 500 ml bottel) , 264 dhar cs hydroxy urea(500mg)cap , 265 dhar cs hydroxyzine 10mg/5ml syrup , 266 dhar cs hydroxyzine(25 mg)tab , 267 dhar cs hyoscine butylbromide 20mg/ml(1ml vial/amp) , 268 dhar cs ibuprofen(400mg)tab , 269 dhar cs ibuprofen syrup 100mg/5ml (60 ml bottle)(60 ml bottle) , 270 dhar cs ifosfamide(1gm)inj , 271 dhar cs imatinib(400 mg tab) , 272 dhar cs imipramine(25 mg)tab , 273 dhar cs imipramine(25mg)tab , 274 dhar cs insulin biphasic 30/70((30% soluble insulin & 70% isophane insulin) 100 iu/ml. 10 ml vial) , 275 dhar cs insulin soluble inj. 40 iu/ml , 276 dhar cs intraperitoneal dialysis solution(0.015 1.5% 500 ml) , 277 dhar cs intraperitoneal dialysis solution(0.025 2.5% 500 ml) , 278 dhar cs ipratropium bromide(250 mcg/ml respules/ampoule) , 279 dhar cs ipratropium bromide inhaler 20mcg per puff(200 metered dose container) , 280 dhar cs irinotecan(100 mg inj (1 ml amp)) , 281 dhar cs irinotecan hydrochloride(100 mg) , 282 dhar cs iron & folic acid enteric coated blue (as per nipi guidelines) 100 mg + 0.5 mg(tablet 10 x 10) , 283 dhar cs iron & folic acid enteric coated red (as per nipi guidelines) 100 mg + 0.5 mg (tablet 10 x 10) , 284 dhar cs iron folic acid sugar coated (blue tablet) ferrous sulphate ip equivalent to 60 mg elemental iron & 500 mcg folic acid ip(60 mg + 500 mcg) , 285 dhar cs iron & folic acid sugar coated pink(as per nipi guidelines) 45 mg + 0.4 mg (tablet 15 x 10) , 286 dhar cs iron folic acid sugar coated (red tablet) ferrous sulphate ip equivalent to 60 mg elemental iron & 500 mcg folic acid ip(60 mg + 500 mcg ) , 287 dhar cs iron folic acid sugar coated tablet dried ferrous sulphate ip eq. to 45mgferrous iron and 400mcg folic acid ip (pink coloured tab) wifs junior ifa tablets (detail specification as per tender)(45mg + 400mcg) , 288 dhar cs iron folic acid syrup each ml containing 20mg elemental iron&100mcgfolic acid with suitable anti oxidant , 289 dhar cs iron sucrose usp(100 mg/5 ml (5 ml amp)) , 290 dhar cs isofluraninhalation) , 291 dhar cs isosorbide 5 mononitrate(tab.20 mg) , 292 dhar cs isosorbide dinitrate tab ip(5mg)tab , 293 dhar cs isoxsuprine(10mg)tab , 294 dhar cs itraconazole cap(100 mg) , 295 dhar cs ivermectin(tab 12 mg) , 296 dhar cs iv human immunoglobin 5% iv ig(5gm/100ml each) , 297 dhar cs iv human immunoglobin 5% iv ig((5mg/100ml each) , 298 dhar cs ketamine hydrochloride(10mg/ml (10ml vial)) , 299 dhar cs ketorolac(10 mg tablet)tab , 300 dhar cs labetalol(100 mg)tab , 301 dhar cs labetalol(100 mg)tab , 302 dhar cs labetalol(20 mg/4 ml (4ml amp)) , 303 dhar cs labetalol 5 mg/ml(4ml ampl) , 304 dhar cs lactulose(10gm/15ml (100 ml bottle)) , 305 dhar cs lantanoprost eye drop 0.005%(5ml) , 306 dhar cs lenalidomide(25mg)cap , 307 dhar cs letrozole(2.5 mg)tab , 308 dhar cs levetiracetam(250 mg)tab , 309 dhar cs levocetirizine + monteleukast 2.5 mg + 4 mg / 5 ml(60 ml bottle suspension) , 310 dhar cs levodopa (a) + carbidopa (b)(tablet 100 mg (a) + 10 mg (b) cr)tab , 311 dhar cs levodopa (a) + carbidopa (b)(tablet 100 mg (a) + 25 mg (b) cr)tab , 312 dhar cs levodopa (a) + carbidopa (b)(tablet 250 mg (a) + 25 mg (b))tab , 313 dhar cs levofloxacin(250mg)tab , 314 dhar cs levofloxacin(500mg)tab , 315 dhar cs levonorgestrel emergency contraceptive(0.75mg)tab , 316 dhar cs levosalbutamol(100mcg)rotacaps , 317 dhar cs levosalbutamol(50mcg/dose 30 capsule in 6 pack with 1 dispecing device) , 318 dhar cs levosulbutamol(100 mcg 30 capsule in 6 pack with 1 dispecing device) , 319 dhar cs levothyroxine(100 mcg)tab , 320 dhar cs levothyroxine(50 mcg)tab , 321 dhar cs lignocaine 2 %(21.3 mg / ml (30 ml vial)) , 322 dhar cs lignocaine 2% + adrenaline 5 mcg/ml(30 ml ) , 323 dhar cs lignocaine hydrochloride(2% w/v (30 gm tube)) , 324 dhar cs linezolid tab(600 mg , 325 dhar cs lithium carbonate(300 mg)tab , 326 dhar cs loperamide(2mg)tab , 327 dhar cs lorazepam(1 mg)tab , 328 dhar cs lorazepam2 mg / ml1 ml vial , 329 dhar cs lorazepam(2 mg / ml2 ml vial) , 330 dhar cs lorazepam(2 mg)tab , 331 dhar cs losartan(10 mg tablet) , 332 dhar cs magnesium sulphate injection(i.p.50 % w/v (1 ml amp)) , 333 dhar cs magnesium suplhate(50 % w/v (2ml amp)) , 334 dhar cs mannitol(20% 100 ml ffs bottle) , 335 dhar cs mannitol inj. 20% 350ml ffs bottle , 336 dhar cs mebeverine hydrochloride(200mg)tab , 337 dhar cs medroxy progesterone acetate(10 mg)tab , 338 dhar cs medroxyprogesterone acetate(injection 150 mg 1 ml / vial) , 339 dhar cs mephentermine inj 30mg/ml(10 ml vial) , 340 dhar cs meropenem(500 mg / vial) , 341 dhar cs metformin(1000mg)tab , 342 dhar cs metformin(500 mg)tab , 343 dhar cs methyldopa tab. 250mg , 344 dhar cs methyl ergometrine inj meleate(0.2 mg /ml (1ml amp)) , 345 dhar cs methyl ergometrine maleate tab(0.125mg) , 346 dhar cs methyl prednisolone(4mg)tab , 347 dhar cs methyl prednisolone(500mg)inj , 348 dhar cs methyl prednisolone sodium succinate inj.1000mg vial(1000mg vial) , 349 dhar cs methyl prednisolone tab(16 mg) , 350 dhar cs metoclopramide(10mg)tab , 351 dhar cs metoclopramide 5mg/ml(2 ml amp) , 352 dhar cs metoprolol( 25mgsustained release )tab , 353 dhar cs metoprolol(50mg)tab , 354 dhar cs metronidazole 500mg/100 ml(100 ml ffs bottle) , 355 dhar cs metronidazole oral suspension(200 mg/5ml (60 ml bottle)) , 356 dhar cs metronidazole tab(400mg) , 357 dhar cs miconazole cream i.p. 2% w/w(15 gm tube) , 358 dhar cs midazolam(1mg/ml (10ml vial)) , 359 dhar cs midazolam(1mg/ml (5ml amp)) , 360 dhar cs mifepristone 200mg (1 tab)+misoprostol 200mcg (4 tab)(combipack) , 361 dhar cs mifepristone(200 mg)tab , 362 dhar cs misoprostol(100 mcg 4 tables / pack)tab , 363 dhar cs misoprostol(200mcg)tab , 364 dhar cs montelukast(5 mg)tab , 365 dhar cs morphine(injection 15 mg/ml 1 ml ampule) , 366 dhar cs morphine sulphate(10 mg)tab , 367 dhar cs morphine sulphate inj. ip 10mg/ml(1ml ampoule) , 368 dhar cs moxifloxacin 0.5% w/v(5 ml)eye drop , 369 dhar cs multivitamin sugar coated tab nfi formula multivitamin sugar(item with additional vitamin will also be considered and film coated also acceptable) tab , 370 dhar cs mupirocin(2% w/w (5 gm tube)) , 371 dhar cs naloxone inj. 0.4 mg/ml(1ml ampoule) , 372 dhar cs neostigmine(0.5mg/ml (1ml amp)) , 373 dhar cs nicotinamide(tablet 50 mg) , 374 dhar cs nifedipine(10mg tab) , 375 dhar cs nifedipine capsule(5mg cap) , 376 dhar cs nitroglycerine(glyceryl trinitrate)(sublingual tab 0.5 mg) tab , 377 dhar cs nitroglycerine inj. 25 mg/5ml(5ml) , 378 dhar cs noraderanaline bitartrate(2 mg base/2ml (2ml amp)) , 379 dhar cs noradrenaline bitartrate2 mg base / 2 ml amp injection(2 ml amp) , 380 dhar cs norfloxacin(100 mg dispersible tablet) , 381 dhar cs norfloxacin tab. 400mg , 382 dhar cs normal saline(0.9% (500ml ffs bottle)) , 383 dhar cs normal saline(nasal drops: sodium chloride drops 0.05% w/v 10 ml vial) , 384 dhar cs ofloxacin(200mg)tab , 385 dhar cs ofloxacin tab 400 mg(ofloxacin tab 400 mg) , 386 dhar cs olanzapine(10mg tab) , 387 dhar cs olanzapine( 5 mg)tab , 388 dhar cs ondansetron(2mg/5ml 30ml bottle) , 389 dhar cs ondansetron(2 mg/ ml (2 ml amp)) , 390 dhar cs ondansetron(tab 4 mg) , 391 dhar cs ormeloxifene(tablet 30 mg 10x10) , 392 dhar cs ors who powder glucose anhydrous 13.5g/lsodium chloride 2.6g/l potassium chloride 1.5g/l trisodium citrate 2.9g/l(as per attached pack specification) powder , 393 dhar cs oxaliplatin(100mg) , 394 dhar cs oxygen gas(oxygen gas for inhalation) , 395 dhar cs oxytocin inj(5 iu/ml (1ml amp)) , 396 dhar cs paclitaxel 260mg(43.34ml vial) , 397 dhar cs paracetamol(125 mg/ml)drop , 398 dhar cs paracetamol(500mg)tab , 399 dhar cs paracetamol inj(150mg/ml 2ml amp(2ml amp)) , 400 dhar cs paracetamol syrup/suspension 125 mg/5ml (60ml bottle)(syrup) , 401 dhar cs paracetamol tab(650 mg)tab , 402 dhar cs pediatric solution like isolyte(p n/2 and n/5) , 403 dhar cs pemetrexed(500mg)inj , 404 dhar cs penicillin v(phenoxymethyl penicillin potassium)(250 mg)tab , 405 dhar cs pentaprazole inj vial(40 mg) , 406 dhar cs pentazocine lactate(30mg/ml (1 ml amp)) , 407 dhar cs permethrin lotion 5% w/v(60 ml bottle) , 408 dhar cs pheniramine maleate(22.75 mg/ml (2 ml amp)) , 409 dhar cs phenobarbitone(200 mg/ml)inj , 410 dhar cs phenobarbitone(30 mg)tab , 411 dhar cs phenobarbitone(60 mg tab) , 412 dhar cs phenytoin sodium(100mg)tab , 413 dhar cs phenytoin sodium(50 mg/ml (2ml amp)) , 414 dhar cs phytomenadione injection 10mg/ml(10mg ampule) , 415 dhar cs phytomenadione injection(10 mg/ml) , 416 dhar cs pilocarpine eye drops 2%(5ml) , 417 dhar cs pioglitazone(15 mg)tab , 418 dhar cs piperacillin + tazobactum(4.5 g) , 419 dhar cs plasma derived activated prothrombin complex concentrate(500 units/vial) , 420 dhar cs plasma derived factor viii(250iu/vial) , 421 dhar cs plasma derived factor viii 500 iu / anti hemophillic factor viii 500 iu(vial) , 422 dhar cs pomalidomide(cap 2 mg) , 423 dhar cs potassium chloride oral solution 100mg/ml(200ml bottle) , 424 dhar cs povidine iodine(gargle 2% w/v 100 ml bottel) , 425 dhar cs povidone iodine(5% 100 ml)solution , 426 dhar cs povidone iodine ointment 5%(15gm tube) , 427 dhar cs povidone iodine vagi pessary tab (200 mg) , 428 dhar cs pralidoxime (pam) inj(25 mg/ml) , 429 dhar cs prednisolone(1% eye drop) , 430 dhar cs prednisolone tab 20 mg(dispersible tablet also acceptable) tab , 431 dhar cs pregabalin (sr tablet also acceptable)(150 mg)tab , 432 dhar cs premix insulin 30:70(40 iu/ml) , 433 dhar cs premix insulin(30:70 injection (regular: nph)2 vial of 100 ml) , 434 dhar cs primaquin(2.5mg)tab , 435 dhar cs primaquin(7.5mg)tab , 436 dhar cs primaquine(15mg)tab , 437 dhar cs promethazine 25 mg/ml(2 ml amp)inj , 438 dhar cs promethazine(50mg(25mg/ml))inj , 439 dhar cs promethazine 5 mg/5ml(60 ml bottle) , 440 dhar cs promethazine(injection 10 mg/ml 2ml vial) , 441 dhar cs propofal(injection 10 mg/ml 1 ml /vial) , 442 dhar cs propranolol tab(10 mg)tab , 443 dhar cs protamine(injection 50 mg/5 ml 5 ml vial) , 444 dhar cs pyridoxine(100 mg)tab , 445 dhar cs pyridoxine(40 mg)tab , 446 dhar cs pyridoxine tab 10mg , 447 dhar cs quinine dihydrochloride(300mg/ml (2ml amp)) , 448 dhar cs quinine sulphate(300mg)tab , 449 dhar cs rabeprazole(20 mg)tab , 450 dhar cs rabies immunoglobulin inj 300 iu((2ml vial pfs)) , 451 dhar cs rabies vaccine human (tissue culture) id/im(inj 2.5 iu/ ml 1 vial with 1 ml diluents) , 452 dhar cs ramipril(2.5 mg)tab , 453 dhar cs ranitidine(150mg)tab , 454 dhar cs ranitidine(50mg/2) ampul , 455 dhar cs recombiant fviia(1mg/vial) , 456 dhar cs recombinant anti hemophilic factor viii(250 iu inj / vial) , 457 dhar cs recombinant anti hemophilic factor viii(500 iu inj / vial) , 458 dhar cs recombinant f ix(500iu/vial) , 459 dhar cs rh erythropoetin(2000 i.u) , 460 dhar cs rh erythropoietin(injection 2000 iu/ml prefilled syringe of 1 ml injection) , 461 dhar cs riboflavin(tablet 5 mg 10 x 10)tab , 462 dhar cs ringer lactate ip i/v 0.24 % w/v of lactic acid ( eq. to 0.32% w/v of sodium lactate)0.6 % w/v sodium chloride 0.04 % w/v potassium chloride and 0.027 % w/v calcium chloride(500ml ffs bottle) infusion , 463 dhar cs risperidone(12.5 mg )inj , 464 dhar cs risperidone(2 mg)tab , 465 dhar cs risperidone(50 mg injection vial of 2 ml) , 466 dhar cs rituximab(500mg )inj , 467 dhar cs salbutamol inhalation ip 100mcg/dose(200 metered dose container) , 468 dhar cs salbutamol sulphate (2mg/5ml 60ml)(60ml bottle) , 469 dhar cs salbutamol sulphate(4mg)tab , 470 dhar cs salicylic acid 6 % ointment(6 % ointment) , 471 dhar cs silver sulphadiazine cream(usp 1% w/w 25gmtube) , 472 dhar cs sitagliptin(50 mg)tab , 473 dhar cs sodium aminosalicylate granules(10 gm bottel of 100 gm) powder , 474 dhar cs sodium bicarbonate inj. 7.5% w/v(10ml) , 475 dhar cs sodium chloride n/2 injection(0.45%(100ml ffs bottle)) , 476 dhar cs sodium chloride n/2 injection ip (0.45%)(500ml ffs bottle) , 477 dhar cs sodium chloride normal saline(100ml ffs bottle) , 478 dhar cs sodium thiopentone 0.5 gm powder/vial(20ml vial) , 479 dhar cs sodium valproate(200mg)tab , 480 dhar cs sodium valproate(500 mg)tab , 481 dhar cs sodium valproateoral solution(200 mg / 5 ml) , 482 dhar cs sodium valproate oral solution(200 mg / 5 ml) , 483 dhar cs sorafenib(200mg)tab , 484 dhar cs spironolactone(25mg)tab , 485 dhar cs streptokinase inj 15 lac iu(vial/amp) , 486 dhar cs succinyl choline(50mg/ml (10 ml vial)) , 487 dhar cs sucralfate(1gm/5ml)syrup , 488 dhar cs sucralfate (20 mg tablet 10 x 10)tab , 489 dhar cs sulfamethoxazole and trimethoprim(400mg + 80mg) tab , 490 dhar cs sulfamethoxazole and trimethoprim(800mg + 160mg) tab , 491 dhar cs sulfamethoxazole +trimethoprim suspension (200 mg + 40 mg) / 5 mlsuspension(50 ml bottle) , 492 dhar cs sulfamethoxazole +trimethoprim tab(200 mg + 40 mg)tab , 493 dhar cs sulfasalazine(500 mg)tab , 494 dhar cs sumatriptan(25mg)tab , 495 dhar cs surfactant suspension(inj 25 mg/ml) , 496 dhar cs suspension for intratracheal instillation(80mg/ml (pack size as licensed)) , 497 dhar cs tab mebeverine(tab 200 mg 10 x 15)tab , 498 dhar cs tamoxifen(10 mg)tab , 499 dhar cs tamoxifen(20mg)tab , 500 dhar cs tamoxifen tab.(10 mg)tab , 501 dhar cs tapentadol(100 mg)tab , 502 dhar cs telmisartan(40 mg)tab , 503 dhar cs temozolomide(250mg)cap , 504 dhar cs tetanus immunoglobulin(usp/ip 250 iu/vial) , 505 dhar cs thiamine(injection 100 mg/ml 1 ml/vial) , 506 dhar cs thyroxine sodium tab 100 mcg (100 tab bottle)(100 tab) , 507 dhar cs thyroxine sodium tab(50mcg(100 tab bottle)) , 508 dhar cs timolol maleate i.p. 0.5 %w/v(5 ml vial)eye drop , 509 dhar cs tinidazole(300 mg)tab , 510 dhar cs tiotropium 18mcg(30cap. x 6 pack with 1 dispensing device) , 511 dhar cs tiotropium 9mcg 180 doses inhaler(180 or more doses acceptable) , 512 dhar cs topotecan(inj 4 mg 4 ml vial) , 513 dhar cs tramadol(50mg/ml (2ml amp)) , 514 dhar cs tramadol(50mg)tab , 515 dhar cs tranexamic acid(500 mg tab)tab , 516 dhar cs tranexamic acid injection bp/ip(100mg/ml (5ml amp)) , 517 dhar cs trastuzumab 440 mg injection(vial) , 518 dhar cs trihexyphenidyl(2mg )tab , 519 dhar cs tropicamide(1% 5ml vial)eye drop , 520 dhar cs turpentine oil(repacking license is also eligible)(50ml bottle) , 521 dhar cs urokinase(5 laciu) , 522 dhar cs vancomycin hydrochloride(1000mg vial) , 523 dhar cs vancomycin hydrochloride(250mg vial) , 524 dhar cs vancomycin hydrochloride(500mg)inj , 525 dhar cs vecuronium bromide(2mg/ml (2ml amp)) , 526 dhar cs verapamil(40 mg ip)tab , 527 dhar cs verapamil(injection 5 mg/2 ml 2 ml vial) , 528 dhar cs vinblastine(10mg inj.) , 529 dhar cs vincristine sulphate(1mg/ml (cytocristin inj) 1 ml vial) , 530 dhar cs vinorelbine(10 mg)inj , 531 dhar cs vitamin a syrup(100000 iu/ml with market spoon for 1ml and 2 ml (100 ml bottle)) , 532 dhar cs vitamin b12 inj 500 mcg/ml(30 ml amp/vial) , 533 dhar cs vitamin b1(thiamine 100 mg) , 534 dhar cs vitamin. b complex nfi (prophylactic)(b12 mgb22mg b6 0.5 mg niacinamide 25 mg calcium pantothenate 1 mg) tablet , 535 dhar cs vitamin k1(1mg/0.5ml (0.5 ml amp)) , 536 dhar cs warfarin(1 mg ) , 537 dhar cs warfarin(2 mg) , 538 dhar cs warfarin sodium(5 mg) , 539 dhar cs water for injection5 ml amp , 540 dhar cs water for injection ip(2 ml amp) , 541 dhar cs wax solvent ear drops: benzocaine(2.7% w/v 10 ml bottel drop) , 542 dhar cs wax solvent ear drops:paradichlorobenzene(2 % w/v 10 ml bottel) , 543 dhar cs xylometazoline 0.05% nasal 10ml(0.05% 10ml) , 544 dhar cs xylometazoline nasal(0.1%w/v (10 ml vial)) , 545 dhar cs zinc dispersible(20mg) , 546 dhar cs zinc sulphate dispersible(10mg) , 547 dhar cs zoledronic acid(4mg vial) , 548 dhar cs zolpidem 10 mg(tablet) , allopurinol(100mg),tablet [110034] , ringer lactate ip i/v 0.24 % w/v of lactic acid ( eq. to 0.32% w/v of sodium lactate), 0.6 % w/v sodium chloride, 0.04 % w/v potassium chloride and 0.027 % w/v calcium chloride(500ml ffs bottle),infusion [110398] , sodium valproate enteric coated tab. bp(200 mg),tablet [4710043] , multivitamin drops (approx 22 drops)( ),drop [4550009] , hepatitis b immunoglobulin(100 iu/vial),vial [110319] , multivitamin drops (approx 22 drops)( ),drop [4550009] , noraderanaline bitartrate(2 mg base/2ml (2ml amp)),injection [700472] , sodium chloride normal saline(100ml ffs bottle),infusion [110396] , diclofenac + menthol(30gm),tube [987636] , piperacillin + tazobactam 1000 mg + 125 mg vial 10 ml vial( ),injection [120570] , electrolyte p inj 500ml bfs bottle(500ml bfs bottle),injection solution for [4350395] , adenosine(6 mg/ 2ml ),injection [2023012002] , caffeine citrate inj. 20mg/ml (3 ml vial)(20mg/ml 3 ml vial),injection [987622] , amoxycilline(500mg),capsule [110073] , digestive drop ( digestive enzyme and multivitamin with l lysine )( 15 ml),drop [987868] , drop iron(15ml),consumable [987633] , cefixime 10 ml drops(10 ml),drop [2020108] , povidine iodine(5% 125gm),ointment [20210877] , multivitamin with zinc drop 15ml(15 ml),drop [700526] , insulin soluble inj. 40 iu/ml [4350097] , cefixime 10 ml drops(10 ml),drop [2020108] , drop iron(15ml),consumable [987633] , multivitamin drops (approx 22 drops)( ),drop [4550009] , multivitamin with protein 200 ml(200 ml),syrup [700505] , cefpodoxime 200 mg + ofloxacine 200mg tab.(200+200),tablet [120980] , cefixime(200 mg tab (dt tablet also acceptable) ),tablet [4710186] , diclofenac + menthol(30gm),tube [987636] , montelukast(5 mg),tablet [202209071] , amiodarone 50mg/ml(3ml vial/amp),injection [1100207] , cap antioxident , tab cabergoline 25 mg , gel piroxicam , protien powder 500 gm , syp. multivitamin 200 ml , syp. cyproheptadine 170 ml , tab dipin 5 mg , guage than , guage swab 4 layer 20x20 , guage swab 6 layer 20x40 , bandage roll 10 cm , bandage roll 15 cm , diclofenac spray , gel diclofenac + menthol , mct oil , enzyme drop , i/v dextrose 50% 100 ml , vitamin d3 drop , domperidone drop , cefixime drop , coloplast bag , infusion syringe pump concentrator , soft cotton roll , identification tag , methylated spirit(500 ml bottle),consumable [121189] , disposable spinal (l.p.) needle(25g),surgical material [6451074] , disposable spinal needle(22 no),each [700130] , disposable spinal needle(23 no),each [700128] , spinal (l.p.) needle disposable(24g),consumable [987783] , spinal needle(24 g),consumable [700417] , spinal needle 26 g(each),needle [700484] , absorbable gelatine sponge(ip 80mm x 50mm x 10mm),consumable [6270001] , bacillus thuringiensis var israeliensis(5% wp),consumable [202208001] , films of size 10x12 inches compatible films to dr system(10x12 inches),film [202111003] , films of size 11x14 inches compatible films to dr system(11x14 inches),film [202111002] , films of size 14x17 inches compatible films to dr system(14x17 inches),film [202111001] , films of size 8x10 inches compatible films to dr system(8x10 inches),film [202111004] , who hemoglobin color scale (starter kit) components (1) colour scale 01/kit (2)test strip 1000/kit (3) printed literature for method of use/kit (4)lancet 1000/kit 10x100(nabl/cap accrediated lab test certificate for the batch no. must be enclosed with each supply delivered),consumable [mis145] , filter paper(12.5 cm, 0.1 micron, 50/pkt),consumable [202011098] , neubauers chamber(each),consumable [700604] , diagnostic strips for urine sugar/albmin packing: amber colored, 100 strips/pkt(packet),consumable [700836] , typhoid test card(an immunochromatography assay for the rapid visual detection of typhoid antibody igg/igm in human serum/plasma)(50 test per pack),consumable [987739] , non foldable iol sterile lens pc+14d (2),pc+16d (3),pc+18d (5),pc+19d (5),pc+19.5d (5),pc+20d (15),pc+20.5d (15),pc+21d (13),pc+21.5d (10),pc+22d (10),pc+22.5d (5),pc+23d (5),pc+24d (3),pc+26d (2),ac+19d(2)(box),lens [700427] , trypan blue(0.06% 1 ml),solution [140104] , sterile(gauze),consumable [202203013] , para film sealing film, quantity 510 roll, rate should be quoted for per roll, parafilm, 100 mm width, 58m length, should withstand at temprature between 40deg c to +50deg c(100 mm width, 58m length),consumable [202011049] , column based viral rna extraction kit(from cell free samples),kit [202112013] , peripheral inserted central catheter(4 fr),consumable [202203008] , peripheral inserted central catheter(5 fr),consumable [202203009] , capd fluid (continuous ambulatory peritoneal dialysis fluid) 1.5% 2 litre bag(each),consumable [202106001] , capd fluid (continuous ambulatory peritoneal dialysis fluid) 2.5% 2 litre bag(each),consumable [202106002] , capd simple(disconnect set),consumable [202106010] , minicap (capd) with povidon iodine(each),consumable [202106004] , outlet port clamp(each),consumable [202106009] , titenium chemo port with silicon catheter (8 9.6 fr) length 60cm 80cm, guide wire, peel away desilet, hubsite needle(22 g * 20 25.4mm),consumable [mis137] , hepatitis e virus anti hev igm antibody (elisa)(as per attached specification),consumable [202012036] , serum creatinine(100 ml bottle (2 x 50 ml)),consumable [700735] , troponin 1 kit(10 test per pack),consumable [700550] , uric acid(50 ml(2 x 25 ml),consumable [121133] , blood urea reagent kit(200ml (2x100ml)),consumable [mis20] , cedar wood oil(125 ml),consumable [121023] , cpk mb kit (kinetic)(25 test/kit),consumable [mis31] , edta solutions k3(500 ml bottle),consumable [700752] , gram iodine (gram stain)(100ml bottle),consumable [700186] , gram staining kit(125ml x 4),consumable [800101] , h2so4 (sulphuric acid)(25% 500 ml bottle),consumable [700535] , methyl blue for (z n)(125 ml bottle),consumable [mis80] , safranine (gram stain)(500 ml bottle),consumable [mis105] , heated breathing circuit(for hfnc),consumable [202302001] , humidifier chamber(for hfnc),consumable [202302002] , cyphenothrin(5% ec),consumable [20210225] , foldable iol sterile lens pc+14d(lens 2),pc+16d(lens 3),pc+18d(lens 5),pc+19d(lens 5),pc+19.5d(lens 5),pc+20d(lens 15),pc+20.5(lens 15),pc+21d(lens 13),pc+21.5d(lens 10),pc+22d(lens 10),pc+22.5d(lens 5),pc+23d(lens 5),pc+24d(lens 3),pc+26d(lens 2)((one box should contain 100 pieces as per specification of power given),lens(attached specification (100 lens per box)),consumable [mis55] , adhesive plasters usp(7.5 cm x 5 mts/roll),consumable [6550014] , adhesive tape 7.5cm x10(mtr/roll),consumable [700446] , paper adhesive plaster microporous surgical tape 1 inch x 9 m / roll(1 inch * 9 m/roll (iso 13485:2016)),consumable [700122] , paper adhesive plaster microporous surgical tape(4 inch x 9 m / roll (iso 13485:2016)),consumable [700123] , sterile disposable/hypodermic syringe for single use(5ml (with needle) :is 10258 :2002 marked),consumable [mis118] , sterile disposable/hypodermic syringe(is 10258:2002 with needle 10ml),consumable [mis119] , sterile disposable/hypodermic syringe with needle for single use(2ml :is10258 marked:),consumable [mis122] , cr system film(size 10x12),consumable [21100202] , cr system film(size 14x17),consumable [21100203] , cr system film(size 8x10),consumable [2110021] , disposable syringe(50 ml),syrings [mis44] , baby diapers small(10 diaper per pkt),consumable [700431] , cbnaat cartridge make cepheid(gxmtb/rif mii 50),consumable [202308029] , blood transfusion set(each),consumable [201396] , foleys urinary catheter 2 way(size 22 each),consumable [700743] , follyscathator (pediatrics),consumable [202110006] , folys catheter(size 16 plain),consumable [202110007] , infant feeding tube (catheter) size: 3g(no.),consumable [700438] , infant feeding tube (catheter)(size: 4g),consumable [20200725] , infant feeding tube(size: 6g),consumable [20200726] , latex based baloon (capacity 30 50 ml) foleys urinary catheter(3 way size 20),consumable [700874] , suction catheter assorted(10 no/each),consumable [700441] , suction catheter assorted 9 no/each(each),consumable [700440] , collagen sheets(10 x 10 cm sheet),sheet [4390002] , ambu bag/adult each 1000 1700ml, with oxygen connecting tube ,should be supplied with a carry pouch , ambu bag should be complete with required autoclavable valves and other accessories,((should have silicon rubber bellow to withstand autoclave at 134 degree c)should be multiple times autoclavable),consumable [121210] , ambu bag (silicon type) paediatrics each 300 500 ml with oxygen connecting tube,should be supplied with a carry pouch, ambu bag should be complete with required autoclavable valves and other accessories( should have silicon rubber bellow to withstand autoclave at 134 degree c,should be autoclavable upto 40 times),consumable [202109007] , sanitizing agent(50 ml),bottle [202209093] , electrolyte concentrate(10 litre/pack),consumable [202208022] , surgical blade isi marked, size 15(100 per packet),surgical material [mis123] , surgical blade isi marked, size 22(100/pkt),surgical material [mis124] , surgical blade isi marked, size 23(100/pkt),surgical material [mis125] , surgical blade isi marked, size 24(100/pkt),surgical material [mis126] , leukoreduction filter((bed side) post storage),consumable [20250902] , cr system cassette size(10x12),consumable [202210021] , cr system cassette size(14x17),consumable [202210022] , cr system cassette size(8x10),consumable [202210023] , cr system film(size 10x12),consumable [21100202] , cr system film(size 14x17),consumable [21100203] , cr system film(size 8x10),consumable [2110021] , black braided silk with 1/2 cir cutting needle 30mm length 75 cm(1/0 12 foils/pkt),consumable [mis18] , chromic catgut (12 foils/pkt)(size:1/0 length at least 150 cm),consumable [987772] , polyester braided coated with 1/2 cir cd white dn 17 mm taped cut 90 cm 2/0 size(12 foils/pkt),consumable [mis93] , mackintosh (as per attached specification), quantity amended as 136940 meter i.e. 6847 roll of 20 meter roll, rate should be quoted for 20 meter(is 8164 1976 or conforming to is 8164 1976),consumable [202109001] , rtpcr kit for covid 19 (as per attached specification)(make m/s genes2me pvt ltd model viraldtect ii),consumable [202101011] , alcohol (absolute)(500 ml),consumable [122008] , mva kit (mannual vaccum aspiration kit)(as per attached specification),consumable [700890] , disposable plastic appron(full size),consumable [700447] , disposable surgeon cap with cable tie(each),consumable [202206004] , ecg jelly 250 gms(bottle),jelly [700024] , echo jelly 250ml bottle(bottle),jelly [700199] , plastic disposable(shoe cover),consumable [202301004] , sputum container(100 per box),consumable [121191] , usg gel(250 ml bottle),consumable [700740] , coated polyster with 1/2 cir green needle 17 mm (curved reverse cutting or curved round body or taper cut) size:2/0 length 90cm(.),consumable [202212002] , gloves latex autoclavable(8 no (pair) made of natural latex micro rough finish for better grip),consumable [mis59] , synthetic, monofilament, nonabsorbable polyprolene mesh 7.5 x 15 cm( each),consumable [202212001] , mask oxygen with connection tube, reservoir bag and valve, high concentartion(adult),consumable [202204018] , mask oxygen with connection tube, reservoir bag and valve, high concentartion, paediatric/ non rebreathing mask(oxygen mask with reservoir bag),consumable [202204019] , nebulization mask kit(adult),mask [700025] , nebulization mask kit(pediatrics),consumable [700323] , oxygen mask adult(standard size),mask [6601029] , oxygen mask paediatric(standard size),mask [4390003] , 0.2 ml pcr tube(sterile, flat cap shaped),consumable [20200826] , columbia blood agar base(500 gm),consumable [121013] , diluent for dna extraction/ ethanol, molecular(biology grade 500ml),consumable [2020777] , isopropanol, molecular(biology grade 500ml),consumable [20200827] , muller hinton agar(500 gm),consumable [121009] , potassium permanganate, powdered(analytical grade 500 gm),consumable [20200829] , solubility test kit (for sickle cell), as per attached specification, control sample is not mandatory acessories required 1. dropper 2.test tube (standard size)/vial 3. reading stand 4.micropipette with tip/capillary tube 5.lancet(6.alcohol swab , kit),kit [131145] , swab stick with tube sterile(70 80 mm length 10 15 mm diameter), unit 1(100/pkt , packet),consumable [700685] , bcg(1 ml each),syrings [700840] , disposable(24 g each),needle [700841] , disposable needle 20 g no(isi marked needle),consumable [121114] , disposable needles(is 10654:2002 22g),surgical material [6451076] , disposable needles is 10654:2002(23g),needle [700843] , disposable needles is 10654:2002 (26 g (1 1/2 inch)),consumable [202110002] , disposable needles is 10654:2002 (26 g (1 inch)),consumable [202110003] , disposable needles is(10654:2002 26 g),needle [700394] , disposable sharp collection containers(5 ltr),consumable [700294] , disposable syringe {auto disabled (ad)/re use prevantion(rup) syringe}((for vitamin k inj)(1ml with needle 26g)),consumable [121134] , disposable syringe with needle(1ml each),syrings [20201062] , hypodermic needles for single use bis gauze(23 length, 25 mm + 1),needle [700839] , needle hypodermic size is(10654:2002 23g),needle [700174] , needle hypodermic size is(10654:2002 24g),consumable [987786] , reuse prevention syringe sterile single use reuse prevention syringe with detachable needles compliance to iso 7886:4 type i and b,flow wrap/ blister pkg using medical grade breathable paper, eto sterilized(3ml),consumable [987824] , reuse prevention syringe sterile single use reuse prevention syringe with detachable needles compliance to iso 7886:4 type i,b,flow wrap/ blister pack using medical grade breathable paper, eto sterilized(2ml),consumable [20200740] , reuse prevention syringe sterile single use reuse prevention syringe with detachable needles compliance to iso 7886:4 type i,b, flow wrap/blister pack using medical grade breathable paper, eto sterilized(5ml),syrings [700023] , syringe with luer lock technology(10 ml syringe),syrings [202203011] , syringe with luer lock technology(5 ml syringe),syrings [202203012] , anti hav igm (elisa)(as per attached specification),consumable [202012030] , disposable cresent knife(2.2mm),consumable [mis38] , disposable keratom knife(2.8mm),consumable [mis40] , disposable keratom knife(3.2mm),consumable [mis41] , disposable sideport knife(num),consumable [mis43] , test card for abg machine(for abg m/c),consumable [202302003] , disposable(cap),consumable [6940001] , disposable under pad dimention of sheet 60*90 cm(inside)(weight 80 gm unit),consumable [121208] , elbow length latex gloves(large),consumable [mis48] , elbow length latex gloves(medium),consumable [mis49] , elbow length latex gloves(small),consumable [mis50] , utility gloves(large),consumable [mis161] , utility gloves(medium),consumable [mis162] , simcoe i/a cannula,direct,(num),consumable [mis110] , sterile disposable insulin syringe each (graduation upto 100 units) 30g needle(40 units/ml (30 g needle, 40units/ml)),syrings [202211181] , blood grouping kit having anti sera a monoclonal(10 ml vial), anti sera b monoclonal(10 ml vial) and anti sera d monoclonal(10 ml vial),consumable [20201039] , serum t3 kit, elisa(96 test kit each),consumable [700551] , serum t4 kit, elisa(96 test kit each),consumable [700552] , serum tsh kit, elisa(96 / pkt),consumable [700553] , alphacypermethrin 5% wp(to be supplied in 25kg or 20kg pack(as per technical specification)),consumable [isct006] , cr system cassette for konica minolta(size 10x12),consumable [202308024] , cr system cassette for konica minolta(size 14x17),consumable [202308023] , cr system cassette for konica minolta(size 8x10),consumable [202308025] , cr system film for konica minolta size(size 10x12),consumable [202308021] , cr system film for konica minolta size(size 14x17),consumable [202308020] , cr system film for konica minolta size(size 8x10),consumable [202308022] , indelible ink marker(pen),consumable [con210101] , cervical collar/each soft,(medium sized),consumable [700430] , plaster of paris bandage 10 cm x 2.7 mtr / roll(roll),bandage [700226] , plaster of paris bandage 15cm x 2.7mtr / roll(roll),bandage [6030008] , k3 blood vaccutainer(edta 100 tubes/pkt),consumable [700465] , urine container size of the container shall be 30ml disposable(50 per pkt),consumable [7004071] , widal slide test(4x5ml with control),consumable [73001] , abdominal drain(set 32 no),each [mis05] , airway, oropharyngeal guedel, set with size of: no. 3(80 mm),consumable [2020765] , airway, oropharyngeal guedel, set with size of: no. 4(90 mm),consumable [2020766] , disposable circuit for ventilator(as per specification),surgical material [20200504] , disposable nasal canula compatible for heated humidified high flow oxygen therapy(adult size),consumable [20200844] , disposable nasal canula compatible for heated humidified high flow oxygen therapy(neonatal size),consumable [20200845] , electric cautery lead/each disposable electro surgical pencil 4cm(each),each [120864] , endotracheal tube no(2.5(uncuffed)),tube [20201060] , endotracheal tube no(3.5(uncuffed)),tube [202011003] , endotracheal tube no 3(uncuffed),consumable [202011005] , endotracheal tube no(4.0(uncuffed)),tube [202011004] , endotracheal tube no 4.5(uncuffed),tube [202011002] , hmef, filter, heat and moisture exchanger with viral filter (hmef), high efficiency(with connectors,single use certification required for viral filtration),consumable [2020761] , hme filter(as per specification),each [20200503] , nasal prong(adult),consumable [2020771] , non invasive masks for niv therapy large size(as per attached specification),consumable [2020763] , non invasive masks for niv therapy medium size( as per attached specification),consumable [2020762] , non rebreathing mask(oxygen mask with reservoir bag),consumable [2020772] , polyethylene high pressure extension tube(length 150cm),consumable [mis94] , silicon mask adult size 3 with connection tube, reservoir bag and valve, high concentration, adult(bains circuit),consumable [202208026] , silicon mask adult size 4 with connection tube, reservoir bag and valve, high concentration, adult(bains circuit),consumable [202208027] , silicon mask size 0 paediatric with connection tube, reservoir bag and valve, high concentration, paediatric(jackson rees circuit),consumable [2020769] , silicon mask size 1 paediatric with connection tube, reservoir bag and valve, high concentration, paediatric(jackson rees circuit),consumable [2020770] , umbical cord clamps(plastic material),consumable [700322] , black braided silk with 1/2 cir cutting needle 30mm length 75 cm(1/0 12 foils/pkt),consumable [mis18] , polyglecaprone with 1/2 cir oval/rb needle 26 mm length 70 cm size 3/0(12 foils/pkt),consumable [mis95] , i.v. cannula with injection valve(size 24 g),consumable [700179] , three way stop(cock),consumable [700181] , disposable syringe with needle 10ml(each),consumable [202212003] , disposable syringe with needle(20ml each),syrings [700443] , disposable syringe with needle(3ml each),syrings [700421] , chromic (12 foils/pkt)(3/8 rb needle 30 mm, length 76 cm, size 2/0),needle [700560] , chromic size 1/0 (12 foils/pkt)(3/8 cir rb needle 40 mm, suture length 76 cm),needle [700572] , chromic with st rb needle (12 foils/pkt)(60 mm length 76 cm size:2/0),consumable [6450009] , polyamide with cd r cut extra penetrating needle (12 foils/pkt)(size 4/0),consumable [987778] , poly propylene mono filament sterile precut with 1/2 cir rb d needle 16mm length 70 cm non absorbable surgical sutures usp size 5/0(12foils/pkt),consumable [700335] , gauze sponge/each(size 3 x 3 inches),consumable [202301005] , triway cannula(3 way stop cock),consumable [700180] , flow meter with humidifier bottle(as per attached specification),consumable [2020760] , laryngeal mask airway (lma)(no. 3),consumable [2020767] , laryngeal mask airway (lma)(no. 4),consumable [2020768] , ventury mask, with percent o2 lock + minimum 2.0 m tubing size adult(as per attached specification),consumable [2020764] , dengue ns 1 elisa (antigen) kit(pack of 96/as per attached specification in tender),consumable [700473] , malaria bivalent antigen detecting rapid diagonstic tests(rdts) for p.f and pv (10 card, 10 capillary,1 buffer solution,10 alcohol swab,10 sterile lancet(0.15 mm to 0.75mm diameter needle based lancet mounted on small non metallic pedastal for pricking,(pack of 10 test., rate shall be quoted for pack of 10),specification attached),consumable [20200730] , dual testing kit for hiv and syphilis screening, rapid diagnostic test kit(total no. of test 900000),consumable [20250901] , 8 0 nylon (polyamide) black monofilament suture double armed(advanced micropoint spatula needle dia 0.20mm, length 6.0mm, 3/8 circle 140 degree suture length min. 38 cm),consumable [202202003] , b.b silk with 1/2 cir rb needle 20 mm length at least 75 cm non absorbable surgical suture usp size 3 0,(12foils/pkt),needle [700104] , chromic with cd rb needle 30 mm length 76 cm size:2/0(absorbable surgical suture surgical usp, 12 foils/boxmaterial),surgical material [987770] , nylon suture,macrofilment spatulated, micropoint double armed size 10 0(12 foils/pkt),sutures [700870] , skin closure stapler (35 pins high quality medical grade plastic,cartridge with ss rectangular design pins with wire diameter 0.60 mm and size after closure( 7.2 x 4.3 mm),consumable [700266] , virgin silk suture 8 0, non absorbable filament of silk fibre,(needle dia 0.20mm, length 6.0mm, 3/8 circle spatulated 140 degree, suture length min.38cm.),consumable [202202001] , blood bag triple 350ml as per attached specification(each),bag [121200] , blood bag triple sagam 450ml(as per attached specification),each [121211] , leukoreduction filter (lab side) prestorage(as per attached specification),consumable [20250903] , minicap (capd) with povidon iodine(each),consumable [202106004] , titanium adapter(each),consumable [202106005] , top and bottom bags for leukoreduction(as per attached specification),consumable [20250904] , transfer set(each),consumable [202106006] , ecg paper(chemical coated)(50mm*20 mm roll),each [700239] , ecg paper (chemical coated)(80mmx 20 mtr each),consumable [700538] , double lumen polyurethane cvp catheter 4 to 5 fr(length 8 to 13 cm,),consumable [700865] , double lumen polyurethane cvp catheter 5 fr(length 8 to 13 cm),consumable [202109169] , femoral catheters single lumen set adult(size 6f to 8f, length 13 cm to 15 cm, each),consumable [700811] , femoral guide wires : straight/j tip((0.325 mm size) sterile: ce/iso13485 marked),consumable [700825] , triple lumen jugular catheter kit,(size 12f, 16+/ 1cm, kit),consumable [700869] , trucut biopsy needle(18 g length 15 cm),each [700134] , k wire length 375mm(size:1.6mm roll),surgical material [mis70] , k wire length 375mm(size:1.8mm roll),surgical material [mis71] , tooke corneal knife(num),consumable [mis138] , sutures 6 0, braided coated polyglycolic acid / polyglactin 910, violet absorbable surgical suture with needle,1/4th micropoint spatula 8mm double arm(12 foils/packet),sutures [202211187] , bacillus thuringiensis var israeliensis 5%(as (aqueous suspension)),consumable [202208002] , intravenous set with airway and needle((adult)),surgical material [6450089] , i.v canulafixater(transperent material for fixation of i.v. cannula),consumable [20200724] , latex based baloon capacity (30 50ml) foleys catheter(size 14 2 way each),consumable [700849] , latex based baloon capacity (30 50ml) foleys catheter(size 16 2 way each),consumable [700851] , latex based baloon capacity (30 50ml) foleys catheter(size 18 2 way, each),consumable [700850] , safe delivery kit 1 plastic desposable gown (non woven plastic laminated, leak proof) 2(4*4),(2) disposable goggles for protection of eyes 2 (free size),(3) face mask 2 free size (4) plastic disposable cap (non woven plastic laminated,leak proof)(( 1pair,(5)long gloves elbow length 2pairs(6 1/2 and 7) (6)disposable shoe covers till calf (plastic) 2pair umbical cord clamps plastic material(1pair)(free size)(as per attached specification))),consumable [121130] , urinary drainage bag cap with non return valve (eo sterile)(2 litre, each),consumable [700876] , urinary drainage bag (paediatric)(100 ml / pc, each),consumable [700567] , sanitary napkins(as per attached specification/pack of 6 pads),consumable [mis106] , hcv kit card(test),digonstic [5400015] , hiv kit(card),kit [5400014] , basic fuchsin chemical name:pararosaniline hydrochloride,chemical structure c20h20cin3 mol wt:337.86 dye content: approx 85% 88% dye content must be mentioned color: metalic green(25 gms glass bottle),consumable [121138] , formaldehyde 40% (conc. formaline)(1 x 30 lit),consumable [710021] , glacial acetic acid (liquid) (100 ml bottles),consumable [202110008] , n/10 hcl (100 ml),consumable [202110010] , sulphuric acid(500ml glass bottle),consumable [121192] , pyrethrum extract 2%(25 litre drum)(as per specification attached in tender),chemical [6411086] , acetone detection kit(100 gm),powder [mis07] , auto pippets fixed volume(1000 micro liters each),consumable [mis12] , auto pippets fixed volume(10 micro liters each),consumable [mis11] , auto pippets fixed volume(20 micro liters each),consumable [mis13] , field stain b(500ml),consumable [mis53] , leishman stain(500 ml bottle),consumable [mis75] , platelet dilution fluid(100 ml),consumable [mis91] , rbc dialuation fluid(500 ml bottle),consumable [mis98] , rpr test kit(100 test),kit [mis103] , semen dilution fluid(100 ml bottle),consumable [mis107] , urea kit berthelot(100 test/kit),consumable [mis142] , disposable drape for eye surgeory(each),consumable [202206003] , salt testing kit(as per attached specification , kit),consumable [6400013] , tourniquet with belt (good quality pairs)(each),consumable [700237] , radio opaque catheter with ptfe/polyurethine/fep/volex material(iv safety cannula with luer lock (g 18)),consumable [121127] , radio opaque catheter with ptfe/polyurethine/fep/volex material(iv safety cannula with luer lock (g 20)),consumable [121128] , abdominal drain(set 32 no),each [mis05] , adult double lumen catheter set(size: 11.5 fr 12 fr, 13cm to 15cm (curved)),consumable [700824] , adult double lumen catheter set(size: 11.5 fr 12 fr, 13cm to 15cm (straight)),consumable [700823] , a v fistula sterilized twin needle(17 g (two needle pack)),consumable [700786] , blood bag double 350ml(as per attached specification),each [121210a] , blood bag triple 350ml as per attached specification(each),bag [121200] , blood bag triple sagam 350ml(each),bag [121212] , blood bag with acd/cpd solution (disposable sterilised) with needle(100 ml),bag [700675] , blood bag with acd/cpd solution (disposable sterilised) with needle(350 ml),bag [700676] , central venous catheter kit(single lumen),kit [700210] , endotracheal tube internal with radioopaque line(dia 2.5 mm to 5 mm, each),consumable [700872] , femoral catheters double lumen kit curved double lumen catheter set(12 f (curved) adult),consumable [700228] , fistula sterilized twin needle(16 g (two needle pack)),consumable [700785] , i.v cannula for single use (intravascular catheters) bis (gauze 22,length 25) consumable(each),consumable [121201] , i.v cannula size with injection valve (port)(18g),consumable [700271] , i.v cannula size with inj. valve (port)(22g),consumable [121203] , i.v cannula (two way) size(16 nos),consumable [121202] , i.v. cannula with injection valve(20g),consumable [700173] , iv cannula with inj valve(16g),consumable [mis163] , iv cannula with inj.valve (port)(size 26g each consumable),consumable [121126] , quadruple blood bags as per attached specification(each),consumable [121204] , radio opague catheter with ptfe/polyurethine/fep/volex material(iv safety cannula with luer lock (g 22)),consumable [121129] , single blood bag(as per attached specification),each [121213] , triple lumen polyurethane cvp catheter 7 to 7.5fr(g 14 16x18x18, length 16 20 cm, each),consumable [700867] , triple lumen polyurethane cvp catheter 7 to 7.5 fr(g 14 16x18x18x18, length 15 16cm, each),consumable [700866] , wound suction catheter(no 18),each [700148] , capillary tube(100 pieces),consumable [202301003] , disposable pricking lancet (pkt of 200 units)(packet),consumable [6120004] , disposable sharp collection containers(1.5 l),consumable [700246] , egc roll(66 mm x 15 mm),consumable [700321] , field stain a(500ml),digonstic [5410005] , gram iodine (gram stain)(100ml bottle),consumable [700186] , hub cutter non electric lockable safety portable box for disposal of hypodermic needles(cuts the needle from the hub of machine),each [700828] , lugols iodine (5% solution) (potassium iodine 10% w/v and iodine 5% w/v(100 ml bottle),consumable [202212004] , micro pipette tips 5 300ul(100 per pack),consumable [80002] , plain vial with screw cap (12x75),consumable [7410047] , rib belt large(each),each [700833] , rib belt medium(each),each [700834] , rib belt small(each),each [700835] , test tube, leak proof, ungraduated, polypropylene/polyethylene capacity 5ml each(each),consumable [130010] , cannula fixer set(piece),each [700602] , cloth based surgical adhesive tape roll(1 inch x 5 mtr / roll),consumable [700887] , cloth based surgical adhesive tape roll(6 inch x 10m / roll),consumable [mis28] , paper adhesive microporous surgical tape 3 inch x 5 m / roll (10 roll/pkt)(3 inch x 5 m / roll (10 roll/pkt)),consumable [700481] , big repackaging box specifications(24 inch length x18 inch width x 18 inch height),consumable [202305007] , packing kit each kit contains as per specification(1. plastic bori 10 quantity, 2. carton tape 01 quantity, 3. marker 01 quantity, 4. plastic rope 01 quantity),consumable [202012183] , sleeve (cp) green for 3fdc drugs (type a)(as per attached technical specification),consumable [202305010] , sleeve (cp) green for 3fdc drugs (type b)(as per attached technical specification),consumable [202305011] , sleeve (cp) green for 3fdc drugs (type c)(as per attached technical specification),consumable [202305012] , sleeve (ip) red for 4fdc drugs (type a)(as per attached technical specification),consumable [202305008] , sleeve (ip) red for 4fdc drugs (type b)(as per attached technical specification),consumable [202305009] , films of size 10x12 inches compatible films to dr system(10x12 inches),film [202111003] , films of size 11x14 inches compatible films to dr system(11x14 inches),film [202111002] , films of size 14x17 inches compatible films to dr system(14x17 inches),film [202111001] , films of size 8x10 inches compatible films to dr system(8x10 inches),film [202111004] , bmw polybags blue colour for sizes 18kg(as per attached specification),consumable [mis201] , bmw polybags red colour for sizes 18kg(as per attached specification),consumable [mis202] , bmw polybags yellow colour for sizes 18kg(as per attached specification),consumable [mis203] , abdominal belt(32 inch each),consumable [700537] , abdominal belt(34 inch each),consumable [700680] , abdominal belt(36 inch each),consumable [700677] , abdominal belt(38 inch each),consumable [700679] , aso kit(25 test/packet),consumable [mis10] , crp test kit(latex/card),kit of 25 tests(25 test / kit),consumable [mis33] , glucose kit (god/pod)(350ml, digonstic),consumable [mis60] , poc kit for syphilis (as per attached specification)(10 test per pack),consumable [mis92] , pregnancy test card(10 card pack),consumable [700682] , sterile alcohol(swabs),consumable [202203014] , blood transfusion set(pediatric),consumable [20201061] , close wound drainage device under negative pressure(closed wound suction unit) size 200 ml(catheter size 16, each),consumable [700568] , close wound drainage device under negative pressure(closed wound suction unit) size 200 ml(catheter size 18, each),consumable [700569] , disposable scalp vein set(size 20 no),consumable [700114] , disposable scalp vein set size 22 no(each),consumable [700115] , disposable suction catheter(size 12),consumable [700113] , disposable suction catheter(size 14),consumable [700112] , feeding tube (catheter)(10 g, each),consumable [700403] , infant feeding tube(10 g each piece, each),consumable [700748] , infant feeding tube(7g each piece, each),consumable [7007481] , infant feeding tube (catheter) size: 8g(each),consumable [987830] , infant mucus extractor sterile pvc(each),surgical material [6550018] , measure volume(drip set),each [700117] , micro volume(drip set),digonstic [6600001] , nasal prong((each) (adult)),consumable [987746] , paediatric drip set(set),digonstic [700116] , ryles tube (pvc) size : adult: 16(each),consumable [987829] , ryles tube (pvc) size : adult(18, each),tube [700110] , ryles tube (pvc) size( children: 10),consumable [987828] , ryles tube (pvc) size(children : 12),tube [700111] , ryles tube(size 14 each piece),consumable [700750] , scalp vein set(size 24g, disposable , each),consumable [700893] , suction catheter, sterile(size fg 20 (disposable, sterile each)),consumable [700744] , suction catheter, sterile(size fg 22 (disposable, sterile each)),consumable [700745] , suction catheter, sterile(size fg 6 (disposable, sterile each)),consumable [700746] , collection tube polystrene(100 per pack),consumable [80001] , micro centrifuge tube2 ml polypropylene tubes, resistance to chemicals,(mechanical stress and temperature extremes, autoclavale, dnase rnase/ endotoxin free),consumable [2020776] , sterile pasteur(pipettes 3ml),consumable [20200831] , test tube stand, polypropylene, 3 tier(for keeping 10 ml vtm vials/ tier),consumable [20200834] , latex examination gloves (large) (100/pkt)(packet),consumable [700554] , latex examination gloves (medium)(100/pkt)(packet),consumable [700555] , latex examination gloves (small) (100/pkt)(packet),consumable [700556] , disposable syringe with needle(2ml each),syrings [700422] , disposable syringe with needle(5ml each),needle [700437] , liquid paraffin(500 ml, bottle),solution [4410002] , liquid paraffin(500 ml, bottle),solution [4410002] , liquid paraffin 50ml(bottle ),consumable [700549] , cold sterilant solution(5 ltr can),consumable [202301002] , fogger solution 5 lit cane containing of hydrogen peroxide(i.p 11.0% w/v and silver nitrate dilute 0.01% w/v),consumable [202301001] , glutaraldehyde solution 2% in 5 litre can (2 strips/vials per each can)(5 litre can),consumable [700591] , interferon gamma release assay kit(igra kit make: qiagen sciences llc model: quantiferon tb gold plus(attached specification)),consumable [202103059] , cryogenic vials(1.8ml sterile external thread),consumable [202202009] , micro centrifuge tube 1.5 ml , polypropylene tubes, resistance to chemicals, mechanical stress and temperature extremes,(autoclavable, dnase rnase/endotoxine free),consumable [2020775] , screw cap vial with o ring (2ml),screw cap,leak proof self standing/flat bottom with o ring, un graduated,polypropylene/polyethylene,2ml capacity each(each),consumable [130011] , steralised and autoclavable culture tube flat bottom, 5ml (plastic)(each),consumable [130012] , glucometer strips 1 should be able to use capillary blood samples 2 should have expiry as printed on the label of the supplied box(3 all strips should have at least one year expiry date from the date of supply 1 glucometer free with each 1 thousand strips rate should be quoted for 50 strip/packet),consumable [700610] , hard cervical collar(large),consumable [202308008] , hard cervical collar(small),consumable [202308009] , pelvic binder(large),consumable [202308010] , pelvic binder(medium),consumable [202308011] , pelvic binder(small),consumable [202308012] , splints(long arm splint),consumable [202308001] , splints(long leg thomas splint),consumable [202308003] , splints(short arm splint),consumable [202308002] , splints(short leg thomas splint),consumable [202308004] , phaco(handpiece),consumable [202303019] , reusable autoclavable phaco tip(size 2.2 mm with 30 degree tips),consumable [202303017] , reusable autoclavable(tubing),consumable [202303016] , reusable phaco(sleve),consumable [202303018] , endotracheal tube no 5.0(uncuffed),tube [202011001] , latex based baloon capacity (3ml) foleys urinary catheter peadiatrics(2 way size 8, each),consumable [700852] , latex based baloon capacity (3ml) foleys urinary catheter peadiatrics(size 10 , each),consumable [700853] , endotracheal tube, soft cuff towards the distal end kink resistant inflation tube murphy eye at distal end with polished smoothness standard 15 mm connector sterile, single use curved shaped blister pack suiting the shape of product(size 4 , each),tube [700613] , endotracheal tubes size 9.5 cuffed should have low pressure high volume cuff and radio opaque line(size 9.5 , each),consumable [700873] , paper adhesive plaster microporous surgical tape(2 inch x 5m /roll),consumable [700124] , paper adhesive plaster microporous surgical tape(6 inch x 5m /roll),consumable [700125] , tracheostomy tube (pvc) sterile single use (adult)(size 4 each piece soft flexible flange at for each fixation 15 mm connector at terminal end which can be rotated in 360 degree direction non irritant),tube [700565] , tracheostomy tube (pvc) sterile single use (adult)(size 5 each piece soft flexible flange at for each fixation 15 mm connector at terminal end which can be rotated in 360 degree direction non irritant),tube [700566] , tracheostomy tube (pvc) sterile single use (adult)(size 7 each piece soft flexible flange at for each fixation 15 mm connector at terminal end which can be rotated in 360 degree direction non irritant, each),tube [700563] , tracheostomy tube (pvc) sterile single use (adult)(size 8 each piece soft flexible flange at for each fixation 15 mm connector at terminal end which can be rotated in 360 degree direction non irritant, each),tube [700564] , disposable sterile gloves bis specification gloves, surgical rubber,made of hypoallergic latex 100%,electronically tested sterilized by gamma irradiatio eto is no:13422:1992 as amended upto , 7inch/pair(pair),consumable [6281066] , disposable sterile gloves b.i.s specification gloves, surgical rubber, made of hypoallergic latex 100%, electronically tested sterilized by gamma irradiation / eto is no : 13422:1992 as amended upto, 6.5 inch / pair(pair),consumable [700164] , disposable sterile gloves b.i.s specification gloves, surgical rubber, made of hypoallergic latex 100%, electronically tested sterilized by gamma irradiation / eto is no : 13422:1992 as amended upto, 6 inch / pair(pair),surgical material [6281063] , disposable sterile gloves b.i.s specification gloves, surgical rubber, made of hypoallergic latex 100%, electronically tested sterilized by gamma irradiation / eto is no : 13422:1992,as amended upto, 7.5 inch / pair(pair),consumable [700166] , disposable sterile gloves isi marked surgical rubber made of hypoallergic latex 100% , electronically tested sterilized by gamma irradiation/ eto is no:13422:1992 as amended upto, powder free 6.5 inch/pair(pair),consumable [13002] , disposable sterile gloves isi marked surgical rubber made of hypoallergic latex 100% , electronically tested sterilized by gamma irradiation/ eto is no:13422:1992 as amended upto, powder free 6 inch/pair(pair),consumable [13001] , disposable sterile gloves isi marked surgical rubber made of hypoallergic latex 100% , electronically tested sterilized by gamma irradiation/ eto is no:13422:1992 as amended upto, powder free 7.5 inch/pair(pair),consumable [13004] , disposable sterile gloves isi marked surgical rubber made of hypoallergic latex 100% , electronically tested sterilized by gamma irradiation/ eto is no:13422:1992 as amended upto, powder free 7 inch/pair(pair),consumable [13003] , spectacles for old person(bifocal),consumable [202210002] , spectacles for old person(black safety goggles),consumable [202210003] , spectacles for old person(presbyopia),consumable [202210001] , spectacles for school(children),consumable [202210004] , acid fast staining kit (carbol)(125ml x 3),consumable [800102] , amikacin 30 mcg(1 packet of 5 vial (each vial of 100 disc)),consumable [121024] , amoxyclav (amoxycillin/clavulanic acid) 20/10 mcg(1 packet of 5 vial (each vial of 100 disc)),consumable [121029] , ampicillin 10 mcg(1 packet of 5 vial (each vial of 100 disc)),consumable [121042] , azithromycin 15 mcg(1 packet of 5 vial (each vial of 100 disc)),consumable [121048] , barium chloride 10%(500 ml bottle),consumable [mis14] , bile esculin agar(100 gm),consumable [121021] , bile salt agar(100 gm),consumable [121020] , brain heart infusion broth(500 gm),consumable [121012] , cary blair medium base(100 gm),consumable [121018] , cefazoline 30 mcg(1 packet of 5 vial (each vial of 100 disc)),consumable [121041] , cefoperazone 75 mcg(1 packet of 5 vial (each vial of 100 disc)),consumable [121038] , ceftazidime 30 mcg(1 packet of 5 vial (each vial of 100 disc)),consumable [121040] , ceftriaxone 30 mcg(1 packet of 5 vial (each vial of 100 disc)),consumable [121032] , cefuroxime 30 mcg(1 packet of 5 vial (each vial of 100 disc)),consumable [0121033] , cetrimide agar(100 gm),consumable [121022] , chloramphenicol 30 mcg(1 packet of 5 vial (each vial of 100 disc)),consumable [121046] , ciprofloxacin 5mcg(1 packet of 5 vial (each vial of 100 disc)),consumable [121031] , clindamycin 2 mcg(1 packet of 5 vial (each vial of 100 disc)),consumable [121051] , colistin 10 mcg(1 packet of 5 vial (each vial of 100 disc)),consumable [121037] , co trimoxazole(sulpha/trimethoprim) 25 mcg (23.75/1.25)(1 packet of 5 vial (each vial of 100 disc)),consumable [121026] , doxycycline hydrochloride 30 mcg(1 packet of 5 vial (each vial of 100 disc)),consumable [121045] , erythromycin 15 mcg(1 packet of 5 vial (each vial of 100 disc)),consumable [121050] , gentamicin 10 mcg(1 packet of 5 vial (each vial of 100 disc)),consumable [121030] , glucose phosphate broth(100 gm),consumable [121015] , imipenem 10 mcg(1 packet of 5 vial (each vial of 100 disc)),consumable [121025] , levofloxacin 5 mcg(1 packet of 5 vial (each vial of 100 disc)),consumable [121049] , macconckeys agar(500grm),consumable [mis77] , nalidixic acid 30 mcg(1 packet of 5 vial (each vial of 100 disc)),consumable [121028] , nitrofurantion 300 mcg(1 packet of 5 vial (each vial of 100 disc)),consumable [121027] , norfloxacin 10 mcg(1 packet of 5 vial (each vial of 100 disc)),consumable [121036] , nutrient agar(500 grm),consumable [mis88] , nutrient broth(500 gm),consumable [121008] , penicillin 10 units(50 100 disc per pack),consumable [121052] , piperacillin 100 mcg(1 packet of 5 vial (each vial of 100 disc)),consumable [0121035] , piperacillin/tazobactam 100/10 mcg(1 packet of 5 vial (each vial of 100 disc)),consumable [121039] , sabourauds dextrose agar powder(100gms),consumable [mis104] , sabroud dextrose agar with chlorophenicol(100 gm),consumable [121010] , salmonella shigella agar(100 gm),consumable [121017] , selenite f broth(100gm pack),consumable [121007] , simmons citrate agar(100 gm),consumable [121011] , sodium citrate 3.8%(500 ml bottle),consumable [mis115] , tcbs agar(100 gm),consumable [121019] , teicoplanin 30 mcg(1 packet of 5 vial (each vial of 100 disc)),consumable [121034] , tetracycline 30 mcg(1 packet of 5 vial (each vial of 100 disc)),consumable [121047] , tobramycin 10 mcg(1 packet of 5 vial (each vial of 100 disc)),consumable [121043] , vancomycin 30 mcg(50 100 disc per pack),consumable [121053] , blood agar powder(500 grm),consumable [mis19] , cled agar(500 gm),consumable [121014] , polymyxin b(1 packet of 5 vial (each vial of 100 disc)),consumable [121044] , iohexol injection 350 mg iodine/ml(20 ml vial),consumable [20200729] , temephose 50% ec(5 litre),chemical [121001] , b.b. silk 6 reels x 25 mts length 25 mts.black braided silk without needle in reels non absorbable surgical sutures usp , 2 0(6 reels is per box rate should be quoted for 6 reels ),surgical material [987723] , b.b. silk 6 reels x 25 mts length 25 mts. black braided silk without needle in reels non absorbable surgical sutures usp 3 0(6 reels is per box rate should be quoted for 6 reels),consumable [700161] , b.b silk size 3/0 (12 foils/pkt)(3/8cir rcut needle 26mm length 76 cm),needle [700615] , b.b silk with 1/2 cir rb/cutting needle 30 mm length 75 cm non absorbable(size 2 0, 12 foils/pkt),consumable [700103] , b.b silk with 1/2 cir rb needle size:4/0 20 mm(length at least 75 cm, 12 foils per packet),needle [700469] , catgut chromic with 1/2 cir cutting needle 12mm(length 70cm no.3 0, 12 foils per pakt),consumable [700458] , catgut chromic with 1/2 cir rb needle 40 mm length 75cm no. 2 consumable(each),consumable [700524] , chromic (12 foils/pkt)(3/8 rb needle 30 mm, length 76 cm, size 2/0),needle [700560] , chromic catgut suture (12 foils/pkt)(3/8 cir r cutting needle 19 mm needle, suture length 76 cm size 4/0),needle [700612] , chromic catgut suture(3/8 cir rcutting needle 16 mm, suture length 76 cm(5/0 12 foils/pkt)),sutures [700859] , polyamide size 1/0, 12 foils/pkt(3/8 r cutting needle 45 mm, length 70 cm),needle [700570] , polyamide size 2/0, 12 foils/pkt(3/8 r cutting needle 45 mm, length 70 cm),needle [700558] , polyglycolic acid absorbable surgical suture (12 foils/pkt)(1/2 cir rb needle 20 mm, length 70 cm size 3/0),needle [700562] , polyglycolic acid absorbable surgical suture (12 foils/pkt)(1/2 cir rb needle 40 mm, length 90 cm size 2/0),needle [700561] , poly propylene mesh(15 x 15 cm),consumable [700330] , poly propylene mesh(7.5cmx15cm),consumable [987906] , poly propylene monofilament sterile precut with 1/2 cir rb needle 30mm length 70cm non absorbable surgical sutures usp size 2/0(size:2/0 (12 foils/pkt)),consumable [987776] , poly propylene monofilament sterile precut with 1/2 cir rb needle 30mm length 70cm size : 1/0(12 foils/pkt),consumable [700265] , poly propylene monofilament sterile precut with 1/2 cir rb needle 40 mm length 70 cm size 1(12 foils/pkt),needle [700329] , polypropylene size 1, (12 foils/pkt)(1/2 cir rb needle 45 mm, length 90 cm ),needle [700571] , poly propylene with 1/2 cir rb needle 16 mm length 70 cm size:4/0(12 foils/pkt),consumable [987775] , prolene 1 0 rb 1/2 circle 30 mm, l 70 cm(12 foils /pkt),needle [700470] , synthetic absorbable suture 1 with 1/2 circle round body needle (h) size :1 40mm length 90cm polyglycolic acid (pga) (12 foils per pkt)(size :1 40mm length 90cm polyglycolic acid (pga) (12 foils per pkt)),consumable [202202002] , synthetic absorbable suture 2/0 with 1/2 cir rb needle size:2/0 30mm length 90cm polyglycolic acid (pga) 12 foils / pkt(12 foils per pkt),needle [700466] , synthetic absorbable suture 3/0 with 1/2 cir cutting needle(size:3/0 36mm length 70cm polyglycolic acid(pga) 12 foils / pkt),needle [700468] , synthetic absorbable suture 3/0 with cd cutting needle size : 3/0 22mm length 45cm polyglycolic acid (pga) (12 foils per pkt)(needle circle size is 1/2 circle),needle [700444] , synthetic absorbable suture 4/0 with 1/2 cir rb needle size:4/0 20mm length 70cm poly glycolic acid (pga)(12 foils/pkt)(size:4/0 20mm length 70cm poly glycolic acid (pga)(12 foils/pkt)),needle [700467] , conventional medical x ray film polyster based imaging film 30.5cmx30.5cm (12x12)(size 50 sheet in one packet),consumable [7004063] , conventional medical x ray film polyster based imaging film 35.6cmx35.6cm (14x14)(size 50 sheet in one packet),consumable [7004062] , conventional medical x ray film polyster based imaging film 35.6cmx43.2cm (14x17)(size 50 sheet in one packet),consumable [7004061] , conventional x ray film 10x12(50 sheet/pack),consumable [7004065] , conventional x ray film 8x10(50 sheet/pack),consumable [7004066] , kellys pad( rubber/each),consumable [700420] , cost of reagent per test (for blood cell counter 3 part)(blood cell counter 3 part),consumable [20210001] , hbs antigen rapid test card kit(pack of 10 card test with 10 dropper, 1 buffer solution, 10 pricking lancet and 10 alcohol swab),digonstic [5400004] , ra factor rapid kit 1)should be based on latex agglutination slide test 2)qualitative and semi quantative testing facility possible 3)test speed must be less than 2 minutes(test),consumable [700756] , bag(spikes),consumable [202305001] , long line silicon catheter(g 24, fr 2, l 30cm),consumable [mis76] , short iv catheter with straight/j tip guidewire(l 20, fr 2, g 22),consumable [mis108] , short iv catheter with straight/j tip guidewire(l 4, fr 2, g 22),consumable [mis109] , single umbilical catheter with leur lock(fr 2 to fr 2.5, l 40 cm),consumable [mis111] , single umbilical catheter with leur lock(fr 3 to fr 3.5 , l 40 cm),consumable [mis112] , single umbilical catheter with luer lock stopcock(fr 4, l 40 cm),consumable [mis113] , single umbilical catheter with luer lock stopcock(fr 5, l 40 cm),consumable [mis114] , synthetic absorbable triclosan coated polyglactin 910 antibacterial suture usp(size 2, 40mm, 1/2 circle rc, 90cms),consumable [20200745] , synthetic absorbable triclosan coated polyglactin 910 antibacterial suture usp(size 2, 40mm, 1/2 circle rc, 90cms),consumable [20200745] , pmo(line),consumable [dme3763] , vdrl kit (strip)(50 test/kit),consumable [700127] , nylon (polyamide black suture)(size 2 0, 45mm 3/8 circle reverse cutting needle 70cm),consumable [20200746] , nylon (polyamide black suture)(size 2 0, 45mm 3/8 circle reverse cutting needle 70cm),consumable [20200746] , baby diapers small(10 diaper per pkt),consumable [700431] , yankauer suction cannula ,(each),consumable [dme1785] , heat sealing machine , guage cutting machine , inspection lamp with magnifier , washer disinfector and ultrasonic cleanser , rack for store as per specification given in tender documents...

Medical Education Department - Madhya Pradesh

39395412 bids are invited for corbolfuchin powder , durhams tube , 30 mcg , oxidase disk , ofloxacin , fosfomycin , aztreonam 30mcg , cefepime30mcg , ceftazidime 30mcg , cefotaxime30mcg , cafrazidimeclavulanic , caftriaxone , cotrimoxazole , doxycycline30mcg , meropenem 30 mcg , ticarcillin clavulnic acid , netilmycin , cefpodoxime 10mcg , penicillin 10unit , linezolid 30mcg , gentamycin high level 120mcg , novobiocin 5 mcg , rifampicin 30 mcg , ph7megilay instrument capsule , ph4 , clarythromycin 15 mcg , cefotoximeclavunic acid , tigecycline , optochin 5 mcg , bacitracin b8 units , chrom agar , o f media , sda without antibiotic , sda with antibiotic , zn dust , nitrate broth , nitrate reagent , glass marking pencil , casein , dextrin , fructose , glacial acetic acid , ferric chloride , hydrochloric acid , liquor ammonia , magnesium sulphate , maltose , mercuric sulphate , metaphosphric acid , methyl alcohol , ninhydrin , pdimethylaminobenzaldehyde , phenolphthalein , picric acid , potassium bisulfate , potassium oxalate , silver nitrate , sodium bicarbonate , sodium nitrite , sodium hypobromite , sodium potassium tratrate , sulfur powder , sulfuric acid , thiosemicarbazide , trichloroacetic acid , urease powder , vit c , slodebox , test tube holders , test tube stands , tissue paper rolls , bovine albumin serum , bile pigment total quantity : 2327...

Directorate Of Health Services - Madhya Pradesh

39274026 tender for supply of printing items 1 form printing all types of a 4 size single side print 60 gss on white paper 2 on white paper farm printing all type a 4 size double sided print 60 gsm 3 form printing all types of a 4 size single side print 75 gsm on white paper 4 farm printing all type a 4 size double sided print 75 gsm on white paper form printing all types of u 1 size single side print 60 5 gsm on white paper 6 on white paper farm printing all type u 1 size double sided print 60 gsm form printing all type u 1 sai0074 single side print 75 7 gsm on white paper 8 form printing all types u 1 size double sided print on 75 gsm white paper 9 form printing all types of a 3 size single side print 70 farm printing all type a 3 size double sided print 70 gsm on white paper pamphlet printing all type a 8 size single side print on 60 gsm white paper pamphlet printing all types of a 8 size double sided print 60 gsm on white paper pamphlet printing all types of a 4 size single side print 60 gsm on white paper pamphlet printing all types of a 4 size double sided print 60 gsm on white paper pamphlet printing all types of a 4 size single side print 49 on gsm color paper pamphlet printing all types of a 4 size double sided print 49 on gsm color paper book printing all type a 4 size 100 pages 60 gsm white yod yaad hain bhavanjar morning book printing all type a 4 size 200 pages 60 gsm white on paper with book bind book printing all type a 4 size 300 pages 60 gsm white , on paper with book bind book printing all type u 1 size 100 pages 60 gsm white , on paper with book bind book printing all type u 1 size 200 pages 60 gsm white on paper with buck bind book printing all types of a 3 size 100 pages 60 gsm book printing all type a 3 size 200 pages 60 gsm white , all types of register with buck bind on paper a 4 size 100 pages 70 gsm white , register all type a 4 size 200 pages 70 gsm white hardsheet on paper with calder bind , register all type u 1 size 100 pages 70 gsm white , register all type u 1 size 200 pages 70 gsm white yodyad dawlit laf gwanjav morning register all type a 3 full size 100 pages 70 gsm hardsheet on white paper with calendar binding register all type a 3 full size 200 pages 70 gsm hardsheet on white paper with calendar binding card on a 8 size color card sheet 180 gsm all types of slips / parchi 100 pages book in a 8 size all types of cards size a 4250 gsm on art card sheet with jingle side print all types of cards size a 4250 gsm on art card sheet with double sided print multicolor form / sheet on a 4 size 100 gsm paper single my print multicolor form / sheet a 4 size double on 100 gsm paper side print multicolor form / sheet on a 3 size 100 gsm paper single side print multicolor form / sheet on a 3 size 100 gsm paper double , multicolor pamphlets on a 4 size 110 gsm art paper single | side print , multicolored pamphlet on a 4 size 110 gsm art paper double | side pint , multicolor certificates on a 4 size 300 gsm art card sheet note sheet printing u 1 size single side print 80 gsm laser note sheet printing on paper u 1 size double sided print 80 gsm laser envelopes printing size 9x4 white 100 gsm all type of invitation card with envelope size 7x5 single color sveer all kinds of invitation cards with envelopes size 7x5 multicolor photo flex print normal on 250 gsm media flex print star 280 on gsm media on paper fitting on flex frame iron pipe with pasting fitting pasting on flex fame wooden vinyl sheet print on 300 gsm acrylic sheet print on 3mm sheet acrylic sheet print on 6mm sheet forex sheet print on 3mm sheet sunpec sheet print on 5mm sheet 55 edta solutions k3(mfg by himedia)(500 ml bottle),consumable 56 field stain a 500ml 57 field stain b 500ml 58 filter paper sheet((whatmann no 01) sheets),consumable 59 fixer: it shall be powder fixer to produce clean radiographs available in pack size size: 13.5 ltr 60 fixer: it shall be powder fixer to produce clean radiographs available in pack size size: 9 ltr 61 formaldehyde 40% (conc. formaline)(1 x 30 lit),consumable 62 crp latex slide per test 63 gel matrix group card 64 gel matrix cross match card 65 g6pd deficiency test kit(10 test / kit),consumable 66 glacial acetic acid (2.5 liter),consumable 67 glass slide 75mm x 25mm 1.1 mm 68 glass slide 75mm x 25mm 1.35 mm 69 glass slide with isi mark at least 75mm x 25 mm thickness at least 1.1mm,detail specifications i with smooth edges, without any scrathtches. ii glazed glass.iii no visual or chromatic abbretions(50 slides/packet),consumable 70 glass test tube 12 x 100 (medium size) heavy quality 100/pkt 71 glass test tube 12 x 75(small size) heavy quality 100/pkt 72 glass test tube 5 without edge 73 glucometer strip (1x100) 74 glucose kit (god/pod)(350ml),digonstic 75 h2so4 (sulphuric acid)(25% 500 ml bottle),consumable 76 hba ag elisa 96 kit 1x96(each),consumable 77 hba ag rapid card test(each),consumable 78 hbs antigeng kit card(pack of 10 card test with 10 dropper, 1 buffer solution, 10 pricking lancet and 10 alcohol swab),digonstic 79 hcl n/10 (500 ml bottle) 80 hcv elisa(96 test kit),consumable 81 hcv kit card test(25 test / kit),digonstic 82 heamoglobin colour scale book with special strip complete(1 x 200),consumable 83 hematology cell counter reagents as per requirement of cell counter cleaning solution 100 ml 84 hemoglobin color scale (starter kit) components (1) color scale 01/kit (2) test strip 1000/kit (3) printed literature for method of use/kit (4)lancet 1000/kit 85 hiv elisa kit (hiv micro elisa ag+ab 4th generation )(96 test kit),consumable 86 hiv kit card (25 test / kit) 87 hydrogen peroxide (conc.) h2o2 (500 ml),consumable 88 k3 blood vaccutainer edta 100 tubes/pkt 89 leishman stain 500 ml 90 malaria antigen card pf/pv card (as per nvbdcp guidelines)( 10 card, 10 dropper, 1 buffer solution) 91 malaria antigen, p vivax, p falciparum rapid diagnostics bivalentt test card (as per gio nvbdcp specification) pack of 10 card test with 10 dropper, 1 buffer solution, 10 pricking lancet, and 10 alcohol swab 92 malaria card (antigen) atleast 100 microbes/desi ltr. for both species 93 malaria pf/pv antigen card 94 malaria pf/pv rapid test 95 methyline blue(100 ml),solution 96 micro pipet 1000 fix and variable each 97 micropiptte 100 1000 98 microtips (2 200 ul) 1x1000(each),consumable 99 n/10 hcl 500ml 100 nebulization mask kit (pediatrics) 101 nebulization mask kit, (pediatrics),consumable 102 nebulization mask kit (adult) 103 new born baby kit [4 piece set] 104 pregnancy test card(10 card pack ,consumable 105 ra factor 50 test kit qualicative 106 ra factor rapid kit (25 test/kit) 1:) should be based on latex agglutination slide test. 2:) qualitative and semiquantitative testing facility possible. 3:) test speed must be less than 2 minutes 107 test tube 12 x 100 (medicm size) 100/pkt 108 test tube 12 x 75 (small size) 100/pkt(12 x 75 (small size) 100/pkt),tube 109 test tube 15x125 110 tips for auto pipettes 2 to 100 micro litres 1000/pkt(2 to 100 micro litres 1000/pkt),each 111 tips for auto pipettes 200 to 1000 micro litres 500/pkt(200 to 1000 micro litres 500/pkt),each 112 tips for auto pippetes 10 to 100 micro litres 113 tissue paper roll(each),consumable 114 tourniquet with belt (good quality pairs), 115 tourniquet with belt (good quality pairs),consumable 116 typhoid card test kit (for igg and igm antibody detection) (25 test kit) 117 typhoid test card. 118 umbical cord clamps plastic material (box of 100 clamps)(mfg by precious life care),consumable 119 umbical cord clamps plastic material(box of 100 clamps),consumable 120 urine albumin & suger 121 usg gel (250 ml bottle),consumable 122 usg thermal paper 123 vdrl (rpr) 1x100 sd strip 124 vdrl kit (strip)(50 test/kit),consumable 125 vdrl kit (strip)(50 test/kit),consumable 126 widal 2x2 sera slide kit 127 widal 2x2 tube test kit 128 widal 4x5 ml 129 slide blue star 130 sputum cup with sticker 131 paraffin strip roll 132 zipper polybag 133 alluminium foil roll 134 hand wash liquid 135 falcon tube 136 thermacol box 137 gel pack 138 bamboo stick 139 tape roll 140 spirit lamp 141 adhesive plasters usp 7.5 cm x 10 mts/roll 142 adhesive plasters usp 7.5 cm x 5 mts/roll 143 adhesive roll 1 inch x 5 m / roll 144 baby oxygen mask set of all sizes 145 blood bag with acd/cpd solution (disposable sterilised) with needle(100 ml),bag 146 blood bag with acd/cpd solution (disposable sterilised) with needle(350 ml),bag 147 disposable appron 148 disposable cap 149 disposable examination gloves made of natural rubber latex, pre powdered, non streile medium 150 disposable examination gloves made of natural rubber latex, pre powdered, non streile small 151 disposable examination gloves made of natural rubber latex, pre powdered, non streile, conforming to is 15354:2003 and amendment thereof. size: large 152 disposable needles 22g consumable 153 disposable needles is 10654:2002 22g 154 disposable needles is 10654:2002 24g 155 disposable needles is 10654:2002 26 g( ),needle 156 disposable paper gloves size 7 inches consumable 157 disposable paper gloves size 7,1/2 inches consumable 158 disposable plastic appron (full size) 159 disposable pricking lancet (pkt of 200 units) 160 disposable pricking lancet 100 units consumable 161 disposable scalp vein set size 20 no 162 disposable scalp vein set size 22 no 163 disposable sharp collection containers 1.5 l 164 disposable sharp collection containers 5 ltr 165 disposable sideport knife(num),consumable 166 disposable sterile gloves size 6 inches consumable 167 disposable sterile gloves size 6,1/2 inches consumable 168 disposable sterile gloves size 7 inches consumable 169 disposable sterile gloves size 7,1/2 inches consumable 170 disposable sterile hypodermic syringe 10ml(each),consumable 171 disposable suction catheter assorted covering all sizes 10,12,14,16,18 consumable 172 disposable suction catheter(size 12),consumable 173 disposable suction catheter(size 14),consumable 174 disposable surgeon cap(box of 100 caps) 175 disposable syringe (for vitamin k inj)(1ml with needle 26g),consumable 176 disposable syringe with needle(2ml each),syrings 177 disposable syringe with needle(3ml each),syrings 178 disposable syringe with needle(5ml each),needle 179 hub cutter non electric lockable safety portable box for disposal of hypodemic needles. consumable 180 kellys pad disposable 181 n 95 mask(as per attached specification),consumable 182 oxygen mask adult (standard size) 183 oxygen mask paediatric (standard size) 184 plain disposable vial 3ml(each),consumable 185 scalp vein set(size 24g, disposable),consumable 186 three layer surgical mask 187 urine container 5ml disposable (50 per pkt) 188 urine container size of the container shall be 30ml disposable (50 per pkt),consumable 189 x ray film 10 x 12 50 sheets/pack 190 x ray film 12 x 12 50 sheets/pack 191 x ray film 12 x 15 50 sheets/pack 192 b.b silk (12 foils/pkt)(3/8 rcut needle 45 mm length 76 cm, size 2/0)),consumable 193 b.b silk size 3/0 (12 foils/pkt)(3/8cir rcut needle 26mm length 76 cm),needle 194 b.b silk with 1/2 cir rb needle 20 mm length 75 cm non absorbable surgical suture usp size 3 0,(12foils/pkt),needle 195 b.b silk with 1/2 cir rb needle size:1/0 20 mm length 75 cm non absorbable surgical sutures usp surgical material 196 b.b. silk 6 reels x 25 mts size:1/0(6 reels is per box rate should be quoted for 6 reels),surgical material 197 black braided silk with 1/2 cir cd cutting needle 16 mm length 75 cm 3/0 (14 foils/pkt) 198 black braided silk with 1/2 cir cutting needle 30mm length 75 cm(1/0 12 foils/pkt),consumable 199 black braided silk with 1/2 cir rb needle 20 mm length 75 cm 1/0 13 foils/pkt 200 black braided silk with 1/2 cir rb needle 30 mm length 75 cm 2/0 12 foils/pkt 201 catgut chromic size:2/0 length 150 cm 202 catgut chromic with 1/2 cir rb needle 30 mm length 70cm no. 1 0, 12 foils per packet 203 catgut chromic with 1/2 cir rb needle 40 mm length 75cm no. 1 consumable 204 catgut chromic with 1/2 cir rb needle 40 mm length 75cm no. 2 consumable(each),consumable 205 chromic catgut (12 foils/pkt)(size:1/0 length 150 cm),consumable 206 chromic catgut , round body needle no. 1.0 207 chromic catgut monofilament with 1/4 circle reverse cutting needle 6 0 ( 12 / pkt ) 208 chromic catgut no 1.0 round dody, 40 mm 12 foils/pkt 209 chromic catgut suture (12 foils/pkt)(3/8 cir r cutting needle 19 mm needle, suture length 76 cm size 4/0),needle 210 foleys urinary catheter silkolatex 2 way sterile, non toxic size 10 211 foleys urinary catheter silkolatex 2 way sterile, non toxic size 10 212 non absorbable braided silk black 10mm 3/8 circle reverse cutting micro point(38 cm),consumable 213 non absorbable braided silk black(12 mm 3/8 circle reverse cutting micropoint 38 cm ),consumable 214 silk no 1 cutting needle 1x12(1x12),consumable 215 suture mersilk 8 0 (12 foil) 216 silver nitrate solution 1 ltr. 217 urine bag 2 ltr. 218 plaster of paris 410x5mtr 219 plaster of paris 6 15x 5mtr 220 cumb sera 221 albumin 222 laryngo scope bulb 223 auto clave quil 224 idetification tag 225 peadiatric drip set 226 dresing pad 227 endotracheal tube no.6 228 endotracheal tube no. 2.5 to 5 ml 229 dynaplast 10 cm.x1 or 10cmx4/6 mtr 230 sicklewive test kit 231 autoclave indicator 232 absorbent cotton roll 100 gm each consumable 233 absorbent cotton wool ip 500 grms(each),consumable 234 cotton crape bandage 10cm x 4m (box of 10 bandages) 235 cotton crape bandage 15cm x 4m (box of 10 bandages) 236 cotton delivery belt 237 adhesive tape 7.5cm x10(mtr/roll),consumable 238 cloth based surgical adhesive tape roll(1 inch x 5 mtr / roll),consumable 239 paper adhesive microporous surgical tape 3 inch x 5 m / roll (10 roll/pkt)(3 inch x 5 m / roll (10 roll/pkt)),consumable 240 paper adhesive plaster microporous surgical tape 1 inch x 9 m / roll 241 paper adhesive plaster microporous surgical tape 2 inch x 5m /roll 242 paper adhesive plaster microporous surgical tape 4 inch x 9 m / roll 243 paper adhesive plaster microporous surgical tape 6 inch x 10 m / roll 244 paper adhesive plaster microporous surgical tape 6 inch x 5m /roll 245 umblical cotton tape length 75cm. 246 disposable suction catheter(size 12),consumable 247 disposable suction catheter(size 14),consumable 248 feeding tube (catheter) 10g 249 foleys catheter size 12 2 way(10 each),consumable 250 foleys catheter size 14 2 way 251 foleys catheter size 14 3 way 252 foleys catheter size 16 2 way(11 each),consumable 253 foleys catheter size 18 2 way 254 foleys catheter size 20 2 way(12 each),consumable 255 foleys catheter size 22 2 way(13 each),consumable 256 foleys catheter size 24 2 way(14 each),consumable 257 foleys urinary catheter 2 way size 8 258 infant feeding tube (catheter) size: 3g 259 infant feeding tube (catheter) size: 4g 260 infant feeding tube (catheter) size: 5g 261 infant feeding tube (catheter) size: 6g 262 surgical blade isi marked, size 15(100 per packet),surgical material 263 surgical blade isi marked, size 22(100/pkt),surgical material 264 surgical blade isi marked, size 23(100/pkt),surgical material 265 surgical blade isi marked, size 24(100/pkt),surgical material 266 surgical blade isi marked, size 25(100/pkt),surgical material 267 surgical blade, size 11 268 ecg jelly 250 gms 269 ecg paper (chemical coated)(80mmx 20 mtr each),consumable 270 ecg paper computerizesd triple channel 20m 271 ecg paper(chemical coated) 50mm x 20mm roll 272 ecg paper(chemical coated) 50mm x 30 mtr. roll 273 ecg paper(wax coated) heavy quality 50mm x 30 mtr/ roll 274 ecg roll three channel 20m 275 ecg roll three channel (50 mm x 20 mtr),consumable 276 absorable surgical suture rb needle size no 1 0,30 mm length 70 cm , 12 foils per packet , polyglycolic acid (pga) 277 absorable surgical suture rb needle size no 1 ,30 mm length 70 cm , 12 foils per packet , polyglycolic acid (pga) 278 absorbable surgical suture braided polyglycolic acid 3/8 circle reverse cuttingg(12mm 45 cm spatulated needle),consumable 279 blood vessel introducers needles 16g, sterilized, set 280 chromic (12 foils/pkt)(3/8 rb needle 30 mm, length 76 cm, size 2/0),needle 281 chromic size 1, (12 foils/pkt)(1/2 cir rb needle 40 mm, length 76 cm),needle 282 chromic size 1, 12 foils/pkt(1/2 cir rb needle 45 mm, length 100 cm),needle 283 insulin syringe/ each (graduation upto 100 units) 30 g needle, 40 units/ml(30 g needle, 40 units/ml),syrings 284 intravenous set with airway and needle((adult)),surgical material 285 intravenous set with airway and needle(children),surgical material 286 spinal needle no. 23 287 sterile hypodermic syring with needle 10 ml 288 sterile hypodermic syring with needle 20 ml 289 sterile hypodermic syring with needle(5 ml),syrings 290 sterile hypodermic syringe with needle, (20 ml),consumable 291 vicryl no. 1 rb 292 vicryl no. 2.0 rb 293 cannula fixer set consumable 294 i.v cannula with injection valve size : 18g 295 i.v. cannula with injection valve 20g 296 iv cannula (two way) size 20 297 iv cannula (two way) size 22 298 iv cannula (two way) size 24 299 iv cannula size 26g( ),consumable 300 biomedical waste collection plastic bag small(all colours) 301 biomedical waste collection plastic bag medium(all colours) 302 biomedical waste collection plastic bag large(all colours) 303 mattress 5kg cotton 3 ft x 6 ft 304 pillow with 2kg cotton 305 tericot sharee 306 compunder dress (male) 307 bed sheet single bed(white) 308 bedsheet double bed(white) 309 bed sheet single bed(coloured) 310 bedsheet double bed(coloured) 311 baby diapers small (10 diaper per pkt) 312 chair cushion box type 313 chair cushion box type 314 chair cushion cover 315 compounder coat/lab tec /xry tec std size 316 curtain green redymade 317 curton cloth rangeen 318 curton cloth rangeen design 319 dionised water 5 ltr cane(each) 320 front aprin 321 metresses 3x6 with raxine cover 4 density 322 napkin sup. quality std size(white) 323 napkin sup. quality std size(coloured) 324 peticote blauge cloth shuti rangeen 325 peticote/blauge cloth shuti bleach 326 pillow cover cloth bleach 327 rangeen baag print kapda 328 rangeen baag print kapda 329 rangeen design towel beev kapda 330 rangeen design weft stripe kapda 331 table cloth rangeen (small) 332 table cloth rangeen (large) 333 biomedical waste collection plastic dustbin small(all colours) 334 biomedical waste collection plastic dustbin medium(all colours) 335 biomedical waste collection plastic dustbin large(all colours) ...

Netaji Subhash Chandra Bose Medical College - Madhya Pradesh

39177951 supply of kits, chemicals, stationary and general items , supply of kits, chemicals, consumables, stationary, & glass ware , manual kits , l block ( brass ) each , hot plate each ( 37 100 degree celcius ) , copper plate ( 1.5 x 1 inch ) , amonium sulphate crystals ( 100 gms ) , d. glucose ( 100 gms ) , dextrose monohydrate ( 500 gm ) , bile salt powder ( 500 gms ) , blood urea kit ( 500 test ) kit , s. creatinine ( 500 test ) kit , s. triglycride ( 500 test ) kit , s. total protine ( 500 test ) kit , s. albumin ( 500 test ) kit , s. cholestrol ( 500 test ) kit , trisodium citrate ( 500gms ) , cupric sulphate ( 500 gms ) , sodium hydrogen carbonate ( 500 gms ) , shyphilis strip ( 100 test ) ( tulip / span / reckon / deacon ) , eeg gel ( 500 ml ) , reticlocyte count reagent ( 500 ml ) , acid phosphates kit ( 100test ) , albuminkit ( 100 gms ) , alkaline phosphates kit ( 500 gms ) , amylase ( 500 ml ) , aptt ( 500 ml ) , aso titre test ( 96 tes ) , billirubin direct ( 100 tset ) , billirubin total ( 100 test ) , mercuric sulphate ( 500 gms ) , sodium nitroprusside ( 500 gms ) , sodium meta by sulphate ( 500 gms ) , chicken gunia rapid kit igm ( 100 test ) , cholesterol kit ( 100 test ) , ck mb ( 100 test ) , cpk mb ( 100 test ) , c reactive protein ( 100 test ) , sodium n+ ( 100 test ) , crp kit ( 100 test ) , csf protein ( 100 test ) , dengue rapid kit for igg & igm ( 100 test ) , robertson cooked media ( 500 gms ) , drinking water testing ( 12 parameters ) , potasium k+ ( 100 test ) , g6pd kit ( 100 test ) , glucose kit god method ( 500 test ) , glycosylate hb% ( 100 test ) , hbsag card test ( each ) , mountax test 5 tu / ppd ( 100 test ) , pragnancy test hcg card test ( 100 test ) , pregnancy test, latex agglutination inhibition test ( 100 test ) , prothombin time kit ( 5 ml ) , ra factor test ( 100 test ) , rapid test kit for anti hcv ab ( 100 test ) , s.acid phosphtac ( 100 test ) , s.alkaline phosphate ( 100 test ) , s.analyese ( 100 test ) , s.cholestrol kit ( 100 test ) , s.glucose kit ( 100 test ) , s.h.d.l. ( 100 test ) , s.triglyceride ( 100 test ) , s.uric kit ( 100 test ) , serum bilirubin kit ( 100 test ) , serum calcium kit ( 100 test ) , serum creatinine kit ( 100 test ) , serum protein kit ( 100 test ) , serum uric acid kit ( 100 test ) , sgot ( 100 test ) , sgpt ( 100 test ) , t3 elisa test kit ( 100 test ) , t4 elisa test kit ( 100 test ) , total protein ( 100 test ) , triglyceride kit ( 100 test ) , tsh elisa test kit ( 100 test ) , urea enzymatic ( 100 test ) , sabourauds dextrose agar with chloramphenicol medium ( 500gms ) , sabourauds dextrose agar with brain heart infusion agar ( 500gms ) , lactophenol cotton blue ( 10gms ) , glycerol ( laboratory grade ) ( 500 ml ) , mccartney bottle ( 500 gms ) , edta disodium salt ( 500 gms ) , barium chloride powder ( 500 gms ) , urea kit ( 100 test ) , vdrl card test tpha ( 100 test ) , vdrl latex test / rpr ( 100 test ) , widal kit ( 100 test ) , widal test ( 100 test ) , isoamyl alchohol ( 500 ml ) , hcl ( 500 ml ) , phenol red powder ( 500 gms ) , bakout ( 20 ltr ) , finit ( 10 ltr ) , k.telurite blood agar ( himedia ) ( 100 gms ) , hi.viral tranport medium ( himedia ) ( 100 tubes ) , cetrimide agar ( himedia ) ( 100 gms ) , caryblair transport medium ( himedia ) ( 100 gms ) , wilson blair agar ( himedia ) ( 100gms ) , agar powder ( himedia ) ( 500 gms ) , sabouraud dextrose agar ( himedia ) ( 500gms ) , urea agar base ( himedia ) ( 500 gms ) , tsi agar ( himedia ) ( 500 gms ) , muller hinton medium powder ( himedia ) ( 100gms ) , ma conkey agar powder veg ( himedia ) ( 500 gms ) , nutrient agar powder veg. ( himedia ) ( 500 gms ) , t.c.b.s.agar powder veg ( himedia ) ( 500 gms ) , geletin agar ( himedia ) ( 500 gms ) , deoxycholate citrate agar ( himedia ) ( 500 gms ) , simmons citrate agar ( himedia ) ( 500 gms ) , bordet gengoue media ( himedia ) ( 500 gms ) , xld agar ( himedia ) ( 500 gms ) , hektoen enteric agar ( himedia ) ( 500 gms ) , lj media slants ( himedia ) ( 500 gms ) , lj media with first line antitubercrular drugs ( himedia ) ( 500 gms ) , cled medium ( himedia ) ( 500 gms ) , triptycase tellurite agar ( himedia ) ( 500 gms ) , brin heart infusion broth ( himedia ) ( 500 gms ) , brain heart infusion agar ( himedia ) ( 500 gms ) , columbia blood agar base ( himedia ) ( 500 gms ) , thioglycolate broth ( himedia ) ( 500 gms ) , lofflers medium base ( himedia ) ( 100 gms ) , moellers decarboxylase broth with arginine ( himedia ) ( 100 gms ) , moellers decarboxylase broth with lysine ( himedia ) ( 100 gms ) , moellers decarboxylase broth with ornithine ( himedia ) ( 100 gms ) , corn meal agar ( himedia ) ( 100 gms ) , tretrazolium reduction media ( himedia ) ( 100 gms ) , hichrome candida differential media ( himedia ) ( 100 gms ) , bile esculin agar ( himedia ) ( 100 gms ) , pvr broth ( himedia ) ( 100 gms ) , pvr reagent ( himedia ) ( 100 gms ) , kits, chemicals, strains & antibiotic sensitivity discs , iso propyl alchohol ( 1 liters ) ( merck / qualigen / fisher ) , benzene ( 1 liters ) ( merck / qualigen / fisher ) , formaline ( 1 liters ) ( merck / qualigen / fisher ) , hematoxyline powder ( fisher / loba ) ( 500 ml ) , dpx ( 500ml ) ( merck / qualigen / fisher ) , microtome blade ( leica / chile ) ( 50 nos per packet ) , alluminium potassium sulphate ( 1kg ) ( merck / qualigen / fisher ) , mercuric oxide ( 100 gm ) ( merck / qualigen / fisher ) , carbolic soap ( 500 ml ) , ammonium potassium sulphate ( 500 gm ) , nitric acid ( 500 ml ) , hiv kit elisa ( 96 test ) ( tulip / transasia / span / sd / j.mitra / meril ) , hiv kit rapid ( 96 test ) ( tulip / transasia / span / sd / j.mitra / meril ) , hcv kit elisa ( 96 test ) ( tulip / transasia / span / sd / j.mitra / meril ) , hcv kit rapid ( 96 test ) ( tulip / transasia / span / sd / j.mitra / meril ) , hbsag kit elisa ( 96 test ) ( tulip / transasia / span / sd / j.mitra / meril ) , hbsag kit rapid ( 96 test ) ( tulip / transasia / span / sd / j.mitra / meril ) , rpr ( vdrl ) kit ( 500 test ) ( tulip / span / reckon / beacon ) , rpr kit strip ( 100 test ) , malaria pf / pv test kit ( 500 test ) ( tulip / span / sd / j.mitra / meril / oscar ) ) , neomycin ( 500 discs ) , norfloxacin ( 500 discs ) , ofloxacin ( 500 discs ) , pencillin ( 500 discs ) , pipracillin + tazobactum ( 500 discs ) , tobramycin ( 500 discs ) , sterptomycin ( 500 discs ) , ticarcillin ( 500 discs ) , optochin ( 100 discs ) , bacitracin ( 500 discs ) , cefoperazone sulbactum ( 500 discs ) , clindamycin ( 500 discs ) , doxcyline ( 500 discs ) , erythromycin ( 500 discs ) , cefuroxime sodium 30mcg ( 500 discs ) , pipracillin ( 500 discs ) , netillin ( 500 discs ) , gentmycin ( 500 discs ) , levofloxacin ( 500 discs ) , cloxacillin ( 500 discs ) , imipenem10mcg ( 500 discs ) , ertapenem10mcg ( 500 discs ) , meropenem10mcg ( 500 discs ) , doripenem10mcg ( 500 discs ) , ceftazidime / clavulanic acid caz / ca 30 / 10mcg ( 500 discs ) , cefotaxime / clavulanic acid ctx / ca 30 / 10mcg ( 500 discs ) , aztreonam30mcg ( 500 discs ) , ceftazidime30mcg ( 500 discs ) , cefotaxime30mcg ( 500 discs ) , ceftriaxone 30mcg ( 500 discs ) , cefoxitin 30mcg ( 500 discs ) , cefepime30mcg ( 500 discs ) , sparfloxacin 5mcg ( 500 discs ) , novobiocin30mcg ( 200 discs ) , amoxycillin clavulanic acid 20 / 10mcg ( 500 discs ) , cephotoxime ( 500 discs ) , clarithromycin 15mcg ( 500 discs ) , co trimoxazole1.25 / 23.75mcg ( 500 discs ) , piperacillin100mcg ( 500 discs ) , vancomycin30mcg ( 500 discs ) , netilmicin30mcg ( 500 discs ) , kanamycin 30mcg ( 500 discs ) , ampicillin 10mcg ( 500 discs ) , azithromycin 15mcg ( 500 discs ) , carbenicillin100mcg ( 500 discs ) , ceacals30mcg ( 500 discs ) , cefoperazone 75mcg ( 500 discs ) , ceftizoxime30mcg ( 500 discs ) , nalidixic acid 30mcg ( 500 discs ) , ceftazidime avibactam 30 / 20mcg ( 500 discs ) , ceftolozane tazobactam 30 / 10mcg ( 500 discs ) , ceftaroline 30mcg ( 500 discs ) , amikacin30mcg ( 500 discs ) , fosfomycin 200mcg ( 500 discs ) , nitrofurantoin 30mcg ( 500 discs ) , sulfisoxazole 250mcg / 300mcg ( 500 discs ) , linezolid 30mcg ( 500 discs ) , caspofungin 5mcg ( 500 discs ) , fluconazole 25mcg ( 500 discs ) , voriconazole 1 mcg ( 500 discs ) , ltraconzaole 10mcg ( 500 discs ) , amphotericin b 100mcg ( 500 discs ) , ketoconazole 50mcg ( 500 discs ) , nystatin i00iu ( 500 discs ) , anti abd monoclonal ( igm ) 10ml , staphylococcus aureusatcc 25923 ( himedia ) , escherichia coli atcc 25922 ( himedai ) , psuedomonas aeruginosa atcc 27853 ( himeda ) , enterococcus faecalisatcc 29212 ( susceptlble ) , atcc51299 ( reslstant ) , salmonela shigella agar ( 500 gms ) , bear extract powder ( 500 gms ) , petri dish ( 100 mm glass ) , petridish big size ( glass ) ( 150 mm* 20 mm ) , petridish medium size ( glass ) ( 100 mm* 17 mm ) , toluidine blue ( 100 gm ) , ethyl alcogol ( 500 ml ) , glycerol ( reagent grade ) ( 500 ml ) , magnesium citrate ( 500 gm ) , asparagine ( 100 gm ) , boric acid ( 500 ml ) , amyl alcohol ( 500 ml ) , mono potassium phosphate ( 500 gm ) , disodium phosphate ( 500 gm ) , xylose ( 100 gm ) , iodine ( 100 gm ) , potassium tellurite ( 100 gm ) , potassium chloride ( 500 gm ) , india ink ( 100 ml ) , l.j. ( lowenstein jensen ) media ( ready to use ) ( 50 bottles ) , lacto phenol cotton blue stain ( ready to use ) ( 100 ml ) , dermatophyte test media ( 500 gm ) , bird seed agar / niger seed agar ( 500 gm ) , potato dextrose agar ( 500 gm ) , hichrome agar for candida ( 500 gm ) , cornmeal agar ( 500 gm ) , tetrazolium reduction medium ( 500 gm ) , vdrl glass slide ( 10 pieces ) , teasing / dissecting needles10 pieces , anti d blend, monoclonal ( igm + igg ) anti sera , anti a1 lectin ( 10 ml ) ( tulip / span ) , anti ab monoclanal ( 5ml ) ( tulip / span ) , anti h ( 10ml ) ( tulip / span ) , activated papain enzyme stablized solution , anti c ( 2ml ) ( tulip / span ) , anti e ( 2ml ) ( tulip / span ) , anti e ( 5ml ) ( tulip / span ) , coombs anti sera ( 5ml ) ( tulip / span ) , id gel cross match card ( ahg ) ( tulip / dimed ) test card , gel diluent tulip / dimed ( per liter ) , sterile swab stick for culture ( 100 nos per pack ) , blood lable sticker ( multiple color ) ( 8.5 x 8.5 cm ) each , blood bag double 350ml ( hll / jmitra ) ( each ) , blood bag double 450 ml ( hll / jmitra ) ( each ) , blood bag triple 350ml ( hll / jmitra ) ( each ) , single donor platelet / plasma kit, with acd a bag 500ml ( for apheresis ) , usg jelly ( 500 ml ) , mannitol ( 100 gms ) , absolute alcohol ( 500 ml ) , acetone ( 500 ml ) , albumin flakes ( 500 gms ) , alpha naphthol ( 100 gms ) , alpha naphthylamine ( 25gms ) , ammonium di hydrogen phosphate ( 500 gms ) , ammonium molybdat ( 500 gms ) , ammonium oxalate ( 100gms ) , ammonium sulphate ( 500 gms ) , barium chroride , basic fuschin ( 100 gms ) , benzidine powder ( 500 gms ) , betadin solution ( 500 gms ) , bile salt agar ( 500 gms ) , bismuth ammonium citrate ( 100 gms ) , bleaching powder ( 1 kg ) , blood group anti sera abd set monoclonal ( igm & igg ) ( 10 ml ) ( tulip ) , blood group anti sera a set monoclonal ( igm ) ( 10 ml ) ( tulip ) , blood group anti sera b set monoclonal ( igm ) ( 10 ml ) ( tulip ) , blood group anti sera d set monoclonal ( igm ) ( 10 ml ) ( tulip ) , bole billiverdin ( 500 ml ) , bromine liquid ( 25 ml ) , bromothymol blue ( 5 gms ) , calcium pure ( 500 gms ) , casein ( 500 gms ) , conc. h2so4 ( 500 ml ) , conc. hno3 ( 500 ml ) , concentrated hcl ( 500 ml ) , copper acetate ( 500 gms ) , cotton roll ( each roll ) , creatinine powder ( 500 gms ) , crystal voilet ( 500gms ) , cuso4 crystal ( 250 gms ) , d.p.x. mount , dextrose ( 500 gms ) , di methyl amino benzaldehyde ( 100 gms ) , di pot. hydrogen phosphate ( 100 gms ) , di sodium ortho phosphate ( 500 gms ) , dibasic sod. phosphate ( 100 gms ) , disodium hydrogen phosphate ( 100 gms ) , distill water 5 ltr , e.d.t.a. powder , ecg jelly 250 gm , eosin ( cdh / merck ) ( 100 gms ) , eosin stain ( for histology staining ) , ferric chloride ( fecl3 ) , field stain a&b , l moulds ( each ) , fontana stain ( 100 gms ) , formaldehyde ( formalin ) 37% , eosin spirit soluble ( himedia / qualigens / loba ) ( 1 gms ) , disposable plastic tissue capsule cover each , tissue casette steel each , tissue capsule with cover ( 20*20*10 ) ( each ) , formaldehyde 40% 200 kg pack , formaldehyde 40% 500 ml pack , fructose ( 500 gms ) , gelatin ( 500 gms ) , giemsa powder ( 500 gms ) , giemsa stain ( 500 gms ) , glacial acetic acid ( 1000 ml ) , glucose ( 500 gms ) , glycerine ( 500 gms ) , gms stain ( each kit ) , cefezolin ( 500 discs ) , hand lotion 250ml antiseptic washing , hand sanitizers ( 500 ml bottel ) , hydrogen peroxide ( 500gms ) , cefaparazone ( 500 discs ) , hydrogen peroxide soln 20% , india ink ( 5 ml ) , ciproflaxcin ( 500 discs ) , kovacs indole reagent ( 100 ml ) , l.asparagine ( 100 gms ) , lactic acid ( 1 ltr ) , lactophenol cotton blue , lactose ( 500 gms ) , lead acetate strips ( 500 gms ) , leishman stain solution ( 500ml ) , lens cleaner 2000ml , liquid paraffin heavy ( 500 gms ) , liquid praffin ( 500ml ) , liquid ammonia ( 500 ml ) , lysozyme ( 1 gms ) , malachite green ( 25gms ) , maltose ( 500 gms ) , naladixix acid ( 500 discs ) , methanol , methyl red ( ph indicator ) ( 25gms ) , methyl violet ( 100 gms ) , methylene blue ( 100 gms ) , na natroprusside , nalc powder ( 25 gms ) , neutral red indicator ( 25 gms ) , paraffin wax make merk / ran / kem / fisher / qualigen ( 500 gms ) , paraffin wax roll for test tube sealing , peptone ( 500 gms ) , reticulocytes reagent ( 500 ml ) , ph strips ( ph 1 10 ) ( 25 packets ) , sealing alumium cap 20 mm each , ctg paper roll make bpl ( each ) , urine strip 10 parameter ( 100 strip per pack ) , urine strip 2 parameter ( 100 strip per pack ) , phenol crystal ( 500 gms ) , phenolphthalein ( 100 gms ) , phenyl hydrazine hydrochloride ( 100 gms ) , phosphate pure , picric acid ( 500 gms ) , pot. dichromate ( 500 gms ) , pot. hydroxide ( 500 gms ) , potasium alum per kg , potassium iodide ( 100gms ) , rectified spirit 500 ml , ressorcinol ( 500 gms ) , saffranine ( 100 gms ) , salphate pure , silver nitrate ( 500 gms ) , sodium acetate ( 500 gms ) , sodium carbonate ( 100 gms ) , sodium chloride ( 1 kg pack ) , sodium dihydrogen phosphate ( 100 gms ) , sodium hydroxide ( 5 ltr ) , sodium hydroxide ( flakes ) , sodium hydroxide pellets ( 500gms ) , sodium hypochloride ( 500 gms ) , sodium sulphate ( 500 gms ) , sodium taurocholate ( bile salt ) ( 500 gms ) , spirit ( 400 ltr ) , starch ( 500 gms ) , sterile container ( each ) , sucrose ( 500 gms ) , sulphur powder ( 500 gms ) , sulphuric acid ( 500 ml ) , tetra methylparaphenyl diaminodihydro chloride ( oxidase reagent ) ( 25gms ) , thallus acetate ( 1 gms ) , thymol crystals ( 1 gms ) , tincture benzoin co , tri sodium citrate ( 100 gms ) , trichloro acetic acid ( 1000 ml ) , urea ( 100 gms ) , urea powder , filter paper no. ( standard size ) , xyline ( 1liters ) ( merck / qualigen / fisher ) , yeast extract powder ( 100 gms ) , molecular water ( nucleous free / rnsa dnsa free ) ( 500 ml pack ) , kh2po4 ( 500 gms ) , beaf exract powder ( 500 gms ) , magnisium sulphate ( 500 gm ) , kits, chemicals, strains & glass ware & others , tissue paper roll each , blood collection vial with color cap ( edta ) , blood collection vial with color cap ( citrate ) , blood collection vial with color cap ( plain ) , amplifire for neurograph , anaerobic gas pack for 3.5 lit capacity, disposable oxygen absorbing, carbon dioxide generating agent used in anaerobic system no need to use catalysts or pressure gauge , anaerobic indicator tables for anaerobic system ( for anaerobic system ) , anaerobic system rubber rings ( for anaerobic system ) , arnold sterilizer , needle disposal 22 gauge 1 ( each ) , b.p. blade 24 no. , beaker ( 1000cc ) , beaker ( 100cc ) , beaker ( 500cc ) , beaker ( 50cc ) , beaker 100ml , beaker 200ml , blood bag tube stripper mannual , bone marrow aspiration needle ( 16, 18, 20 no. ) , bone marrow trephine biopsy needle , bottle with clear transparent glass 50ml , capillary tube 1 mm ( long ) , capillary tube 1mm or all size , centrifuge tube 15ml , centrifuge tube 2ml ( p.p ) , seftazidime avibactum ( 500 discs ) , charging droppers , collection vail 2ml , collection vail 5ml , colony counter digital for bacteriology, digital display to cout 9999 , colorimeter cuvetts , conical flask flat bottom ( 1000cc ) , conical flask flat bottom ( 250cc ) , conical flask flat bottom ( 500cc ) , conical flask flat bottom ( 50cc ) , coplins jar50ml , coppling jars ( horizontal ) , demonstration stethoscope with multiple earpiece , distilled water plant ( all glass ) , dropping bottel , dropping bottles for stains ( plastic ) , durhams tube , e.s.r. tube , ecg roll , eeg electrodes for neurograph , esr tube ( wwstergren ) , flask bottom flask 2 ltr capaciy , flat bottom flask 5 liter capacity , flat bottom ph electrode for ph determination for use on soft moist surface like agar gel plate and both on solid and semisolid surface , funnel , glass pipetts each of each size , glass slide ( sunbeam / bluestar ) , glass slide ( size 75x25 mm ) thickness , glass slide ( size 76x26 mm ) thickness 1.35mm , glass slide ( size 76x22mm ) thickness :1.45mm ) , glass trough pneumatic , seftaroline ( 500 discs ) , haemocytometer ( each ) , haemoglobinometer ( sahils ) , hammer ( reflex ) ( each ) , hb tube ( each ) , ink well for neurograph , jar glass ( 2ltr ) , lovibond comparators , lp bone marrow needle , lp needle ( top spinal ) 22x89mm , mackartaneys bottle , maker pen for digital colony counter , measuring cylinder 1000ml , measuring cylinder 100ml , measuring cylinder 500ml , micro coverslips ( 18mmx18mm ) square , micro coverslips ( 19mmx19mm ) square , micro coverslips ( 22mmx22mm ) square , micro coverslips ( 22mmx25mm ) rectangular , micro coverslips ( 22mmx30mm ) rectangular , micro coverslips ( 22mmx40mm ) rectangular , micro coverslips ( 22mmx500mm ) rectangular ( special ) , micro coverslips ( 22mmx50mm ) rectangular , micro coverslips ( 22mmx60mm ) rectangular ( special ) , micro coverslips ( 24mmx24mm ) square ( special ) , micro coverslips ( 24mmx40mm ) rectangular ( special ) , micro coverslips ( 24mmx60mm ) rectangular ( special ) , micro coverslips ( 25mmx50mm ) rectangular ( special ) , micro coverslips ( 25mmx60mm ) rectangular ( special ) , micro coverslips 18mm circular , micro coverslips 19mm circular , micro coverslips 22 mm circular , micro coverslips 24mm circular , micro pippete 10 ul , micro pippete 20 ul , micro pippette 1000 ul , micro pippette 100ul , micro pippette 200 ul , micro pippette 50 ul , micro pippette ( 0 50ul ) , micro pippette 500ul , micro pippette tips ( 200 1000ul ) , micro pippette tips ( 2 200ul ) , micro tips yellow size small , micrometer stage , micropipate ( 00 to 210 micro litter ) , micropipate ( 00 to 1500 microlitter ) , micropipette tips 0 200 ?l , micropipette tips 1000 ?l , micropipette tips 200 ?l , microscope oil immersion moveable stage abbe condenser etc , multichannel micropipette 10?l ( fixed volume, 8 channel with built in tip ejector , multichannel micropipette 100?l ( fixed volume, 8 channel with built in tip ejector , multichannel micropipette 200?l ( fixed volume, 8 channel with built in tip ejector , multichannel micropipette 50?l ( fixed volume, 8 channel with built in tip ejector , museum jar ( rectangular with lid ) , anti sera e coli ( 5 amplues ) , anti sera shigella ( 5 amplues ) , anti sera vibrio ( 5 amplues ) , anti sera salmonella ( 5 amplues ) , patri dish 9cm glass , shigella ( lyophilized culture ( 173204 ) ( pack 2 stick ) , vibrio ( lyophilized culture ( 173204 ) ( pack 2 stick ) , klebsella ( lyophilized culture ( 173204 ) ( pack 2 stick ) , proteus ( lyophilized culture ( 173204 ) ( pack 2 stick ) , salmonella ( lyophilized culture ( 173204 ) ( pack 2 stick ) , alkaline bile salt agar ( himeda ) ( 500 gms ) , monsurs gelatin tourochalate ( himedia ) ( 100 gms ) , pcv tube ( wintrobe ) , petri plate carrier for 10 paltes anerobic system , ph meter digital each , pippete 1ml , pippete 5ml , plastic container for collection of stool, pus, sputum, with sepcimens 20ml capacity, sterile , plastic container for collection of stool, pus, sputum, with sepcimens 50ml capacity, sterile , platinum wire loop per meter , postmortem glvoes size 8 ½ pair , pricking needles per pack of 100 nos , priestley smith perimeter each , rack for patridish each , reagent bottle ( 1000cc ) , reagent bottle ( 100cc ) , reagent bottle ( 2000cc ) , reagent bottle ( 250cc ) , reagent bottle ( 500cc ) , reagent bottle ( 50cc ) , reagent bottle 100ml , reagent bottle 50ml , regent bottle 250ml , rubber bulb for pipettes big each , rubber bulb for pipettes small each , rubber teats varium volume each , single channel fixed volume micropipette 10?l , single channel fixed volume micropipette 100?l , single channel fixed volume micropipette 25?l , single channel fixed volume micropipette 50?l , single channel micropipette variable volume 100 1000?l , slide 76mmx25mm , spatula each , spirit lamp each , staining trough , stature needles ( half dozen stainless stell ) cat no. round bodied half circle size 1 , surgical gloves 7.5 pair , surgical gloves 7 pair , surgical glvoes 6 ½pair , test tube borocilicated ( 100x12mm ) each , test tube borocilicated ( 150x18mm ) each , test tube borocilicated ( 75x12mm ) each , test tube basket each , test tube glass 5ml each , test tube holder each , test tube plastic with cap 5ml each , test tube stand ( big ) each , test tube washing brush each , test tube with rim 05 cm each , test tube with rim 10cm each , digital thermometer each , analog ( mercury ) thermometer each , urinometer each , vdrl shakereach , water both ( serological ) 56c each , diamond pencil for slide marking , writing pen for neurograph each , stationary & other items , blood center master record register ( 20 cm x 32 cm ) , bio waste register ( 20cmx 32cm ) , blood and bllod components register ( 20cmx 32cm ) , blood and bllod components discardregister ( 32 cmx 20 cm ) , patient & donor cell & serum grouping register ( 20cmx 32cm ) , register of adverse blood transfusion reaction record ( 32cm x 20cm ) , register of blood transfusion transmitted infection ( tti ) test record ( 32c x 20cm ) , blood & bllod components ( packed red blood cels issue ) ( 32cmx 20cm ) , donor record register ( 20cmx32cm ) , attendance register 200 pages student each , attendance register 200 pages staffeach , calculator ( 12 digit basic large display ) each , carbon paper ( 8x13 blue ) ( 100 sheet per pack ) , chalk color ( 1x100 per pkt, non dust type ) , chalk white ( 1x100 per pkt, non dust type ) , correcting pen ( white fluid ) each , cotton tag ( 8 long ) 100 pcs per bunch ) , dak book 2qr per piece , envelope ( 11x5, laminated 100gsm ) per piece , envelope ( 11x5, white 57gsm ) per piece , envelope ( 12x16, brown paper100gsm ) per piece , envelope ( 8x10, laminated100gsm ) per piece , lamineted envelop ( 9 x4 ) per piece , lamineted envelop ( 10x12 ) per piece , paper flag ( 76mm×15mm×5 ) multi color per pack , four flapper file pad each , customized file cover with top side printed each , examination copy24 pages ( size 32x20cm ) 64 gsm with numbering neolith paper , examination supplementary copy12 pages ( size 32x20cm ) 64 gsm with numbering neolith paper , favicol 50 gms each , file cover no. 555 , index file ( liver arch file ) , file folder ( each ) , file lace ( 18 cloth green / white 924 ) ( 100 pcs ) , file pad / dak pad ( each ) , glue stick ( 18gms ) , glue stick ( 8gms ) , gum bottle ( 150ml ) , gum bottle ( 700ml ) , ink pad ( medium size ) ( each ) , paper clip ( 15mm ) , paper clip ( 41mm ) , t paper pin ( 500 pcs per box ) , paper punching machine big size ( each ) , paper weight for office desk per piece , photocopy pape a3 size ( 75gsm 500sheets ) , photocopy pape a4 size ( 75gsm 500sheets ) , photocopy pape fssize ( 75gsm 500sheets ) , pin cushion ( magnet type, standard size plastic body ) , sealing wax ( per kg ) , water damper for office use , stamp pad ( big size ) ( 7cm x 14cm metal case ) , stamp pad ( small size ) ( 5cmx9cm ) metal case , stapler big size no. 24 / 6 , stapler hp 45 , stapler pin no.10 , stapler pin no.24 / 6 , tag ( big green ) 100 pcs per bunch , a4 size color printing with 100 pages book binding with numbering on each page , a4 size color printing single side , a4 size color printing double side , a4 size printing single side , a4 size printing double side , a5 size printing single side , a5 size printing double side , a3 size printing single side , a3 size printing double side , a4 size book printing with binding ( 100 pages ) ( multiple color pages ) , ruled regiter 3 qr ( 8 ½ x 13 ½ ) , ruled regiter 6 qr ( 8 ½ x 13 ½ ) , ruled regiter 8 qr ( 8 ½ x 13 ½ ) , ruled reigter 4 qr ( size 8 ½ x 13 ½ ) , hp 12a compatible complete , mint color 75gsm a4 size ( 500 sheets per pack ) , stock register ( 100 page ) ( custom print ) , stock register ( 200 page ) ( custom print ) , fs size printing ( double side ) , fs size printing ( single side ) , marker pen ( each ) ( blue / black ) , highlighter ( each ) , dak book ( custom print ) , led bulb ( 12 watt ) ( syska / bajaj / surya / phylips ) per piece , led bulb ( 15 watt ) ( syska / bajaj / surya / phylips ) per piece , led bulb ( 09 watt ) ( syska / bajaj / surya / phylips ) per piece , tag 6’’ 100 pcs per bunch , godrej lock 7 liver , basta cloth per kg , led tube light complete set baton ( syska / bajaj / surya / phylips ) per piece , punching machine big size , pin cushion plastic box magnetic , duster for white board , duster for black board , pad ink ( 25 ml ) , scissor ( big size ) , plastic tasla / tub , dusting cloth , pen ( red, blue & black ) , poker , detergent powder ( 1 kg ) ( nirma / ghadi / tide / arieal / surf ) , soap ( lifeboy / detol / savlon ) , black phenyl ( 5 ltr pack ) , acid cleaner ( 5 ltr pack ) , naphthaline balls ( 10 no. per pack ) , dustbin small 10 ltr per piece , dustbin big ( 50 ltr ) with lid , dustbin big ( 10 ltr ) with lid, foot operated , plastic bucket ( 20 ltr ) , toilet brush with handel each , wiper with handel ( big size ) , bomboo stick ( 5 feet ) , bomboo stick ( 12 feet ) , bomboo basket , floor cleaning moper with stick big size , plastic mugs ( 1.5 ltr ) , keyboard mouse combo pack ( logitech ) , water pipe ( flexible ) ( per meter ) , date broom big size , coconut broom big size , grass broom big size...

Directorate Of Health Services - Madhya Pradesh

38937189 tender for supply of drugs, medicines and material during theyear2023 24 1 surgicalreagintes andeuipments 2 abdominal belt 3 abdominal drain kit all size 4 abdominal gauze sponge 30x30 5 abgel 6 absorbant cotton 100 gm 7 absorbant cotton 250 gm 8 absorbant cotton 400 gm 9 absorbant cotton 500 gm 10 acetone detection kit 150 tests 11 ad tape10cm x5mtr 12 ad tape10cm x8mtr 13 ad tape2.5cm x 5mtr 14 ad tape2.5cm x 8mtr 15 ad tape7.5cm x 5mtr 16 ad tape7.5cm x 8mtr 17 ad tape 5cm x 5mtr 18 ad tape 5cm x 8mtr 19 aed 20 aero mist (neonate) 21 air bad romsons 22 airbed 23 alb, glucose, ph strips 100 24 albumin & glucose strips 100 25 albumin (bcg method) (liquistat) 4 x50ml 26 alchohol tester 27 alkaline phosphatase(pnpp) kinetic 4 x50ml 28 allies tissue forcep 6 29 allies tissue forcep 7 30 allies tissue forcep 8 31 alluminium foil roll 32 ampul box 12 hol 33 ampul box 24 hol 34 ampul box 36 hol 35 amylase (cnpg3) (liquistat) 5x10 ml 36 aneroid sphygmomanometer 37 arm siling balt 38 artery forcep straight & curved5 39 artery forcep straight & curved6 40 artery forcep straight & curved7 41 artery forcep straight & curved8 42 artery forcep straight & curved9 43 artery forcep straight & curved10 44 aso turbilatex (quantitative)50 ml 45 auto scope 46 autoclave indicator tape 47 b.p. instument dial type 48 b.p. instument digital 49 b.p. instument wall type 50 b.p.handle 3 & 4 51 b.p.instument mercuri 52 b.p.instument mercuri free lcd 53 b.p.instument mercuri stand modle 54 baby clothkit 4pcs 55 baby credle 56 baby feeding spoon 57 baby warmer 58 bad side locker 59 bag for carrying kit / material during home visit for asha 60 bain circuit adult 61 bain circuit child 62 bandage 2x10m 63 bandage 2x5m 64 bandage 3x10m 65 bandage 3x5m 66 bandage 4x10m 67 bandage 4x5m 68 bandage 6x10m 69 bandage 6x5m 70 bandage cutting si 71 bandage than 18cmx100cm 72 barbar thared 100no 73 barbar thared 30no 74 barbar thared 40no 75 barbar thared 60no 76 barbar thared 80no 77 barium chloride 10% w/v 500 ml 78 bed pan female s.s. with cover 79 bed pan female s.s. without cover 80 bed pan male s.s. with cover 81 bed sheet single bed(coloured) 82 bed sheet single bed(white) 83 bed side locker deluxe s.s.top 84 bed side screen 4fold 85 bed side screen cloth 86 bedsheet double bed(coloured) 87 bedsheet double bed(white) 88 benedicts reagent (qualitative) 1000ml 89 bilirubin (liquistat) 2x100 ml(dmso total & direct auto & manual) 90 bio bags large (bio hazard bag) 91 bio bags medium (bio hazard bag) 92 bio bags small(bio hazard bag) 93 bio medical west polythin 30 kg. with bio hazard symbol mark (red,black,yellow,blue) 94 bio medical west polythin 5 kg. with bio hazard symbol mark (red,black,yellow,blue) 95 bio waste trolly with three color buckets 96 bioles nitries cylander 97 bioles oxygencylander 98 biolyse (detergent, deodorant) 35000ml 99 biomedical disposable waste bag with colour (red, black,blue, yellow ) per piece size 20 lt as per polution control board norm 100 biomedical disposable waste bag with colour (red, black,blue, yellow ) per piece size 40 lt per polution control board norm 101 biomedical disposable waste bag with colour (red, black,blue, yellow ) per piece size 60 lt per polution control board norm 102 biomedical waste collection plastic dustbinfoot pedal large (all colours) 103 biomedical waste collection plastic dustbinfoot pedal medium (all colours) 104 biomedical waste collection plastic dustbin foot pedal small (all colours) 105 bipap 106 bi phasic defebrillator 107 black phenyl 1ltr 108 black phenyl 1ltr jar 109 blade handle s.s. 3no & 4no 110 blancket for neonates 111 bloodadministration set 112 blood bag(disposable sterilised) with needle(100 ml) 113 blood bag with (disposable sterilised) with needle(350 ml) 114 blood grouping regent anti a 10 ml 115 blood grouping regent anti b10 ml 116 blood grouping regent anti d 10 ml 117 blood grouping regent anti comboa+ b + d3x10ml 118 blood pressure blader 119 blood pressure bulb 120 bob cock forcep 6 121 bob cock forcep 8 122 body wipes 123 bougie all size 124 c.v.p. manometer 125 calcium 2x50 ml 126 camer wire all size 127 camra cover 128 canada balsam (cytology mountant) 500ml 129 cannula fixator 130 capillary tube 131 carbol fuchsin (zn strong) 500 ml 132 carmancannula 133 catheter mount 134 cervical collar 135 chair cushion box type 136 chair cushion box type 137 chair cushion cover 138 cheatal forcep 10 139 chest drain catheterfg 16 140 chest drainage catheter all size 141 chinkungunia card 142 cholesterol total 250ml(wybenga manual with hdl ppt reagent) 143 ck nac (ifcc) 5x10 ml 144 codan set 145 codon filter set 146 cold/hot pack 147 colo bag 148 colostomy kitadult 149 colostomy kitpaediatric 150 compounder coat/lab tec /xry tec std size 151 compunder dress (male) 152 cord clamp 153 corrugated drainage sheet 154 cottan thared 155 counting chamber 156 cover slip 18 x 18 mm 10gm 157 covid self testkit 158 cpap 159 cpap/bipapmask tubing 160 cpap/bipap mask airvent 161 creatinine ep (liquistat) 25 test(manual end point jaffs) 162 creatinine fk (kinetic) (liquistat) 2x50 ml 163 crep bandage 2 164 crep bandage 3 165 crep bandage 4 166 crep bandage 6 167 cromic catgut 1 168 cromic catgut 1 0 169 cromic catgut 2 170 cromic catgut 2 0 171 cromic catgut 3 172 cromic catgut 3 0 173 crp turbilatex (quantitative) 50ml 174 crystal violet (gention violet) 500 ml 175 csf diluting fluid 100ml 176 csf protein (liquistat) 2 x 50ml(auto & manual for urine micro proteins) 177 curtain green redymade 178 curton cloth rangeen 179 cvc double lumen 180 cvc single lumen 181 cvc triple lumen 182 cytochrom kit with buffer 2x (modified leishmans stain)500ml 183 cytology collection kit 50 smears 184 d & c sat 185 de colouriser for hematoxylene (1% hcl in a.a.) 500 ml 186 delivery kit 187 dengue combo card 188 dengue igg/igm card 189 dengue ns1 card 190 dialater sat 8pcs. 191 diapers baby 192 digital b.p cuff 193 digital hemoglobino meter 194 digital tourniquet 195 digital wrist watch 196 digital x ray film 10x12 197 digital x ray film 11x14 198 digital x ray film 14x17 199 digital x ray film 8x10 200 dilasis cathator double lumen 201 dilasis cathator triple lumen 202 dionised water 5 ltr 203 dipers adult 204 direct hdl (liquistat) 5x10 ml 205 direct ldl (liquistat) 5 x 10ml 206 disposable adis kit 207 disposable face mask 208 disposable gown 209 disposable hme filter 210 disposable n95 face mask 211 disposable needle 22,23,24,26 212 disposable non wovanbed sheet 213 disposable nursecap 214 disposable opration kit 215 disposable paper gloves 216 disposable plasticbed sheet 217 disposable plastic apron 218 disposable plastic lancet 219 disposable ppe kit 220 disposable sharp collection containers 1.5 l 221 disposable sharp collection containers 5 ltr 222 disposable shoe cover 223 disposable sprit swab 224 disposable sterile gloves 6 225 disposable sterile gloves 6 1/2 226 disposable sterile gloves 7 227 disposable sterile gloves 7 1/2 228 disposable surgeon cap 229 disposable syringe 10ml 230 disposable syringe 20ml 231 disposable syringe 2ml 232 disposable syringe 3ml 233 disposable syringe 50ml 234 disposable syringe 5ml 235 disposable woodan tongue depressor 236 distilled water5000ml 237 doctor apron 238 doctor chair 239 double oxalate solution 100ml 240 double stage nitrogen regulator 241 double stage oxygen regulator 242 dpx mountant (cytology mountant) 500 ml 243 drabkins solution with standard (ready to used for hb) 1000ml 244 dressing forcep plain & toeth 10 245 dressing forcep plain & toeth 5 246 dressing forcep plain & toeth 6 247 dressing forcep plain & toeth 8 248 dressing pad 10*10 249 dressing pad 10*20 250 dressing scissor straight & curved 10 251 dressing scissor straight & curved 5 252 dressing scissor straight & curved 6 253 dressing scissor straight & curved 8 254 dressing trolley m.s 255 dressing trolley s.s 256 dual testing kit for hiv and syphilis screening, rapid diagnostic test kit(total no. of test 900000),consumable 257 dust bin 10 ltr. (red,black,yellow,blue) 258 dust bin 20 ltr. (red,black,yellow,blue) 259 dust bin 40 ltr. (red,black,yellow,blue) 260 dust bin, foot operated, metal 261 dylazer & tubing set for adult 262 dylazer & tubing set for child 263 e.n.t sat 264 easyfix spray (blood smear fixative) 50 ml 265 ecg 210 x 300 x 200 sheets 266 ecg electrode 267 ecg gel 250gm 268 ecg gel 5kg 269 ecg machinesix channel 270 ecg machinethreechannel 271 ecg machinetwelvechannel 272 ecg machine single channel 273 ecg roll50 x 20 mtrs 274 ecg roll 106 x 20 mtrs 275 ecg roll 210 x 20 mtrs 276 ecg roll 215 x 20 mtrs 277 ecg roll 60 x 15 mtrs 278 ecg roll 80 mm x 20 mtrs 279 edta 5% w/v 500ml 280 edta k3 concentrate 150ml(dropping bottle) 281 elastic adhesive bandage 4 x 1mtr 282 elastic adhesive bandage 4 x 4/6mtr 283 elecrto surgical pencil 284 elevated calibrator (liquistat)(with multi parameter assigned value) 5ml 285 endotracheal tube cuffed all size 286 endotracheal tube plain all size 287 enema pot(douche sat) 288 eosin 2% (for hematoxylin stain) 500 ml 289 eosinophil diluting fluid 100ml 290 epidural cathator 16 , 18 291 epidural kit16 , 18 292 epidural needle ng 16 293 essence nebulizer (home) 294 ett intubation stylet 295 examination gloves 296 examination table three fold 297 examination table two fold 298 extention duo 299 external catheter male condom cathator 300 eye,ear & ulcer syringe 301 falcon tube 302 feeding bag 303 feeding tube fg all size 304 fetal doppler 305 fetal monitor 306 field stain a 500 ml 307 field stain b 500 ml 308 field stain a & b2 x 500ml(combined kit with easyfix spray fixative) 309 fingartippulse oximeter 310 fix wakar 311 flatus tube all size 312 flaxomatalic endotracheal tube all size 313 flouride solution(pot.oxalate 5%, flouride 1%) 500 ml 314 flow cell cleaner (ready to use) 500 ml 315 fluoride concentrate 150ml(dropping bottle) 316 folding wakar 317 foley catheterpaed. 8 , 10 318 foley catheter 2 way 319 foley catheter 3 way 320 foot stap double 321 foot stap single 322 forcep plan pointed 4 323 formal saline 5000ml(for histology sample preservation) 324 formalin chambers 21x 8x 8 three tray 325 formalin chambers 26x 8x 8 three tray 326 fouchet’s reagent 150ml 327 freeze thermometer 328 front aprin 329 g 6pdh (quantitative, uv) kinetic 15 x 1.1ml 330 g 6pdh (screening) 15 x 1ml 331 gamji roll 4x3m. 332 gamji roll 6x3m. 333 gamma gt (ifcc kinetic) (liquistat) 2x50 ml 334 gauze 18x90 super fine 335 gauze swab10cm x 10cm 336 gauze swab 7.5cm x 7.5cm 337 geimsa stain kit 500ml(with buffer 10x & easyfix spray) 338 gel pack 339 giglisaw handal 340 giglisaw wire 341 glacial acetic acid (2.5 liter) 342 glacial acetic acid (2.5 liter) 343 glass slide 344 glass test tube 12 x 100 (medium size) 345 glass test tube 12 x 75 (small size) 346 glucometer 347 glucometer strips 348 glucose (god pod) 5 x100ml 349 gonio meter medium 350 got (ast) kinetic (liquistat)2x50 ml 351 gpt (alt) kinetic (liquistat)1 x50ml 352 gram’s stain kit (ready to use) 4 x 100ml 353 grams iodine 500 ml 354 guedel airways all size 355 haemoglobin std (cynmeth) 10ml 356 hamar with brush 357 hand hold pulse oximeter 358 hand wash liquid 500ml 359 hbsag card 360 hbsag strip 361 hcg card 362 hcg strip 363 hcv card 364 head strap for cpap/bipap mask 365 heamoglobin colour scale book with strip 366 heamoglobino meter 367 heamoglobino strip 368 heamstrips (occult blood strips) 369 heamtest 200 test(for occult blood with positive & negative control) 370 heavy duty pallet racks 371 hematoxylene (harris) 500 ml 372 hemoglobino strips 373 hight scale with stand 374 hiv card 375 hub cutter needle syring cutter ele. 376 hub cutter needle syring cutter non ele. 377 humidifeder bottal 378 hydrochloric acid n/10 500 ml 379 hydrochloric alcohol 380 hygrometer 381 i.v. set (regular) 382 i.v.stand 383 i.v.stand with whill 384 icu bed deluxe 385 idetification tag adult 386 immersion oil (microscopy grade) dropping bottle25ml 387 infantometer 388 infantometer 389 infrared digitalthermometer 390 infusion pump 391 insulin syringe 100 unit 392 insulin syringe 40 unit 393 intera kit 18 ,20 ,22 394 intracath 26 395 intracath24 396 intracathg 18 , 20 ,22 397 intravenous set with airway and needle 398 iron racks 399 iron tibc (ferrozin) 2x50 ml 400 iui cannula 401 jaundice meter 402 k3 blood vaccutainer(edta 100 tubes/pkt),consumable [700465] 403 kehr’s ‘t’ tubefg all size 404 kellys pad disposable 405 ketone & glucose strips 100 406 kidney tray s.s. 10 407 kidney tray s.s. 12 408 kidney tray s.s. 6 409 kidney tray s.s. 8 410 knee cap 411 kwire all size 412 l s belt 413 labour table 2 lighotomy rod 414 laringoscop adult 3 blade 415 laringoscop adult 4 blade 416 laringoscop bulb 417 laringoscop peidatric 2 blade 418 laryngeal mask all size 419 laryngoscope 420 ldh (uv kinetic) (liquistat) 5x10 ml 421 led torch 422 lint cloth 100 gm 423 lipase (liquistat) 2x25 ml 424 liquid hand wash 500ml 425 liquid paraffin 500 ml 426 lugol’s iodine 100 ml 427 m.v. set 110ml 428 m.v. set 150ml 429 m.v.a. cannula all size 430 m.v.a. kit 431 macanical wight machine adult 432 macanical wight machine pedatric 433 magnesium (calmagite) (liquistat) 5x10 ml 434 malaria antigen pf/pv card 435 malicot cathater all size 436 manual breast pump 437 masquitoforcep straight & curved 5 438 matarnity pad 439 mattress 5kg cotton 3 ft x 6 ft 440 mayo scissor 6 1/2 441 mayo scissor 8 1/2 442 mayos instument trolley 443 mercury free sphygmomanometer 444 methylene blue 100 ml 445 metresses 3x6 with raxine cover 40 density 446 micro drip set 447 micro protein (pyrogallol red) 5 x 10ml 448 micro protein (turbidometry) 2 x 25ml 449 microanatomy spray fixative 50ml 450 micropiptte 0 100 fix and variable 451 micropiptte 100 1000 fix and variable 452 mini vac set 453 mob 454 monitor 2 parameter 455 mother and child idetification tag 456 motorized icu bed 457 mouthgag 458 mucus extractor 459 multipara monitor 5 parameter 460 myner opration tray 461 napkin sup. quality std size(white) 462 nasopharyngeal airwayall size 463 nebulizer 464 nebulizer kit (adult) 465 nebulizer kit (child) 466 nelaton cathetar all size 467 neonatle / infent weighing scale with sling weighing machine / scale 468 nibp cuff 469 nitril powder freeexaminationglovesalll size 470 non.ster. glovesall size 471 nylon 1 472 nylon 2 473 nylon 2 0 474 nylon 3 475 nylon 3 0 476 nylon1 0 477 office almirah 478 office chair 479 office table 480 opthalmoscope 481 opticare microscope lens cleaner 150ml 482 orthipadictourniquet with belt electric 483 orthipadictourniquet with belt manual 484 ortho bandage 4x 10m 485 ortho bandage 6x 10m 486 over bad trolly adjustable 487 ovum forcep 10 488 oxygen concentration 489 oxygen cyilnder trolley jambo 490 oxygen cyilnder trolley medium 491 oxygen cylander 20cft 492 oxygen cylander 44cft 493 oxygen cylander jambo 494 oxygen cylander key 495 oxygen flow meter 496 oxygen hood (l)10x 8x 9 497 oxygen hood (m)8x 7x 9 498 oxygen hood (s) 6x6x6 499 oxygen mask (adult) 500 oxygen mask (child) 501 oxygen nasal cannula (child) 2 mtr 502 oxygen nasal cannula (child) 2 mtr 503 pap sumer kit 504 papanicolaou ea 36 500 ml 505 papanicolaou ea 65 500 ml 506 papanicolaou og 6 500 ml 507 paper tape 5cm x 9mtr 508 paper tape10cm x 9mtr 509 paper tape 2.5cm x 9mtr 510 paper tape 7.5cm x 9mtr 511 paraffin strip roll 512 paraffin wax 58° 60°c with cerecin 1kg 513 patient body wipes 514 patient dress paint shirt 515 patient gown 516 pead. urine bag 100ml 517 pediatric jacson rees system 518 peritoneal dialysiscatheter set adult 519 peritoneal dialysiscatheter set child 520 peticote blauge cloth shuti rangeen 521 ph meter 522 phosphorus (end point) new (liquistat) 2 x 50ml 523 phototheraphy 524 pillow cover cloth bleach 525 pillow with 2kg cotton 526 pipette bulb 527 plain rubber catater all size 528 plaster of paris 410x2.7mtr 529 plaster of paris 6 15x 2.7mtr 530 plastic kidny tray 8 531 plastic kidny tray 10 532 plastic kidny tray 12 533 plastic sputom cap 534 plastic urin pot male 535 platelet diluting fluid 100 ml 536 plstic bad pan 537 plstic urin pot femail 538 portable suction machine 539 portneb handheld nebulizer 540 post mortem sat 541 potassium (stpb) (liquistat) 2x50 ml 542 powderd examinationgloves all size 543 power drool 544 prep razor 545 presaure monitiring line all size 546 pressure monitering kit 547 procto scopes,m,l, 548 proline 549 protein (biuret) (liquistat) 4 x 50ml 550 quadripot stik 551 rapid afb stain kit (cold method) 2 x 100ml 552 rapid aso (latex slide test) 50 tests 553 rapid bile pigment reagent 25ml 554 rapid crp (latex slide test) 50 tests 555 rapid fructose kit(with positive control) 100 ml 556 rapid h & e stain kit 250 smears(only 03 minute h & e staining kit) 557 rapid malaria stain kit (jsb i & ii)2 x500ml(one minute stain for blood parasite) 558 rapid mp stain kit 2 x 100ml(one minute stain for blood parasite) 559 rapid ra (latex slide test) 50 tests 560 rapid widal (o, & h) slide test(2+2) x5 ml 561 rapid widal (o, h, ah, bh) slide test 4 x 5ml 562 rapid pap cytoplasm stain a 500 ml 563 rapid pap cytoplasm stain b 500 ml 564 rapid pap dehydrant 500 ml 565 rapid pap nuclear stain 500 ml 566 rapid pap stain kit 250 smears(a3 minute pap staining kit) 567 rbc diluting fluid 500 ml 568 re breathing bag 569 respirometer 570 reticulocyte counting 25ml 571 reticview 125 smears(with counter stain & buffer) 572 revolving stool 573 rf turbilatex 50 ml(rheumtoid factor) quantitative 574 right angle forcep 8 575 right angle forcep 9 1/2 576 romo drain bag 577 romo vac set all size 578 room thermometer 579 rubber bed pan 580 rubber corrugated drainage sheet 581 rubber kellys pad 582 rubber lung excise bag 583 rubber post mortam gloves all size 584 ruber mac & tose sheetper metre 585 ryles tube all size 586 s.s autoclove 12 x 12 587 s.s. bad pan female w/o cover 588 s.s. bad pan female with cover 589 s.s. bad pan male with cover 590 s.s. bowel 10cm 591 s.s. bowel 12cm 592 s.s. bowel 14cm 593 s.s. bowel 16cm 594 s.s. bowel 20cm 595 s.s. fumigater5liters 596 s.s. urinal female 597 s.s. urinal male 598 s.s.autoclove 12 x 20 599 s.s.catheter tray 17 x 6 x 4 600 s.s.catheter tray 8 x 5 x 3 601 s.s.dressing drums (jointed)6x6 602 s.s.dressing drums (jointed)9x9 603 s.s.dressing drums (jointed) 11x 9 604 s.s.dressing drums (jointed) 12x10 605 s.s.dressing drums (jointed) 15x12 606 s.s.fogar 607 s.s.kidney tray 10 608 s.s.kidney tray 12 609 s.s.kidney tray 6 610 s.s.kidney tray 8 611 s.s.sterilizer 10 x 5 x 3 612 s.s.sterilizer 14 x 6 x 4 613 s.s.sterilizer 16 x 6 x 4 614 s.s.sterilizer 18 x 8 x 6 615 s.s.sterilizer 20 x 8 x 6 616 s.s.tray w/o cover new born baby 617 s.s.tray with cover 10 x 8 618 s.s.tray with cover 12 x8 619 s.s.tray with cover 12x 10 620 s.s.tray with cover 14 x10 621 s.s.tray with cover 15 x 12 622 s.s.tray with cover 18 x12 623 s.s.tray with cover 8 x6 624 s.s.tray with cover 9 x6 625 safranine 0.5% w/v (grams) 500 ml 626 sanatry napkeen 627 scalp vein set all size 628 scissor cutical 4 629 scott’s tap water substitute 100 ml 630 semen diluting fluid 100 ml 631 sgot (manual dnph) 30 tests 632 sgpt (manual dnph) 30 tests 633 silicon ambubag adult 634 silicon ambubag neonatal 635 silicon ambubag peidiatric 636 silicon foley catheter 2 way 637 silicon mask all size 638 silicon ventouse cup with release valve 639 silk 1 640 silk 2 641 silk 2 0 642 silk 3 643 silk 3 0 644 silk thared 645 silk1 0 646 simple camood chair 647 simple camood stool 648 single stage nitrogen regulator 649 single stage oxygen regulator 650 single walking stik 651 skin grafting blade 652 skin grafting blade handle 653 skin marker pan 654 sod / pot / chlo (liquistat)( u. acetate / stpb / thiocynate ) 3 x100ml 655 sodium (phosphonazo iii) new (liquistat) 2 x 50ml 656 sodium citrate 3.2% w/v 100 ml 657 sodium citrate 3.8% w/v 500 ml 658 sodium hypochlorite 5000ml 659 solid linen trolley 660 spinal needleall size 661 spirit lamp 662 sponge holding forcep 10 663 sponge holding forcep 8 664 spoon 5 ml 665 sputum cup with sticker 30ml 666 sputum cup with sticker 50ml 667 stadiometer 668 ster. surgical glovesall size 669 sterile blade with handle all size 670 stethoscope 671 stracher meter 672 stretchre on trolley 673 stumach wash tube 674 sture needle 1/2 circle cutting 675 sture needle r.b. 1/2 circle 676 sture needle straight 677 suction catheter plain all size 678 suction catheter thamb cantrolall size 679 suction handal 680 suction machine double bottle 681 suction set 682 suction tube (roll of 10 mtr) 683 sulphosalicylic acid 3% w/v 500 ml 684 sulphosalicylic acid 30 % w/v 500 ml 685 sulphuric acid 20% v/v 500 ml 686 supra cath all size 687 surgical bladeall size 688 surgical spirit 100 ml bottle 689 surgical spirit 500 ml bottle 690 suture stitch cutting scissor teeth 691 syphilis card 692 syphilis strip 693 syringe pump 694 table cloth rangeen 695 tape roll 696 tds meter 697 tericot sharee 698 test tubebrush 699 therm0meter digital 700 therm0meter ovel 701 therm0meter round 702 thermacol box 703 thermometer rectal 704 thomas splint all size 705 three way cannula all size 706 three way ext. tube all size 707 three way stop cock 708 tips for auto pipettes 2 to 100 micro litres 709 tips for auto pipettes 200 to 1000 micro litres 710 tips for auto pippetes 10 to 100 micro litres 711 tissue paper roll(each),consumable 712 toomy syringe 713 torch with 2 cells 714 total protein & albumin 2 x100ml(biuret & bcg ) (liquistat) 715 tourniquet belt 716 towel clip 717 tracheostomy filtor 718 tracheostomy tube (cuffed) all size 719 tracheostomy tube (plain) all size 720 tri pot stik 721 triangular bandage 90cm x 90cm 722 triglycerides (enz. end point) (liquistat) 2x50 ml(enz. end point) (liquistat) 723 trocar catheterall size 724 troponin card 725 tur set 726 typhoid card igg/igm 727 typhoid test card(an immunochromatography assay for the rapid visual detection of typhoid antibody igg/igm in human serum/plasma)(50 test per pack),consumable [987739] 728 ultrasonic nebulizer 729 ultrasound gel 250gm 730 ultrasound gel 5kg 731 under pad sheet 732 universal cleaner 10 ltrs.(compatible with all 3 parts 18 23 parameter hematology counter) 733 universal diluent 10 ltrs.(compatible with all 3 parts 18 23 parameter hematology counter) 734 universal wash 100ml(compatible with all 3 parts 18 23 parameter hematology counter) 735 urea (gldh) (liquistat) 5 x 10ml 736 urea (ned) (liquistat) 4 x 50ml 737 urea dam (with extended linearity) reagent 1 x 100ml 738 urea h. p. (berthelot) 100 ml 739 urethral catheter k90 , k91 740 uric acid (end point) (liquistat) 4 x 50 ml 741 urine albumine/sugar strip 742 urine bile pigment kit 250 test 743 urine collecting bag 744 urine collecting bag leg bag set 745 urometer adult 746 usg papers glosy 747 usg papers non glosy 748 vaporiser 749 vein finder 750 ventilator circuit double water trap 751 ventilator circuit plain 752 ventilator circuit single water trap 753 vicril 2 754 vicril1 0 755 vicril2 0 756 vicril3 757 vicril3 0 758 vicril 1 759 video colposcope 760 visitor stool 761 viwe box double film 762 viwe box singal film 763 ward bad deluxe 764 ward bad fowler 765 ward bad genral 766 ward bad samifowler 767 warm sleeping bag for neonates 768 wash basin stand double 769 wash basin stand single 770 water bad 771 water bed 772 water wipes 773 wbc diluting fluid 500 ml 774 wheel chair 775 who hemoglobin color scale (starter kit) components (1) colour scale 01/kit (2)test strip 1000/kit (3) printed literature for method of use/kit (4)lancet 1000/kit 10x100(nabl/cap accrediated lab test certificate for the batch no. must be enclosed with each supply delivered),consumable [mis145] 776 widal test kit 777 wight machine digitaladult 778 wight machine pedatric digital modle 779 wiper 780 wright’s stain with buffer 2x100 ml(gold standard) 781 x ray casettedigital10x 12 for fuzi make machine 150 sheet 782 x ray casettedigital11x 14 for fuzi make machine 150 sheet 783 x ray casettedigital14x 17 for fuzi make machine 100 sheet 784 x ray casettedigital8x 10 for fuzi make machine 150 sheet 785 x ray tablecomplete 786 x ray casette 10x12 787 x ray casette 12x15 788 x ray casette 6.5x8.5 789 x ray casette 8x10 790 x ray chest stand floor mounted 791 x ray chest stand wall mounted 792 x ray dark room safe light 793 x ray developer 13.5ltr 794 x ray developer 22.5ltr 795 x ray developer 9ltr 796 x ray developing tank 22.5ltr 797 x ray developing tank 9ltr 798 x ray film 10x12 packet of 50 sheet 799 x ray film 12x12 packet of 50 sheet 800 x ray film 12x15 packet of 50 sheet 801 x ray film 6.5x8.5 packet of 50 sheet 802 x ray film 8x10 packet of 50 sheet 803 x ray film digital 10x12 packet of 150 sheet 804 x ray film digital 11x14 packet of 150 sheet 805 x ray film digital 14x17 packet of 150 sheet 806 x ray film digital 8x10 packet of 150 sheet 807 x ray film drying rack for 12 film 808 x ray fixer13.5 ltr 809 x ray fixer13.5 ltrtank 810 x ray fixer 22.5ltr 811 x ray fixer 9 ltr 812 x ray hanger s.s. 10x12 813 x ray hanger s.s. 12x15 814 x ray hanger s.s. 6.5x8.5 815 x ray hanger s.s. 8x10 816 x ray lad aprine 817 x ray lad lets 818 x ray lad number 819 x ray lead appron 820 x ray lead gloves 821 x ray lead letter 0 9 822 x ray lead letter a z 823 x ray lead partition with lead glass 824 x ray machine 100 ma digital complete set portabel 825 x ray machine 100 ma manual complete set 826 x ray machine 300 ma digital complete set 827 x ray machine 300 ma manual complete set 828 x ray machine 60 ma digital complete set 829 x ray machine 60 ma manual complete set 830 x ray screen kiran h.s. 10x12 831 x ray screen kiran h.s. 12x15 832 x ray screen kiran h.s. 6.5x8.5 833 x ray screen kiran h.s. 8x10 834 x ray screen kiran kg 4 10x12 835 x ray screen kiran kg 4 12x15 836 x ray screen kiran kg 4 6.5x8.5 837 x ray screen kiran kg 4 8x10 838 x ray view box med. two tubelight , size 24x24 839 x ray view box med. two tubelight , size 36x24 840 zig zag cottan 500gm 841 zipper polybag 842 medicines 843 10% amino acid + electrolyte inj. 844 10% entravenec fate emlusion 10% inj. 845 5 fu 250mg. inj. 846 5 fu 500mg. inj. 847 5% amino acid + 5% sarbitol inj. 848 5% amino acid + sarbitol inj. 849 a&d cap 850 abacavir 300mg tablet 851 acarbose 50mg tablet 852 aceclofenac 100mg + paracetamol 325mg + chlorzoxazone 250mg tablet 853 aceclofenac 100mg + paracetamol 325mg + serratiopepdise10mg tablet 854 aceclofenac 100mg + paracetamol 325mg tablet 855 aceclofenac 100mg tablet 856 aceclofenac 50mg + paracetamol 125mg 60mlsyrup 857 aceclofenac 50mg/5ml syrup 858 acetazolomide 250mg tablet 859 acetylsalicylic acid (aspirin 25 mg)tablet 860 acetylsalicylic acid 150mg tablet 861 activated charcoal 400mg tablet 862 acyclovin 3mg oint 863 acyclovir 0.5% 5ml eye drop 864 acyclovir 200mg tablet 865 acyclovir 250mg injection 866 acyclovir 400mg tablet 867 acyclovir 500mg injection 868 acyclovir 800mg tablet 869 adenachrome (chromstate) tablet 870 adenachrome 3mg/2ml 2ml injection 871 adenachrome 5mg/5ml 5ml injection 872 adenosine 6mg/2ml injection 873 adrenaline 1ml injection 874 ags 10000iu/ml injection 875 albendazole 200mg/5ml 10ml syrup 876 albendazole 400mg tablet 877 allopurinol 100mg tablet 878 allopurinol 300mg tablet 879 alpha beta arteether 150mg/2ml 2ml injection 880 alphacalcidol cap 881 alprazolam 0.25mg tablet 882 alprazolam 0.50mg tablet 883 ambroxol hcl 15mg+terbutaline sulphate 1.25mg+guaiphenesin 50mg 5ml((additional composition of menthol also acceptable) 100ml bottle),syrup 884 amikacin 100mg 2ml injection 885 amikacin 250mg 2ml injection 886 amikacin 500mg 2ml injection 887 amino acid 7% + eaa 61% injection 888 amino acid 8% + bcaa 42% injection 889 aminophyline 100mg tablet 890 aminophyline injection 10ml 891 amiodarone 100mg tablet 892 amiodarone 200mg tablet 893 amiodarone hydrochloride injection(50mg /ml) 3ml 894 amlodipine 10mg tablet 895 amlodipine 2.5mg + ramipril 2.5mg tablet 896 amlodipine 2.5mg tablet 897 amlodipine 5mg + atenolol 50mg tablet 898 amlodipine 5mg + ramipril 2.5mg tablet 899 amlodipine 5mg tablet 900 amoxicillin + clavulanic acid tablet kid 228mg. 901 amoxicillin 1000 + clavulanic acid 200mg tablet 902 amoxicillin 200mg + clavulanic acid 28.5 30 ml syp 903 amoxicillin 250 mg+ bromhexine 8 mg cap 904 amoxicillin 250mg+ lactic acid basilus 60 million spores cap 905 amoxicillin 500mg + clavulanic acid 125mg tablet 906 amoxycillin 1000mg+ potassium clavulanate 200mg injection 907 amoxycillin 250mg + potassium clavulanate 50mg injection 908 amoxycillin 500mg+ potassium clavulanate 100mginjection 909 amoxycillin inj 250 mg/vial vial 910 amoxycillin trihydrate disp. tab. 125mg. 911 amoxycilline 250mg cap 912 amoxycilline 500mg cap 913 amoxycilline 5ml/125mg30 ml syp 914 amoxycilline injection 250mg 915 amoxycilline injection 500mg 916 amphotericin b inj ip 50 mg(liposomal amphotericin b also acceptable),injection 917 ampicilline + cloxacilline injection(250 mg +250mg ) 918 ampicilline + cloxacilline injection(500 mg +500mg) 919 ampicilline 125mg+ cloxacilline 125mg cap 920 ampicilline 250mg + cloxacilline 250mg cap 921 ampicilline 250mg cap 922 ampicilline 30ml /125mg syp 923 ampicilline 500mg cap 924 ampicilline injection 250mg 925 ampicilline injection 500mg 926 antacid 170ml syrup 927 antacid tablet 928 anti d immunoglobulin for iv/im use (monoclonal) inj 150mcg 1 ml vial 929 anti d immunoglobulin for iv/im use (monoclonal) inj 300mcg pfs/vial 930 anti rabies vaccine i.p. inj. human (tissue culture) for i/d and i/m route 2.5 iu with(1ml diluents),vial 931 anti scorpion venom injection 10 ml 932 anti snake venom inj polyvalent 10 ml (lyophilized) 10 ml vial 933 anti tetanus human immunoglobulininjection250 iu /vial 934 anticold 30ml drop 935 anticold 60ml syp. 936 anticold tab. 937 antifungal 5 gm oint . 938 antioxidant lycopen, vitamins & multi minerals 200ml syrup 939 antioxidants+ lycopene+ vitamins& multimineralscap 940 antioxident cap 941 antioxident with vitamine & ginseng cap. + 15 ingredients 942 arteether injection1 ml 943 artemether + lumefantrine tab 20mg +120mg 944 artemether inj 80 mg/ ml 1ml amp 945 artesunate + sulphadoxine + pyrimethamine(age group of less than 1year) tab artesunate 25mg(3tab) + sulphadoxine 250mg(1tab)+pyrimethamine 12.5mg tablets ip(1tab) 1 combi pack 946 artesunate + sulphadoxine + pyrimthamine (age group 15 or above) tab artesunate 200mg (3 tab) + sulphadoxine 750mg (2 tab) + pyrimethamine 37.5 mg (2 tab) tab. ip 1 combi pack 947 artesunate + sulphadoxine + pyrimthamine (age group between 1 4 years) tab artesunate 50mg (3 tab) + sulphadoxine 500mg (1 tab) + pyrimethamine 25 mg (1 tab) tab. ip 1 combi pack 948 artesunate + sulphadoxine + pyrimthamine (age group between 5 to 8 years) tab artesunate 100mg (3 tab) + sulphadoxine 750mg (1 tab) + pyrimethamine 37.5 mg (1 tab) tab. ip 1 combi pack 949 artesunate + sulphadoxine + pyrimthamine (age group between 9 to 14 years) tab artesunate 150mg (3 tab) + sulphadoxine 500mg (2 tab) + pyrimethamine 25 mg (2 tab) tab. ip 1 combi pack 950 artesunate 60 mg tablet 951 artesunate 60mg injection 952 artesunate powder for injection 120 mg(vial of 1 powder injection with appropriate diluents),injection 953 arv rabies vaccine injection i.p. 2.5 iu single dose 954 ascorbic acid 100mg tablet 955 ascorbic acid 500mg tablet 956 asprin 150mg tablet 957 asprin 75mg tablet 958 atenolol 100 mg tablet 959 atenolol 25 mg tablet 960 atenolol 50 mg tablet 961 atorvastatin 10 mg tablet 962 atorvastatin 20 mg tablet 963 atorvastatin 40 mg tablet 964 atracurium 10mg/ml 2.5ml vial/amp injection 965 atropine sulphateinjection 0.6mg/ml 1ml 966 atropine sulphate 0.6 mg/ml sc/im/iv(2ml amp),injection 967 atropine sulphate 1% 5ml eye drop 968 atropine sulphate eye 1% ointment 969 avastin 100mg. inj. 970 azithromycininjection 100mg 5ml 971 azithromycininjection 200mg 5ml 972 azithromycin 200mg/5ml 15ml syp 973 azithromycine 250mg tablet 974 azithromycine 500mg tablet 975 baclofen(40 mg tab),tablet 976 b complexinjection 10ml 977 b complexinjection 3 ml 978 b complexinjection 30ml 979 b complexminerals with zinc cap 980 bcomplex + zinc + ginsengcap. 981 b complex 100ml syp 982 b complex tablet nfi 983 bendamustine(100mg vial),injection 984 benzathain penicillininjection 12 lac 985 benzathain penicillininjection 6 lac 986 benzoyl peroxide gel 5% 15gm tube 987 betahistidine 16 mg tablet 988 betahistidine 24 mg tablet 989 betahistidine 8 mg tablet 990 betamethasoneinjection 4mg ml 1 ml 991 betamethasone dipropionate ointment 0.05% 15 gram tube 992 betamethasone sodium phosphate(ml contain betamethasone sodium phosphate equal to 4mg of betamethasone (1ml amp)),injection 993 betamethasone tab 0.5 mg 994 bicalutamide 50mg tablet 995 bisacodyl suppositories 5 mg 996 bisacodyl tab 5mg 997 bleaching powder containing not less than 30% w/w of available chlorine(as per i.p),powder 998 bleomycin(15 units / vial),injection 999 boro spirit ear drops (0.183 gm boric acid in 2.08 ml of alcohol 10 ml vial) drop 1000 bortezomib(2mg),injection 1001 botropase injection(haemocoagulase 1cu) 1ml 1002 brimonidine eye drops 1003 bromhexin (4mg ) + salbutamol (2mg) 60ml syp 1004 bromhexine 4mg/5ml 50ml bottle syp 1005 budesonide nebulising suspension containing budesonide(0.5 mg/2ml 2ml amp) suspension 1006 bupivacaine hcl for spinal anaesthesia 4ml amp injection 1007 bupivacaine hydrochloride 0.5% 20ml vial injection 1008 bupivacaine hydrochloride with dextrose 5% spinalinjection 1009 cabergoline tab 0.5 mg 1010 caffeine citrate inj. 20mg/ml 3ml vial injection 1011 caffine citrate drop 1012 calamine lotion 50 ml bottle 1013 calamine lotion ip (contains per 1000 ml: calamine 150 gm,zinc oxide 50 gm, bentonite 30 gm, sodium citrate 5gm, liquified phenol 5ml, glycerin 50 ml purified waterfreshly boiled and cooled to produced 1000ml) 50 ml bottle(50 ml bottle),bottle 1014 calcium 100ml. syp 1015 calcium 75mg + phosphorus 58mg + vitamin c 25mg + niacinamide 15mg + vit a 6.4mg + vit e 5mg + magnesium 3mg + potassium 2mg + vit b1 1mg + vit b2 1mg + calcium phosphorus 1mg + manganese 0.5mg + molybdenum 0.1mg iodine 0.075mg + vit d3 0.0025mg + folic acid 50mcg + copper 45mcg + vit b12 0.5mcg cap. 1016 calcium carbonate 500mg tablet . 1017 calcium carbonate vita. d3500 mg tablet . 1018 calcium chloride injection 1019 calcium citrate vita d3 tablet 1020 calcium dobesilate 15 gm oint . 1021 calcium dobesilate cap 1022 calcium drpo 30ml. 1023 calcium gluconate injection 10 ml 1024 calcium leucovorin 15mg. inj. 1025 calcium leucovorin 50mg. inj. 1026 calcium with vitamin d tablets usp calcium carbonate 1.25g eq. to elemental(calcium 500mg and cholecalciferol ip 250 iu) tablet 1027 calium with vit d 3 iu 100 ml syp 1028 calutide 50mg. tab. 1029 capecitabine 500mg tablet 1030 capecitabine tab 500 mg 1031 carbamazepine syp 100mg/5ml 100ml bottle 1032 carbamazepine tab 200 mg 1033 carbamazepine tab 400 mg 1034 carbimazole 10mg tablet 1035 carbolic acid 1000 ml 1036 carboplatin 150mg. inj. 1037 carboplatin 450mg. inj. 1038 carboprost 250mg injection 1039 carboxy methyl cellulose sodium drops 1% eye drops 10 ml 1040 carboxymethyl hydroxyethyl cellulose 1041 carboxymethylcellulose sodium eye drop 0.5% 10ml eye drop 1042 carpinol (sunway) injection2 ml 1043 ccnu (lomustine) 40mg. cap 1044 cefaodoxil 125mg/30ml syp 1045 cefaodoxil 250mg tablet 1046 cefaodoxil 500mg tablet 1047 cefepime500mg injection 1048 cefepime 1000mg injection 1049 cefepime 250mg injection 1050 cefixime 100mg dispersible tablet 1051 cefixime 200mg + ofloxacin 200mg tab 1052 cefixime 200mg tablet 1053 cefixime 50mg dispersible tablet 1054 cefixime oral 100mg/5ml 30ml suspension 1055 cefixime oral 10ml bottle drop 1056 cefixime oral 50mg/5ml 30ml suspension 1057 cefoparazone 1000mg injection 1058 cefoparazone 250mg injection 1059 cefotaxime sod500mg injection 1060 cefotaxime sod 1000mg injection 1061 cefotaxime sod 250mg injection 1062 cefozoline sodium 250mg injection 1063 cefozoline sodium 500mg injection 1064 cefozoline sodium1gm injection 1065 cefpodoxime 100mg tablet 1066 cefpodoxime 100mg/5ml 30ml syrup 1067 cefpodoxime 200mg tablet 1068 cefpodoxime 200mg with ofloxacin 200mg tablet 1069 cefpodoxime 50mg tablet 1070 cefpodoxime 50mg/5ml 30ml syrup 1071 ceftazidime 1000mg injection 1072 ceftazidime 250mg injection 1073 ceftazidime 500mg injection 1074 ceftriaxone 1000mg + sulbactam sodium500mg vial injection 1075 ceftriaxone 1000mg + tazobactum 125mg vial injection 1076 ceftriaxone 1000mg injection 1077 ceftriaxone 125mg injection 1078 ceftriaxone 250mg + sulbactam 125mg vial injection 1079 ceftriaxone 250mg injection 1080 ceftriaxone 500mg + sulbactam 250mg vial injection 1081 cefuroximeinjection 250mg 1082 cefuroximeinjection 750mg 1083 cefuroxime 250mg tablet 1084 cefuroxime 500mg tablet 1085 cephalexin 250mg cap 1086 cephalexin 500mg cap 1087 cephalexin dispersible 125mg tablet 1088 cephalexin syp 125mg/5ml 30 ml bottle 1089 cetrimide cream solution 20% concentrative for dilution(0.2 mg),cream 1090 cetrimide+chlorhexidine conc. solution 15% + 7.5% 1 litre bottle 1091 cetrizine 10mg tablet 1092 cetrizine 30ml syp 1093 chloramphenicolinjection20ml 1094 chloramphenicol + dexamethasone 10ml eye drop 1095 chloramphenicol 10 ml eye drop 1096 chloramphenicol 500mg cap 1097 chloramphenicol eye ointment 0.5% ointment 1098 chloramphenicol eye ointment 1% 4g/5g tube 1099 chlorhexadineacetate 0.5% white soft parafin medicated gauze 1x10 1100 chlorhexidine gluconate mouthwash 0.2 % w/v solution50ml bottle 1101 chlorine 75mg tablet isi mark 1102 chlorocal h 1.5 gm eye oint 1103 chloroquine phosphateinjection 40mg/ml (5ml amp) 1104 chloroquine phosphate syp 160mg /10ml(50mg/5ml base) 60ml bottle 1105 chloroquine phosphate tab 250 mg 1106 chlorphenaramine miltinjection 2ml 1107 chlorphenaramine miltinjection10ml 1108 chlorpheniramine maleate 4mg tablet 1109 chlorpheniramine(oral liquid 2 mg/5 ml 30 ml bottel),liquid 1110 chlorpromazineinjection 25mg /ml 2ml 1111 chlorpromazine 100mg tablet 1112 chlorthalidone 12.5mg tablet 1113 chlorthalidone 25mg tablet 1114 chlorthalidone tab 50mg 1115 chlotrimazole 2%+ metronidazole 10%45 gm oint . 1116 cinnargin 25 mg tablet 1117 cinnargin 50 mg tablet 1118 ciprofloxacin + dexamethasone 5ml eye drop 1119 ciprofloxacin 250mg + tinidazole 300mg tablet 1120 ciprofloxacin 250mg tablet 1121 ciprofloxacin 500mg + tinidazole 600mg tablet 1122 ciprofloxacin 500mg tablet 1123 ciprofloxacin eye drop 1124 ciprofloxacin eye ointment 0.3% 3/3.5 gram tube 1125 ciprofloxacin inj 200 mg/100ml 100ml ffs bottle infusion 1126 cisplatin 10mg. inj. 1127 cisplatin 50mg. inj. 1128 clarithromycin 250mg tablet 1129 clindamycin inj 150 mg/ ml 2 ml vial 1130 clindamycine 150 mg capsule 1131 clindamycine 300 mg capsule 1132 clinidipne 10mg tab. 1133 clobetasol propionate oint . 1134 clofazimine 100mg capsule 1135 clofazimine 50mg tablet 1136 clomiphene citrate 50 mg tab 1137 clonazepam 0.5mg tablet 1138 clonazepam injection 1139 clonidineinjection10ml vial (1mg ) 1140 clonidine 100 mcgtablet 1141 clopidogrel + aspirin 150mg cap 1142 clopidogrel + aspirin 75mg cap 1143 clopidogrel 75mg tablet 1144 clotrimazole (vaginal tab) 100 mg (with applicator) tab. 1145 clotrimazole (vaginal tab) 500 mg (with applicator) tab. 1146 clotrimazole + lignocaine ear drop 1% 5 ml vial 1147 clotrimoxazole 15gm 1% tube oint . 1148 clotrimoxazole 15gm 2% tube oint . 1149 cloxacillin(500mg),capsule 1150 cloxacillin(capsule 125 mg),capsule 1151 clozapine(25 mg),tablet 1152 clozapine(50 mg),tablet 1153 cmc eye drop 1154 codeine(oral solution 15 mg/5 ml 60 ml bottle),solution 1155 collodal calcium with b 12injection 15ml 1156 combo ear drop(chloramphenicol 5% w/v + clotrimazole 1% + lignocaine hydrochloride 2%),ear drop 1157 cough drop 15ml 1158 cpm + ammonium chloride+ sdodium citrate+ menthol 100ml syp 1159 cristaline panicilline 10 lac (cp 10lac) inj. 1160 cristaline panicilline 5 lac (cp 5lac) inj. 1161 cyclophosphamide inj 500 mg/vial vial 1162 cycloserine(capsule 125 mg),capsule 1163 cynocobalamineinjection10ml (b 12) 1164 cynocobalamineinjection30ml (b 12) 1165 cyproheptadine 4 mg tablet 1166 cytoheptadine 1.5 mg drop 15ml 1167 dacarbazine (dtic) 500mg with solvent inj. 1168 dacarbazine(200 mg per vial),injection 1169 deferasirox dispersible 250mg tablet 1170 deferasirox dispersible 500mg tablet 1171 deferasirox dispersible tab 500 mg 1172 deferiprone 500mg capsule 1173 deriphylline (sustained release) tablet 1174 desferrioxamine injection 500mg vial 1175 dexamethasoneinjection4mg/ml.10ml 1176 dexamethasone eye drop(0.1%, 5ml),eye drop 1177 dexamethasone sodium phosphate 8mg/2ml 2ml injection 1178 dexamthasone 0.5mg tablet 1179 dextran 40 + 0.9% sodium chloride inj. 1180 dextran 40 + 5% dextrose inj. 1181 dextran 70 injection 1182 dextromethorphan 10mg/5ml 100ml syrup 1183 dextromethorphan 10mg/5ml 60ml syrup 1184 diazepaminjection5 mg/2ml 1185 diazepam 5mg tablet 1186 diclofenac + methyl salicylate + menthol ointment 10gm oint 1187 diclofenac 50mg + paracetamol 325mg + chlorzoxazone 250mg tablet 1188 diclofenac 50mg + paracetamol 325mg + serratiopeptidase 10mg 1189 diclofenac 50mg+ paracetamol 500mg tablet 1190 diclofenac potassium 50 mg + paracetamol 325 mg + cpm 4mg +magnasium trisillicate 100mg + chlorpheniramine meleate 4mg tab. 1191 diclofenac sodium 25 mg/ml(3ml amp),injection 1192 diclofenac sodium 50mg tablet 1193 diclofenac with menthol 30gm ointment 1194 diclofenac(1%),gel 30gm ointment 1195 diclophenic sodinjection 1ml 1196 dicyclominedrop 1197 dicyclomineinjection 2ml 1198 dicyclomine hydrochloride 20mg + paracetamal 325mg tablet 1199 dicyclomine hydrochloride 20mg tablet 1200 dicyclomine hydrochloride tab 10mg 1201 diethycarbomazim 50mg tablet 1202 diethylcarbamazine tab 100mg 1203 diethylcarbamazine(oral liquid 120 mg/5 ml 100 ml bottel),liquid 1204 digoxin 0.25mg tablet 1205 digoxin injection(0.5mg /2ml) 2ml 1206 dilitizem injection 1207 diloxanide furoate(tablet 500 mg),tablet 1208 diltiazem sr 90mg tablet 1209 diltizime 30mg tablet 1210 diltizime 60mg tablet 1211 diphenhdramine hcl 12.50 mg + ammonium cloriede 125 mg + sodium citrate 55 mg syrup 100ml 1212 diphenhydramineinjection50 mg /ml 1213 diphenhydramine 12.5mg/ml. syp 1214 diphenhydramine 25mg. cap 1215 diphenhydramine sg inj. 1216 diphenylhydantoin 100mg tablet 1217 diphenylhydantoin 30mg tablet 1218 diphtheria antitoxin 10000 iu 10 ml vial 1219 disodium hydrogen citrate (alkalizer) 100 ml syp 1220 disulfiram 250mg tablet 1221 dobutamine 50mg/ml 5ml ampinjection 1222 dobutamine inj 12.5 mg/ ml 20 ml vial 1223 docetaxel 120mg. inj. 1224 docetaxel 20mg. inj. 1225 docetaxel 80mg. inj. 1226 domperidone 10mg tablet 1227 domperidone 1mg per 1ml suspension 30 ml bottle 1228 donepezil 5mg tablet 1229 dopamine hydrochlorideinjection40mg /ml (5ml amp) 1230 doripenem inj. 1231 doxorubicin lypholozed 10mg vial injection 1232 doxorubicin lypholozed 50mg vial injection 1233 doxycyclin hyclate 100mg cap 1234 doxycycline 100mg tablet 1235 doxycycline dry 50mg/5ml syrup 1236 doxylamine succinate tab 10 mg 1237 drotaverine inj 40 mg/2 ml 2 ml amp 1238 drotaverine tab 40 mg 1239 dydrogesterone 10 mg tab 1240 empagliflozin 25mg tablet 1241 enalapril injection 1242 enalapril maleate 10mg tablet 1243 enalapril maleate 2.5mg tablet 1244 enalapril maleate 5mg tablet 1245 endoxan (cyclophosphamide) inj. 1246 endoxan (cyclophosphamide) tab. 1247 enoxaparin inj 40 mg equivalent to 4000 iu vial/pfs 1248 enoxaparin inj 60 mg equivalent to 6000 iu vial/pfs 1249 entravenec fate emlusion 20%inj. 1250 enzyme with vitaminsdrop 15ml 1251 epirubicin 10mg. inj. 1252 epirubicin 50mg. inj. 1253 epirubicin inj 100 mg /vial vial 1254 erithroprotine 10 k inj. 1255 erithroprotine 2 k inj. 1256 erithroprotine 4 k inj. 1257 erlotinib 150mg tablet 1258 erlotinib(150 mg),tablet 1259 ertapenem inj. 1260 erythromycine 250mg tablet 1261 erythromycine 500mg tablet 1262 erythropoietin10000iu injection 1263 escitalopram 10mg tablet 1264 esmolol 100mg/vial(10mg/ml),injection 1265 ethamsylate 250mg tablet 1266 ethamsylate injection 2ml 1267 ethinylestradiol (a) + levonorgestrel (b)(tablet 0.03 mg (a) + 0.15 mg (b) tablet 1268 ethinylestradiol + norethisterone tab 35 mcg +1mg 21 tablets/strip 1269 ethinylestradiol 0.01mg tablet 1270 ethinylestradiol 0.05mg tablet 1271 etiophylline and theophylline 220mg/2ml injection 1272 etophylline 231mg + theophylline 69mg sr tablet 1273 etophylline 77mg + theophylline 23mg tablet 1274 etoposide 100mg. inj. 1275 famotidine 20mg tablet 1276 famotidine 40mg tablet 1277 fenofibrate 200mg tab. 1278 fentanyl citrate 50 microgram/ml 2 ml amp 1279 fentanyl citrate 50mcg/ml 2ml ampinj 1280 ferric ammonium citrate 110mg + folic acid1.5mg + cyanocobalamin 15mcg+ sorbitol solution syrup 200ml 1281 ferric ammonium citrate ip 25mg + lysine hydrochlorideusp 50 mg. + cyanocobalamin ip 5mcg. + folic acid ip 200mcgper mldrop 15ml 1282 ferric ammoniun citrate 200 mg+ folic acid 0.5 mg / 5ml 200ml syp 1283 ferric carboxymaltose 50mg/ml(20ml vial),injection 1284 ferric carboxymaltose inj equ.to elemental iron 500mg/10ml 1285 ferrous ascorbate 100 mg , folic acid 1.5 mg ,zink 22.5 ,d3 200i.u.,cynocobalamin 2 mg 1286 ferrous ascorbate 100mg (elemental iron)+folic acid 1.5mg(tablet),tablet 1287 filgrastim 300mcg. prefilled syring contains inj. 1288 finofibrate 160mg tablet 1289 finofibrate 40mg tablet 1290 fluconazole 100ml inj. 1291 fluconazole 150mg tablet 1292 fluconazole 400mg tab. 1293 fluconazole(eye drop 3 mg/ml(10 ml vial),eye drop 5 ml eye drop),drop 1294 flumazenil inj 0.1 mg/ ml 5 ml multiple dose vial 1295 flunarizine 5mg tablet 1296 fluoxetine 20mg capsule 1297 fluphenazine 1ml 25mg/ml injection 1298 foleron (iron iii) hydroxide polymaltose complex tablet 1299 folic acid 5mg tablet 1300 folic acid tab(400 mcg),tablet 1301 formalin 450ml 1302 formoterol 6mcg + budesonide 200mcg(30 cap x 6 pack with 1 dispensing device),rotacaps 1303 fortifield procane penicillineinjection 20 lac 1304 fortifield procane penicillineinjection 4 lac 1305 framycetin sulphate 1% cream 30gm tube cream 1306 frusemide 10mg/ml 2ml amp injection 1307 fulvestrant 500mg 10ml injection 1308 furazolidone 100mg tablet 1309 furazolidone 60ml syp 1310 furosemide 40mg tablet 1311 furosemide drop 1312 fusidic acid cream/sodium fusidic ointment 2% 5gm 5gm tube 1313 gamma benzene hexachloride solution/lotion 1% 100ml bottle 1314 gatifloxacin 5ml eye drop 1315 gatifloxacine 200mg tablet 1316 gefitinib(250mg),tablet 1317 gemcitabine 1gm. inj. 1318 gemcitabine 200mg. inj. 1319 gemcitabine inj 1.4 gram/vial vial 1320 gentamicin + hydrocortisone ear drop (0.3%+1%) 5 ml vial 1321 gentamicin 0.3% eye/ear drops 5ml 1322 gentamicin 40mg/ml 2ml amp injection 1323 gentamycine sulpfate 15gmoint . 1324 glibenclamide 5mg tablet 1325 gliclazide 80mg tab 1326 glimepiride 1mg tablet 1327 glimepiride 2mg tablet 1328 glipizide 5mg tablet 1329 glucose pouch 100gm powder 1330 glucose pouch 75gm powder 1331 glycereen 15% sod chlor 15% enema 20ml 1332 glycerin 500gm 1333 glycerin oral liquid 30ml bottel liquid 1334 glycerine ip solution 100 ml bottle 1335 glycerol 100ml 1336 glyceryl trinitrateinjection5mg/ml 5 ml 1337 glyceryl trinitrate sub lingual tab 0.5 mg 10 tab 1338 glycopyrolate 0.2mg/ml 1ml vial injection 1339 griesofulvin 125mg tablet 1340 gum paint (tannic acid)(2% w/v 15 ml bottle),bottle 1341 haloperidol 5mg tablet 1342 haloperidol 5mg/ml 1ml amp injection 1343 haloperiodol 1.5mg tablet 1344 halothane 250ml inhalation 1345 halothane 50ml inhalation 1346 heparin sodiuminjection 1000iu/ml 5ml 1347 heparin sodiuminjection 5000iu/ml 5ml 1348 hepatitis b immunoglobulin 100 iu/vial vial 1349 herceptin 440mg. inj. 1350 human albumin solution ip i/v 20% w/v 100 ml ffs bottle 1351 human chorionic gonadotropin(injection 10000 iu 1ml injection 1352 human chorionic gonadotropin(injection 5000 iu +2mlinjection 1353 human immunoglobin 5% iv ig((5mg/100ml each),injection 100ml injection),injection 1354 hyaluronidase 1355 hydrochlorothiazid 12.5mg tablet 1356 hydrochlorothiazide 25mg tablet 1357 hydrochlorothiazide 50mg tablet 1358 hydrocortisone 0.5% 15gm ointment or cream 1359 hydrocortisone 1% 15gm ointment or cream 1360 hydrocortisone sodium succinateinjection 200 mg/ml vial 1361 hydrocortisone sodium succinate injection400 mg /ml vial 1362 hydrocortisone sodium succinate injection 100 mg /ml vial 1363 hydrogen peroxide 400ml 1364 hydrogen peroxide 6% solution (who gmp certification exempted for this item)(400 ml ),bottle 1365 hydroxy ethyl starch 200/3% inj. 1366 hydroxy progesterone injection250mg 2ml 1367 hydroxychloroquine 200mg tablet 1368 hydroxyethyl (6% saline solution for infusion)(starch 6%ip 500 ml bottel),infusion 1369 hydroxyethylstarch 6% solution with sodium chloride 0.9% iv infusion i/v 500 ml ffs bottle 0.90% 1370 hydroxyurea 500mg capsule 1371 hydroxyurea dispersable 100mg tablet 1372 hydroxyzine 10mg/5ml syrup,(100ml bottle),syrup 1373 hydroxyzine 25mg tablet 1374 hylace injection 1ml 1375 hyoscine butylbromide 20mg/ml 1ml vial/amp injection 1376 hypersol 10mleye drop 1377 hypersoninjection 5ml 1378 i.v. (electrolyte m) 500ml ffs dextrose anhydous 5gm kcl 150mgnacl 100mgna acetate 280mgna meisulphite21 mg dibasic k phosphate 130mg/100ml 500ml ffs 1379 i.v. 10% amino acid + electrolyte inj. 1380 i.v. ciprofloxacine100ml ffs 1381 i.v. d.n.s.500 ml glass bottle500ml 1382 i.v. d.n.s.500 ml plastic bottle500ml ffs 1383 i.v. dextrose 5% glass bottle500ml 1384 i.v. dextrose 5% plastic bottle500ml ffs 1385 i.v. dextrose10%glass bottle500ml 1386 i.v. dextrose10%plastic bottle500ml ffs 1387 i.v. dextrose 25% 100ml ffs bottle injection 1388 i.v. dextrose 25% 25ml ffs 1389 i.v. dextrose 25% 500ml ffs bottle injection 1390 i.v. dextrose 50% 25 ml ffs 1391 i.v. electrolyte e i.v 500ml ffs/bfs bottle 500ml ffs. dextrose 5gsodium acetate 0.64gsodium chloride 5gpotassium chloride 75mgsodoium citrate 75mgcalcium chloride solution correcting water electrolyte & nutrition 52mg magnesium chloride 31 mg tabletsodium meta bi sulphate 20 mg 1392 i.v. electrolyte p (multi electrolytes and dextrose injection type i ip) i/v fluid (each 100ml contains: anhydrous dextrose 5gm potassium chloride 0.13gm, sodium acetate 0.32gm, dibasic potassium phosphate 0.026gm)(500 ml ffs bottle),injection 1393 i.v. glycin 3000ml. inj. bottle plastic 1394 i.v. linozolidine ffs 1395 i.v. mannitol 10% 100ml ffs 1396 i.v. normal saline 0.9 % 100 ml glass bottle 1397 i.v. normal saline 0.9 % 100 ml plastic bottleffs 1398 i.v. normal saline 0.9 % 500 ml glass bottle 1399 i.v. normal saline 0.9 % 500 ml plastic bottle ffs 1400 i.v. ofloxacine 100 ml ffs 1401 i.v. ornidazole 100ml ffs 1402 i.v. ringer lactate plasticbottle 500 ml ffs 1403 i.v. tinidazole 400ml ffs 1404 i.v.( electrolyte ‘g’) 500ml ffs dextrose anhydrous 5 gmkcl 130 mgnacl 370 mg tabletammon cl 370 mg na sulphite 15 mg /100ml 500mlffs 1405 ibuprofen400 mg + paracetamole 325 tablet 1406 ibuprofen + paracetamole syrup 1407 ibuprofen 100mg/5ml 60ml syp 1408 ibuprofen 200mg. tab. 1409 ibuprofen 400mg tablet 1410 icthamol 100gm 1411 icthamol glycerin 100gm 1412 ifosfamide(1gm),injection 1413 imatinib mesylate cap 400 mg 1414 imipromine 25mg tablet 1415 indomethacine 25mg tablet 1416 insline nph inj. 1417 insulin soluble (bovine + porcine or porcine) 40iu/mlinjection10ml 1418 insulin soluble inj. 40iu/ml 10ml 1419 insulins human mixtard30:70 injection10ml 1420 intraperitoneal dialysis solution 0.015 1.5% 500ml solution 1421 intraperitoneal dialysis solution 0.025 2.5% 500ml solution 1422 intrvenous immunoglobulin inj. 1423 ipratropium bromide 250 mcg/ml respules inhalation 1424 ipratropium bromide inhaler 20mcg per puff(200 metered dose container),inhaler 1425 irinotecan hydrochloride 100mg injection 1426 irinotecan(100 mg inj (1 ml amp)),injection 1427 iron & folic acid enteric coated blue (as per nipi guidelines) 100 mg + 0.5 mg tablet 1428 iron 100ml syp. 1429 iron 30ml drop 1430 iron and folic acid enteric coated tab dried ferrous sulphate equ. to ferrous iron 100 mg and folic acid 0.5 mg (blue tablet) 1431 iron and folic acid enteric coated tab dried ferrous sulphate ip eq. to 45 mg elemental iron and 400 mcg folic acid ip (pink color) wifs junior 1432 iron and folic acid enteric coated tab. ferrous sulphate ip to ferrous iron 100 mg & folic acid ip 0.5 mg granules (red tablet) 1433 iron ferras sulphate folic acid 100ml syp 1434 iron folic acid sugar coated (blue tablet) ferrous sulphate ip equivalent to 60 mg elemental iron & 500 mcg folic acid ip(60 mg + 500 mcg),tablet 1435 iron folic acid sugar coated tablet dried ferrous sulphate ip eq. to 45mg ferrous iron and 400mcg folic acid ip (pink coloured tab) wifs junior ifa tablets (detail specification as per tender)(45mg + 400mcg),tablet 1436 iron folic acid syrup, each ml containing 20mg elemental iron&100mcgfolic acid with suitable anti oxidant, antimicrobial agent and food grade flavouring agent.the bottle should have 6 fragmented markings at equal intervals(if an artificial sweetening is used it should be highlighted on the label. warning should be put on label medication should be kept out of reach of children. (as per attached specification) (50ml bottle with auto dispenser)),syrup 1437 iron polymaltoseinjection 1438 iron sucroseinjection 2.5ml 1439 iron sucroseinjection 5ml 1440 isoflurane inhalation 1441 isosorbite dinitra.10 mg tablet(sub) {sorbitrate} 1442 isosorbite dinitra.5 mg tablet(sub.) {sorbitrate} 1443 isosorbite mononitrate 20 mg tablet 1444 isoxsuprine 10mg tablet 1445 isoxsuprine hcl injection 1446 itraconazole cap 100mg 1447 itraconazole cap 200mg 1448 ivabradine 5mg tab. 1449 ivermectin 12mg tablet 1450 ketamine hydrochlorideinjection 10mg/10ml in each vial 1451 ketorolac 10mg tablet 1452 ketorolac eye drop 0.5% 5ml drop 1453 labetalol inj 20 mg/4ml 4ml amp 1454 labetalol tablet 100mg. 1455 lactobacillus tab 60 million spores 1456 lactulose 10gm/15ml 100ml bottle syrup 1457 lantanoprost eye drop 0.005% 5ml eye drop 1458 lenalidomide 25mg capsule 1459 letrozole 2.5mg tablet 1460 levetiracetam 250 mg tablet 1461 levocetirizine + monteleukast 2.5 mg + 4mg/5ml 60ml suspension 1462 levocetirizine 5mg + montelukast 10mg tablet 1463 levocetirizine dihydrochloride ip 2.5mg+ ambroxol hydrochloride ip 30mg per 5ml syp. 60ml 1464 levocetrizine dihydrochloride 5mg tablet 1465 levodopa (a) + carbidopa (b)(tablet 100 mg (a) + 10 mg (b) cr),tablet 1466 levodopa (a) + carbidopa (b)(tablet 100 mg (a) + 25 mg (b) cr),tablet 1467 levodopa (a) + carbidopa (b)(tablet 250 mg (a) + 25 mg (b)),tablet 1468 levofloxacin inj 500 mg/100 ml 100 ml ffs bottle 1469 levofloxacine250mg tablet 1470 levofloxacoine 500mg tablet 1471 levonorgeastrelemergency contraceptives0.75 mg tablet2 no 1472 levosalbutamol(50mcg/dose 30 capsule in 6 pack with 1 dispecing device),capsule 1473 levosulbutamol(100 mcg 30 capsule in 6 pack with 1 dispecing device),capsule 1474 levothyroxine 100mcg tablet 1475 levothyroxine 50mcg tablet 1476 lignocain spray 1477 lignocaine 2 % 21.3mg/ml 30ml injection 1478 lignocaine 2% + adrenaline 5mcg/ml 30mlinjection 1479 lignocaine 4%injection30 ml 1480 lignocaine hydrochloride 2% 30gm tube gel 1481 lignocaine hydrochloride 4% eye drops 5ml vial 1482 lignocaine hydrocloride and dextorse injection hevy 5% spinal 2 ml amp. 1483 linagliptin 5 mg tablet 1484 linezolid 600mg tablet 1485 liquid paraffin 400ml 1486 liquid paraffin 50ml 1487 lisinopril 5 mg tablet 1488 lithium carbonate 300mg tablet 1489 loperamide(2mg),tablet 1490 lorazepam 1mg tablet 1491 lorazepam 2 mg/ml 2ml amp 1492 losartan 10mg tablet 1493 losartan potassium 25mg tablet 1494 losartan potassium 50mg tablet 1495 lotion benzyl benzoate 100 ml 25% 1496 lotion gama benzyne hexachloride 100ml 1497 lquid cresol with soap solu. 400ml 1498 luliconazole cream 10gm ointment 1499 luliconazole cream 20gm ointment 1500 luliconazole cream 30gm ointment 1501 lycopen + niacinamide + pyridoxine h + c + vitamins + methylcobalamin200ml syrup 1502 lycopene + antioxidant + multivitamine cap. 1503 lycopene with multivitamins + multiminerals cap 1504 lysol 5 ltr. jar 1505 mabthera 100mg. inj. 1506 mabthera 500mg. inj. 1507 magnesium hydroxide+aluminium hydroxide tablet 500mg. + 250mg. 1508 magnesium sulphate 50 % 1ml amp injection 1509 magnesium sulphate 50 % 2ml amp injection 1510 mannitol inj. 20% 350ml ffs bottle 1511 mannitol(20% 100 ml ffs bottle),injection 1512 mebendazole 100mg tablet 1513 mebendazole 30ml syp 1514 mebeverine 200mg tablet 1515 medroxy progesterone acetate(10 mg),tablet 1516 medroxyprogesterone acetate(injection 150 mg 1 ml / vial),injection 1517 mefenamic acid 250mg + dicyclomine 10mg tablet 1518 mefenamic acid 500 mg+ dicyclomine 10mg tablet 1519 mefloquine tab 250 mg 1520 menadione (vit.k3) injection10mg/ml 2ml 1521 mepafotic eye drop 1522 mephentermine inj 30mg/ml(10 ml vial),injection 1523 meropanam 1000mg inj. 1524 meropanam 125mg inj. 1525 meropanam 500mg inj. 1526 metaclopromide10ml injection 1527 metaclopromide2ml injection 1528 metaclopromide 10mg tablet 1529 metformin 500mg + glim. + piog. mp1 tab. 1530 metformin 500mg + glim. + piog. mp2 tab. 1531 metformin(1000mg),sr tablet 1532 metformin(500 mg),tablet 1533 methotraxate 2.5mg. tab. 1534 methotraxate 50mg. inj. 1535 methotrexate tab 5 mg 1536 methyl ergometrin injection 2ml 1537 methyl ergometrine maleate0.125mg tablet 1538 methyl sacicylate 100gm oint. 1539 methylcobalmin 1500mg cap 1540 methyldopa 250mg tablet 1541 methylprednisolone125mg injection 1542 methylprednisolone250mg injection 1543 methylprednisolone40mg injection 1544 methylprednisolone500mg injection 1545 methylprednisolone 1000mg injection 1546 methylprednisolone 16mg tablet 1547 methylprednisolone 4mg tablet 1548 methylprednisolone 8mg tablet 1549 metoclopramide 10mg tab 1550 metoclopramide 5mg/ml 2 ml amp injection 1551 metoprololinjection1mg /ml 1552 metoprolol 25mg sustained release tablet 1553 metoprolol 25mg tab 1554 metoprolol 50mg sustained release tablet 1555 metoprolol 50mg tab 1556 metronidazole 1% ointment 15 gram tube 1557 metronidazole 200mg tablet 1558 metronidazole 400mg tablet 1559 metronidazole 500mg/100 ml(100 ml ffs bottle),injection 1560 metronidazole oral suspension(200 mg/5ml (60 ml bottle)),suspension 1561 miconazole ip cream 2% w/w 15 gram tube 1562 micronised progestroninjection200mg1 ml 2ml 1563 midazolam 1mg/ml 10ml injection 1564 midazolam 1mg/ml 5ml injection 1565 mifepristone 200mg tablet 1566 mifepristone 200mg (1 tab)+misoprostol 200mcg (4 tab)(combipack),tablet 1567 milk of magnasia 11.25ml liquid paraffin 3.75ml/15ml ( creamafin formula ) 170 ml syp 1568 misoprostal200mcg tablet 1569 montelukast 10mg tablet 1570 montelukast 5mg tablet 1571 morphine15mg/ml 1ml injection 1572 morphine sulphate 10mg tablet 1573 morphine sulphate inj. ip 10mg/ml(1ml ampoule),injection 1574 moxifloxacine 5ml eye drop 1575 multivitamin 200ml syp. 1576 multivitamin sugar coated tab nfi formula multivitamin sugar(item with additional vitamin will also be considered),tablet 1577 multivitamin with protein 100ml syp 1578 multivitamin with protein 200ml syp 1579 multivitamine drop 1580 multivitamine with zincdrop 1581 mupirocin 2% 5gm tube ointment 1582 mupirocin cream/ointment 2% 15 gram tube 1583 n acetyl cysteine inj 200 mg/ ml 1 ml amp 1584 nalidixic acid 500mg tablet 1585 nalidixic acid susp 30ml syp 1586 naloxoneinjection 0.4mg/ml 1ml amp 1587 naloxone injection 0.1mg/ml 1ml amp 1588 natamycin eye drop 1589 natural progesteron injection 100mg/2ml 1590 neomycin sulfate 10gm oint . 1591 neosporin h 5gm eye oint 1592 neostigmineinjection 2.5mg/ml 1593 neostigmine 0.5mg/ml 1ml injection 1594 netimycin 250mg. inj. 1595 netlimycineinjection300 mg 1596 nicotinamide 15mg + thiamine mononitrate (vitamin b1) 1mg+ riboflavine (vitamin b2) 1mg + pyridoxine hcl (vitamin b6) 0.5mg + cyanocobalamin (vitamin b12) 1mcg tab. 1597 nicotinamide 50mg tablet 1598 nifedipine 10mg tablet 1599 nifedipine 5mg capsule 1600 nikethamideinjection 2ml 1601 nitazoxanide 500mg tab. 1602 nitroglycerine inj. 25 mg/5ml(5ml),ampule 1603 nitroglycerine(glyceryl trinitrate)(sublingual tab 0.5 mg),tablet 1604 nondrolon deconateinjection25 mg 1605 nondrolon deconateinjection50 mg 1606 noraderanaline bitartrate 2mg/2ml2ml injection 1607 norfloxacin + dexamethasone 10 ml eye drop 1608 norfloxacin 100mg tablet 1609 norfloxacin 5ml eye drop 1610 norfloxacine 400mg + tinidazole 600mg tablet 1611 norfloxacine 400mg tablet 1612 normal saline(nasal drops: sodium chloride drops 0.05% w/v 10 ml vial),drop 1613 ofloxacin 10 mleye drop 1614 ofloxacin 200mg tablet 1615 ofloxacin eye drops 0.3% w/v 5 ml vial 1616 ofloxacin tab 400 mg 1617 ofloxacine 200 + ornidazole 500 tablet 1618 ofloxacine dexamethasone eye drop 1619 olanzapine 10mg tablet 1620 olanzapine 5mg tablet 1621 olopotadine antiallergic eye drop 0.1% 5 ml vial 1622 omeprazole 20mg + domperidone 10mg cap 1623 ondansetroninjection 2 ml 1624 ondansetron 4 mg tablet 1625 ondansetron syp 2mg/5 ml 30 ml bottle 1626 ondansetron tab 2 mg 1627 opthalmic sol. hydroxypropyl methyl cellulose 10ml nasal drop 1628 ormeloxifene(tablet 30 mg 10x10),tablet 1629 ornidazole 60ml. syp 1630 ors who powder glucose anhydrous 13.5g/l, sodium chloride 2.6g/l, potassium chloride 1.5g/l, trisodium citrate 2.9g/l(as per attached pack specification),powder 1631 oseltamivir ip 100ml. syp 1632 oseltamivir ip 30mg cap 1633 oseltamivir ip 45mg cap 1634 oseltamivir ip 75mg cap 1635 oxaliplatin 100mg. inj. 1636 oxaliplatin 50mg. inj. 1637 oxygen gas(oxygen gas for inhalation),inhalation 1638 oxytocin inj(5 iu/ml (1ml amp)),injection 1639 paclitaxel 100mg. 260/3005 inj. 1640 paclitaxel 260mg(43.34ml vial),injection 1641 paclitaxel 30mg.inj. 1642 pancuroniuminjection2mg/ml 1643 pantoparazole 40mg injection 1644 pantoprazole 40mg + domperidone 30mg cap. 1645 pantoprazole 40mg + domperidone 10mg tablet 1646 pantoprazole 40mg + levosulpiride 75mg cap. 1647 pantoprazole 40mg tablet 1648 paracetamol + phenylephrine hydrochloride + caffeine + diphemhydramine hcl tab. 1649 paracetamol 125 mg/5ml 60ml bottle suspension 1650 paracetamol 125 mg/5ml 60ml bottle syrup 1651 paracetamol 125 mg/ml drop 1652 paracetamol 150mg/ml 2ml amp injection 1653 paracetamol 500mg tablet 1654 paracetamol 650mg tablet 1655 paracetamole 325 mg + mefenamic acid 500mg tablet 1656 pediatric solution like isolyte(p n/2 and n/5),solution 1657 pemetrexed(500mg),injection 1658 penicillin v tab 125 mg 1659 penicillin v tab 250 mg 1660 penicillin v(phenoxymethyl penicillin potassium)(250 mg),tablet 1661 pentazocine lactate(30mg/ml (1 ml amp)),injection 1662 peprazine citrate 30ml syp 1663 permethrin cream 5% 30gm tube 1664 permethrin lotion 5% 60ml bottle lotion 1665 pheniramine maleate 22.75 mg/ml 2ml injection 1666 pheniramine meleate 25mg tablet 1667 phenobarbitone 200 mg/ml injection 1668 phenobarbitone 200mg/5ml syp 1669 phenobarbitone 30mg tablet 1670 phenobarbitone 60mg tablet 1671 phenytoin sodium 100mg tablet 1672 phenytoin sodium 50mg/ml 2ml amp injection 1673 phenytoin sodium oral suspension 25mg/ml 100 ml bottle 1674 phytomenadione injection 10mg/ml injection 1675 pilocarpin pfs injection 1676 pilocarpine eye drops 2% 5ml vial 1677 pilocarpine eye drops 4% 5ml vial 1678 pioglitazone 15mg tablet 1679 piperacillin 1gm + tazobactam 125mg injection 1680 piperacillin 2gm + tazobactam 0.25mg injection 1681 piperacillin 4gm + tazobactam 0.5gm injection 1682 piroxicam 20mg cap. 1683 piroxicam gel 30gm oint . 1684 plasma derived activated prothrombin complex concentrate(500 units/vial),injection 1685 plasma derived factor viii 500 iu / anti hemophillic factor viii 500 iu(vial),vial 1686 plasma derived factor viii(250iu/vial),vial 1687 pomalidomide 2mg capsule 1688 potassium chloride 150mg/10ml injection 1689 potassium chloride oral solution 100mg/ml 100ml bottle 1690 potassium chloride oral solution 100mg/ml 200ml bottle 1691 povidine iodine germicide(gargle 20% w/v 100 ml bottel),bottle 1692 povidine iodine(gargle 2% w/v 100 ml bottel),bottle 1693 povidone iodine + metronidazol 15gm ointment 1694 povidone iodine cream 125gm oint . 1695 povidone iodine cream 15 mg oint . 1696 povidone iodine cream 250gm oint . 1697 povidone iodine solution 5% 100ml 1698 povidone iodine solution 5% 500ml 1699 povidone iodine solution 7.5% 100ml 1700 povidone iodine solution 7.5% 500ml 1701 povidone iodine surgical scrub 7.5% 500ml bottle 1702 povidone iodine vaginal 200mg pessary 1703 powder acriflavin 20gm 1704 powder bleaching 25kg 1705 powder boric acid 400gm 1706 powder cetrimide 100gm 1707 powder glucose 100 gm 1708 powder magnesium sulphate 400gm 1709 powder mercurochrome 20gm 1710 powder nitrofurazone 20% 10gm 1711 powder povidoine 1712 powder sulfanilamide dusting 400gm 1713 pralidoxime (pam)injection25 mg/ml 20 ml 1714 pralidoxime chloride (2 pam)injection 1715 prazosin tab 1mg 1716 prednisolone 10mg tablet 1717 prednisolone 20mg tablet 1718 prednisolone(1% eye drop),drop 1719 prednisolone(drops 1% eye 5 ml drop),drop 1720 pregabalin 150mg cap. 1721 premix insulin(30:70 injection (regular: nph)2vial of 100ml injection 1722 primaquin 15mg tablet 1723 primaquin 2.5 mg tablet 1724 primaquin 7.5 mg tablet 1725 procarbazine 50mg. cap. 1726 proctocedyl ointment30 gm. tube 1727 promethazine 25 mg/ml(2 ml amp),injection 1728 promethazine 5 mg/5ml(60 ml bottle),syrup 1729 promethazine tab 25 mg 1730 proparacaine hydrochloride eye drop 1731 propofal 10mg/ml 10ml injection 1732 propofal 10mg/ml 20ml injection 1733 propranolol 10mg tablet 1734 propranolol 40mg tablet 1735 protamine 50mg/5ml 5ml vial injection 1736 proteine hydrolysate 1gm + choline citrate 1mg pyridoxine hcl 2mg cyanocobalamin 10 mcg + folic acid 1mg per 15ml syp200ml 1737 protin hydrolysate + pyridoxin + niacinamide + iron cholin citrate + magnesium chloride + maganese chloride + zinc sulphate + lysine 1738 protin tonic syrup 200ml 1739 pyridoxine 100mg tablet 1740 pyridoxine 10mg tablet 1741 pyridoxine 40mg tablet 1742 quinine dihydrochloride 300mg/ml 2ml injection 1743 quinine sulphate 300mg tablet 1744 rabeprazole 20mg + domperidone 30mg cap. 1745 rabeprazole 20mg + domperidone10mg tablet 1746 rabeprazole 20mg + levosulpiride 75mg cap. 1747 rabeprazole 20mg tablet 1748 rabies immunoglobinesinjection150iu 1749 rabies immunoglobulin inj 300 iu((2ml vial pfs)),injection 1750 rabies vaccine human (tissue culture) id/im(inj 2.5 iu/ ml 1 vial with 1 ml diluents),injection 1751 rabies vaccine human injection. (intra dermal) 1752 ramipril 2.5 mg tablet 1753 ramipril 5 mg tablet 1754 ranitidine 150mg tablet 1755 ranitidine 300 mg tablet 1756 ranitidine 50mg/2ml 2ml injection 1757 ranolazine 500mg tablet 1758 recombiant fviia(1mg/vial),vial 1759 recombinant anti hemophilic factor viii(250 iu inj / vial),injection 1760 recombinant anti hemophilic factor viii(500 iu inj / vial),injection 1761 recombinant f ix(500iu/vial),vial 1762 reduced osmolarity ors pkt. who formula sodium chloride 2.5mg potessium chloride 1.5mgsodium citrtr 2.09g dextrose 13.6g 20.5gm 1763 erythropoetin 2000 iu injection 1764 erythropoietin 2000 iu/ml prefilled syringe of 1ml injection 1765 riboflavin 5mg tablet 1766 risperidone 12.5mg injection 1767 risperidone 2mg tablet 1768 risperidone 50mg 2ml injection 1769 rituximab 500mg injection 1770 rosuvastatin 10mg + fenofibrate 145mg tablet 1771 rosuvastatin 10mg tablet 1772 rosuvastatin 20mg tablet 1773 rosuvastatin 5mg tablet 1774 roxithromycin50mg tablet 1775 roxithromycin 150mg tablet 1776 roxithromycine 30 ml syp 1777 salbutamol 2mg tablet 1778 salbutamol 4mg tablet 1779 salbutamol inhalation ip 100mcg/dose(200 metered dose container),inhaler 1780 salbutamol sulphate (2mg/5ml 60ml)(60ml bottle),syrup 1781 salicylic acid 2% ointment 30 gram tube 1782 salicylic acid 6 % ointment 30 gram tube 1783 sargramostin inj 500 mcg/ ml vial vial 1784 sensorcaneinjection0.5% 20ml 1785 seratiopaptidase 10mg tablet 1786 seratiopaptidase 5mg tablet 1787 silver sulphadiazine cream 1% 25gm tube 1788 sitagliptin 100mg tablet 1789 sitagliptin(50 mg),tablet 1790 sodium aminosalicylate granules(10 gm bottel of 100 gm),powder 1791 sodium bicarbonate inj. 7.5% w/v(10ml),ampoule 1792 sodium chloride n/2 injection ip (0.45%)(500ml ffs bottle),injection 1793 sodium picosulfate tablet 1794 sodium picosulphate syp 1795 sodium thiopentone 0.5 gm powder/vial(20ml vial),injection 1796 sodium valproate oral solution 200mg/5ml 100 ml bottle 1797 sodium valproate(200mg),tablet 1798 sodium valproate(500 mg),tablet 1799 soframycine 1.5gm eye ointtube 1800 solution chloroxylenol4.8%w/v terpineol 9%v/v alcohol absolute 13.1%v/v ( detol formula} 1801 sorafenib(200mg),tablet 1802 spironolactone(25mg),tablet 1803 streptokinaseinjection15 lac unit 1804 streptokinaseinjection750000 lakh 1805 succinyl choline(50mg/ml (10 ml vial)),injection 1806 sucralfate (20 mg tablet 10 x 10),tablet 1807 sucralfate(1gm/5ml),syrup or suspension 1808 sulfacetamide eye drops 20% 10 ml vial 1809 sulfadimidine 500mg tablet 1810 sulfamethoxazole +trimethoprim suspension (200 mg + 40 mg) / 5 ml suspension(50 ml bottle),suspension 1811 sulfamethoxazole 100mg+trimethoprim20 mg tablet 1812 sulfamethoxazole 200mg+trimethoprim40 mg tablet 1813 sulfamethoxazole 400mg+trimethoprim80 mg tablet 1814 sulfamethoxazole 800mg+trimethoprim160mg tablet 1815 sulfasalazine(500 mg),tablet 1816 sumatriptan(25mg),tablet 1817 surfactant suspension(inj 25 mg/ml),injection 1818 surgical sprit 100 ml 1819 surgical sprit 500 ml. 1820 suspension for intratracheal instillation(80mg/ml (pack size as licensed)),suspension 1821 tamoxifen 10mg. tab. 1822 tamoxifen 20mg. tab. 1823 tamsulosin 0.4mg. tab. 1824 tapentadol 100mg tablet 1825 telmisartan 20mg tablet 1826 telmisartan 40mg + hydrochlorothiazide 12.5mg tab 1827 telmisartan 40mg + amlodephin 5mg tablet 1828 telmisartan 40mg + metoprolol succinate (er) tab 1829 telmisartan 40mg tablet 1830 telmisartan 80mg tablet 1831 temozolimide 100mg. cap. 1832 temozolimide 20mg. cap. 1833 temozolimide 250mg. cap. 1834 temsulusin 0.4mg + dutasteride 0.5mg 1835 teneligliptin 20mg & metformin hydrochloride (er) 500mg tab 1836 teneligliptin 20mg & metformin hydrochloride (sr) 1000mg tab 1837 teneligliptin 20mg tab. 1838 terbutaline suplhateinjection 0.5mg/ml 1 ml 1839 terbutanil sulphate 1.5mg + bromhexine 4mg + guaiphensin 50mg 100ml syp 1840 tetanus immunoglobulin(usp/ip 250 iu/vial),injection 1841 tetanus toxideinjection 0.5ml 1842 tetanus toxideinjection 5ml 1843 thiamine hydrochloride 2.25 mg + riboflavine 2.5mg + pyridoxine hydrochloride 0.75mg +cyanocobalamin 2.5mg + nicotinamide 30mg + d panthenol 2.5mg flavoured syrup200ml 1844 thiamine(injection 100 mg/ml 1 ml/vial),injection 1845 thiopentoneinjection 1gm 1846 thyroxine sodium. 100mcg tablet 1847 thyroxine sodium. 50 mcg tablet 1848 timolol maleate eye drop 0.5 % 5ml vial solution 1849 tincture benzoin 450ml 1850 tincture iodine 450ml 1851 tinidazole 300mg tablet 1852 tinidazole 500mg tablet 1853 tinidazole susp. 150mg/5ml 60 ml bottle 1854 tiotropium 18mcg(30cap. x 6 pack with 1 dispensing device),rotacaps 1855 tiotropium 9mcg 180 doses inhaler(180 or more doses acceptable),inhaler 1856 tizanidine 2mg tablet 1857 tizanidine 4mg tablet 1858 tobramycin 10ml eye drop 1859 topotecan(inj 4 mg 4 ml vial),injection 1860 torasemideinjection100mg/2ml 1861 torsemide 10mg tablet 1862 torsemide 20mg tablet 1863 tramadol100mg tablet 1864 tramadol50mg tablet 1865 tramadol injection 100mg/ml 2 ml 1866 tramadol injection 50mg/ml 2ml 1867 tranamic acid 500 mg + mefenamic acid 250 mg tablet 1868 tranexamic acid 100mg/ml injection 5ml amp 1869 tranexamide acid 500 mg tablet 1870 trastuzumab 440 mg injection(vial),injection 1871 trastuzumab 440 mg injection(vial),injection 1872 trihexyphenidyl tab 2 mg 1873 tropicacl phenylephrine hydrochloride eye drop 1874 tropicacyl plus 5 ml eye drop 1875 tropicamide(1% 5ml vial),eye drop 1876 tropicasyl plus (ophth) 10ml eye drop 1877 turpentine liniment 400ml 1878 turpentine oil (repacking license is also eligible)(50ml bottle),bottle 1879 turpentine oil 400ml 1880 urokinase inj 5 lac iu/vial vial 1881 ursodeoxycholic acid bp 150mg tab. 1882 ursodeoxycholic acid bp 300mg tab. 1883 valethamate bromide ( epidosin ) injection 1884 vancomycin hydrochloride(1000mg vial),injection 1885 vancomycin hydrochloride(250mg vial),injection 1886 vancomycin hydrochloride(500mg),injection 1887 vecuronium bromide inj 2mg/ml (2ml amp) 1888 velcade 1 mg./2ml (only 1/2)inj. 1889 velcade 3.5 mg. inj. 1890 verapamil(40 mg ip),tablet 1891 verapamil(injection 5 mg/2 ml 2 ml vial),injection 1892 vildagliptin 50 + metformin 1000 mg 1893 vildagliptin 50 + metformin 500 mg 1894 vildagliptin 50mg tab 1895 vinblastine 10mg. inj. 1896 vincristine sulphate(1mg/ml (cytocristin inj) 1 ml vial),injection 1897 vinorelbine(10 mg),injection 1898 vitamin a ip 2500 iu + vit b1 1mg + vit b2 1.5mg+ vit b6 1mg + vit b12 1mcg + vitamin c 50mg+ vit e 5mg + vit e 5mg + niacinamide 15mg + folic acid ip 0.15mg elemental calcium ip 75mg + phosphorus 58mg+ ferrous fumarate ip 30mg + zinc sulphate ip 10mg +magnesium sulphate ip 0.50mg + coppersulphate usp 0.50mg + potassium iodide ip 0.01mg + ginseng usp 42.50mg cap. (with mono cartan) 1899 vitamin a syrup(100000 iu/ml with market spoon for 1ml and 2 ml (100 ml bottle)),syrup or solution 1900 vitamin b1(thiamine 100 mg),tablet 1901 vitamin b12 inj 500 mcg/ml(30 ml amp/vial),injection 1902 vitamin c(100 mg),tablet 1903 vitamin kinjection(10mg /ml) 1 ml 1904 vitamin k1(1mg/0.5ml (0.5 ml amp)),injection 1905 vitamin. b complex nfi (prophylactic)(b12 mg, b22mg, b6 0.5 mg, niacinamide 25 mg, calcium pantothenate 1 mg),tablet 1906 voglibose 0.2 mg tablet 1907 voglibose 0.3 mg tablet 1908 voglibose ip 0.2 mg + metformin hydrochloride ip 500 mg tablet 1909 voglibose ip 0.3 mg + metformin hydrochloride ip 500 mg tablet 1910 warfarin 1mg tablet 1911 warfarin sodium(5 mg),tablet 1912 warfarint 2mg tablet 1913 water for injection 10 ml amp 1914 water for injection 2 ml amp 1915 water for injection 5 ml amp 1916 wax solvent ear drops: benzocaine 2.7% 10 ml bottel drop 1917 wax solvent ear drops:paradichlorobenzene 2% 10ml botte drop 1918 xylometazoline 0.05% nasal 10ml(0.05% 10ml),drop 1919 xylometazoline nasal 0.1% 10ml vial drop 1920 zinc sulphate dispersible 10mg tablet 1921 zinc sulphate dispersible 20mg tablet 1922 zinc sulphate syrup 100ml 1923 zinc sulphate syrup 50ml 1924 zine sulfate monohydrate 20mg + thiamine mononitrate 10mg + riboflavine 10mg + pyridoxine 3mg +cyanocobalamin 5mcg + nicotinamide 50mg + calcium pantothenate 12.5mg + folic acid 1000mcg + magnesium sulfate monohydrate 10mgcap. 1925 zoledronic acid(4mg vial),injection 1926 zolpidem 10 mg(tablet),tablet ...

Department Of Farmer Welfare And Agriculture Development - Madhya Pradesh

38872299 bids are invited for laboratory beakers (v2) as per is 2619 (q4) , laboratory filter papers (q3) , calcium chloride dihydrate as per is 10758 (q3) , hydrochloric acid as per is 265 (q3) , sodium bicarbonate (q3) , potassium dichromate (q3) , stannous chloride (q3) , ammonium molybdate (q3) , ammonium ferrous sulphate hexahydrate (q3) , sulfuric acid (research grade) (q3) , ammonium acetate (q3) , triethylamine (q3) , glacial acetic acid (q3) , barium chloride as per is: 5288 (q3) , azomethine h monosodium salt monohydrate (q3) , laboratory flask as per is 1381 (q3) , funnel (q3) , burette stand (q3) , burettes (q3) total quantity : 2008...

Directorate Of Health Services - Madhya Pradesh

38649155 supply of drugs and other supply of drugs/material/pathology reagent/equipment/other material during the year 2023 24 , medicine and material and equipment , aceclofenac 100mg + paracetamol 325mg + chlorzoxazone 250mg tablet , aceclofenac 100mg + paracetamol 325mg + serratiopepdise10mg tablet , aceclofenac 100mg + paracetamol 325mg tablet , aceclofenac 100mg tablet , aceclofenac 50mg + paracetamol 125mg 60mlsyrup , aceclofenac 50mg/5ml syrup , acetazolomide 250mg tablet , acyclovir 200mg tablet , acyclovir 250mg injection , acyclovir 400mg tablet , acyclovir 500mg injection , acyclovir 800mg tablet , albendazole 200mg/5ml 10ml syrup , albendazole 400mg tablet , amikacin 100mg 2ml injection , amikacin 250mg 2ml injection , amikacin 500mg 2ml injection , amiodarone 100mg tablet , amiodarone 200mg tablet , amiodarone hydrochloride injection(50mg /ml) 3ml , amlodipine 10mg tablet , amlodipine 2.5mg + ramipril 2.5mg tablet , amlodipine 2.5mg tablet , amlodipine 5mg + atenolol 50mg tablet , amlodipine 5mg + ramipril 2.5mg tablet , amlodipine 5mg tablet , amoxicillin + clavulanic acid tablet kid 228mg. , amoxicillin 1000 + clavulanic acid 200mg tablet , amoxicillin 200mg + clavulanic acid 28.5 30 ml syp , amoxicillin 500mg + clavulanic acid 125mg tablet , amoxycillin 1000mg+ potassium clavulanate 200mg injection , amoxycillin 250mg + potassium clavulanate 50mg injection , amoxycillin 500mg+ potassium clavulanate 100mginjection , amoxycillin trihydrate disp. tab. 125mg. , amoxycilline 250mg cap , amoxycilline 500mg cap , amoxycilline 5ml/125mg30 ml syp , amoxycilline injection 250mg , amoxycilline injection 500mg , amphotericin b 50mg. inj. , ampicilline + cloxacilline injection(250 mg +250mg ) , ampicilline + cloxacilline injection(500 mg +500mg) , ampicilline 125mg+ cloxacilline 125mg cap , ampicilline 250mg + cloxacilline 250mg cap , ampicilline 250mg cap , ampicilline 30ml /125mg syp , ampicilline 500mg cap , ampicilline injection 250mg , ampicilline injection 500mg , antacid 170ml syrup , antacid tablet , anti d immunoglobulin for iv/im use (monoclonal) inj 150mcg 1 ml vial , anti d immunoglobulin for iv/im use (monoclonal) inj 300mcg pfs/vial , anti scorpion venom injection 10 ml , anti snake venom inj polyvalent 10 ml (lyophilized) 10 ml vial , anti tetanus human immunoglobulininjection250 iu /vial , anticold 30ml drop , anticold 60ml syp. , anticold tab. , antifungal 5 gm oint . , antioxident cap , arteetherinjection1 ml , artemether + lumefantrine tab 20 mg+120 mg , artemether inj 80 mg/ ml 1 ml amp , artesunate + sulphadoxine + pyrimethamine(age group of less than 1year) tab artesunate 25mg(3tab) + sulphadoxine 250mg(1tab)+pyrimethamine 12.5mg tablets ip(1tab) 1 combi pack , artesunate + sulphadoxine + pyrimthamine (age group 15 or above) tab artesunate 200mg (3 tab) + sulphadoxine 750mg (2 tab) + pyrimethamine 37.5 mg (2 tab) tab. ip 1 combi pack , artesunate + sulphadoxine + pyrimthamine (age group between 1 4 years) tab artesunate 50mg (3 tab) + sulphadoxine 500mg (1 tab) + pyrimethamine 25 mg (1 tab) tab. ip 1 combi pack , artesunate + sulphadoxine + pyrimthamine (age group between 5 to 8 years) tab artesunate 100mg (3 tab) + sulphadoxine 750mg (1 tab) + pyrimethamine 37.5 mg (1 tab) tab. ip 1 combi pack , artesunate + sulphadoxine + pyrimthamine (age group between 9 to 14 years) tab artesunate 50mg (3 tab) + sulphadoxine 500mg (2 tab) + pyrimethamine 25 mg (2 tab) tab. ip 1 combi pack , artesunate 60 mg tablet , artesunate injection 60mg , anti rabies vaccine injection i.p. 2.5 iu single dose , ascorbic acid 500mg tablet , asprin 150mg tablet , asprin 75mg tablet , atenolol 100 mg tablet , atenolol 25 mg tablet , atenolol 50 mg tablet , atorvastatin 10 mg tablet , atorvastatin 20 mg tablet , atorvastatin 40 mg tablet , atracurium 10mg/ml 2.5ml vial/amp injection , atropine sulphateinjection 0.6mg/ml , atropine sulphate 1% 5ml eye drop , atropine sulphate eye 1% ointment , azithromycin 200mg/5ml 15ml syp , azithromycine 250mg tablet , azithromycine 500mg tablet , b complexinjection 3 ml , b complexminerals with zinc cap , bcomplex + zinc + ginsengcap. , b complex 100ml syp , b complex tablet nfi , benzoyl peroxide gel 5% 15gm tube , betahistidine 16 mg tablet , betahistidine 8 mg tablet , betamethasoneinjection 4mg ml 1 ml , betamethasone tab 0.5 mg , bisacodyl suppositories 5 mg , bisacodyl tab 5mg , boro spirit ear drops (0.183 gm boric acid in 2.08 ml of alcohol 10 ml vial) drop , botropase injection(haemocoagulase 1cu) 1ml , bromhexin (4mg ) + salbutamol (2mg) 60ml syp , bromhexine 4mg/5ml 50ml bottle syp , budesonide nebulising suspension containing budesonide(0.5 mg/2ml 2ml amp) suspension , bupivacaine hcl for spinal anaesthesia 4ml amp injection , bupivacaine hydrochloride 0.5% 20ml vial injection , bupivacaine hydrochloride with dextrose 5% spinalinjection , cabergoline tab 0.5 mg , caffine citrate drop , caffine citrate inj. , calamine lotion 50 ml bottle , calcium carbonate 500mg tablet . , calcium carbonate vita. d3500 mg tablet . , calcium chloride injection , calcium citrate vita d3 tablet , calcium dobesilate 15 gm oint . , calcium gluconate injection 10 ml , calcium with vitamin d tablets usp calcium carbonate 1.25g eq. to elemental(calcium 500mg and cholecalciferol ip 250 iu) tablet , calium with vit d 3 iu 100 ml syp , carbamazepine syp 100mg/5 ml 100 ml bottle , carbamazepine tab 200 mg , carbamazepine tab 400 mg , carbimazole 10mg tablet , carboprostinjection250 mg , carboxy methyl cellulose sodium drops 1% eye drops 10 ml , carboxymethyl hydroxyethyl cellulose , carboxymethylcellulose sodium eye drop 0.5% 10ml eye drop , carpinol (sunway) injection2 ml , cefaodoxil 125mg/30ml syp , cefaodoxil 250mg tablet , cefaodoxil 500mg tablet , cefazolin inj 1gm/vial vial , cefazolin inj 500 mg/vial vial , cefepimeinjection1000mg , cefepimeinjection500mg , cefepime 250mg. inj. , cefixime 100mg tablet , cefixime 200mg tablet , cefixime 50mg tablet , cefixime oral 100mg/5ml 30ml suspension , cefixime oral 10ml bottle drop , cefixime oral 50mg/5ml 30ml suspension , cefoparazone250mg injection , cefoparazone 1gminjection , cefotaxime sodium 500mg injection , cefotaxime sodium 1gm injection , cefotaxime sodium 250mg injection , cefozoline sodium 250mg injection , cefozoline sodium 500mg injection , cefozoline sodium1gm injection , cefpodoxime 100mg tablet , cefpodoxime 100mg/5ml 30ml syrup , cefpodoxime 200mg tablet , cefpodoxime 200mg with ofloxacin 200mg tablet , cefpodoxime 50mg tablet , cefpodoxime 50mg/5ml 30ml syrup , cefpodoxime tab 200 mg , cefpodoxime tab 50 mg , ceftazidimeinjection 250mg , ceftazidimeinjection1gm , ceftazidime inj 500 mg/ vial , ceftriaxoneinjection 125mg , ceftriaxoneinjection 1gm , ceftriaxoneinjection 250mg , ceftriaxone 1000mg + sulbactam sodium500mg vial injection , ceftriaxone 1000mg + tazobactum 125mg vial injection , ceftriaxone 250mg + sulbactam 125mg vial injection , ceftriaxone 500mg + sulbactam 250mg vial injection , cefuroximeinjection 250mg , cefuroximeinjection 750mg , cefuroxime 250mg tablet , cefuroxime 500mg tablet , cephalexin 250mg cap , cephalexin 500mg cap , cephalexin dispersible tablet 125 mg , cephalexin syp 125mg/5ml 30 ml bottle , cetrimide+chlorhexidine conc. solution 15% + 7.5% 1 litre bottle , cetrizine 10mg tablet , cetrizine 30 ml syp , charcoal activated (powder) oral powder 100 gram box/pouch , chloramphenicolinjection20ml , chloramphenicol + dexamethasone 10ml eye drop , chloramphenicol 10 ml eye drop , chloramphenicol cap 500 mg 10 x 10 , chloramphenicol eye ointment 0.5% ointment , chloramphenicol eye ointment 1% 4g/5g tube , chlorhexadine acetate 0.5% white soft parafin medicated gauze 1x10 , chlorhexidine gluconate mouthwash 0.2 % w/v solution50ml bottle , chlorine 75mg tablet isi mark , chlorocal h 1.5 gm eye oint , chloroquine phosphateinjection64.5 mg ml (5ml amp) , chloroquine phosphate syp 160mg /10ml(50mg/5ml base) 60ml bottle , chloroquine phosphate tab 250 mg , chlorphenaramine maleate injection10 ml , chlorphenaramine maleate injection 2 ml , chlorpheniramine maleate 4mg tablet , chlorpheniramine(oral liquid 2 mg/5 ml 30 ml bottel),liquid , chlorpromazineinjection 25mg /ml 2ml , chlorpromazine 100mg tablet , chlorthalidone 12.5mg tablet , chlorthalidone 25mg tablet , chlorthalidone tab 50mg , chlotrimazole 2%+ metronidazole 10%45 gm oint . , cinnarizine 25 mg tablet , cinnarizine 50 mg tablet , ciprofloxacin + dexamethasone 5ml eye drop , ciprofloxacin 250mg + tinidazole 300mg tablet , ciprofloxacin 250mg tablet , ciprofloxacin 500mg + tinidazole 600mg tablet , ciprofloxacin 500mg tablet , ciprofloxacin eye drop , ciprofloxacin eye ointment 0.3% 3/3.5 gram tube , ciprofloxacin inj 200 mg/100ml 100ml ffs bottle infusion , clarithromycin 250mg tablet , clindamycin inj 150 mg/ ml 2 ml vial , clindamycine 150 mg tablet , clindamycine 300 mg tablet , cilnidipine 10mg tab. , clobetasol propionate oint . , clofazimine 100mg capsule , clofazimine 50mg tablet , clomiphene citrate 50 mg tab , clonazepam 0.5mg tablet , clonazepam injection , clonidineinjection10ml vial (1mg ) , clonidine 100 mcgtablet , clopidogrel + aspirin 150mg cap , clopidogrel + aspirin 75mg cap , clopidogrel 75mg tablet , clotrimazole (vaginal tab) 100 mg (with applicator) tab. , clotrimazole + lignocaine ear drop 1% 5 ml vial , clotrimoxazole 15gm 1% tube oint . , clozapine(25 mg),tablet , clozapine(50 mg),tablet , cough drop 15ml , chlorpheniramine+ammonium chloride+sodium citrate+menthol100ml syp , cyproheptadine 4 mg tablet , cytoheptadine 1.5 mg drop 15ml , dacarbazine (dtic) 500mg with solvent inj. , deferasirox dispersible 250mg tablet , dexamethasone eye drop(0.1%, 5ml),eye drop , dexamethasone sodium phosphate 8mg/2ml 2ml injection , dexamthasone 0.5mg tablet , dextromethorphan 10mg/5ml 100ml syrup , dextromethorphan 10mg/5ml 60ml syrup , diazepaminjection5 mg/2ml , diazepam 5mg tablet , diclofenac 50mg + paracetamol 325mg + chlorzoxazone 250mg tablet , diclofenac 50mg + paracetamol 325mg + serratiopeptidase 10mg , diclofenac 50mg+ paracetamol 500mg tablet , diclofenac sodium 25 mg/ml(3ml amp),injection , diclofenac sodium 50mg tablet , diclofenac with menthol 30gm ointment , diclofenac(1%),gel 30gm ointment , diclofenac sodium injection 1ml , dicyclominedrop , dicyclomineinjection2ml , dicyclomine hydrochloride 20mg + paracetamal 325mg tablet , dicyclomine hydrochloride 20mg tablet , dicyclomine hydrochloride tab 10mg , dilitiazem injection , diltiazem 30 mg tablet , diltiazem 60 mg tablet , diltiazem 90 mg tablet , diphenhydramine hcl 12.50 mg + ammonium cloriede 125 mg + sodium citrate 55 mg syrup 100ml , diphenhydramineinjection 50 mg /ml , diphenhydramine 12.5mg/ml. syp , diphenhydramine 25mg. cap , diphtheria antitoxin 10000 iu 10 ml vial , disodium hydrogen citrate (alkalizer) 100 ml syp , dist. water inj. 10ml vial , dist. water inj. 5ml vial , dobutamine 50mg/ml (5 ml amp)injection , dobutamine inj 12.5 mg/ ml 20 ml vial , domperidone 10mg tablet , domperidone 1mg per 1ml suspension 30 ml bottle , donepezil 5mg tablet , dopamine hydrochlorideinjection40mg /ml (5ml amp) , doxycycline dry 50mg/5ml syrup , doxylamine succinate tab 10 mg , drotaverine inj 40 mg/2 ml 2 ml amp , drotaverine tab 40 mg , dydrogesterone 10 mg tab , enalapril injection , enalapril maleate 10mg tablet , enalapril maleate 2.5mg tablet , enalapril maleate 5mg tablet , enoxaparin inj 40 mg equivalent to 4000 iu vial/pfs , enoxaparin inj 60 mg equivalent to 6000 iu vial/pfs , enzyme with vitaminsdrop 15ml , erythropoietin 10 k inj. , erythropoietin 2 k inj. , erythropoietin 4 k inj. , erlotinib 150mg tablet , erythromycine 250mg tablet , erythromycine 500mg tablet , escitalopram 10mg tablet , ethamsylate 250mg tablet , ethamsylate injection 2ml , etiophylline and theophylline 220mg/2ml injection , etophylline 231mg + theophylline 69mg sr tablet , etophylline 77mg + theophylline 23mg tablet , etoposide 100mg. inj. , fenofibrate 200mg tab. , fentanyl citrate 50 microgram/ml 2 ml amp , ferric ammonium citrate 110mg + folic acid1.5mg + cyanocobalamin 15mcg+ sorbitol solution syrup 200ml , ferric ammonium citrate ip 25mg + lysine hydrochlorideusp 50 mg. + cyanocobalamin ip 5mcg. + folic acid ip 200mcgper mldrop 15ml , ferric ammoniun citrate 200 mg+ folic acid 0.5 mg / 5ml 200ml syp , ferric carboxymaltose inj equ.to elemental iron 500mg/10ml , ferrous ascorbate 100 mg , folic acid 1.5 mg ,zink 22.5 ,d3 200i.u.,cynocobalamin 2 mg , ferrous ascorbate 100mg (elemental iron)+folic acid 1.5mg(tablet),tablet , filgrastim 300mcg. prefilled syring contains inj. , fluconazole 150mg tablet , fluconazole 100ml. inj. , fluconazole 400mg. tab. , flunarizine 5mg tablet , fluorouracil (5 fu) inj 500 mg /10 m lvial 10 ml vial , fluoxetine 20mg capsule , fluphenazine 1ml 25mg/ml injection , foleron (iron iii) hydroxide polymaltose complex tablet , folic acid 5mg tablet , framycetin sulphate 1% cream 30gm tube cream , frusemide 10mg/ml 2ml amp injection , furazolidone 100mg tablet , furazolidone 60ml syp , furosemide 40mg tablet , furosemide drop , fusidic acid cream/sodium fusidic ointment 2% 5gm 5gm tube , gamma benzene hexachloride solution/lotion 1% 100ml bottle , gentamicin + hydrocortisone ear drop (0.3%+1%) 5 ml vial , gentamicin 0.3% eye/ear drops 5ml , gentamicin 40mg/ml 2ml amp injection , gentamycine sulpfate 15gmoint . , glibenclamide 5 mg tablet , gliclazide tab 80 mg , glimepiride 1 mg tablet , glimepiride 2 mg tablet , glipizide 5 mg tablet , glucose pouch 75gm powder , glycerine 15% sod chlor 15% enema 20ml , glycerine oral liquid 30ml bottel liquid , glycerine ip solution 100 ml bottle , glycopyrolate 0.2mg/ml 1ml vial injection , griesofulvin 125mg tablet , haloperidol 5mg tablet , haloperidol 5mg/ml 1ml amp injection , haloperiodol 1.5mg tablet , heparin sodiuminjection 1000iu/ml 5ml , heparin sodiuminjection 5000iu/ml 5ml , human albumin solution 0.05 250ml injection , human albumin solution ip i/v 20% w/v 100 ml ffs bottle , human anti d. immunoglobulin (monoclonal)(300mcg/vial),injection , human chorionic gonadotropin(injection 10000 iu vial of 1 ml injection),injection , human chorionic gonadotropin(injection 5000 iu vial of 2 ml injection),injection , hyaluronidase , hydrochlorothiazide 12.5mg tablet , hydrochlorothiazide 25mg tablet , hydrochlorothiazide 50mg tablet , hydrocortisone 0.5% 15gm ointment or cream , hydrocortisone 1% 15gm ointment or cream , hydrocortisone sodium succinateinjection 200 mg/ml vial , hydrocortisone sodium succinate injection400 mg /ml vial , hydrocortisone sodium succinate injection 100 mg /ml vial , hydrogen peroxide 6% solution (who gmp certification exempted for this item)(400 ml ),bottle , hydroxy ethyl starch 200/3% inj. , hydroxy urea 500mg capsule , hydroxychloroquine 200mg tablet , hydroxyethyl (6% saline solution for infusion)(starch 6%ip 500 ml bottel),infusion , hydroxyethylstarch 6% solution with sodium chloride 0.9% iv infusion i/v 500 ml ffs bottle 0.90% , hydroxyurea dispersable 100mg tablet , hydroxyzine 25mg tablet , hyoscine butylbromide 20mg/ml 1ml vial/amp injection , hypersol 10 mleye drop , hypersoninjection5ml , i.v. (electrolyte m) 500ml ffs dextrose anhydous 5gm kcl 150mgnacl 100mgna acetate 280mgna meisulphite21 mg dibasic k phosphate 130mg/100ml 500ml ffs , i.v. 10% amino acid + electrolyte inj. , i.v. ciprofloxacine100ml ffs , i.v dextrose with saline 500 ml plastic bottle500ml ffs , i.v. dextrose 5% plastic bottle500ml ffs , i.v. dextrose10%plastic bottle500ml ffs , i.v. dextrose 25% 25ml ffs , i.v. dextrose 25%(500ml ffs bottle),injection , i.v. dextrose 5%(500ml ffs bottle),injection , i.v. dextrose 50% 25 ml ffs , i.v. dextrose with saline(5% + 0.9% (500ml ffs bottle)),injection , i.v. dextrose(10% inj 500 ml ffs btl),injection , i.v. dextrose(25% 100 ml ffs bottle),injection , i.v. electrolyte‘p’ 500ml ffs dextrose anhydous 5gm kcl 130mg dibasic k phosphate 25mg na acetate 320mg na meisulphite21 mgcl2 31 mg /100ml 500ml ffs , i.v. electrolyte e i.v 500ml ffs/bfs bottle 500ml ffs. dextrose 5gsodium acetate 0.64gsodium chloride 5gpotassium chloride 75mgsodoium citrate 75mgcalcium chloride solution correcting water electrolyte & nutrition 52mg magnesium chloride 31 mg tabletsodium meta bi sulphate 20 mg , i.v. electrolyte p (multi electrolytes and dextrose injection type i ip) i/v fluid (each 100ml contains: anhydrous dextrose 5gm potassium chloride 0.13gm, sodium acetate 0.32gm, dibasic potassium phosphate 0.026gm)(500 ml ffs bottle),injection , i.v. glycin 3000ml. inj. bottle plastic , i.v. linozolidine ffs , i.v. mannitol 10% 100ml ffs , i.v. normal saline 0.9 % 100 ml plastic bottleffs , i.v. normal saline 0.9 % 500 ml plastic bottle ffs , i.v. ofloxacine 100 ml ffs , i.v. ornidazole 100ml ffs , i.v. ringer lactate plasticbottle 500 ml ffs , i.v. tinidazole 400ml ffs , i.v.( electrolyte ‘g’) 500ml ffs dextrose anhydrous 5 gmkcl 130 mgnacl 370 mg tabletammon cl 370 mg na sulphite 15 mg /100ml 500mlffs , ibuprofen400 mg + paracetamole 325 tablet , ibuprofen + paracetamol syrup , ibuprofen 200mg. tab. , ibuprofen 400mg tablet , ibuprofen 60ml syp , insulin soluble inj. 40iu/ml , insulins human mixtard30:70 injection10ml , intraperitoneal dialysis solution 0.015 1.5% 500ml solution , intraperitoneal dialysis solution 0.025 2.5% 500ml solution , intravenous immunoglobulin inj. , ipratropium bromide 250 mcg/ml respules inhalation , ipratropium bromide inhaler 20mcg per puff(200 metered dose container),inhaler , iron & folic acid enteric coated blue (as per nipi guidelines) 100 mg + 0.5 mg(tablet 10 x 10),tablet , iron & folic acid enteric coated red (as per nipi guidelines) 100 mg + 0.5 mg (tablet 10 x 10),tablet , iron & folic acid entric coated 100mgof elemental iron (adult)+fa 1.5mg tablet , iron & folic acid entric coated dessicated ip 67mg tablet equivalent to 20mgof elemental iron tablet , iron & folic acid sugar coated pink(as per nipi guidelines) 45 mg + 0.4 mg (tablet 15 x 10),tablet , iron 100ml syp. , iron 30ml drop , iron and folic acid enteric coated tab dried ferrous sulphate equ. to ferrous iron 100 mg and folic acid 0.5 mg (blue tablet) , iron and folic acid enteric coated tab dried ferrous sulphate ip eq. to 45 mg elemental iron and 400 mcg folic acid ip (pink color) wifs junior , iron and folic acid enteric coated tab. ferrous sulphate ip to ferrous iron 100 mg & folic acid ip 0.5 mg granules (red tablet) , iron ferras sulphate folic acid 100ml syp , iron folic acid sugar coated (blue tablet) ferrous sulphate ip equivalent to 60 mg elemental iron & 500 mcg folic acid ip(60 mg + 500 mcg),tablet , iron folic acid sugar coated (red tablet) ferrous sulphate ip equivalent to 60 mg elemental iron & 500 mcg folic acid ip(60 mg + 500 mcg ),tablet , iron folic acid sugar coated tablet dried ferrous sulphate ip eq. to 45mg ferrous iron and 400mcg folic acid ip (pink coloured tab) wifs junior ifa tablets (detail specification as per tender)(45mg + 400mcg),tablet , iron folic acid syrup, each ml containing 20mg elemental iron&100mcgfolic acid with suitable anti oxidant, antimicrobial agent and food grade flavouring agent.the bottle should have 6 fragmented markings at equal intervals(if an artificial sweetening is used it should be highlighted on the label. warning should be put on label medication should be kept out of reach of children. (as per attached specification) (50ml bottle with auto dispenser)),syrup , iron polymaltoseinjection , iron sucroseinjection 2.5ml , iron sucroseinjection 5ml , isoflurane inhalation , isosorbide dinitrate.10 mg tablet(sub) {sorbitrate} , isosorbide dinitrate 5 mg tablet(sub.) {sorbitrate} , isosorbite mononitrate 20 mg tablet , isoxsuprine 10mg tablet , isoxsuprine hcl injection , itraconazole cap 100mg , itraconazole cap 200mg , iv human immunoglobin 5% iv ig(5gm/100ml each),infusion , ivabradine 5mg tab. , ivermectin 12mg tablet , ketorolac eye drop 0.5% 5ml drop , labetalol inj 20 mg/4ml 4ml amp , labetalol tablet 100mg. , lactobacillus tab 60 million spores , lactulose 10gm/15ml 100ml bottle syrup , levocetirizine + monteleukast 2.5 mg + 4mg/5ml 60ml suspension , levocetirizine 5mg + montelukast 10mg tablet , levocetirizine dihydrochloride ip 2.5mg+ ambroxol hydrochloride ip 30mg per 5ml syp. 60ml , levocetrizine dihydrochloride 5mg tablet , levodopa (a) + carbidopa (b)(tablet 100 mg (a) + 10 mg (b) cr),tablet , levodopa (a) + carbidopa (b)(tablet 100 mg (a) + 25 mg (b) cr),tablet , levodopa (a) + carbidopa (b)(tablet 250 mg (a) + 25 mg (b)),tablet , levofloxacin inj 500 mg/100 ml 100 ml ffs bottle , levofloxacine250mg tablet , levofloxacoine 500mg tablet , levosalbutamol(50mcg/dose 30 capsule in 6 pack with 1 dispecing device),capsule , levosulbutamol(100 mcg 30 capsule in 6 pack with 1 dispecing device),capsule , levothyroxine(100 mcg),tablet , levothyroxine(50 mcg),tablet , lignocain spray , lignocaine 2 %(21.3 mg / ml (30 ml vial)),injection , lignocaine 2% + adrenaline 5 mcg/ml(30 ml ),vial , lignocaine 4%injection30 ml , lignocaine hydrochloride 2% 30gm tube gel , lignocaine hydrochloride 4% eye drops 5 ml vial , lignocaine hydrocloride and dextrose injection hevy 5% spinal 2 ml amp. , linagliptin 5 mg tablet , linezolid 600mg tablet , liq glycerol 100 ml , liquid formalin 450ml , liquid glycerin 500gm , liquid hydrogen peroxide 400ml , liquid icthamol 100gm , liquid icthamol glycerin 100gm , liquid lysol 5 ltr. jar , liquid paraffin light 400ml , lisinopril 5 mg tablet , lithium carbonate 300mg tablet , loperamide(2mg),tablet , lorazepam 2 mg / ml 1 ml vial , lorazepam(1 mg),tablet , losartan potassium 50mg tablet , losartan(10 mg tablet),tablet , benzyl benzoate 100 ml 25% lotion , gama benzene hexachloride 100ml lotion , liquid cresol with soap solu. 400ml , luliconazole cream 10gm ointment , luliconazole cream 20gm ointment , luliconazole cream 30gm ointment , lycopene + antioxidant + multivitamine cap. , lycopene with multivitamins + multiminerals cap , multivitamine injection10 ml , magnesium hydroxide+aluminium hydroxide tablet 500mg. + 250mg. , magnesium suplhate(50 % w/v (2ml amp)),injection , mannitol inj. 20% 350ml ffs bottle , mannitol(20% 100 ml ffs bottle),injection , mebendazole 100mg tablet , mebendazole 30ml syp , mebeverine(tab 200 mg 10 x 15),tablet , medroxy progesterone acetate(10 mg),tablet , medroxyprogesterone acetate(injection 150 mg 1 ml / vial),injection , mefenamic acid 250mg + dicyclomine 10mg tablet , mefloquine tab 250 mg , menadione (vit.k3) injection10mg/ml 2ml , mepafotic eye drop , mephentamine inj 30mg/ml(10 ml vial),injection , meropenam 1000mg inj. , meropenam 125mg inj. , meropenam 500mg inj. , metaclopromideinjection2ml (5mg) , metaclopromide 10mg tablet , metformin(1000mg),sr tablet , metformin(500 mg),tablet , methylergometrininjection(2mg ) 2ml , methyl ergometrine maleate0.125mg tablet. , methyl salicylate 100gm ointment , methylcobalmin 1500mg cap , methylprednisoloneinjection1000 mg , methylprednisoloneinjection125 mg , methylprednisoloneinjection 250 mg , methylprednisoloneinjection 40 mg , methylprednisoloneinjection 500 mg , methylprednisolone 16mg tablet , methylprednisolone 4mg tablet , methylprednisolone 8mg tablet , metoclopramide inj 5 mg/ ml 2 ml amp , metoclopramide tab 10 mg , metoprololinjection1mg /ml , metoprolol tab 50 mg , metoprolol tab 25 mg , metronidazole 1% ointment 15 gram tube , metronidazole 200mg tablet , metronidazole 400mg tablet , metronidazole 500mg/100 ml(100 ml ffs bottle),injection , metronidazole oral suspension(200 mg/5ml (60 ml bottle)),suspension , miconazole ip cream 2% w/w 15 gram tube , micronised progestroninjection 200mg1 ml 2ml , midazolam 1mg/ml 5ml amp injection , mifepristone 200mg tablet , milk of magnasia 11.25ml liquid paraffin 3.75ml/15ml ( creamafin formula ) 170 ml syp , misoprostal200mcg4s tabletpack , montelukast 5mg tablet , moxifloxacine 5ml eye drop , multivitamin 200ml syp. , multivitamin sugar coated tab nfi formula multivitamin sugar(item with additional vitamin will also be considered),tablet , multivitamin with protein 100ml syp , multivitamin with protein 200ml syp , multivitamine drop , multivitamine with zincdrop , mupirocin cream/ointment 2% 15 gram tube , mupirocin(2% w/w (5 gm tube)),ointment , naloxoneinjection 0.4mg/ml 1ml(amp) , naloxone injection 0.1mg/ml 1ml(amp) , neomycin sulfate 10gm oint . , neosporin h 5gm eye oint , neostigmine(0.5mg/ml (1ml amp)),injection , nicotinamide 15mg + thiamine mononitrate (vitamin b1) 1mg+ riboflavine (vitamin b2) 1mg + pyridoxine hcl (vitamin b6) 0.5mg + cyanocobalamin (vitamin b12) 1mcg tab. , nifedipine capsule(5mg cap),capsule , nifedipine(10mg tab),tablet , nitroglycerine inj. 25 mg/5ml(5ml),ampule , nondrolon deconateinjection25 mg , nondrolon deconateinjection50 mg , noraderanaline bitartrate(2 mg base/2ml (2ml amp)),injection , norfloxacin + dexamethasone 10 ml eye drop , norfloxacin 5ml eye drop , norfloxacin(dispersible tablet 100 mg),tablet , norfloxacine 400mg + tinidazole 600mg tablet , norfloxacine 400mg tablet , normal saline(nasal drops: sodium chloride drops 0.05% w/v 10 ml vial),drop , ofloxacin 10 mleye drop , ofloxacin 200mg tablet , ofloxacin eye drops 0.3% w/v 5 ml vial , ofloxacin tab 400 mg , ofloxacine 200 + ornidazole 500 tablet , ofloxacine dexamethasone eye drop , olanzapine( 5 mg),tablet , olanzapine(10mg tab),tablet , olopotadine antiallergic eye drop 0.1% 5 ml vial , omeprazole 20mg+ domperidone10mg cap , ondansetroninjection 2 ml , ondansetron 4 mg tablet , ondansetron syp 2mg/5 ml 30 ml bottle , ornidazole 60ml. syp , ors who powder glucose anhydrous 13.5g/l, sodium chloride 2.6g/l, potassium chloride 1.5g/l, trisodium citrate 2.9g/l(as per attached pack specification),powder , oseltamivir ip 100ml. syp , oseltamivir ip 30mg cap , oseltamivir ip 45mg cap , oseltamivir ip 75mg cap , oxytocin inj(5 iu/ml (1ml amp)),injection , pantoparazoleinjection 40mg , pantoprazole 40mg + domperidone10mg tablet , pantoprazole 40mg tablet , paracetamol + phenylephrine hydrochloride + caffeine + diphemhydramine hcl tab. , paracetamol inj(150mg/ml 2ml amp(2ml amp)),injection , paracetamol syrup/suspension 125 mg/5ml (60ml bottle)(syrup),syrup , paracetamol 650mg tablet , paracetamol(125 mg/ml),drop , paracetamol 500mg tablet , paracetamole 325 mg + mefenamic acid 500mg tablet , pemetrexed 500mg injection , pentazocine lactate(30mg/ml (1 ml amp)),injection , peprazine citrate 30ml syp , permethrin cream 5% w/v(60 gm),tube , permethrin lotion 5% w/v(60 ml bottle),lotion , pheniramine maleate(22.75 mg/ml (2 ml amp)),injection , pheniramine meleate 25mg tablet , phenobarbitone 200mg/5ml syp , phenobarbitone(200 mg/ml),injection , phenobarbitone(30 mg),tablet , phenobarbitone(60 mg tab),tablet , phenytoin sodium oral suspension 25mg/ml 100 ml bottle , phenytoin sodium(100mg),tablet , phenytoin sodium(50 mg/ml (2ml amp)),injection , phytomenadione injection(10 mg/ml),injection , pilocarpin pfs injection , pilocarpine eye drops 2%(5ml),vial , pilocarpine eye drops 4% 5 ml vial , piperacillin 1gm + tazobactam 125mg injection , piperacillin 2gm + tazobactam 0.25mg injection , piperacillin 4gm + tazobactam 0.5gm injection , piroxicam 20mg cap. , piroxicam gel 30gm oint . , potassium chloride injection150 mg/10 ml , potassium chloride oral solution 100mg/ml(200ml bottle),bottle , povidine iodine germicide(gargle 20% w/v 100 ml bottel),bottle , povidone iodine + metronidazol 15gm ointment , povidone iodine cream 125gm oint . , povidone iodine cream 15 mg oint . , povidone iodine cream 250gm oint . , povidone iodine solution 5% 100ml , povidone iodine solution 5% 500ml , povidone iodine solution 7.5% 100ml , povidone iodine solution 7.5% 500ml , povidone iodine surgical scrub 7.5% 500ml bottle , povidone iodine vaginal(200 mg),pessary , powder acriflavin 20gm , powder bleaching 25kg , powder boric acid 400gm , powder cetrimide 100gm , powder glucose 100 gm , powder magnesium sulphate 400gm , powder mercurochrome 20gm , powder nitrofurazone 20% w/n 10gm , powder povidoine , powder sulfanilamide dusting 400gm , pralidoxime (pam)injection25 mg/ml 20 ml , pralidoxime chloride (2 pam)injection , prazosin tab 1mg , prednisolone 10mg tablet , prednisolone 20mg tablet , prednisolone(drops 1% eye 5 ml drop),drop , pregabalin(tablet 150 mg),tablet , primaquin 15mg tablet , primaquin 2.5 mg tablet , primaquin 7.5 mg tablet , procarbazine 50mg. cap. , promethazine 25 mg/ml(2 ml amp),injection , promethazine 5 mg/5ml(60 ml bottle),syrup , promethazine tab 25 mg , proparacaine hydrochloride eye drop , propofal(injection 10 mg/ml 1 ml /vial),injection , propranolol 40mg tablet , propranolol tab(10 mg),tablet , protamine(injection 50 mg/5 ml 5 ml vial),injection , proteine hydrolysate 1gm + choline citrate 1mg pyridoxine hcl 2mg cyanocobalamin 10 mcg + folic acid 1mg per 15ml syp200ml , protin hydrolysate + pyridoxin + niacinamide + iron cholin citrate + magnesium chloride + maganese chloride + zinc sulphate + lysine , pyridoxine tablet , quinine dihydrochloride(300mg/ml (2ml amp)),injection , quinine sulphate(300mg),tablet , rabeprazole 20mg + domperidone 30mg cap , rabeprazole 20mg + domperidone10mg tablet , rabeprazole 20mg tablet , rabies immunoglobinesinjection150iu , rabies immunoglobulin inj 300 iu((2ml vial pfs)),injection , rabies vaccine human (tissue culture) id/im(inj 2.5 iu/ ml 1 vial with 1 ml diluents),injection , rabies vaccine human injection. (intra dermal) , ramipril 2.5 mg tablet , ramipril 5 mg tablet , ranitidine 150mg tablet , ranitidine 300 mg tablet , ranitidine 150mg + domperidone 10mg tablet , ranitidine(50mg/2ml , 2ml amp),injection , reduced osmolarity ors pkt. who formula sodium chloride 2.5mg potessium chloride 1.5mgsodium citrtr 2.09g dextrose 13.6g 20.5gm , risperidone(12.5 mg ),injection , risperidone(2 mg),tablet , roxithromycin50mg tablet , roxithromycin 150mg tablet , roxithromycine 30 ml syp , salbutamol inhalation ip 100mcg/dose(200 metered dose container),inhaler , salbutamol sulphate 2mg/5ml 60ml syrup , seratiopaptidase 10mg tablet , seratiopaptidase 5mg tablet , silver sulphadiazine cream1% 25gm tube , sitagliptin 100mg tablet , sitagliptin 50mg tablet , sodium bicarbonate inj. 7.5% 10ml ampoule , sodium thiopentone 0.5gm powder/vial(20ml vial),injection , sodium valproate oral solution 200mg/5ml 100 ml bottle , sodium valproate 200mg tablet , sodium valproate 500mg tablet , soframycine 1.5gm eye ointtube , solution chloroxylenol4.8%w/v terpineol 9%v/v alcohol absolute 13.1%v/v ( detol formula} , solution chloroxylenol4.8%w/v terpineol 9%v/v alcohol absolute 13.1%v/v ( detol formula}hw , streptokinaseinjection15 lac unit , streptokinaseinjection 750000iu , succinyl choline(50mg/ml (10 ml vial)),injection , sucralfate 20mg tablet , sucralfate(1gm/5ml),syrup or suspension , sulfacetamide eye drops 20% 10 ml vial , sulfadimidine 500mg tablet , sulfamethoxazole +trimethoprim suspension (200 mg + 40 mg) / 5 ml suspension(50 ml bottle),suspension , sulfamethoxazole 200mg +trimethoprim 40mg tablet , sulfamethoxazole 100mg +trimethoprim 20mg tablet , sulfamethoxazole 400mg +trimethoprim 80mg tablet , sulfamethoxazole 800mg +trimethoprim 160mg tablet , surfactant suspension(inj 25 mg/ml),injection , surgical sprit 100 ml , surgical sprit 500 ml. , tamsulosin 0.4mg. tab. , telmisartan 20mg tablet , telmisartan 40mg tablet , temozolimide 100mg. cap. , temozolimide 20mg. cap. , temozolimide 250mg. cap. , teneligliptin 20mg tab. , terbutaline sulphate 1.5 mg + bromhexine 4 mg + guaiphensin 50 mg 100ml syp , tetanus immunoglobulin(usp/ip 250 iu/vial),injection , tetanus toxide injection 0.5ml , tetanus toxide injection 5ml , thiamine hydrochloride 2.25 mg + riboflavine 2.5mg + pyridoxine hydrochloride 0.75mg +cyanocobalamin 2.5mg + nicotinamide 30mg + d panthenol 2.5mg flavoured syrup200ml , thyroxine sodium. 100mcg tablet , thyroxine sodium. 50 mcg tablet , timolol maleate eye drop i.p. 0.5 %w/v (5 ml vial)(5 ml),solution , tincture benzoin 450ml , tincture iodine 450ml , tinidazole 300mg tablet , tinidazole 500mg tablet , tobramycin 10ml eye drop , torasemideinjection100mg/2ml , torasemide tab 10 mg , torasemide tab 20 mg , tramadol100mg tablet , tramadol50mg tablet , tramadol injection(100mg/ml) 2 ml , tramadol injection(50mg/ml) 2ml , tranexamic acid injection 5ml amp , tranexamide acid 500 mg tablet , trihexyphenidyl tab 2 mg , tropicacl phenylephrine hydrochloride eye drop , tropicacyl plus 5 ml eye drop , tropicamide(1% 5ml vial),eye drop , tropicasyl plus (ophth) 10ml eye drop , turpentine liniment 400ml , urokinase inj 5 lac iu/vial vial , valethamate bromide ( epidosin ) injection , vancomycin hydrochloride(1000mg vial),injection , vancomycin hydrochloride(500mg),injection , vecuronium bromide inj 2mg/ml (2ml amp) , vitamin a ip 2500 iu + vit b1 1mg + vit b2 1.5mg+ vit b6 1mg + vit b12 1mcg + vitamin c 50mg+ vit e 5mg + vit e 5mg + niacinamide 15mg + folic acid ip 0.15mg elemental calcium ip 75mg + phosphorus 58mg+ ferrous fumarate ip 30mg + zinc sulphate ip 10mg +magnesium sulphate ip 0.50mg + coppersulphate usp 0.50mg + potassium iodide ip 0.01mg + ginseng usp 42.50mg cap. (with mono cartan) , vitamin a syrup(100000 iu/ml with market spoon for 1ml and 2 ml (100 ml bottle)),syrup or solution , vitamin c(100 mg),tablet , vitamin kinjection(10mg /ml) 1 ml , vitamin k1(1mg/0.5ml (0.5 ml amp)),injection , vitamin. b complex nfi (prophylactic)(b12 mg, b22mg, b6 0.5 mg, niacinamide 25 mg, calcium pantothenate 1 mg),tablet , warfarin sodium 5mg tablet , warfarin 1mg tablet , warfarin 2mg tablet , water for injection 10 ml amp , water for injection 5 ml amp , water for injection 2 ml amp , xylometazoline 0.05% nasal 10ml(0.05% 10ml),drop , xylometazoline nasal(0.1%w/v (10 ml vial)),drop , zinc dispersible(20mg),tablet , zinc sulphate dispersible(10mg),tablet , zinc sulphate syrup 50ml , zine sulfate monohydrate 20mg + thiamine mononitrate 10mg + riboflavine 10mg + pyridoxine 3mg +cyanocobalamin 5mcg + nicotinamide 50mg + calcium pantothenate 12.5mg + folic acid 1000mcg + magnesium sulfate monohydrate 10mgcap. , b.b. silk with 1/2 cir cd cutting needle size:1/0 16 mm length 75 cm , b.b. silk with 1/2 cir cd cutting needle size:2/0 16 mm length 75 cm , b.b. silk with 1/2 cir rb cutting needle size:2/0 20 mm length 75 cm , b.b. silk with 1/2 cir rb cutting needle size:3/0 20 mm length 75 cm , dust bin 10 ltr , dust bin 15 ltr , dust bin 25 ltr , bed pan male with cover (made of stainless steel) , blood administrations set , catgut chromic size 1/0 length 150 cm on needle , catgut chromic size 2 length 150 cm on needle , catgut chromic size 2/0length 150 cm on needle , catgut plain size 1/0 length 150 cm on needle , desire colour poly bag bmw sutable for normal size approx 10 ltr dustbeen , desire colour poly bag bmw sutable for normal size approx 20 ltr dustbeen , desire colour poly bag bmw sutable for normal size approx 30 ltr dustbeen , disposable gown , ecg gelly , ecg roll , foleys urinary catheter two way size 16 , foleys urinary catheter two way size 18 , artery forceps , scissors , weight machine child , weight machine adult , kells pad , knife blade all no. , gauze than 90 cm x 18 mm , gauze than 60 cm x 18 mm , gauze than 90 cm x 16 mm , hand wash salution 500 ml , seek jhadu , digital wrist watch , phool jhadu , rassi pocha , phenyl 1 ltr , phenyl 500 ml , floor cleaner 5 ltr , floor cleaner 1 ltr , hand sanitizer 100 ml , hand sanitizer 500 ml , wiper complete , three layer mask , sanitary pad , n 95 mask , hand wash solution 100 ml , tharmacol box for covid sample , hypochloride solution 500 ml , mindray diluent 500 solution , mindray lyse 500 solution , vdrl kit , typhoid test kit , hbsag test kit , billirubin kit , sgot test kit , sgpt test kit , creatinine kit , hcv test kit , hiv test kit , dual testing kit for hiv and syphilis test , pregnancy test kit upt , micro pipettetips , computer with desktop complete , laptop , inverter with battery , cooler , printer with scanner all in one , steel almirah , iron rack , fowler bed ss , bed side locker , semi fowler bed with mettress , syringe infusion pump , b.p. instrument digital , pulse oximeter , stethoscope , digital thermometer , oxygen flowmeter , oxygen concentrator , office table , office chair , executive office chair , sanitary napkin , turkish towel , pillow cover , pillow 2 kg cotton , basta cloth , colour bed sheet , white bed sheet , readymade parde large , autoclave drum 11x09 , disposable surgeon cap , face shield , disposable bed sheet , disposable appron , finger tip pulse oximeter , infrared thermameter , usg gelly 5 ltr , disposable surgeon gown , cotton mattress 10 kg , anti septic solution 1 ltr , ice pack jelly , bmw poly bed red , bmw poly bed yellow , bmw poly bed blue , bmw poly bed white , digital watch , digital thermameter , neonatal weighing scale with sling , baby blanket , baby feeding spoon/paladi , warm bag , bag for kits , photocopy machine , abdominal belt , abdominal drain kit all size , abdominal gauze sponge 30x30 , abgel , absorbant cotton 100 gm , absorbant cotton 250 gm , absorbant cotton 400 gm , absorbant cotton 500 gm , acetone detection kit 150 tests , ad tape10cm x5mtr , ad tape10cm x8mtr , ad tape2.5cm x 5mtr , ad tape2.5cm x 8mtr , ad tape7.5cm x 5mtr , ad tape7.5cm x 8mtr , ad tape 5cm x 5mtr , ad tape 5cm x 8mtr , aed , aero mist (neonate) , air bad romsons , airbed , alb, glucose, ph strips 100 , albumin & glucose strips 100 , albumin (bcg method) (liquistat) 4 x50ml , alchohol tester , alkaline phosphatase(pnpp) kinetic 4 x50ml , allies tissue forcep 6 , allies tissue forcep 7 , allies tissue forcep 8 , alluminium foil roll , ampul box 12 hol , ampul box 24 hol , ampul box 36 hol , amylase (cnpg3) (liquistat) 5x10 ml , aneroid sphygmomanometer , arm siling balt , artery forcep straight & curved5 , artery forcep straight & curved6 , artery forcep straight & curved7 , artery forcep straight & curved8 , artery forcep straight & curved9 , artery forcep straight & curved10 , aso turbilatex (quantitative)50 ml , auto scope , autoclave indicator tape , b.p. instument dial type , b.p. instument digital , b.p. instument wall type , b.p.handle 3 & 4 , b.p.instument mercuri , b.p.instument mercuri free lcd , b.p.instument mercuri stand modle , baby clothkit 4pcs , baby credle , baby warmer , bad side locker , bain circuit adult , bain circuit child , bandage 2x10m , bandage 2x5m , bandage 3x10m , bandage 3x5m , bandage 4x10m , bandage 4x5m , bandage 6x10m , bandage 6x5m , bandage cutting si , bandage than 18cmx100cm , barbar thared 100no , barbar thared 30no , barbar thared 40no , barbar thared 60no , barbar thared 80no , barium chloride 10% w/v 500 ml , bed pan female s.s. with cover , bed pan female s.s. without cover , bed pan male s.s. with cover , bed sheet single bed(coloured) , bed sheet single bed(white) , bed side locker deluxe s.s.top , bed side screen 4fold , bed side screen cloth , bedsheet double bed(coloured) , bedsheet double bed(white) , benedicts reagent (qualitative) 1000ml , bilirubin (liquistat) 2x100 ml (dmso total & direct auto & manual) , bio bags large (bio hazard bag) , bio bags medium (bio hazard bag) , bio bags small(bio hazard bag) , bio medical west polythin 30 kg. with bio hazard symbol mark (red,black,yellow,blue) , bio medical west polythin 5 kg. with bio hazard symbol mark (red,black,yellow,blue) , bio medical west polythin 60 kg. with bio hazard symbol mark (red,black,yellow,blue) , bio waste trolly with three color buckets , bioles nitries cylander , bioles oxygencylander , biolyse (detergent, deodorant) 35000ml , biomedical disposable waste bag with colour (red, black,blue, yellow ) per piece size 20 lt as per polution control board norm , biomedical disposable waste bag with colour (red, black,blue, yellow ) per piece size 40 lt per polution control board norm , biomedical disposable waste bag with colour (red, black,blue, yellow ) per piece size 60 lt per polution control board norm , biomedical waste collection plastic dustbinfoot pedal large (all colours) , biomedical waste collection plastic dustbinfoot pedal medium (all colours) , biomedical waste collection plastic dustbin foot pedal small (all colours) , bipap , bi phasic defebrillator , black phenyl 1ltr , black phenyl 1ltr jar , blade handle s.s. 3no & 4no , bloodadministration set , blood bag(disposable sterilised) with needle(100 ml) , blood bag with (disposable sterilised) with needle(350 ml) , blood grouping regent anti a 10 ml , blood grouping regent anti b10 ml , blood grouping regent anti d 10 ml , blood grouping regent anti comboa+ b + d3x10ml , blood pressure blader , blood pressure bulb , bob cock forcep 6 , bob cock forcep 8 , body wipes , bougie all size , c.v.p. manometer , calcium 2x50 ml , camer wire all size , camra cover , canada balsam (cytology mountant) 500ml , cannula fixator , capillary tube , carbol fuchsin (zn strong) 500 ml , carmancannula , catheter mount , cervical collar , chair cushion box type , chair cushion cover , cheatal forcep 10 , chest drain catheterfg 16 , chest drainage catheter all size , chinkungunia card , cholesterol total 250ml (wybenga manual with hdl ppt reagent) , ck nac (ifcc) 5x10 ml , codan set , codon filter set , cold/hot pack , colo bag , colostomy kitadult , colostomy kitpaediatric , compounder coat/lab tec /xry tec std size , compunder dress (male) , cord clamp , corrugated drainage sheet , cottan thared , counting chamber , cover slip 18 x 18 mm 10gm , covid self testkit , cpap , cpap/bipapmask tubing , cpap/bipap mask airvent , creatinine ep (liquistat) 25 test (manual end point jaffs) , creatinine fk (kinetic) (liquistat) 2x50 ml , crep bandage 2 , crep bandage 3 , crep bandage 4 , crep bandage 6 , cromic catgut 1 , cromic catgut 1 0 , cromic catgut 2 , cromic catgut 2 0 , cromic catgut 3 , cromic catgut 3 0 , crp turbilatex (quantitative) 50ml , crystal violet (gention violet) 500 ml , csf diluting fluid 100ml , csf protein (liquistat) 2 x 50ml (auto & manual for urine micro proteins) , curtain green redymade , curton cloth rangeen , cvc double lumen , cvc single lumen , cvc triple lumen , cytochrom kit with buffer 2x (modified leishmans stain)500ml , cytology collection kit 50 smears , d & c sat , de colouriser for hematoxylene (1% hcl in a.a.) 500 ml , delivery kit , dengue combo card , dengue igg/igm card , dengue ns1 card , dialater sat 8pcs. , diapers baby , digital b.p cuff , digital hemoglobino meter , digital tourniquet , digital x ray film 10x12 , digital x ray film 11x14 , digital x ray film 14x17 , digital x ray film 8x10 , dilasis cathator double lumen , dilasis cathator triple lumen , dionised water 5 ltr , dipers adult , direct hdl (liquistat) 5x10 ml , direct ldl (liquistat) 5 x 10ml , disposable adis kit , disposable face mask , disposable gown , disposable hme filter , disposable n95 face mask , disposable needle 22,23,24,26 , disposable non wovanbed sheet , disposable nursecap , disposable opration kit , disposable paper gloves , disposable plasticbed sheet , disposable plastic apran , disposable plastic lancet , disposable ppe kit , disposable sharp collection containers 1.5 l , disposable sharp collection containers 5 ltr , disposable shoe cover , disposable sprit swab , disposable sterile gloves 6 , disposable sterile gloves 6 1/2 , disposable sterile gloves 7 , disposable sterile gloves 7 1/2 , disposable surgeon cap , disposable syringe 10ml , disposable syringe 20ml , disposable syringe 2ml , disposable syringe 3ml , disposable syringe 50ml , disposable syringe 5ml , disposable woodan tongue depressor , distilled water5000ml , doctor apron , doctor chair , double oxalate solution 100ml , double stage nitrogen regulator , double stage oxygen regulator , dpx mountant (cytology mountant) 500 ml , drabkins solution with standard (ready to used for hb) 1000ml , dressing forcep plain & toeth 10 , dressing forcep plain & toeth 5 , dressing forcep plain & toeth 6 , dressing forcep plain & toeth 8 , dressing pad 10*10 , dressing pad 10*20 , dressing scissor straight & curved 10 , dressing scissor straight & curved 5 , dressing scissor straight & curved 6 , dressing scissor straight & curved 8 , dressing trolley m.s , dressing trolley s.s , dual testing kit for hiv and syphilis screening, rapid diagnostic test kit(total no. of test 900000),consumable , dust bin 10 ltr. (red,black,yellow,blue) , dust bin 20 ltr. (red,black,yellow,blue) , dust bin 40 ltr. (red,black,yellow,blue) , dust bin, foot operated, metal , dylazer & tubing set for adult , dylazer & tubing set for child , e.n.t sat , easyfix spray (blood smear fixative) 50 ml , ecg 210 x 300 x 200 sheets , ecg electrode , ecg gel 250gm , ecg gel 5kg , ecg machinesix channel , ecg machinethreechannel , ecg machinetwelvechannel , ecg machine single channel , ecg roll50 x 20 mtrs , ecg roll 106 x 20 mtrs , ecg roll 210 x 20 mtrs , ecg roll 215 x 20 mtrs , ecg roll 60 x 15 mtrs , ecg roll 80 mm x 20 mtrs , elastic adhesive bandage 4 x 1mtr , elecrto surgical pencil , elevated calibrator (liquistat) (with multi parameter assigned value) 5ml , endotracheal tube cuffed all size , endotracheal tube plain all size , enema pot(douche sat) , eosin 2% (for hematoxylin stain) 500 ml , eosinophil diluting fluid 100ml , epidural cathator 16 , 18 , epidural kit16 , 18 , epidural needle ng 16 , essence nebulizer (home) , ett intubation stylet , examination gloves , examination table three fold , examination table two fold , extention duo , external catheter male condom cathator , falcon tube , feeding bag , feeding tube fg all size , fetal doppler , fetal monitor , fingartippulse oximeter , fix wakar , flatus tube all size , flaxomatalic endotracheal tube all size , flouride solution (pot.oxalate 5%, flouride 1%) 500 ml , flow cell cleaner (ready to use) 500 ml , fluoride concentrate 150ml (dropping bottle) , folding wakar , foley catheterpaed. 8 , 10 , foley catheter 2 way , foley catheter 3 way , foot stap double , foot stap single , forcep plan pointed 4 , formal saline 5000ml (for histology sample preservation) , formalin chambers 21x 8x 8 three tray , formalin chambers 26x 8x 8 three tray , fouchet’s reagent 150ml , freeze thermometer , front aprin , gamji roll 6x3m. , gamma gt (ifcc kinetic) (liquistat) 2x50 ml , gauze 18x90 super fine , gauze swab10cm x 10cm , gauze swab 7.5cm x 7.5cm , geimsa stain kit 500ml (with buffer 10x & easyfix spray) , gel pack , giglisaw handal , giglisaw wire , glacial acetic acid (2.5 liter) , glass slide , glass test tube 12 x 100 (medium size) , glass test tube 12 x 75 (small size) , glucometer , glucometer strips , guedel airways all size , haemoglobin std (cynmeth) 10ml , hamar with brush , hand hold pulse oximeter , hand wash liquid 500ml , hbsag card , hbsag strip , hcg card , hcg strip , hcv card , head strap for cpap/bipap mask , heamoglobin colour scale book with strip , heamoglobino meter , heamoglobino strip , heamstrips (occult blood strips) , heamtest 200 test (for occult blood with positive & negative control) , heavy duty pallet racks , hematoxylene (harris) 500 ml , hemoglobino strips , hight scale with stand , hiv card , hub cutter needle syring cutter ele. , hub cutter needle syring cutter non ele. , humidifeder bottal , hydrochloric acid n/10 500 ml , hydrochloric alcohol , hygrometer , i.v. set (regular) , i.v.stand , i.v.stand with whill , icu bed delux , idetification tag adult , immersion oil (microscopy grade) dropping bottle25ml , infantometer , infrared digitalthermometer , infusion pump , insulin syringe 100 unit , insulin syringe 40 unit , intera kit 18 ,20 ,22 , intracath 26 , intracath24 , intracathg 14 , intracathg 16 , intracathg 18 , 20 ,22 , intraflong 16 , intraflong 18 , 20 , 22 , intravenous set with airway and needle , iron racks , iron tibc (ferrozin) 2x50 ml , iui cannula , jaundice meter , k3 blood vaccutainer(edta 100 tubes/pkt),consumable [700465] , kehr’s ‘t’ tubefg all size , kellys pad disposable , ketone & glucose strips 100 , kidney tray s.s. 10 , kidney tray s.s. 12 , kidney tray s.s. 6 , kidney tray s.s. 8 , knee cap , kwire all size , labour table 2 lighotomy rod , laringoscop adult 3 blade , laringoscop adult 4 blade , laringoscop bulb , laringoscop peidatric 2 blade , laryngeal mask all size , laryngoscope , led torch , lint cloth 100 gm , lipase (liquistat) 2x25 ml , liquid hand wash 500ml , lugol’s iodine 100 ml , m.v. set 110ml , m.v. set 150ml , m.v.a. cannula all size , m.v.a. kit , macanical wight machine adult , macanical wight machine pedatric , magnesium (calmagite) (liquistat) 5x10 ml , malaria antigen pf/pv card , malicot cathater all size , manual breast pump , masquitoforcep straight & curved 5 , matarnity pad , mattress 5kg cotton 3 ft x 6 ft , mayo scissor 6 1/2 , mayo scissor 8 1/2 , mayos instument trolley , mercury free sphygmomanometer , methylene blue 100 ml , metresses 3x6 with raxine cover 40 density , micro drip set , micro protein (pyrogallol red) 5 x 10ml , micro protein (turbidometry) 2 x 25ml , microanatomy spray fixative 50ml , micropiptte 0 100 fix and variable , micropiptte 100 1000 fix and variable , mini vac set , mob , monitor 2 parameter , mother and child idetification tag , motorized icu bed , mouthgag , mucus extractor , multipara monitor 5 parameter , myner opration tray , napkin sup. quality std size(white) , nasopharyngeal airwayall size , nebulizer , nebulizer kit (adult) , nebulizer kit (child) , nelaton cathetar all size , nibp cuff , nitril powder freeexaminationglovesalll size , non.ster. glovesall size , nylon 1 , nylon 2 , nylon 2 0 , nylon 3 , nylon 3 0 , nylon1 0 , office almirah , office table , opthalmoscope , opticare microscope lens cleaner 150ml , orthipadictourniquet with belt electric , orthipadictourniquet with belt manual , ortho bandage 4x 10m , ortho bandage 6x 10m , over bad trolly adjustable , ovum forcep 10 , oxygen concentration , oxygen cyilnder trolley jambo , oxygen cyilnder trolley medium , oxygen cylander 20cft , oxygen cylander 44cft , oxygen cylander jambo , oxygen cylander key , oxygen flow meter , oxygen hood (l)10x 8x 9 , oxygen hood (m)8x 7x 9 , oxygen hood (s) 6x6x6 , oxygen mask (adult) , oxygen mask (child) , oxygen nasal cannula (child) 2 mtr , pap sumer kit , papanicolaou ea 36 500 ml , papanicolaou ea 65 500 ml , papanicolaou og 6 500 ml , paper tape 5cm x 9mtr , paper tape10cm x 9mtr , paper tape 2.5cm x 9mtr , paper tape 7.5cm x 9mtr , paraffin strip roll , paraffin wax 58° 60°c with cerecin 1kg , patient body wipes , patient dress paint shirt , patient gown , pead. urine bag 100ml , pediatric jacson rees system , peritoneal dialysiscatheter set adult , peritoneal dialysiscatheter set child , peticote blauge cloth shuti rangeen , ph meter , phosphorus (end point) new (liquistat) 2 x 50ml , phototheraphy , pipette bulb , plain rubber catater all size , plaster of paris 410x2.7mtr , plaster of paris 6 15x 2.7mtr , plastic kidny tray 8 , plastic kidny tray 10 , plastic kidny tray 12 , plastic sputom cap , plastic urin pot male , platelet diluting fluid 100 ml , plstic bad pan , plstic urin pot femail , portable suction machine , portneb handheld nebulizer , post mortem sat , powderd examinationgloves all size , power drool , prep razor , presaure monitiring line all size , pressure monitering kit , procto scopes,m,l, , re breathing bag , respirometer , reticulocyte counting 25ml , revolving stool , right angle forcep 8 , right angle forcep 9 1/2 , romo drain bag , romo vac set all size , room thermometer , ryles tube all size , s.s autoclove 12 x 12 , s.s. bad pan female w/o cover , s.s. bad pan female with cover , s.s. bad pan male with cover , s.s. bowel 10cm , s.s. bowel 12cm , s.s. bowel 14cm , s.s. bowel 16cm , s.s. bowel 20cm , s.s. fumigater5liters , s.s. urinal female , s.s. urinal male , s.s.autoclove 12 x 20 , s.s.catheter tray 17 x 6 x 4 , s.s.catheter tray 8 x 5 x 3 , s.s.dressing drums (jointed)6x6 , s.s.dressing drums (jointed)9x9 , s.s.dressing drums (jointed) 11x 9 , s.s.dressing drums (jointed) 12x10 , s.s.dressing drums (jointed) 15x12 , s.s.fogar , s.s.sterilizer 10 x 5 x 3 , s.s.sterilizer 14 x 6 x 4 , s.s.sterilizer 16 x 6 x 4 , s.s.sterilizer 18 x 8 x 6 , s.s.sterilizer 20 x 8 x 6 , s.s.tray w/o cover new born baby , s.s.tray with cover 10 x 8 , s.s.tray with cover 12 x8 , s.s.tray with cover 12x 10 , s.s.tray with cover 14 x10 , s.s.tray with cover 15 x 12 , s.s.tray with cover 18 x12 , s.s.tray with cover 8 x6 , s.s.tray with cover 9 x6 , safranine 0.5% w/v (grams) 500 ml , sanatry napkeen , scalp vein set all size , scissor cutical 4 , scott’s tap water substitute 100 ml , semen diluting fluid 100 ml , sgot (manual dnph) 30 tests , sgpt (manual dnph) 30 tests , silicon ambubag adult , silicon ambubag neonatal , silicon ambubag peidiatric , silicon foley catheter 2 way , silicon mask all size , silicon ventouse cup with release valve , silk 1 , silk 2 , silk 2 0 , silk 3 , silk 3 0 , silk thared , silk1 0 , simple camood chair , simple camood stool , single stage nitrogen regulator , single stage oxygen regulator , single walking stik , skin grafting blade , skin grafting blade handle , skin marker pan , sod / pot / chlo (liquistat)( u. acetate / stpb / thiocynate ) 3 x100ml , sodium (phosphonazo iii) new (liquistat) 2 x 50ml , sodium citrate 3.2% w/v 100 ml , sodium citrate 3.8% w/v 500 ml , sodium hypochlorite 5000ml , solid linen trolley , spinal needleall size , spirit lamp , sponge holding forcep 10 , sponge holding forcep 8 , sputum cup with sticker 30ml , sputum cup with sticker 50ml , ster. surgical glovesall size , sterile blade with handle all size , stracher meter , stretchre on trolley , stumach wash tube , sture needle 1/2 circle cutting , sture needle r.b. 1/2 circle , sture needle straight , suction catheter plain all size , suction catheter thamb cantrolall size , suction handal , suction machine double bottle , suction set , suction tube (roll of 10 mtr) , sulphosalicylic acid 3% w/v 500 ml , sulphosalicylic acid 30 % w/v 500 ml , sulphuric acid 20% v/v 500 ml , supra cath all size , surgical bladeall size , surgical spirit 100 ml bottle , surgical spirit 500 ml bottle , suture stitch cutting scissor teeth , syphilis card , syphilis strip , syringe pump , table cloth rangeen , tape roll , tds meter , tericot sharee , test tubebrush , therm0meter digital , therm0meter ovel , therm0meter round , thermacol box , thermometer rectal , thomas splint all size , three way cannula all size , three way ext. tube all size , three way stop cock , tips for auto pipettes 2 to 100 micro litres , tips for auto pipettes 200 to 1000 micro litres , tips for auto pippetes 10 to 100 micro litres , tissue paper roll(each),consumable , toomy syringe , total protein & albumin 2 x100ml (biuret & bcg ) (liquistat) , tourniquet belt , towel clip , tracheostomy filtor , tracheostomy tube (cuffed) all size , tracheostomy tube (plain) all size , tri pot stik , triangular bandage 90cm x 90cm , triglycerides (enz. end point) (liquistat) 2x50 ml (enz. end point) (liquistat) , trocar catheterall size , troponin card , tur set , typhoid card igg/igm , typhoid test card(an immunochromatography assay for the rapid visual detection of typhoid antibody igg/igm in human serum/plasma)(50 test per pack),consumable [987739] , ultrasonic nebulizer , ultrasound gel 250gm , ultrasound gel 5kg , under pad sheet , universal cleaner 10 ltrs. (compatible with all 3 parts 18 23 parameter hematology counter) , universal diluent 10 ltrs. (compatible with all 3 parts 18 23 parameter hematology counter) , universal wash 100ml (compatible with all 3 parts 18 23 parameter hematology counter) , urea (gldh) (liquistat) 5 x 10ml , urea (ned) (liquistat) 4 x 50ml , urea dam (with extended linearity) reagent 1 x 100ml , urea h. p. (berthelot) 100 ml , urethral catheter k90 , k91 , uric acid (end point) (liquistat) 4 x 50 ml , urine albumine/sugar strip , urine bile pigment kit 250 test , urine collecting bag , urine collecting bag leg bag set , urometer adult , usg papers glosy , usg papers non glosy , vaporiser , vein finder , ventilator circuit double water trap , ventilator circuit plain , ventilator circuit single water trap , vicril 2 , vicril1 0 , vicril2 0 , vicril3 , vicril3 0 , vicril 1 , video colposcope , visitor stool , viwe box double film , viwe box singal film , ward bad deluxe , ward bad fowler , ward bad genral , ward bad samifowler , wash basin stand double , wash basin stand single , water bad , water bed , water wipes , wbc diluting fluid 500 ml , wheel chair , who hemoglobin color scale (starter kit) components (1) colour scale 01/kit (2)test strip 1000/kit (3) printed literature for method of use/kit (4)lancet 1000/kit 10x100(nabl/cap accrediated lab test certificate for the batch no. must be enclosed with each supply delivered),consumable [mis145] , widal test kit , wight machine digitaladult , wight machine pedatric digital modle , wiper , wright’s stain with buffer 2x100 ml (gold standard) , x ray casettedigital10x 12 for fuzi make machine 150 sheet , x ray casettedigital11x 14 for fuzi make machine 150 sheet , x ray casettedigital14x 17 for fuzi make machine 100 sheet , x ray casettedigital8x 10 for fuzi make machine 150 sheet , x ray tablecomplete , x ray casette 10x12 , x ray casette 12x15 , x ray casette 6.5x8.5 , x ray casette 8x10 , x ray chest stand floor mounted , x ray chest stand wall mounted , x ray dark room safe light , x ray developer 13.5ltr , x ray developer 22.5ltr , x ray developer 9ltr , x ray developing tank 22.5ltr , x ray developing tank 9ltr , x ray film 10x12 packet of 50 sheet , x ray film 12x12 packet of 50 sheet , x ray film 12x15 packet of 50 sheet , x ray film 6.5x8.5 packet of 50 sheet , x ray film 8x10 packet of 50 sheet , x ray film digital 10x12 packet of 150 sheet , x ray film digital 11x14 packet of 150 sheet , x ray film digital 14x17 packet of 150 sheet , x ray film digital 8x10 packet of 150 sheet , x ray film drying rack for 12 film , x ray fixer13.5 ltr , x ray fixer13.5 ltrtank , x ray fixer 22.5ltr , x ray fixer 9 ltr , x ray hanger s.s. 10x12 , x ray hanger s.s. 12x15 , x ray hanger s.s. 6.5x8.5 , x ray hanger s.s. 8x10 , x ray lad aprine , x ray lad lets , x ray lad number , x ray lead appron , x ray lead gloves , x ray lead letter 0 9 , x ray lead letter a z , x ray lead partition with lead glass , x ray machine 100 ma digital complete set portabel , x ray machine 100 ma manual complete set , x ray machine 300 ma digital complete set , x ray machine 300 ma manual complete set , x ray machine 60 ma digital complete set , x ray machine 60 ma manual complete set , x ray screen kiran h.s. 10x12 , x ray screen kiran h.s. 12x15 , x ray screen kiran h.s. 6.5x8.5 , x ray screen kiran h.s. 8x10 , x ray screen kiran kg 4 10x12 , x ray screen kiran kg 4 12x15 , x ray screen kiran kg 4 6.5x8.5 , x ray screen kiran kg 4 8x10 , x ray view box med. two tubelight , size 24x24 , x ray view box med. two tubelight , size 36x24 , zig zag cottan 500gm , zipper polybag , pop powder 1kg...

Department of Health Research - Madhya Pradesh

38329946 bids are invited for laboratory chemicals glacial acetic acid 2.5l atc , methanol 25l normal grade , hcl 1l normal , h2so4 500ml normal , sodium phosphate dibasic 1kg , sodium phosphate monobasic anhydrous 1kg , tris base 2kg , pbs tablets 200 x 100ml , kcl 500gm , nacl 5kg , sds 5kg , activated charcoal powder 2kg , edta 2kg , ammonium persulfate mb grade 100gm , temed mb grade 100ml , sarcosyl mb grade 25gm , paraformaldehyde pfa , silver nitrate mb grade 25gm , triton x 100 mb grade 500 ml , sodium hydroxide pellets mb grade 500 gm , sodium carbonate mb grade 500gm , sodium bicarbonate mb grade 500gm , glycerol 5 l , tween 20 mb grade 100ml , luria broth 500gm , agar agar 500gm , agarose low melting mb grade 100gm , skimmed milk powder mb grade 500gm , magnesium chloride anhydrous mb grade 100gm , 2 propanol ar grade 25l , propidium iodide mb grade 25mg , glycine mb grade 5kg , sucrose mb grade 500gm , coomassie brilliant blue r 250 100gm , coomassie brilliant blue g 250 25gm , imidazole mb grade 100gm , 2 mercapto ethanol mb grade 100ml , ponceau s stain mb grade 250ml , butanol mb grade 500ml , calcium chloride dihydrate 500gm 1665 , xylene cyanol mb grade 5gm , urea mb grade 500gm , ortho phosphoric acid 500 gm , oxalic acid dihydrate hi ar 500gm total quantity : 44...

Bhopal Gas Tragedy Relief and Rehabilitation - Madhya Pradesh

38275122 tender of supply of medicines , tablet , tab. aceclofenac 100mg , tab. aceclofenac 100mg + paracetamol 500mg , tab. aceclofenac 100mg + paracetamol 325mg + serratiopeptidase 15mg , tab. aceclofenac + thiocolchicoside ( 100mg+8mg ) , tab. acenocoumarol ( 1 mg ) , tab. acyclovir 800mg , tab. albendazole 400mg , tab. alprazolam 0.25mg , tab. alprazolam 0.50mg , tab. amiodarone 100mg , tab. amlodipin 5mg , tab. amlodipin 10mg , tab. amoxycillin 250mgand clavulanic acid 125mg , tab. amoxycillin 500mgand clavulanic acid 125mg , tab. amoxycillin dispersible 125mg , tab. ampicillin 125mg , tab. antacid chewable containing aluminium hydroxide equivalent to dried gel 250mg + magnesium hydroxide 250mg + simethicone 50mg , tab. ascorbic acid ( vitamin c ) 500mg , tab. aspirin i.p.75mg , tab. aspirin i.p.150mg , tab. atenolol50mg , tab. atorvastatin 10mg , tab. atorvastatin 10mg + asprin 75mg , tab. atorvastatin 10mg + asprin 150mg , tab. atorvastatin 10mg + cholecalciferol 1000 iu , tab. atorvastatin 10mg + ezitemibe 10mg , tab. atorvastatin 20mg , tab. azilsartan 40mg , tab. azithromycin 250mg , tab. azithromycin 500mg , tab. azithromycin 250mg + cefexime 200mg , tab. betahistine 8mg , tab. betahistine 16mg , tab. bisoprolol + amlodipin 2.5mg+5mg , tab. bisoprolol 2.5mg , tab. bisoprolol 5mg , tab. calcium acetate ( 667 mg ) , tab. calcium citrate 1000mg ( elemental calcium equivalent to 250mg and vitamin d3 400 iu ) , tab. calcium carbonate ( 1250mg ) , vit d 3 ( 500mg ) , methylclobalamin ( 1500mcg ) , l methylfolate calcium ( 1mg ) + pyredoxal 5 phosphate ( 20mg ) , tab. calcium with vitamin d usp ( calcium carbonate 1.25g eq. to elemental calcium 500mg and cholecalciferol usp 250iu ) , tab. calcium 3 methyl 2 oxo valerate calcium 4 methyl 2 oxo valerate calcium 2 oxo 3 phenylproinate calcium 3 methyl 2 oxo – butyrate calcium dl 2 hydroxy 4 butyrate l lysine acetate l threonine l tryptophan l histidine l tyrosine total nitrogen content calcium 1.25 mmol , tab. carbamazepin 200mg , tab. canagliflozin 100 mg , tab. carvedilol 3.125mg , tab. carvedilol 6.250mg , tab. cefadroxyl 250mg , tab. cefadroxyl 500mg , tab. cefixime 200mg , tab. cefixime 200mg + clavulanic acid 125mg , tab. cefuroxime 500mg , tab. cepodoxamine 200mg , tab. cepodoxamine 200mg + clavulanic acid 125mg , tab. cepodoxamine 200mg + ofloxacin 200mg , tab. cetirizine 10mg , tab. chlorine based compound ( sodium di choloroisocyanurate ) nadcc 75mg with available chloroine 45mg bis , tab. chlorpheniramine maleate 4mg , tab. chymotrypsin + trypsin ( 20000 iu + 100000 iu ) , tab. cilostazol 50mg , tab. chlorthalidone 3.25mg , tab. chlorthalidone 6.25mg , tab. chlorthalidone 12.5mg , tab. cinarizine 25mg , tab. cinarizine 75mg , tab. ciprofloxacin 250mg , tab. ciprofloxacin 500mg , tab. ciprofloxacin 750mg , tab. ciprofloxacin 500mg + tinidazole 600mg , tab. citecoline 500mg , tab. clarithromycin 500mg , tab. clinidepine 5mg , tab. clinidepine 10mg , tab. clobazam 10mg , tab. clonazepam 0.5 mg , tab. clopidogrel 75mg , tab. clopidogrel 75mg + aspirin 75mg , tab. clopidogrel + aspirin ( 75 mg + 150 mg ) , tab. corbis 6.5 mg , tab. dexamethasone 0.5mg , tab. depgliflozin 10mg , tab. diclofenac 50mg , tab. diclofenac 100mg sustained release , tab. diclofenac 50mg + paracetamol 325mg , tab. diclofenac 50mg + serrtiopeptidase 10mg , tab. diclofenac sod. 50mg+ paracetamol 325mg+ serriopeptidase 10mg , tab. diclofenac 50mg + paracetamol 325mg + chlorzoxazone 500mg , tab. dicyclomine 20mg , tab. digoxin 0.25mg , tab. dilitiazem 30mg , tab. dilitiazem 60mg , tab. divalproex sodium extended release 500mg , tab. dolepazilmementile 5mg , tab. domperidone 10mg , tab. doxofylline 400mg , tab. empagliflozin 25mg , tab. erythromycin stearate 250mg , tab. escitalopram 10mg , tab. escitalopram 10mg + clonazepam 0.5mg , tab. ethamsylate 500mg , tab. etiophylline ( 77mg ) + theophylline ( 23mg ) , tab. etorocoxib 90mg , tab. febuxostat 40mg , tab. ferrous ascorbate 100mg & folic acid 1.5mg , tab. fexofenadine 120mg , tab. fexofenadine 180mg , tab. fexofenadine + montelukast 120mg / 10 mg , tab. fluconazole 150mg , tab. flunerizine 5mg , tab. flunerizine 10mg , tab. folic acid 5mg , tab. frusemide 40mg , tab. frusemide 20mg + spironolactone 50mg , tab. gabapantin 300mg + methacobalamin 500mg , tab. gemigliptin 50mg + metformin 500mg , tab. glicazide 60mg extended release , tab. gliclazide 80mg , tab. glimepride 1mg , tab. glimepride 2mg , tab. glimepride 1mg + metformin 500mg , tab. glimepiride 2mg + metformin500 mg ( sr form also acceptable ) , tab. glyceryl trinitrate 2.6mg , tab. hydrochlorothiazide 12.5mg , tab. hyoscine butylbromide 10mg , tab. ibprofen 400mg + paracetamol 325mg , tab. ibuprofen 200mg , tab. ibuprofen 400mg , tab. iron and folic acid enteric coated tab dried ferrous sulphate equ. to ferrous iron 100mg and folic acid 0.5mg , tab. isosorbide dinitrate 5mg , tab. isosorbide mononitrate 20mg , tab. isosorbide mononitrate 30mg , tab. isoxsuprine 10mg , tab. ivabradine 5mg , tab. ivabradin 10mg , tab. ivermectin usp 6mg , tab. lactic acid bacillus ( 60 million spores ) , tab. levetiracetam 500mg , tab. levocetrizine 5mg , tab. levocetrizine 5mg + montelucost10mg , tab. levocetrizine 10mg , tab. levocornitin 500mg , tab. levofloxacin 500mg , tab. linagliptin 2.5mg + metformin 500mg , tab. linagliptin 5mg , tab. lisinopril 5mg , tab. lorazepam 2mg , tab. l ornithine l aspartate 150mg , tab. losartan 25mg , tab. losartan 50mg , tab. losartan 50mg + hydrochlorthiazide 12.5mg , tab. mefanamic acid 250mg + dicyclomin 20mg , tab. metformin 500mg , tab. metformin 1000mg sustained release , tab. methycobalamin 500mcg , tab. methycobalamin 1500mcg , tab. methylcobalamin 1500mcg + pregabalin 75mg , tab. pregabalin 75 mg + methylcobalamin 750 mcg , tab.pregabalin 75 mg + nortriptyline 10 mg , tab. methyl prednisolone 16mg , tab. metoclopramide 10mg , tab. metoprolol 50mg , tab. metoprolol succinate 47.5mgeq. to metoprolol tartrate 50 mgextended release + telmisartan 40 mg , tab. s metoprolol succinate 11.88mg eq. tos metoprolol 12.5mg prolonged release 12.5 mg , tab. s metoprolol succinate 23.75mg eq. tos metoprolol 25mg prolonged release 25 mg , tab. s metoprolol succinate 47.50 eq. tos metoprolol 50mg prolonged release 50 mg , tab. metronidazole 200 mg , tab. metronidazole 400mg , tab. moxonidin 0.3mg , tab. multivitamin sugar coated nfi formula , tab. mycophanolate 360mg , tab. mycophanolate 500mg , tab. n acetylcysteine 600mg , tab. nicoumalone 1mg , tab. nicoumalone 2mg , tab. nicoumalone 4mg , tab. nitrofurantoin 100mg , tab. nitroglycerine 2.6mg , tab. nitroglycerine 6.5mg , tab. norfloxacin 400mg + tinidazole 600mg , tab. norfloxacin 400mg , tab. ofloxacin 200mg , tab. ofloxacin 400mg , tab. ofloxacin 200mg + tinidazole 600mg , tab. ofloxacin 200mg + ornidazole 500mg , tab. olmesartan 20mg , tab. ondansetron 4 mg , tab. paracetamol 500mg , tab. paracetamol 650 mg , tab. paracetamol 500mg + chlorpheniramine 2mg + phenylephrine 10mg , tab.paracetamol 325 mg + tramadol hydrochloride +37.5mg , tab. paroxetin 12.5mg sustained release , tab. pentaprazole 40mg , tab. pentaprazole 40mg + domperidone 10mg , tab. phenytoin sodium 100mg , tab. pioglitazone 15mg , tab. piracetam 800mg , tab. prazocin 5mg , tab. propanolol 10mg , tab. rabeprazole 20mg , tab. rabeprazole 20mg + domperidone 10mg , tab. ramipril 2.5mg , tab. ramipril 5mg , tab. ranitidine 150mg , tab. renolazine 500mg , tab. resperidone 1mg , tab. rifaximin 400mg , tab. rivaroxaban 2.5mg , tab. rivaroxobon 20mg , tab. rivaroxaban 10mg , tab. rosuvastatin 10mg , tab. rosuvastatin 20mg , tab. roxithromycin 150mg , tab. salbutamol 4mg , tab. sacubitril ( 24mg ) + valsartan ( 26mg ) 50mg , tab. sacubitril ( 49mg ) + valsartan ( 51mg ) 100mg , tab. s amlodepine 5mg , tab. selevimir 800mg , tab. serratiopeptidase 10mg , tab. sertalin 50mg , tab. sexagliptin 5mg , tab. sirolimus 1 mg , tab. sitagliptin 100mg , tab. sitagliptin 50mg + metformin 500mg , tab. sitagliptin 50mg , tab. sodium bicarbonate 500mg , tab. sodium valporate + valproic acid cr 200mg , tab. sodium valporate + valproic acid cr 500mg , tab. sodium valproate 200mg , tab. spironolactone 25mg , tab. spironolactone 50mg + frusemide 20mg , tab. sumitriptan 50mg , tab. tacrolimus 0.50mg , tab. tacrolimus 1mg , tab. tacrolimus 2mg , tab. tamsulosin 0.4mg , tab. tamsulosin 0.4mg + dutasteride 0.5mg , tab. telmisatran 20mg , tab. telmisatran 40mg , tab. teneligliptin 20mg , tab. teneligliptin 20mg + metformin 500mg , tab. thyroxine sodium 25mcg , tab. thyroxine sodium 50mcg , tab. thyroxine sodium 75 mcg , tab. thyroxine sodium 100mcg , tab. ticagrelor 90mg , tab. tolvaptan 15mg , tab. torsemide 10mg , tab. toresamide 20mg , tab. toresamide 40mg , tab. tramadol 50mg , tab. tranexamic acid 500mg + mefenamic acid 250mg , tab. trihexyphenidyl 2mg , tab. trimetazidine 20mg , tab. trimetazidine 35mg sr , tab. trimetazidine 60mg sr , tab. ursodeoxycholic acid 300mg , tab. vildagliptin 50mg , tab. vildagliptin 50mg + metformin 500mg , tab. vildagliptin 50mg + metformin 1000mg , tab. vit. b1 10mg, vit. b2 10mg, vit. b6 3mg, vit. b12 15mcg, niacinamide 100mg, calcium panthenol 50mg, folic acid 1.5mg, vit. c 150mg, biotin 100 mcg. or more , tab. vitamin. b complex nfi ( prophylactic ) , tab. voglibose 0.3mg , tab. zinc sulphate dispeible contains zinc sulphate ip eq. to elemental zinc 20mg , capsule , cap. aceborophylline 100mg , cap. alfacalcidol 0.25mcg , cap. alfacalcidol 0.25mcg + calcium 200mg , cap. amoxicillin 250mg , cap. amoxycillin 250mg + cloxacillin 250mg , cap. amoxycillin 250mg + lactic acid bacillus 60 million spore , cap. amoxycillin 500mg + lactic acid bacillus 60 million spore , cap. amoxycillin 500mg , cap. ampicillin 250mg , cap. ampicillin 500mg , cap. b carotene, zinc sulphate monohydrate, selenium dioxide, manganese & copper , cap. calcitriol 0.25mcg , cap. cephalexine 250mg , cap. cholecalciferol ( vitamin d3 60000iu ) , cap. cyclosporin 25mg , cap. doxycycline 100mg , cap. glucosamin 1500mcg + methyl sulfonyl methane 100mg + dicerine 50mg , cap. itraconazole 100mg , cap. methycobolamin, alpha lipoic acid, folic acid, pyridoxine , cap. nifedipine 5mg ( sublingual ) , cap. omeprazole 20mg , cap. omeprazole 40mg , cap. omeprazole + domperidone 20 mg + 10 mg , cap. pregabalin 75mg , cap. probiotic each capusle contains lactobacillus ( rhamunousus gr 1 & lactobacillus reuteri rc 14 1 billion ) , cap. salmeterol 50mcg + fluticasone 250 mcg , cap. salmeterol 50mcg + fluticasone 500 mcg , cap. silodosin 4mg , cap. silodosin 8mg , cap. silodosin 4mg +dutasteride 0.5mg , cap. vitamin e 400mg , syrup, suspension& paed. drop , syp. ambroxol hcl 15mg + terbutaline sulphate 1.25mg + guaiphenesin 50mg per 5ml , syp. amoxycillin 200mg + clavulanic acid 28.5mg per 5ml , syp. amoxycillin 250mg + cloxacillin 250mg / 5ml , syp. ampicillin dry powder 125mg each 5ml , susp. azithromycin suspension 200mg / 5ml , syp. b complex ( nfi formula ) each 5ml contains vit.b1 2mg, vit.b2, 2mg, vit. b6 0.5mg, niacinamide 25mg, calcium pantothenate 1mg , syp. bromhexine 4mg, guaiphenesin 50mg, terbutaline sulphate 1.25 mg / 5ml , syp. calcium carbonate 2.5mg / 5ml , syp. cefixime 50mg / 5ml , syp. cephalexine each 5ml contains 125mg , syp. cetrizine 2.5 mg / 5ml , syp. cyprohepatidine hydrochloride ip 2mg each 5ml , syp. cyprohepatidine hydrochloride ip 2mg each 5ml + tricholine , syp. di sodium hydrogen citrate1.4gm each 5ml , syp. elemental iron & folic acid ( as per the standards provided 5ml 100mg ) , syp. etiophylline and theophylline paediatric 5ml contains etiophylline 46.5mg and theophylline 14mg , syp. glycerol i.p. , syp. ibuprofen 100mg + paracetamol 125mg , syp. iodised peptone 0.322mg ( equivalent to 33 mcg of lodine ) , magnesium chloride ip 6.67mg ( equivalent to 0.8 mg of magnesium ) , manganese sulphate bp 1.33 mg ( eq. to 0.33 mg of manganese ) , sodium metavanadate 0.22mg. zinc sulphate ip 10.71 mg ( eq. to 2.5mg of zinc ) , pyrodoxine hydrochloride ip 0.25 mg cyanocobalamin ip 0.167 mcg, nicotinamide ip 3.33 mg, ethanol ( 95% ) ip 0.317 ml. syrup 300 ml ) , syp. lactulose 3.35 gm / 5ml , syp. mebendazole 100mg each 5 ml , syp. mg ( oh ) 2, simethicone, sodium carboxymethylcellulose & driied al ( oh ) 3 , syp. ondanesteron 2mg / 5ml , syp. paracetamol 125 mg / 5ml , syp. paraffin liquid ( liquid paraffin 1.25ml + milk of magnesia 3.75ml + sodium picosulphate 3.33ml ) , syp. pepsin, papain, vitamin b1, vitamin b2, vitamin b6, niacinamide, d panthenol , syp. potassium chloride each 15ml contains: 20 meq of potassium chloride , syp. salbutamol2mg / 5ml , syp. tricholine citrate & sorbitol , susp. albendazole suspension 200mg / 5ml 10ml bottle , susp. amoxicillin suspension 125mg / 5ml , susp. colistine sulphate 12.5mg , susp. domperidone contains domperidone ip 5mg / 5ml , susp. metronidazole benzoate oral 100mg of base / 5ml , susp. sulfamethoxazole and trimethoprim each 5ml 200mg + 40mg , dicyclomine drop 10mg / ml , domperidone drops 10mg / ml , multivitamin drops ( approx 22 drops ) each ml contains vit a 3000 iu vit b1 1mg riboflavin phosphate sodium 2mg, panthenol 2.5mg niacinamide 10mg pyridoxin 1mg cynacobalmin 1mcg lycine 10mg 15ml , paracetamol paed. drop 100mg / ml , injection , inj. adrenaline 1mg / ml , i / v. amino acid ( composition ) 7% ( acetyicysteine0.050g+glacial acetic acid ph. eur0.138g+glycine ph. eur. 0.320g+l alanine ph.eur. 0.630g+ l arginine ph. eur. 0.490g+l cysteine ph. eur. 0.037g+l histidine ph.eur. 0.430g+l isoleucine ph.eur. 0.510g+l leucine ph. eur. 1.030g+l lysine 0.71g+l lysine monoacetate u.s.p1.001g+l malic acid dab 1997 ( 0.150g ) +l methionine ph.eur0.280g+l phenylalanine ph. eur. 0.380g+l proline ph. eur0.430g+l serine ph. eur. 0.450g+l threonine ph. eur. 0.480g+l tryptophan ph.eur. 0.190g+l valine ph.eur. 0.620g+theoreticalosmolarity 645 mosm / l+total amino acids 70.0g / l+total energy 1210kj / l ( 280kcal / l+total nitrogen 10.8g / l+water for injections ph.eur q.s. ) , i / v. amino acid ( composition ) 7% ( acetyicysteine0.050g+glacial acetic acid ph. eur0.138g+glycine ph. eur. 0.320g+l alanine ph.eur. 0.630g+ l arginine ph. eur. 0.490g+l cysteine ph. eur. 0.037g+l histidine ph.eur. 0.430g+l isoleucine ph.eur. 0.510g+l leucine ph. eur. 1.030g+l lysine 0.71g+l lysine monoacetate u.s.p1.001g+l malic acid dab 1997 ( 0.150g ) +l methionine ph.eur0.280g+l phenylalanine ph. eur. 0.380g+l proline ph. eur0.430g+l serine ph. eur. 0.450g+l threonine ph. eur. 0.480g+l tryptophan ph.eur. 0.190g+l valine ph.eur. 0.620g+theoreticalosmolarity 645 mosm / l+total amino acids 70.0g / l+total energy 1210kj / l ( 280kcal / l+total nitrogen 10.8g / l+water for injections ph.eur q.s. ) , inj. alpha beta arteether 150mg / 2ml , inj. amikacin 100mg / 2ml vial , inj. amikacin 250mg / 2ml , inj. amikacin 500mg / 2ml , inj. aminophylline25 mg / ml , inj. amoxycillin and potassium clavulanate i.p. 1gm + 0.2 gm / 10 ml vial , inj. ampicillin 500 mg / vial , inj. anti d immunoglobulin ( monoclonal ) 300mcg , inj. artemether 80mg each 1 ml , inj. atropine sulphate 0.6 mg / ml sc / im / iv , inj. azithromycin ( 500 mg / 5ml ) , inj. balanced salt solution ( bss for ophthalmic use ) , inj. betamethasone sodium phosphate ( betamethasone sodium phosphate equal to 4mg of betamethasone 1ml amp ) , inj. biphasic human insulin 30 / 70 cartiridge ( 30% soluble insulin & 70% isophane insulin ) 40 iu / ml , inj. bupivacaine 0.5% , inj. bupivacaine hydrochloride heavy 0.5% 4ml amp , inj. calcium gluconate i.p. 10%w / v , inj. carboprost tromethamine 250mg , inj. cefotaxim 1gm + sulbactum 500mg , inj. cefotaxime 1gm , inj. cefotaxime 250mg , inj. cefotaxime 500mg , inj. ceftriaxone 1gm , inj. ceftriaxone 1000mg + sulbactam 500mg , inj. ceftriaxone + tazobactum ( 1gm+125mg ) , inj. ceftriaxone 250mg , inj. cefuroxime 1.5gm , inj. chloroquine phosphate 40mg / ml , inj. chlorpheniramine maleate 10mg / ml 10ml vial , inj. ciprofloxacin 100 mg / 50ml , inj. clindamycin 600mg ( 150mg / ml ) , inj. cyanocobalmin ( vitamin b12 ) ip 500mcg / ml , inj. darebepoetin 25mg , inj. darebepoetin 40mg , inj. degludec 3ml ( 100 iu / ml ) cartridge with pen , inj. dexamethasone sodium phosphate 8mg , inj. dextrose 5% , inj. dextrose 10% , inj. dextrose 25% , inj. dextrose 50% , inj. dextrose with normal saline 5%+ 0.9% , inj. diazepam 5mg / ml , inj. diclofenac sodium 25mg / ml , inj. dicyclomine 10 mg / ml , inj. dilitizem 5mg / ml , inj. dobutamine 50gm / ml , inj. dopamine ­ 40 mg / ml , inj. electrolyte p , inj. enoxaparin 40mg equivalent to­ 4000 iu , inj. enoxaparin 60mg equivalant to­ 6000 iu , inj. erythropoiten 4000 iu , inj. erythropoiten 6000 iu , inj. erythropoiten 10000 iu , inj. essential amino acid ( l isoleucine 5.1g, l leucine10.3g, l lysine 7.1g ) , inj. ethamsylate 250mg , inj. etiophylline and theophylline 220mg / 2ml , inj. frusemide 10 mg / ml , inj. gentamicin 40 mg / ml , inj. glargine 1.5ml ( 300 iu / ml ) cartridge , inj. glargine kit. ( pen with cartridge ) , inj. heparin 5000iu each ml equ. to 25000iu / 5ml , inj. human albumin 20% , inj. human insulin biphasic 25 / 75100iu / ml cartridge withpermanent pen & 5 needle 32 guage , inj. hyaluronidase 1500 iu , inj. hydrocortisone sodium succinate 100mg / vial , inj. hydroxy methyl propyl cellulose pfs , inj. hyoscine butylbromide ­ 20mg / ml , inj.insulin lispro monocomponent insulin 100 iu / ml cartridge ( recombinant dna origin ) , inj. insulin soluble ( regular ) 40 iu / ml vial , inj. insulin aspart cartridge 30 / 70 , inj. insulin aspart faster acting 100 iu / ml 3ml pen fills , inj. insulin degludeg 70% + insulin aspart 30% 100 iu / ml 3ml pen fills , inj. intracameral adrenaline tartarate 1:1000 for subcutaneous & intravenous ( for opthalmic use ) , inj. iron sucrose usp 100 mg / 5ml , inj. ketamine 50 mg / ml , inj. levocarnitine 1gm , inj. levofloxacin 500 mg / 100mlffs / bfs , inj. lignocaine 10% topical aerosol spray , inj. lignocaine 2% ( 21.3mg / ml ) , inj. lignocaine 2% + adrenaline 5mcg , inj. lignocaine 4% topical , inj. linezolid 200mg / 100ml , inj. lispro cartridge 25 / 75 ( 100 unit / ml ) , inj. l ornithine + l aspartate 5gm , inj. mannitol 20% 100 ml bottle , inj. meropenom 1000 mg , inj. methycobolamine 1500mcg ( 500 mcg per ml ) , inj. methyl ergometrine 0.2mg / ml , inj. methyl prednisolone sodium usp 500mg , inj. metoclopramide 5mg / ml , inj. metronidazole 500mg / 100ml , inj. midazolam 1mg / ml , inj. multi vitamin , inj. nandrolone deconate 25mg , inj. nandrolone deconate 50mg , inj. nandrolone deconate 100mg , inj. nikethamide 5mg / ml , inj. nitroglycerine usp 25 mg / 5ml , inj. nor adrenaline , inj. ondansetron ( 2mg / ml ) , inj. oxytocin 5 iu / ml , inj. pantoprazole 40mg , inj. paracetamol 150mg / ml , inj. paracetamol 150mg / ml , inj. paracetamol 1000mg i v infusion ( 100 ml ffs bottle ) , inj. pentazocin lactate 30mg / ml , inj. pheniramine maleate 22.75mg / ml , inj. phenytoin sodium 50 mg / ml , inj. phytonadione usp ( vitamin k1 ) 10mg / ml , inj. pilocarpine 0.5% intracameral ( preservative free ) , inj. piperacillin 4gm + tazobactum 0.5gm , inj. promethazine 25mg / ml , inj. propofol 1% ( 10mg / ml ) , inj. ranitidine 50mg / 2ml , inj. ringer lactate , inj. sodium bicabicarbonate , inj. sodium chloride 0.9% 100ml bottle , inj. sodium chloride 0.9% 500ml bottle , inj. sodium chloride 3% ( hypertonic saline ) , inj. streptokinase 1, 500, 000 iu , inj. terlipressin 1mg , inj. tetnous toxide , inj. theophyline 25.3mg + etofylline 84.7mg , inj. tramadol 100mg / ml , inj. tramadol 50mg / ml , inj. trenexamic acid , inj. vancomycin hydrochloride 500mg , inj. vitamin k1 1mg / 0.5ml , water for injection 5ml amp , water for injection 10ml amp , miscellaneous items , albumin powder ( oral ) , atropine sulphate eye ointment ( 1% ) , azelastin + fluticasone ( 140mcg / 50 mcg ) nasal spray ( 70 120 meter dose 140mcg / 50 mcg spray , beclomethasone inhalation i.p. 200 mcg per dose , beclomethasone dipropionate, neomycin sulphate, miconazole nitrate ( 0.025 % + 0.5 % + 2 % ( 5 gm tube ) ) , betamethasone + neomycin ointment , betamethasone valerate cream 0.05% , bisacodyl suppositories paediatric , brimonidine eye drop 0.2% ( 5ml ) , budesonide respules 0.25mg / 2ml inhaler , budesonide nebulising suspension containing budesonide ( 0.5 mg / 2 ml, 2ml amp ) , calcium polystyrene sulfonate sachet , calcitonin salmone nasal solution usp ( 30 metered doses 3.7ml ) , carboxymethyl cellulose 0.5% eye drop ( 5 ml ) , chloramphenicol ear drop 5% , chloramphenicol eye ointment 1% ( 4 gram ) , chlorhexidine 2% mouth gargle solution , cholecalciferol d3 60000 k powder sachet , ciprofloxacin 0.3% + dexamethosone eye drop 0.1% , ciprofloxacin 0.3% eye drop , clotrimazole 1% + beclomethasone 0.025%+ chloramphenicol 5% and + lignocaine 2% ear drops , clotrimazole 1% + lignocaine 2% ear drops , clotrimazole 1% cream , clotrimazole ( 1% 100 gm ) powder , cyclopentolate eye drop , diclofenac gel 1% 30gm tube , dorzolamide 2% w / v , dorzolamide 2% w / v + timolol 0.5% w / v , flurbiprofen 0.03% w / v eye drops , fluticasone inhaler , fluticasone nasal spray , formeterol 6mcg + budesonide 100 mcg / puff inhaler , gamma benzene hexachloride lotion 1% , gentamicin cream 0.1% , gentamycin 0.3% eye / ear drops , glycerine enema ip solution , heparin 200 iu gel , lactic acid bacillus sachet , lidocain 100mg ethanon 28.29 % v / v spray , lidocain transdermal patch 5% , lignocaine hydrochloride gel 2% w / v , miconazole 2% cream , moxifloxacin0.5%+ dexamethasone0.1%eye drop , moxifloxacin eye drop 0.5% w / v , mupirocin ointment 2 % w / w , norfloxacin 0.3 % w / v eye drop , ofloxacin 0.3 % + dexamethasonena phosphate 0.1 % w / v eye drop , ofloxacin eye drop 0.3% w / v of ofloxacin ph.eur. , ors packet who formula sodium chloride 2.5g, potassium chloride 1.5g, sodium citrate 2.09g dextrose 13.6g, 20.5gm pouch , paradichlorobenzene 2% benzocaine 2.7% chlorbutol 5% turpentine oil 15% cerumenolytic for ear wax 10 ml , phenylephrine hcl 5% + tropicamide 0.8% eye drops , piroxicam 0.5 % gel. , povidon iodine 5 % ointment , povidone iodine ointment 5% 250gm jar , povidone iodine solution. 5% , povidone iodine solution. 10% , povidone iodine surgical scrub solution. 7.5% , powder polymyxin b sulphate 5000u, neomycin sulphate 3400u, zn bacitracin 400 u / g , rivastigmine transdermal patch 9mg , salbutamol inhalation ip ( inhaler ) 100mcg / dose , salbutamol nebuliser solution bp salbutamol sulphate eq. to salbutamol 1mg per ml in each 2.5ml ampoule , salmeterol 25 mcg + fluticasone 250 mcg inhaler ( 120mdi ) ( 250 mcg ) , timolol maleate 0.5% eye drops , tobramycin 0.3% + dexomathasone 0.1%eye drops , trypan blue 0.6% 1ml soln. , xylometazoline 0.1% nasal drop...

Bhopal Gas Tragedy Relief and Rehabilitation - Madhya Pradesh

38274231 tender of pathology items tender document for pathology items , biochemisry &serology kits , a.s.o.tire , alkaline phosphatase , amylase kit , anti sera a , anti sera b , anti sera d , bloodglucose , blood urea berthlot method , blood urea kinetic method , blood urea urease method , brain thromboplastin (5ml bottle) , chickengunia igm , cholesterol kit , cpkmb kit , coombs sera , control serum 1.20x 5 ml , control serum 2.20x 5 ml , crp kit , csf protein kit , dengu (combi pack) , g6pd kit , glycocylated haemoglobin (hba 1c) kit , hbs ag test card , hbs ag test kit , hcv test antigen card , hdl cholestrol (direct) , hiv test antigen card , l.d.h.kit , malaria antigen card , malaria antigen strip kit , occult blood kit , phosphorus , prothrombin time kit , r. a. factor test kit , serum albumin kit , serum bilirubin kit , serum calcium kit , serum creatinine kit , serum lipase kit , serum triglyceride kit , serum uric acid kit , sgotkit , sgpt kit , t 3 kit , t 4 kit , total protein kit , troponin 1 card , tsh kit , vdrl. card (rapid plasma reagin test) , widal test kit slide method , widal test kit test tube method , reagents& miscellaneous , barium chloride 10%solution , carbol fuschin , crystal violet solution , cynamethaemoglobin solution , deionised water , dpx mountanent , e.d.t.a. solution , field staina , field stain b , flow clean solution , fouchet’s reagent , glassware cleaning solution , glacial acetic acid , isopropyl alcohol , leishaman’s stain , methylene blue , methanol , multi strip urine , n / 10 hcl , oil imerssion , pregnancy test strip , r.b.c. diluting fluid , urine strip protein & sugar , urine strip sugar & acetone , w.b.c. diluting solution , xylene , glassware , beaker (100 ml) , capillary tubes , centrifuge machine tubes (plastic) , cover slip withsize:18x18mm (+/ 1.00mm), thikness 0.13 to 0.17mm (pkt of 50 pieces) , esr stand wintrobe , esr tube wintrobe , falcon tube (conical bottom) (50ml each plastic containers with air tight screw cap printed graduation) , filter paper , glass marking pencil , glass slide 75mm x 25mm x 1.1mm , glass test tube 12 x 100 (medium size) heavy quality 100/pkt(no.) , k3 e.d.t.a. tube , micro pipette 10 ml , micro pipette 5 50 micron , micro pipette 50 100 micron , micro pipette 100 1000 micron , micro pipette tips 50 100 ?l , micro pipette tips 200 1000 ?l , micro pipette tips 5 300ul , plain vial with screw cap (12x75) , polypaper labels (sticker) , sputum container (100 per box) , sterile polyvial , swab stick with tube sterile (70 80 mm length 10 15 mm diameter), unit 1 (100/pkt) , test tube basket , test tube medium , test tube small 12 x 75 mm , test tube stand 24 hole aluminiummedium , test tube washing brush big , test tube washing brush medium , test tube washing brush small , thermal paper for r. a. 50 analyzer (size 78 ml) , tissuerole paper , torniquet (arm belt) , urine culture container sterile plasticsize 50mm , urine container size of the container shall be 30ml disposable (50 per pkt) , vaccutainer , wash bottle , pathology reagentsfor fully automaticbiochemistryanalyzer , alk phosphate (4x12ml / 4x12ml) , alt (4x50ml / 4x25ml) , amylase (4x40ml / 4x10ml) , ast(4x25ml / 4x25ml) , calcium (4x27ml / 4x27ml) , cholesterol(4x22.5ml) , ckmb (uv) (2x25ml / 2x4ml) , ckmb calibrator (6x1ml) , creatinine (4x51ml / 4x51ml) , direct billirubin (4x6ml / 4x6ml) , glucose (4x25ml / 4x12.5ml) , hdl cholesterol (4x27ml / 4x9ml) , hdl cholestrol calibrator (2x3ml) , haemoglobin denaturant , hba 1c kit , lipase (4x10ml / 4x3.3ml) , total billirubin (4x15ml / 4x15ml) , triglyceride(4x20ml / 4x5ml) , urea (4x25ml / 4x25ml) , uric acid(4x12ml / 4x5ml) , wash solution(6x2 ltr) , pathology other itemsfor fully automaticbiochemistryanalyzer , hba 1c calibrator , mandoline line for probe cleaning , mixing rods ( 3pcs./set) l shape , r. probe , rack id level (1 20) , s. probe , sample cup glass 100pcs. , sensa core st 200 aqua reagent pack (cal a :450 ml, cal b : 200 ml) , system calibrator...

Directorate Of Health Services - Madhya Pradesh

38257665 supply of medicine / material / suture surgicals / lab regents / instruments , abacavir tablet 300 mg , aceclofenec tab 100mg , acetazolamide tab 250 mg , acetylsalicylic acid tablet 150 mg , acetylsalicylic acid ( aspirin ) * tablet 25 mg , activated charcoal , acyclovir inj 250 mg / vial , acyclovir tab 200 mg , acyclovir tab 800 mg , acyclovir ointment3% , adenosine inj 3 mg / ml , adrenaline inj 1 mg / ml , albendazole 200mg / 5 ml , albendazole tab 400 mg , allopurinol tablet300 mg , allopurinol tablet 100 mg , alprazolam tab 0.25 mg , ambroxol hcl 15mg + terbutaline sulphate 1.25mg + guaiphenesin 50mg5ml 15mg+1.25mg+50mg / 5ml , amikacin inj 100 mg / 2 ml , amikacin inj 500 mg / 2 ml vial , aminophylline inj 25 mg / ml , amiodarone inj 50 mg / ml , amiodarone tab 100 mg , amlodipine tab 5 mg , amlodipine tab 10 mg , amoxycillin cap 250 mg , amoxycillin cap 500 mg , amoxycillin oral suspension 125 mg / 5 ml , amoxycillin+ clavulanic acid inj ( amoxycillin 500 + clavulanic acid 100 mg ) , amoxycillin +clavulanic acid syp ( amoxicillin 200mg + clavulanic acid 28.5mg ) / 5ml , amoxycillin+clavulanic acid tab ( amoxycillin 500 + clavulanic acid 125mg ) , amphotericin b injection 50 mg , ampicillin cap 500 mg , ampicillin inj 500 mg / vial , anti d immunoglobulin for iv / im use ( monoclonal ) inj 150mcg , anti d immunoglobulin for iv / im use ( monoclonal ) inj 300mcg , anti snake venom inj polyvalent 10 ml ( lyophilized ) , antitetanusimmunoglobulins inj 250 iu / vial , artesunate inj 60 mg / vial , artesunate powder for injection120 mg , artemether ( a ) + lumefantrine ( b ) oral liquid 80 mg ( a ) + 480 mg ( b ) / 5 ml , artemether ( a ) + lumefantrine ( b ) tablet 80 mg ( a ) + 480 mg ( b ) , artemether ( a ) + lumefantrine ( b ) tablet 20 mg ( a ) + 120 mg ( b ) , artesunate + sulphadoxine + pyrimethamine ( age group 15 or above ) tab artes unate 200 mg ( 3tab ) + sulphadoxine 750 mg ( 2tablets ) + pyrimethamine37.5 mg ( 2 tab ) tablets ip , artesunate + sulphadoxine + pyrimethamine ( age group 9 to 14 years ) tab artes unate 150mg ( 3tab ) + sulphadoxine 500mg ( 2 tab ) +pyrimethamine 25m tab ip ( 2tab ) , artesunate + sulphadoxine + pyrimethamine ( age group between 1 4 years ) tab artesunate 50 mg ( 3 tab ) + sulphadoxine 500 mg ( 1 tab ) + pyrimethamine 25 mg ( 1 tab ) tablets ip , ascorbic acid ( vitamin c ) tablet 100 mg tablet 100 mg , aspirin tab 75 mg , atenolol 100 mg , atenolol tab 50 mg , atorvastatin tab 10 mg , atorvastatin tablet 40 mg , atracurium inj 10 mg / ml , atropine inj 0.6 mg / ml , atropine sulphate 1%, gel , atropine 1% eye ointment , atropine 1% eye drops , azithromycin tab 250 mg , azithromycin tab 500 mg , azithromycin syp 200mg / 5ml , baclofen baclofen 40 mg tablet , benzathinepenicilline 6 lakh iu / vial , benzathinepenicilline 12 lakh iu / vial , benzoyl peroxide gel 5% , betahistine tab 8 mg , betamethasone tab 0.5 mg , betamethasone injection 4 mg / ml , betamethasone sodium phosphate inj 4 mg / ml , betamethasone dipropionate ointment 0.05% , biphasic isophane insulin insulin biphasic aspart 30:70 100 iu / ml ( firm has to supply compatible pen along with cartridges as andwhen required without any extra cost ) ( 3ml cartridge ) , cartridges , bisacodyl tab 5mg , bisacodyl suppositories 5 mg , bleaching powder containing not less than 30% w / w of available chlorine ( as per i.p ) containing not less than 30% w / w of available chlorine ( as per i.p ) , boro spirit ear drops 0.183 gm boric acid in 2.08 ml of alcohol , bromhexine syp 4mg / 5ml , budesonide nebulising suspen. containing budesonide 0.5 mg / 2 ml , bupivacaine hcl inj 0.5% , caffeine oral liquid 20 mg / ml , caffeine citrate inj 20 mg / ml , calamine lotion , calcium carbonate . tab 500 mg , calcium gluconate inj 10% , calcium with vitamin d3 calcium equivalent to 500 mg & vit. d3 250 iu , carbamazepine tab 100 mg , carbamazepine tablet 200 mg , carbamazepine oral liquid 100 mg / 5 ml , carbimazole tab 10 mg , carboprost ( 15 methyl pgf2a ) inj 250mcg , carboxymethyl cellulose drops 0.5% , ce?xime tab 50 mg , ce?xime tab 200 mg , ce?xime oral suspension 100mg / 5ml , cefotaxime inj 250 mg / vial , cefotaxime inj 500 mg / vial , cefotaxime inj 1gm / vial , cefpodoxime tab 200 mg , ceftazidime powder for injection 250 mg , ceftazidime powder for injection 1gm , ceftriaxone inj 250 mg / vial , ceftriaxone inj 500 mg / vial , ceftriaxone inj 1 gm / vial , cephalexin cap 250 mg , cephalexin syp 125mg / 5ml , cetirizine tab 10 mg , cetirizine syp 5mg / 5ml , cetrimide solution 20% ( concentrate for dilution ) solution 20% ( concentrate for dilution ) , chloramphenicol eye ointment 0.5% , chloroquine inj 40 mg / ml , chloroquine syp 160mg / 10ml ( 50mg / 5ml base ) , chloroquine tab 250 mg , chlorpheniramine inj 10 mg / ml , chlorpheniramine oral liquid 2 mg / 5 ml , chlorpromazine tab 100 mg , chlorthalidone 12.5mg , chlorthalidone 25mg , cinnarizine tab 25 mg , cipro?oxacin tab 250 mg , cipro?oxacin tab 500 mg , cipro?oxacin inj 200 mg / 100 ml , cipro?oxacin eye / ear drop 0.3% , cipro?oxacin eye ointment 0.3% , clarithromycin tablet 250 mg , clindamycin capsule 150 mg , clofazimine tablet 50 mg 4 , clofazimine capsule 100 mg , clomiphene citrate 50 mg tab , clonazepam tablet 0.5 mg , clopidogrel tab 75 mg , clotrimazole ( vaginal tab ) pessary 500 mg ( with applicator ) , clotrimazole cream 2%w / w , cloxacillin capsule 125 mg , cloxacillin capsule 500 mg , clozapine tablet 50 mg , clozapine tablet 25 mg , codeine oral solution 15 mg / 5 ml , combi pack with mifepristone + misoprostol ( 1 tablet of mifepristone 200 mg and 4 tablets of misoprostol 200mcg ) , combo ear drop chloramphenicol 5% w / v +clotrimazole 1% +ligno cainehydroc hloride 2% combo ear drop chloramphenicol 5% w / v +clotrimazole 1% +lignocaine hydrochloride 2% , cycloserine capsule 125 mg , d 10 ( dextrose 10% ) iv fluid ( dextrose 10% ) , d 25 injection ( dextrose ) iv fluid ( dextrose 25% ) , d 25 injection ( dextrose ) iv fluid ( dextrose 25% ) , dapsone tablet 100 mg , deferasirox tab 250mg , deferasirox tab 500 mg , deferiprone 500mg , deriphylline tablet sr 300 mg , deferoxamine 500mg / vial , desferrioxamine injection 500 mg , dexamethasone inj 8 mg / 2 ml , dextromethorphan syrup 10 mg / 5 ml , dexamethasone tab 0.5 mg , dexamethasone drop ( 0.1%, 5ml ) , eye drop , dextrose 5% iv fluid ( dextrose 5% ) , dextrose with saline i / v fluid ( dextrose 5% + saline 0.9% ) , diazepam inj 5 mg / ml , diazepam tab 5 mg , diclofenac tab 50 mg , diclofenac inj 25 mg / ml , diclofenac 0.01 , dicyclomine tablet 10 mg tablet , dicyclomine hydrochloride inj 10 mg / ml , dicyclomine hydrochloride tab 20 mg , diethylcarbamazine tab 100 mg , diethylcarbamazine oral liquid 120 mg / 5 ml , digoxin tab 0.25 mg , digoxin tab 250 mg , diloxanide furoate tablet 500 mg , diltiazem injection 5 mg / ml , diltiazem sr tablet 90 mg , diltiazem tablet 60 mgl , diltizem tab 30 mg , diphenylhydantoin tab 30 mg , dispersable tablet hydroxyurea 100 mg , disul?ram tablet 250 mg , dobutamine inj 50 mg / ml , domperidone tab 10 mg , domperidone 1mg per 1ml suspension , donepezil tablet 5 mg , dopamine inj 40 mg / ml , doxycycline cap 100mg , doxycycline dry syrup 50 mg / 5 ml , drotaverine inj 40 mg / 2 ml , drotaverine tab 40 mg , drotaverine inj 40 mg / 2 ml , duvadilan 10 mg , duvadilan inj 5mg , empagli?ozin 25 mg , enalapril maleate tab 10 mg , enoxaparin inj 40 mg equivalent to 4000 iu , erythropoietin injection 2000 iu / ml , erythropoietin injection 10000 iu / ml , escitalopram tablet 10 mg , esmolol injection 10 mg / ml , ethamsylate tablet tab 250 mg , ethinylestradiol tablet 0.05 mg , ethinylestradiol tablet 0.01 mg , ethinylestradiol ( a ) + levonorgestrel ( b ) tablet 0.03 mg ( a ) + 0.15 mg ( b ) , etophylline +theophylline tab 100 mg ( etophylline 77 + theophylline 23 ) mg , etophylline +theophylline inj 220 mg / 2 ml ( 169.4+50.6 mg ) , fentanyl 50 microgram / ml , ferric carboxymaltose 250mg , ferric carboxymaltose 50mg / ml , ferrous ascorbate ( 100mg. elemental iron+ folic acid 1.5 mg ) , fino?brate tablet160 mg , fino?brate tablet 40 mg , fluconazole tab 150 mg , fluconazole eye drop 3 mg / ml ( 10 ml vial ) , eye drop , flunarizine tablet 5 mg , fluoxetine capsule 20mg , fluphenazine injection 25mg , folic acid tab 5mg , formoterol inhaled bronchodilator , framycetin sulphate 1% cream , furazolidone tab 100 mg , furusemide tab 40 mg , furusemide inj 10 mg / ml , fusidic acid cream / ointment 2% , gamma benzene hexachloride , gentamicin inj 40 mg / ml , gentamicin ear / ear drop ( 0.3% ) , glibenclamide tablet 5 mg , gliclazide tab 80 mg , glimeperide tab 1 mg , glimeperide tab 2 mg , glucose ( a ) + sodium chloride ( b ) injection 5% ( a ) + 0.9% ( b ) , glucose packet 75 mg for ogtt test glucose packet 75 mg for ogtt test , glycerin oral liquid , glycopyrolate inj 0.2 mg / ml , gum paint ( tannic acid ) 2% w / v , gutta percha ( gp ) , haemodialysis fluid , haloperidol inj 5 mg / ml , haloperidol tab 5 mg , halothane inhalation , heparin inj 1000 iu , hepatitis bimmunoglobulin 100 iu / vial , homatropine drops 2% , human albumin solution 0.05 , human chorionic gonadotropin injection 10000 iu , human chorionic gonadotropin injection 5000 iu , human immunoglobulin 5% iv ig ( 5mg / 100ml each ) , injection , hydrochlorothiazid tablet 12.5 mg , hydrochlorothiazid tablet 50 mg , hydrochlorothiazide tab 25 mg , hydrocortisone inj 100 mg / vial , hydrocortisone ointment 0.5% , hydrocortisone ointment1% , hydrogen peroxide solution 6% , hydroxychloroquine tablet 200 mg , hydroxyethyl ( 6% saline solution for infusion ) starch 6%ip , hydroxyurea capsule 500 mg , hydroxyzine syrup 10 mg / 5 ml , hydroxyzine tablet25 mg , hyoscine butylbromide 20mg / ml , ibuprofen tab 400mg , ibuprofen oral suspension 100mg / 5ml , imipramine tablet 25 mg , insulin soluble inj 40 iu / ml , intraperitoneal dialysis solution , ipratropium inhalation ( mdi / dpi ) 20 mcg / dose ipratropium respirator solution for use in nebuliszer 250 mcg / ml , iron & folic acid syp iron each 1 ml contains 20mg elemental iron+folic acid 100 ?g , iron & folic acid sugar coated iron folic acid sugar coated ( red tablet ) ferrous sulphate ip equivalent to60 mg elemental iron & 500 mcg folic acid ip , iron & folic acid sugar coated iron folic acid sugar coated ( blue tablet ) ferrous sulphate ip equivalent to60 mg elemental iron & 500 mcg folic acid ip , iron & folic acid sugar coated iron and folic acid sugar coated tab dried ferrous sulphate ip eq. to 45 mg ferrous iron and 400 mcg folic acid ip ( pink colored tab ) wifs junior ifa tablets , iron sucrose inj 100 mg / 5 ml , iso?urane inhalation , isosorbide dinitrate tab 5 mg , isosorbide 5 mononitrate tab 20 mg , itraconazole tablet / capsule 100 mg , ivermectin tab 12 mg , ketamine inj 10 mg / ml , ketorolac 10 mg tablet , labetalol tab 100 mg , labetalol inj 20 mg / 4 ml , labetalol injection 5 mg / ml , lactulose solution 10 gm / 15 ml , lantanoprost 0.005% ( 5ml ) , eye drop , levetiracetam tablet 250 mg , levodopa ( a ) + carbidopa ( b ) tablet 100 mg ( a ) + 10 mg ( b ) cr , levodopa ( a ) + carbidopa ( b ) tablet 100 mg ( a ) + 25 mg ( b ) cr , levodopa ( a ) + carbidopa ( b ) tablet 250 mg ( a ) + 25 mg ( b ) , levo?oxacin tab 250 mg , levo?oxacin tab 500 mg , levonorgestrel tablet 0.75 mg , levosalbutamol 50mcg / dose , levosulbutamol 100 mcg , levothyroxine tab 50 mcg , levothyroxine tab 100 mcg , light cure composite , lignocaine inj 2% , lignocaine gel 2% , lignocaine + adrenaline inj 2% + 0.005 mg / ml , linezolid tablet 600 mg , lithium carbonate tablet 300 mg , loperamide tablet 2 mg , lorazepam tab 1 mg , lorazepam inj 2 mg / ml , losartan 10 mg , magnesium sulphate injection 500 mg / ml , mannitol inj 20% , mannitol inj 20% , mebeverine tab 200 mg , medroxy progesterone tablet 10 mg , medroxy progesterone acetate injection 150 mg , mephentermine injection 30 ml vial mg / ml , meropenem 500 mg , metformin tab 500 mg , metformin sr 1000mg , methyl ergometrine maleate inj 0.2 mg / ml , methyl ergometrine maleate tab 0.125 mg , methyldopa tab 250 mg , methylprednisolone injection 1000 mg / ml , methylprednisolone injection 500 mg , methylprednisolone tablet 16 mg , methylprednisolone tablet 4 mg , metoclopramide inj 5 mg / ml , metoclopramide tab 10 mg , metoprolol sr tab 25 mg , metoprolol sr / plain tab 50 mg , metronidazole inj 500 mg / 100 ml , metronidazole tab 400 mg , metronidazole oral suspension 200 mg / 5ml , miconazole cream 2% w / w , midazolam inj 1 mg / ml , mifepristone tab 200 mg , misoprostal tab 200 mcg , misoprostal tablet 100mcg , misoprostol tablet 200mcg ( oral / vaginal ) , montelukast syrup , montelukast tablet 5 mg , morphine inj 10 mg / ml , morphine injection 15 mg / ml , morphine tablet 10 mg , morphine tablet sr / 30 mg , moxi?oxacin 0.5% w / v ( 5 ml ) , eye drop , multivitamin sugar coated tab nfi formula sugar coated vit a 2500 iu, vit c 50mg , calcium pantothenate 1mg, vit b1 2 mg vit b6 0.5 mg vit d3 200 iu vit b2 2mg niacinamide 25mg folic acid 0.2mg. , mupirocin cream / ointment 2% , naloxone inj 0.4 mg / ml , neostigmine inj 0.5 mg / ml , nicotinamide tablet 50 mg7 , nifedipine cap 5 mg , nifedipine tab 10 mg , nitroglycerine ( glyceryl tri nitrate ) sub lingual tab 0.5 mg , nitroglycerine ( glyceryl tri nitrate ) inj 25 mg / 5 ml , nitrous ( store under pressure in metal cylinders of the type conforming to the appropriate safety regulations and at temperature not exceeding 378c ) , noradrenaline inj 2 mg base / 2 ml amp. , nor?oxacin tab 400 mg , nor?oxacin dispersible tablet 100 mg , normal saline nasal drops: sodium chloride drops 0.05% w / v , o?oxacin 200 mg , o?oxacin 400mg , olanzapine tablet 5 mg , olanzapine 10 mg , ondansetron tab 4 mg , ondansetron inj 2 mg / ml , ondansetron syp 2mg / 5 ml , ormeloxifene tablet 30 mg , oxygen inhalation , oxytocin injection 5 iu / ml injection 5 iu / ml , pantoprazole inj 40 mg / vial , paracetamol tab 500mg , paracetamol drops 125mg / ml , paracetamol inj150 mg / ml , paracetamol syp 125mg / 5 ml , paracetamol tab 650mg , pediatric solution like isolyte p, n / 2 & n / 5 pediatric solution like isolyte p, n / 2 & n / 5 , pentazocine injection 30mg / ml , penicillin v ( phenoxymethylpenicillin ) 250 mg , permethrin permethrin lotion 5% w / v ( , pheniramine injection 22.75 mg / ml , phenobarbitone inj 200 mg , phenobarbitone tab 30 mg , phenobarbitone tablet 60mg , phenytoin inj 50 mg / ml , phenytoin / diphenylhydantoin tab 100mg , phytomenadione injection 10 mg / ml , pilocarpine drops 4% , pilocarpine drops 2% , pilocarpine drops 1% , pioglitazone 15mg tablet , piperacillin +tazobactam inj 4.5 gm / vial , potassium chloride oral solution 100mg / ml , povidine iodine germicide gargle 20% w / v , povidone iodine solution 5%, , povidone iodine vaginal pessary 200mg , povidone iodine 5% ointment , pralidoxime ( pam ) inj 25 mg / ml , prednisolone tab 20 mg , prednisolone drops 1% , pregabalin tablet 150 mg , premix insulin 30:70 injection ( regular: nph ) 2 , premix insulin 30:70 injection 40 iu / ml , primaquine tab 2.5 mg , primaquine tab 15 mg , primaquine tab 7.5 mg , promethazine injection 10 mg / ml , promethazine syp 5mg / 5ml , promethazine injection 50 mg ( 25mg / ml ) , propofal injection 10 mg / ml , propranolol tab 10 mg , protamine injection 50 mg / 5 ml , pyridoxine tab 10 mg , pyridoxine tablet 40 mg , pyridoxine tablet 100 mg , quinine inj 300 mg / ml , quinine tab 300 mg , rabeprazole tab 20 mg , rabies immunoglobulin 300 iu / 2 ml , rabies vaccine ( cell culture ) id / im inj 2.5 iu / ml , ramipril tab 2.5 mg , ranitidine tab 150 mg , ranitidine inj 50 mg / 2 ml , recombinant factor eight inhibitor bypassing activility ( feiba ) 500 units , recombinant factor ix 500iu , recombinant factor vii a 1 mg , recombinant factor viii 250iu , recombinant factor viii 500iu , reduced osmolarity ors pkt. whoformula , ribo?avin tablet 5 mg7 , ringer lactate i / v 0.24 % v / v of lactic acid ( eq. to 0.32% w / v of sodium lactate ) , 0.6 % w / v sodium chloride, 0.04 % w / v potassium chloride and 0.027 % w / v calcium chloride , risperidone 50 mg , risperidone tab 2 mg , salbutamol tab 4 mg , salbutamol inhaler 100mcg / dose , salbutamol syp 2mg / 5ml , salicylic acid ointment 6% , silver sulphadiazine cream usp 1% , sitagliptin tab 50 mg , sodium aminosalicylate granules 10 gm , sodium bicarbonate inj 7.5% w / v , sodium chloride hypotonic inj n / 2 ( 0.45% ) , sodium chloride isotonic inj 0.9% isotonic ( equivalent to na+154 m mol / l, cl+154 m mol / l ) , sodium chloride isotonic inj 0.9% isotonic ( equivalent to na+154 m mol / l, cl+154 m mol / l ) , sodium valproate tab 500 mg , sodium valproate syrup each 5ml contains 200mg , spironolactone tablet 25 mg , streptokinase injection 15 lac / vial , succinyl choline inj 50 mg / ml , sucralfate syrup 1gm / 5ml , sucralfate tablet 20 mg , sulfamethoxazole +trimethoprim tab200mg +40 mg , sulfamethoxazole +trimethoprim oral liquid ( 200mg + 40 mg ) / 5 ml , sulfamethoxazole and trimethoprim tab800mg + 160mg , sulfamethoxazole+ trimethoprim ( pediatric tablets ) tab 400 mg+80 mg , sulfasalazine tablet 500 mg , sumatriptan tablet 25 mg , surfactant suspension inj 25 mg / ml , tapentadol tablet 100 mg , telmisartan tab 40 mg , thiamine injection 100 mg / ml , thiamine tablet 100 mg , thinylestradiol ( a ) + levonorgestrel ( b ) tablet 0.03 mg ( a ) + 0.15 mg ( b ) with ferrous fumarate , thiopentone inj 0.5gm powder / vial , timolol 0.5% eye drops , tinidazole tab 300 mg , tiotropiuminhalation ( dpi ) 18 mcg / dose , tiotropiuminhalation ( dpi ) 9 mcg / dose , tramadol inj 50 mg / ml , tramadol tab 50mg , tranexamic acid inj 500 mg / 5 ml. , tranexamic acid tab 500mg , trihexyphenidyl tab 2 mg , tropicamide drops 1% , turpentine oil 15% w / v , urokinase ( 5 laciu ) , valproate oral solution 200mg / 5ml , vancomycin powder for injection 1 g , vancomycin powder for injection 250 mg , vancomycin powder for injection 500 mg , vecuronium inj 2 mg / ml , verapamil tab 40 mg , verapamil injection 5 mg / 2 ml , vitamin a syp 100000 iu / ml with marked spoon for 1ml &2ml , vitamin b12 inj, injection 500 mcg / ml , vitamin k1 inj 1 mg / 0.5 ml , vitamin. b complex tab nfi ( prophylactic ) b1 2 mg, b2 2mg, b6 0.5 mg, niacin amide 25 mg, calcium pantothenate 1 mg , warfarin tab 5 mg , warfarin tablet 1 mg , warfarin tablet 2 mg , water for injection 2 ml , water for injection 5 ml , wax solvent ear drops: benzocaine 2.7% w / v , wax solvent ear drops: paradichloro benzene 2 % w / v , xylometazoline nasal drops: adult ( 0.1% ) , xylometazoline nasal drops 0.05 %, , zinc sulphate tab dispersible 10mg , zinc sulphate tab dispersible 20mg , zolpidem 10 mg , aceclofenac 100mg+paracetamol 325mg + serratiopeptidase 15mg ( 10x10 ) , tab , aceclofenac 100mg+paracetamol 325mg tablet , aciclovir tab 400 mg ( 400 mg dt tablet also acceptable ) , tab. , albendazole + ivermectin ( 400mg + 6mg ) , tablet , alpha beta arteether ( 150mg / 2ml ) , injection , alprazolam ( 0.5mg ) , tablet , amikacin ( 250mg / 2ml ) , injection , amitryptiline tab ( 50 mg ) , tablet , ammonium chloride+diphenhydramine+sodium citrate+menthol ( 138 mg +14.08mg+57.03mg+2.5mg each 5ml cough syrup ) , syrup , amoxicillin trihydrate dispers. 125 mg tab ( 125 mg ) , amoxycillin+potassium clavulanic ( 250mg + 125mg ) , tab. , artemether inj 80mg / ml ( 1 ml amp ) , injection , artesunate + sulphadoxine + pyrimethamine ip ( 100 mg ( 3tab ) + 750 mg + 37.5mg ( 1tab ) ( age group 5 to 8 years ) , combi blister pack , ascorbic acid ( vitamin c ) tab i.p. ( 500mg ) , tablet , aspirin ( 150 mg low dose ) , tablet , atorvastatin + asprin ( 10mg + 75mg ) , tablet or capsule , atorvastatin ip ( 20 mg ) , tablet , atorvastatin ( 40mg ) , tablet , beclomethasone dipropionate, neomycin sulphate, miconazole nitrate ( 0.025 % + 0.5 % + 2 % ( 5 gm tube ) ) , oint. , beclomethasone inhalation i.p 200 mcg per dose ( 200 metered dose container ) , inhaler , benzyl benzoate lotion 25% ( 100ml bottle ) , bottle , betahistin 8 mg tab. , betamethasone sodium tab. , bromhexine hcl 4 mg+ guaiphensin 50 mg+terbutali ne sulphate 1.25 mg / 5ml syp ( 100 ml bottle ) , syrup , bss solution for opthalmic use ( 500ml ) , solution , bupivacaine hydrochloride ( not for spinal use ) ( 0.5% ) ( 4ml amp ) , bupivacaine hydrochloride 0.25% ( 20 ml vial ) , injection , cabergoline 0.25 mg tab. , cabergoline 0.5 mg tab. , calcium carbonate 625 mg, vitamin d3 125 iu / 5 ml ( 100 ml syrup ) , calcium gluconate 10% ( 10ml amp ) , injection , carboxymethyl cellulose ( 1% eye drop, 5ml ) , eye drop , carboxymethylcellulose eye drop ip 1% w / v 10ml vial ( sodium cmc also accepted ) , eye drop , cefadroxil 250 mg ( tab ) , tablet , cefixime + ofloxacin ( 200 mg + 200 mg ) , tablet , cefixime tab ip ( 100mg ) , tablet , cefpodoxime ( 50 mg ( dt tablet also acceptable ) ) , tablet , ceftazidime inj ( 500mg / vial ) , injection , ceftriaxone+tazobactum ( 1gm+125mg, vial ) , injection , cefuroxime 250 mg 10 x 10 ( 250 mg ) , tablet , cephalexine ( 500mg ) , capsule , chewable antacid containing magnesium hydroxide. 250mg to 500mg +alum. hydroxide 250mg to 500mg +simethecon / dimethicon mini. 25mg to 50mg tab ( additional component will also be accept ) , tablet , chlorhexidine gluconate mouthwash 0.2% w / v solu. ( 50ml bott. ) , chlorpheniramine maleate ( 4mg ) , tablet , chlorpromazine ( 25 mg / ml inj ) , injection , ciprofloxacin + tinidazole ( 250 mg + 300 mg ) , tablet , ciprofloxacin+dexamethosone ( 0.3%+0.1% ) ( 5ml ) , eyedrop , clindamycin 300mg capsule / tab ( 10x10 ) , tab. / caps. , clomiphene citrate ( 25 mg tab ) , tablet , clopidogrel + aspirin ( 75 mg + 150 mg ) , capsule , clopidogrel 75mg + aspirin 75mg tab ( 10x10 ) , tablet , clotrimazole cream 1% ( 15 gm tube ) , cream , dexamethasone ( 4 mg ) , tablet , dextromethorphan hydrobromide syrup 13.5 mg / 5ml ( 30 ml bottle ) , diazepam ( 10 mg ) , tablet , diclofenac + seratopeptidase ( 50mg + 10mg ) , tablet , diclofenac 100mg ( sr tablet 10x10 ) , tablet , diclofenac 50mg +paracetamol 325mg+chlorzoxazone 500mg ( tab ) , diclofenac sodium + paracetamol +serratiopeptidase ( 50 mg +325 mg + 10 mg ) , tablet , diclofenac sodium 50mg + paracetamol ( 325mg ) , tablet , diclofenac sodium 75mg ( 1ml amp ) , injection , dicyclomine hydrochloride syrup , doxylamine succinate + pyridoxine ( 10mg+10mg ) , tablet , drotaverine ( 80 mg ) , tablet , electrolyte m ( multi electrolyte with 5% dextrose iv injection type iii ip ) i / v fluid each 100ml contains: ( anhydrous dextrose 5g; sodium acetate trihydrate ) ( 500 ml ffs bottle ) , injection , electrolyte p ( multi electrolytes and dextrose injection ( each 100ml contains: anhydrous dextrose 5gm potassium chloride 0.13gm, sodium acetate 0.32gm, dibasic potassium phosphate 0.026gm ) ( 500 ml ffs bottle ) , injection , enoxaparin ( 60mg equivalant to 6000 iu vial / pfs ) inj. , erythromycin stearate ( 500 mg ) , tablet , ethamsylate inj ( 250mg ( 2ml amp ) ) , injection , etiophylline +theophylline ( ( 46.5+14 ) mg / 5ml ( 100 ml bottle ) ) , syrup , etophylline+theophylline sr tablet 231mg+69mg tab. , fluconazole ( 50 mg ) , tablet , furazolidone ( 25mg / 5ml ( 60 ml bottle ) ) , suspension , gluteraldehyde solution 2% ( 5 litre can ) , solution , glycerine 400 ml , glycopyrolate 0.5 mg + neostigmine 2.5 mg ( 5ml ) , inj. , haloperidol ( 10mg ) , tablet , heparin injection 25000 iu , humolog insulin 3 ml cartidge , hydroxy urea ( 500mg ) , capsule , hydroxypropyl methylcellulose eye drops ( 2% 5 ml vial ) , eye drop , hyoscine butylbromide ( 10mg ) , tablet , ibuprofen 100mg + paracetamol 125mg per 5 ml syrup ( 60 ml bottle ) , ibuprofen 400mg+ paracetamol 325mg tablet ( ) , tablet , ibuprofen ( 200 mg ) , tablet , insulin aspart100 iu / ml ( supply compatiblepen along with cartridges as and when required without any extra cost ) ( 3ml cartridge ) , insulin biphasic lispro 25:75 100 iu / ml ( 3ml ) ( firm has to supply compat ible pen along with cartridges as and when required without any extra cost ) , ivermectin usp ( 6mg ) , tablet , lanctus 100 iu insulin ( glargine ) 3 ml cartidge , letrozole ( 2.5 mg ) , tablet , levocetirizine + monteleukast 2.5 mg+4 mg / 5 ml ( 60 ml ) suspen. , levocetirizine + monteleukast ( 5 mg + 10 mg ) , tablet , levocetirizine 5mg ( mouth dissolving tablet also acceptable ) , tablet , levocetrizine ( 10mg ) , tablet , levofloxacin 500 mg ( 100 ml ffs bottle ) , injection , lignocaine spray 10% ( 100ml ) , spray , linagliptin ( 5mg tab ) , tablet , liquid paraffin ( 500 ml, bottle ) , solution , losartan ( 25 mg ) , tablet , magnesium hydroxide + aluminium hydroxide simethecon 250 mg + 250 mg + 50 mg / 5 ml 170 ml bottle ( syrup ) , syrup , meropenem + sulbactum ( 1gm+500mg ) ( 1.5 gm inj. ) , metformine 500mg + glibenclamide 5mg ( tab ) , tablet , methyl prednisolone ( 8mg ) , tablet , metronidazole benzoate oral suspension ( 100mg of base / 5 ml ( 60ml bott ) , metronidazole tab ( 200 mg ) , tablet , micronised progesterone ( 100 mg ) , tablet , norfloxacin ( 200 mg ) , tablet , norfloxacin + tinidazole ( 100 mg + 100 mg ) / 5 ml 30ml syrup ) , norfloxacine 400mg and tinidazole 600mg tablet , normal saline ( 0.9% ( 500ml ffs bottle ) ) , infusion , novarapid insulin cartidge 3 ml , ofloxacin + ornidazole ( 200mg and 500mg ) , tablet , ofloxacin 0.3% w / v of ofloxacin ph.eur. ( 5 ml vial ) , eye drop , ofloxacin 200mg +tinidazole 600mg ( tab ) , tablet , ofloxacin suspension 50mg / 5 ml ( 30 ml bottle ) , suspension , omeprazole ( 20mg ) , capsule , omeprazole + domperidone 20 mg + 10 mg ( capsule ) , capsule , oseltamivir 12 mg / ml syrup ( 75ml bottle ) , syrup , oseltamivir cap ( 75mg ) , capsule , oxytocin 10 iu / ml ( 1ml ampoule ) , injection , pantaprazole ( 40mg tab ) , tablet , paracetamol ip +tramadol hydrochloride ip ( 325mg +37.5mg ) , tablet , paracetamol oral drops ( 100 mg / ml ( 15 ml bottle with dropper ) ) , drop , paraffin liquid ( liquid paraffin 1.25ml + milk of magnesia 3.75ml + sodium picosulphate 3.33mg ) , syrup , phenytoin sodium oral suspension 25 mg / ml ( 100 ml bottle ( loan licencing will be accepted for this item. ) , suspension , piroxicam ( 20mg ) , tablet or capsule , povidone iodine ointment 5% 250gm jar ( ) , each , povidone iodine solution 5% ( 500 ml ) , bottle , pralidoxime chloride injection i.p. 1gm ( 20 ml ) , injection , prazosin tab ( 5 mg ) , tablet , prednisolone ( 5 mg ( dt also acceptable ) , tablet , prednisolone ( 10 mg ( dt also acceptable ) , tablet , promethazine 25 mg / ml ( 1ml amp ) , ampule , rabeprazole 20 mg + domperidone 10mg ( 10x10 ) , tab. , rabeprazole+levosulpiride ( 20mg+75mg ) , tab. or cap. , ramipril ( 5 mg ) , tablet , risperidone ( 1mg ) , tablet , rosuvastatin ( 20 mg ) , tablet , serratiopeptidase ( 5 mg ) , tablet , silver sulphadiazine cream usp 1% ( 250 gm jar ) , cream , sitagliptin + metformin ( 50mg + 500mg ) , tablet , sodium valporate ( 300 mg ) , tablet , sodium valproate + valproate ( 333 mg + 145 mg ) , tablet , telmisartan+ hydrochlorthiazide ( 40 mg+12.5 mg ) tab. , telmisatran ( 20 mg ) , tablet , teneligliptin + metformin ( 20m +500mg ) tablet ( extended / sustained release also acceptable ) , teneligliptin 20 mg tablet , tetanus toxide 0.5 ml , ampule , tetanus immunoglobulin usp / ip ( 500 iu / vial ) , vial , thyroxine sodium 25 mcg ( 100 per bottle ) , tablet , thyroxine sodium 50 mcg ( 100 per bottle ) , tablet , thyroxine sodium 75 mcg ( 100 per bottle ) , tablet , thyroxine sodium 88 mcg ( 100 per bottle ) , tablet , thyroxine sodium 100 mcg ( 100 per bottle ) , tablet , tinidazole 150 mg / 5 ml ( 60 ml bottle ) , suspension , tinidazole ( 500mg ) , tablet , tobramycin + dexamethasone ( 0.3%w / v+0.1%w / v ( 5ml ) ) , eye drop , torsemide ( 20mg ) , tablet , tramadol ( 100mg ) , tablet , tramadol ( 100mg / ml ( 2 ml amp ) ) , injection , tranexamic acid + mefenamic acid ( 500mg+250mg ) tab. , trypan blue ( 0.06% 1 ml ) , solution , trypsin chymotrypsin ( 1 lac iu ) , tablet , vildagliptin + metformin ( 50mg + 500mg ) , tablet , vildagliptin tab ( 50 mg ) , tablet , vitamin a cap usp soft gelatin capsule ( 2 lakh iu ) , cap. , vitamin b complex nfi formula ( 100ml bottle ) , syrup , vitamin b1 10mg, b2 10mg, b6 3mg, b12 15mcg, niacinamide 75mg, calcium panthenol 50mg ( folic acid 1.5mg, vitamin c 150mg, biotin 100mcg or more ) , tablet , vitamin d3 granules ( 60000 iu sachet ) , powder , vitamin e usp ( 400 mg ) , capsule , voglibose 0.3mg ( mouth dissolving tablet also acceptable ) ) , tab. , water for injection inj 10 ml amp , zinc sulphate syrup 20mg / 5ml ( 50 ml bottle ) , syrup , moxi?oxacin 400 mg tablet , rifampicine 150 mg tablet / capsule , rifampicine 300 mg tablet / capsule , rifampicine 450 mg tablet / capsule , rifampicine 600 mg tablet / capsule , pyrazinamide 500 mg tablet , pyrazinamide 750 mg tablet , pyrazinamide 1000 mg tablet , ethambutol 800 mg tablet , ethonamide 250 mg tablet , delamide 50 mg tablet , prednisolone 5mg tablet , prednisolone 10mg tablet , prednisolone 20mg tablet , prednisolone 30mg tablet , prednisolone 46mg tablet , clofinazine 100 mg tablet , sitagliptin tab 100 mg , telmisatran ( 80 mg ) , tablet , tacrolimus capsule ip 1 mg , mycophenolate mofetil tablets ip 500 mg tablet , lacosamide tablet ph.eur.200 mg tablet , aceclofenac 100 mg+ paracetamol 325 +chlorzoxazone 500mg tablet , aceclofenac 100 mg+ thiocolchicoside 4mg tablet , anti cold tablet , anti cold syrup , tetanus toxide 5 ml , vial , multivitamin drops , dicyclomine hydrochloride drops , abdominal retractor , adult scope , adult socpe for disposable bronchoscope , air conditioner ( 1.5 ton ) , allies forcep big size 8 , allies forcep small size 6 , ambu bag ( child ) , ambu bag ( adult ) , artery forceps curved 8 , artery forceps straight 8 , autoclave drum all size , autoclave type b , autoclave vertical , b.p. instrument dial type , b.p. instrument digital , beb cock forceps , bed side bench cum chair , bed side locker , bed side screen , bed side stool , bubble c pap machine , cautery machine , centrifuge machine 12 tube , centrifuge machine 6 tube , computer all in one , cr system cassette size 10x12 , cr system film size 14x17 , cr system film size 8x10 , cuvette of digital hb meter and lancet ( pack of 50 cuvette and 50 lancet ) , digital haemoglobinometer , digital thermometer , digital vision chart with remote , dissection set complete , dressing drum big size , dressing drum medium size , dressing drum small size , dressing trolley ss , dressing trolley with bowl and bucket ss , ecg machine 12 channel , ecg machine 3 channel , ecg machine 6 channel , electric operated suction machine , elisa readers with washer , emergency cart , eto sterliser , examination table , examination table with mattress , extraction forceps set , fetal doppler digital , fire extinguisher 6 ltr. , fire extinguisher 9 ltr. , fire extinguisher abc type 4 kg , fogger machine , foot opreted suction machine , foreign body removal set , full fowler bed ss with mattress & accessories , general surgery set , glucometer , gynae examination table with mattress , high flow nasal cannula system , hospital bed with mattress , instrument tray with cover 12×8 size , instrument tray with cover 12x10 size , instrument tray with cover 15×12 size , instrument tray with cover 10×8 size , instrument trolly , iv stand , labor table , large scope , large scope for disposable bronchoscope , laryngoscope set adult , laryngoscope set child , laryngoscope set neonatal , lscs set , mayo scissors , medicine trolley , microscope with hd camera research microscope , nebulizer , needle destroyer , needle destroyer electrical , non invasive ventilator ( bi pap ) , operating microscope basic , operation theatre table , ovem forceps , over bed table , oxygen cylinder key , oxygen cylinder trolley b type , oxygen cylinder trolley d type , oxygen cylinder with instrument set for oxygen delivery b type , oxygen cylinder with instrument set for oxygen delivery d type , oxygen flow meter , oxygen hood , oxygen mask , patient bed with mattress , pedestal lights , pediatric icu bed , plane forceps , portable shadowless lamp , portable x ray machine 100 ma , pulse oxymeter finger tip , radiant warmer , resuscitation kit , retinoscope , revolving stool , scissors big size , self inflatable bag and mask 250ml , semi fowler hospital bed ss , slim scope for disposable bronchoscope , slow suction machine ( electric ) , small scope for disposable bronchoscope , sponge holding forceps , steam sterilizers table top , sterlizer electric big size , sterlizer electric medium size , sterlizer electric small size , stethograph , stethoscope adult , stethoscope neonatal , stich cutting scissors , stretcher trolley for patients , strip / cuvette for digital haemoglobinometer , suction machine neonatol , syringe infusion pump , tailor scissors , tooth forceps , tounge depresser , umblical cord cutting scissors , urine pot female ss , urine pot male ss , vaginal speculum , vertical autoclave big size , vertical autoclave medium size , visitor chair 3 seater , volumetric infusion pump ( as per specifications ) , water bath ( 25 ltrs ) , water bath with 12 holes , weighing machine neonatol , weighing machine pediatrics , weighing machine scale , wheel chair , x rayhanger 8x10 , x ray cassettess 8x10, 10x12, 12x15 , x ray view box , thermometer , sphygnomanometer , measuring tape , torch , height chart , stool doctors , autoclave electric , urine bag , walking stick , rack , almira , dressing scissor / curved no 4 , dressing scissor / curved no 5 , dressing scissor / curved no 6 , dressing scissor / curved no 7 , dressing scissor / curved no 8 , dressing scissor / curved no 9 , dressing scissor / curved no 10 , cheatle forcep , insulin needle 0.4 mm , artery forcep 5 , artery forcep 6 , artery forcep 8 , needle holder 5no , needle holder 6no , needle holder 8no , mosquito forcep , stomach wash tube , stitch cutting scissor , lense cleaning paper , pm set , enema cane , quile for autoclave 2000w , quile for autoclave 3000w , x rayhanger 10x12 , x rayhanger 12x16 , x ray cassettess 10x12 , x ray cassettess 12x16 , epistomy scissor , bandage scissor , tripod stick , folding walker , cathater tray , kidney tray , folleys catheter , nasel forcep , metzenbaum scissor 6.5 , metzenbaum scissor 7.5 , metzenbaum scissor 8.5 , cokers stright , towel clip , addison tooth forcpe , sinus forcep , masgil forcep 6 , masgil forcep 8 , masgil forcep 10 , fine scissor 6 , hammer , stepler remover 5 , green armtag forcep , autoclave rubber ( med ) , autoclave rubber small , autoclave rubber large , sterlizer electric , morries rectractor , devers rectractor , vullsen forcep , sims speculumn , anterior speculumn , tenakulumn speculumn , steel bowl , thumb forcep , kellys retractor , czemy rectractor , balfour rectractor , pozzy rectractor , kilner rectractor , single hook rectractor , double hook rectractor , vaginal rectractor , bholler strirrups , proctoscope , rectal anal dialatior , piles gun set , phymosus forcep , piles forcep , electric plaster cutter , autoclave watch ( pressuer gauze ) , nsv set , manual operating drill , uterine curetter 10 , hysterectomy forcep , hegar dialator antimagnetic , cervical biopsy punch , iucd removing hook , obstetrical forcep , d&c set , yankur suction cannula , mpt set , para baff , bone holding forcep , plaster cuttersaw angle , amputation saw , bone cutter , bone scope , bone nibler , bone chiesel gauge , rib shear , gigle saw , absorable surgical suture rb needle size no 1 , 30 mm length 70 cm , 12 foils per packet , polyglycolic acid ( pga ) , absorbable surgical suture braided polyglycolic acid 3 / 8 circle reverse cuttingg ( 12mm 45 cm spatulated needle ) , consumable , absorbent cotton roll 100 gm each consumable , absorbent cotton roll 20 gm each consumable , absorbent cotton wool ip 500 grms ( each ) , consumable , adhesive plasters usp 7.5 cm x 10 mts / roll , adhesive plasters usp 7.5 cm x 5 mts / roll , adhesive roll 1 inch x 5 m / roll , adhesive tape 7.5cm x10 ( mtr / roll ) , consumable , albumin for medical use , alkaline phosphatase ( alp ) dea 300 ml ( model ba 400 system ( mfg bybio system ) ) , consumable , alkaline phosphatase kit ( kinetic ) 10x2.2ml 44 test / kit consumable , alluminium foil roll , anti a sera igm ( 10 vial ) , consumable , anti ab lectin , anti abd grouping serum 3x10ml consumable , anti b sera igm ( 10 vial ) , consumable , anti d sera igg+igm 10ml vial ( each ) , consumable , anti h lectin , anti human globulin , anti d ( polyvalent ) ( 1x10 ml ) , consumable , anti h sera , antiseptic lotion 500 ml , auto clave quil , auto pippets fixed volume 10 micro liters each , auto pippets fixed volume 1000 micro liters each , auto pippets fixed volume 20 micro liters each , autoclave indicator , autoclave tape strip , b.b silk ( 12 foils / pkt ) ( 3 / 8 rcut needle 45 mm length 76 cm, size 2 / 0 ) ) , consumable , b.b silk size 3 / 0 ( 12 foils / pkt ) ( 3 / 8cir rcut needle 26mm length 76 cm ) , needle , b.b silk with 1 / 2 cir rb needle 20 mm length 75 cm non absorbable surgical suture usp size 3 0, ( 12foils / pkt ) , needle , b.b silk with 1 / 2 cir rb needle size:1 / 0 20 mm length 75 cm non absorbable surgical sutures usp surgical material , b.b. silk 6 reels x 25 mts size:1 / 0 ( 6 reels is per box rate should be quoted for 6 reels ) , surgical material , b.t. c.t. cappilary tube , baby diapers small ( 10 diaper per pkt ) , baby oxygen mask set of all sizes , bamboo stick , bed sheet single bed ( coloured ) , bed sheet single bed ( white ) , bedsheet double bed ( coloured ) , bedsheet double bed ( white ) , benedicts qualitative reagent ( 1x5 lit ) , consumable , bilirubin ( direct ) as 300 ml ( model ba 400 system ( mfg bybio system ) ) , consumable , bilirubin ( total ) 600 ml ( model ba 400 system ( mfg bybio system ) ) , consumable , bilirubin caoillary heparinised vitrex ( one packet contain 100 capillary ) , consumable , bilirubin kit ( colorimeter semi auto ) 4x60 ml 480 test / kit consumable , bilirubin standard 1x5 ml ( model ba 400 system ( mfg bybio system ) ) , consumable , bio medical waste bins yellow ( 40 ltr ) , consumable , biomedical waste collection plastic bag large ( all colours ) , biomedical waste collection plastic bag medium ( all colours ) , biomedical waste collection plastic bag small ( all colours ) , biomedical waste collection plastic dustbin large ( all colours ) , biomedical waste collection plastic dustbin medium ( all colours ) , biomedical waste collection plastic dustbin small ( all colours ) , black braided silk with 1 / 2 cir cd cutting needle 16 mm length 75 cm 3 / 0 ( 14 foils / pkt ) , black braided silk with 1 / 2 cir cutting needle 16mm length 75cm size 3 / 0 ( 12 foils / pkt ) , consumable , black braided silk with 1 / 2 cir cutting needle 30mm length 75 cm ( 1 / 0 12 foils / pkt ) , consumable , black braided silk with 1 / 2 cir cutting needle 30mm length 75 cm ( 1 / 0 12 foils / pkt ) , consumable , black braided silk with 1 / 2 cir rb needle 20 mm length 75 cm 1 / 0 13 foils / pkt , black braided silk with 1 / 2 cir rb needle 30 mm length 75 cm 2 / 0 12 foils / pkt , blanket cover 54x90 ( for cover of above size blanket ) , consumable , blanket cover 60x90 ( for cover of above size blanket ) , consumable , blood agar powder ( 500 grm ) , consumable , blood bag 100ml , blood bag 350ml , blood bag double 350ml ( as per attached specification ) , each , blood bag triple 350ml as per attached specification ( each ) , bag , blood bag triple sagam 350ml ( each ) , bag , blood bag triple sagam 450ml ( as per attached specification ) , each , blood bag with acd / cpd solution ( disposable sterilised ) with needle ( 100 ml ) , bag , blood bag with acd / cpd solution ( disposable sterilised ) with needle ( 100 ml ) , bag , blood bag with acd / cpd solution ( disposable sterilised ) with needle ( 350 ml ) , bag , blood bag with acd / cpd solution ( disposable sterilised ) with needle ( 350 ml ) , bag , blood gluose ( god / pod ) semi auto end point ( 1000 ml ) , consumable , blood grouping kit having anti sera a monoclonal ( 10 ml vial ) , anti sera b monoclonal ( 10 ml vial ) and anti sera d monoclonal ( 10 ml vial ) , consumable , blood transfusion set ( each ) , consumable , blood transfusion set ( pediatric ) , consumable , blood urea ( bun ) uv ( 1000 ml ) , consumable , blood urea reagent kit ( 200ml ( 2x100ml ) ) , consumable , blood urea ( arba ) , consumable , blood vessel introducers needles 16g, sterilized, set , bmw polybags blue colour for sizes 18kg ( as per attached specification ) , consu. , bmw polybags blue colour ( sizes 28kg ( as perspecification ) bag , bmw polybags blue colour ( sizes 45kg ( as per specification ) bag , bmw polybags blue colour ( sizes 5kg ( as per specification ) bag , bmw polybags red colour for sizes 18kg ( as per specification ) bag , bmw polybags red colour ( sizes 28 kg ( as per specification ) bag , bmw polybags red colour ( sizes 45 kg ( as per specification ) bag , bmw polybags red colour ( sizes 5kg ( as per specification ) bag , bmw polybags yellow colour for sizes 18kg ( as per specification ) bag , bmw polybags yellow colour ( sizes 28kg ( as per specification ) bag , bmw polybags yellow colour ( sizes 45kg ( as per specification ) bag , cannula fixer set consumable , capillary tube 100 pieces consumable , carbolic acid phenol ( 500ml ) , consumable , catgut chromic size:2 / 0 length 150 cm , catgut chromic with 1 / 2 cir cutting needle 12mm ( length 70cm no.3 0, 12 foils per pakt ) , consumable , catgut chromic with 1 / 2 cir rb needle 30 mm length 70cm no. 1 0, 12 foils per packet , catgut chromic with 1 / 2 cir rb needle 30 mm length 70cm no. 1 0, 12 foils per packet ( needle 30 mm length 70cm no. 1 0, 12 foils per packet ) , consumable , catgut chromic with 1 / 2 cir rb needle 40 mm length 75cm no. 1 consumable , catgut chromic with 1 / 2 cir rb needle 40 mm length 75cm no. 2 consumable , catgut chromic with 1 / 2 cir rb needle 40 mm length 75cm no. 2 consumable ( each ) , consumable , chair cushion box type , chair cushion box type ( 18 inch x 18 inch ) , consumable , chair cushion cover , chair cushion cover ( 19 inch x 19 inch ) , consumable , cholesterol hdl direct 160 ml ( model ba 400 system ( mfg bybio system ) ) , consumable , cholesterol kit end point enzymatic kit 50 test / kit , cholesterol kit end point enzymatic kit 5x20ml 200 test / kit , chromic ( 12 foils / pkt ) ( 3 / 8 rb needle 30 mm, length 76 cm, size 2 / 0 ) , needle , chromic ( 12 foils / pkt ) ( 3 / 8 rb needle 30 mm, length 76 cm, size 2 / 0 ) , needle , chromic catgut ( 12 foils / pkt ) ( size:1 / 0 length 150 cm ) , consumable , chromic catgut , round body needle no. 1.0 , chromic catgut monofilament with 1 / 4 circle reverse cutting needle 6 0 ( 12 / pkt ) , chromic catgut no 1.0 round dody, 40 mm 12 foils / pkt , chromic catgut suture ( 12 foils / pkt ) ( 3 / 8 cir r cutting needle 19 mm needle, suture length 76 cm size 4 / 0 ) , needle , chromic catgut suture ( 3 / 8 cir rcutting needle 16 mm, suture length 76 cm ( 5 / 0 12 foils / pkt ) ) , sutures , chromic size 1, ( 12 foils / pkt ) ( 1 / 2 cir rb needle 40 mm, length 76 cm ) , needle , chromic size 1, ( 12 foils / pkt ) ( 1 / 2 cir rb needle 40 mm, length 76 cm ) , needle , chromic size 1, 12 foils / pkt ( 1 / 2 cir rb needle 45 mm, length 100 cm ) , needle , chromic size 1 / 0 ( 12 foils / pkt ) ( 3 / 8 cir rb needle 40 mm, suture length 76 cm ) , needle , chromic with 1 / 2 cir rb needle absorbable surgical suture ( 12 foils / pkt ) ( 40 mm length 76 cm size:1 / 0 , surgical material ) , consumable , chromic with 1 / 2 cir rb needle 30 mm length 76cm, 2 0 usp, absorbable surgical suture surgical material ( 12 foils / box ) , surgical material , chromic with 1 / 2 cir rb needle 40 mm length 76 cm ( with needle ) ) absorbable surgical sutures usp, ( size 1, 12 foils / pkt ) , surgical material , chromic with cd rb needle 30 mm length 76 cm size:2 / 0 ( absorbable surgical suture surgical usp, 12 foils / boxmaterial ) , surgical material , chromic with st rb needle ( 12 foils / pkt ) ( 60 mm length 76 cm size:2 / 0 ) , consumable , close wound drainage device under negative pressure ( closed wound suction unit ) size 200 ml ( catheter size 16, each ) , consumable , close wound drainage device under negative pressure ( closed wound suction unit ) size 200 ml ( catheter size 18, each ) , consumable , cloth based surgical adhesive tape roll ( 1 inch x 5 mtr / roll ) , consumable , cloth based surgical adhesive tape roll ( 6 inchx10m / roll ) consum. , compounder coat / lab tec / xry tec ( std size ) , consumable , compunder dress ( male ) , conc hcl ( 1x500 ml = 500 ml ) , consumable , conventional medical x ray film polyster based imaging film 30.5cmx 30.5 cm ( 12x12 ) ( size 50 sheet ) , consumable , conventional medical x ray film polyster based imaging film 35.6cm x43.2 cm ( 14x17 ) ( size 50 sheet ) , consumable , conventional medical x ray film polyster based imaging film 35.6cmx35.6 cm ( 14x14 ) ( size 50 sheet ) , consumable , conventional x ray film 10x12 ( 50 sheet ) , consumable , conventional x ray film 12x15 ( 50 sheet ) , consumable , conventional x ray film 8x10 ( 50 sheet ) , consumable , cotton crape bandage 10cm x 4m ( box of 10 bandages ) , cotton crape bandage 15cm x 4m ( box of 10 bandages ) , cotton delivery belt , cover slip 18 x 18 mm 10gm , cover slip with isi marked size:18x18mm ( + / 1.00mm ) , thikness 0.13.. to 0.17mm ( pkt of 50 pieces ) , consumable , cover slip with isi marked size:18x18mm ( + / 1.00mm ) , thikness 0.13.. to 0.17mm ( pkt of 50 pieces ) , consumable , cpk mb kit ( kinetic ) ( 25 test / kit ) , consumable , cr system film ( size 10x12 ) , consumable , cr system film ( size 14x17 ) , consumable , cr system film ( size 8x10 ) , consumable , creatine calorimeter for semi auto kinetica 4x60ml 480 test kit , creatinin kit , crp kit 1x100 biolab qualitative ) , crp latex slide per test , crp test kit ( latex / card ) ( 25 test / kit ) , crp test kit ( latex / card ) , kit of 25 tests ( mfg pathogyme diagnostics ) ( 25 test / kit ) , consumable , crp test kit ( latex / card ) , kit of 25 tests, consumable , cumb sera , curtain green redymade , curtain green redymade ( 45 inch x 60 inch ) , consumable , curton cloth rangeen , curton cloth rangeen design , cyanemeth solution for hb ( 5 litre ) , consumable , dengu card antigen ( 25 card / pkt ) , consumable , dengue card test 100 test kit , dengue ns 1 elisa ( antigen ) kit ( pack of 96 / as per attached specific ation in tender ) , consumable , dengue ns 1 elisa ( antigen ) kit ( pack of 96 / as per attached specific ation in tender ) , consumable , developer powder ( 22.5 ltr ) , diagnostic strips for urine sugar / albmin packing: 100 strip / pkt , diagnostic strips for urine sugar / albmin packing: amber colored, 100 strips / pkt ( packet ) , consumable , dialysis starting kit disposable:a ) sterile tray with top ( disposable ) , size not less than 30x30cm b ) sterile drape size not less than 45x45 cm 1no c ) cotton ball 6 no d ) cotton gauze pieces 1 , digital x ray film 10x12 ( 150 films / pkt ) , digital x ray film 11x14 ( 150 films / pkt ) , digital x ray film 8x10 ( 150 films / pkt ) , dionised water 5 ltr cane ( each ) , disposable appron , disposable cap , disposable cresent knife ( 2.2mm ) , consumable , disposable drape for eye surgeory ( each ) , consumable , disposable examination gloves made of natural rubber latex, pre powdered, non streile medium , disposable examination gloves made of natural rubber latex, pre powdered, non streile small , disposable examination gloves made of natural rubber latex, pre powdered, non streile, conforming to is 15354:2003 and amendment thereof. size: large , disposable keratom knife ( 2.8mm ) , consumable , disposable keratom knife ( 3.2mm ) , consumable , disposable needle 20 g no ( isi marked needle ) , consum. , disposable needles 0.4 mm ( for insulin pen ) , disposable needles 22g consumable , disposable needles is 10654:2002 22g , disposable needles is 10654:2002 24g , disposable needles is 10654:2002 26 g ( ) , needle , disposable needles is 10654:2002 ( 23g ) , needle , disposable needles ( is 10654:2002 22g ) , surgical material , disposable paper gloves size 7 inches consumable , disposable paper gloves size 7, 1 / 2 inches consumable , disposable plastic appron ( full size ) , disposable pricking lancet ( pkt of 200 units ) , consumable , disposable pricking lancet 100 units consumable , disposable scalp vein set size 22 no ( each ) , consumable , disposable scalp vein set ( size 20 no ) , consumable , disposable sharp collection containers 1.5 l , disposable sharp collection containers 5 ltr , disposable sharp collection containers ( 5 ltr ) , consumable , disposable sideport knife ( num ) , consumable , disposable spinal ( l.p. ) needle ( 25g ) , surgical material , disposable spinal needle ( 22 no ) , each , disposable spinal needle ( 23 no ) , each , disposable sterile gloves isi marked surgical rubber made of hypoallergic latex 100% , electronically tested sterilized by gamma irradiation / eto is no:13422:1992 as amended upto, powder free 6 inch / pair ( pair ) , consumable , disposable sterile gloves isi marked surgical rubber made of hypoallergic latex 100% , electronically tested sterilized by gamma irradiation / eto is no:13422:1992 as amended upto, powder free 6.5 inch / pair ( pair ) , consumable , disposable sterile gloves isi marked surgical rubber made of hypoallergic latex 100% , electronically tested sterilized by gamma irradiation / eto is no:13422:1992 as amended upto, powder free 7 inch / pair ( pair ) , consumable , disposable sterile gloves isi marked surgical rubber made of hypoallergic latex 100% , electronically tested sterilized by gamma irradiation / eto is no:13422:1992 as amended upto, powder free 7.5 inch / pair ( pair ) , consumable , disposable sterile gloves size 6 inches consumable , disposable sterile gloves size 6, 1 / 2 inches consumable , disposable sterile gloves size 7 inches consumable , disposable sterile gloves size 7, 1 / 2 inches consumable , disposable sterile hypodermic syringe 10ml ( each ) , consumable , disposable suction catheter assorted covering all sizes 10, 12, 14, 16, 18 consumable , disposable suction catheter ( size 12 ) , consumable , disposable suction catheter ( size 14 ) , consumable , disposable surgeon cap with cable tie ( each ) , consumable , disposable surgeon cap ( box of 100 caps ) , disposable syringe ( for vitamin k inj ) ( 1ml with needle 26g ) , consumable , disposable syringe with needle ( 2ml each ) , syrings , disposable syringe with needle ( 3ml each ) , syrings , disposable syringe with needle ( 5ml each ) , needle , disposable three layer surgical mask ( as per attached specification ) , mask , disposable ( 24 g each ) , needle , dohar readymade made by cotton thread ( 54x90 ) , consumable , dressing pad , dual testing kit for hiv and syphilis screening, rapid diagnostic test kit ( total no. of test 900000 ) , consumable , duster ( 39x39 ) , consumable , dynaplast 10 cm. , ecg jelly 250 gms , ecg paper ( chemical coated ) ( 80mmx 20 mtr each ) , consumable , ecg paper computerizesd triple channel 20m , ecg paper ( chemical coated ) 50mm x 30 mtr. roll , ecg paper ( chemical coated ) ( 50mm*20 mm roll ) , each , ecg paper ( wax coated ) heavy quality 50mm x 30 mtr / roll , ecg paper ( wax coated ) mfg by life o line technologist ( 50mm x 30 mtr, roll ) , consumable , ecg paper ( wax coated ) ( 50mm x 30 mtr, roll ) , consuma. , ecg roll three channel 20m , echo jelly 20ml bottle , echo jelly 250ml bottle ( bottle ) , jelly , edta k3 vial each , edta solutions k3 ( 500 ml bottle ) ( bottle ) , consumable , egc roll ( 66 mm x 15 mm ) , consumable , endotracheal tube internal with radioopaque line ( dia 2.5 mm to 5 mm, each ) , consumable , endotracheal tube introducer ( stylet ) ( make teleflex medical model rusch & 503700 000140 ) , consumable , endotracheal tube no 3 ( uncuffed ) , consumable , endotracheal tube no 4.5 ( uncuffed ) , tube , endotracheal tube no 5.0 ( uncuffed ) , tube , endotracheal tube no 5.5 ( uncuffed ) , each , endotracheal tube no 6.0 ( uncuffed ) , each , endotracheal tube no ( 2.5 ( uncuffed ) ) , tube , endotracheal tube no ( 3.5 ( uncuffed ) ) , tube , endotracheal tube no ( 4.0 ( uncuffed ) ) , tube , endotracheal tube no. 2.5 to 5 ml. , endotracheal tube no. 6 , endotracheal tubes size 9.5 cuffed should have low pressure high volume cuff and radio opaque line ( size 9.5 , each ) , consumable , face sheild ( as per specification ) , consumable , falcon tube , falcon tube ( conical bottom ) ( 50ml each plastic containers with air tight screw cap printed graduation ) , consumable , feeding tube ( catheter ) 10g , feeding tube ( catheter ) ( 10 g, each ) , consumable , field stain a ( 500ml ) , digonstic , field stain b ( 500ml ) , consumable , filter paper sheet ( ( whatmann no 01 ) sheets ) , consumable , filter paper ( 12.5 cm, 0.1 micron, 50 / pkt ) , consumable , fixer: it shall be powder fixer to produce clean radiographs available in pack size size: 13.5 ltr , fixer: it shall be powder fixer to produce clean radiographs available in pack size size: 9 ltr , foleys catheter size 12 2 way ( 10 each ) , consumable , foleys catheter size 14 2 way , foleys catheter size 14 3 way , foleys catheter size 16 2 way ( 11 each ) , consumable , foleys catheter size 18 2 way , foleys catheter size 20 2 way ( 12 each ) , consumable , foleys catheter size 22 2 way ( 13 each ) , consumable , foleys catheter size 24 2 way ( 14 each ) , consumable , foleys urinary catheter 2 way size 8 , foleys urinary catheter silkolatex 2 way sterile, non toxic size 10 , follyscathator ( pediatrics ) , consumable , follyscathetor 8 no ( pediatrics ) , consumable , folys catheter ( size 16 plain ) , consumable , formaldehyde 40% ( conc. formaline ) ( 1 x 30 lit ) , consumable , formaldehyde solution ( analytical grade 500ml ) , consumable , front aprin ( std size ) , consumable , g6pd deficiency test kit ( mfg pathogyme diagnostics ) ( 10 test / kit ) , consumable , g6pd deficiency ( test kit 10 test ) , consumable , garam coat / woolan saluka sup.quality ( std.size ) , consumable , gel matrix cross match card , gel matrix group card , gel pack , gents livirise set redymade ( pent+shirt+topi ) ( std.size ) , consumable , glacial acetic acid ( 2.5 liter ) , consumable , glass slide 75mm x 25mm 1.1 mm , glass slide 75mm x 25mm 1.35 mm , glass slide with isi mark at least 75mm x 25 mm thicknss at least 1.1mm, detail specifications i with smooth edges, without any scrathtches. ii glazed glass.iii no visual or chromatic abbretions ( 50 slides / packet ) , consumable , glass test tube 12 x 100 ( medium size ) heavy quality 100 / pkt , glass test tube 12 x 75 ( small size ) ( heavy quality 100 / pkt ) , tube , glass test tube 5 without edge , glucometer strip ( 1x100 ) , glucose kit ( god / pod ) ( 350ml, digonstic ) , consumable , glucose phosphate broth ( 100 gm ) , consumable , gram iodine ( gram stain ) ( 100ml bottle ) ( bottle ) , consumable , gram staining kit ( crystal ) ( 125ml x 4 ) , consumable , h2so4 ( sulphuric acid ) ( 25% 500 ml bottle ) , consumable , hand wash liquid , hba ag elisa 96 kit 1x96 ( each ) , consumable , hba ag rapid card test ( each ) , consumable , hbs antigeng kit card ( pack of 10 card test with 10 dropper, 1 buffer solution, 10 pricking lancet and 10 alcohol swab ) , digonstic , hbv rapid test kit quantity is in no. of test card only ( andrate should be quoted for one test card ) , consumable , hcl n / 10 ( 500 ml bottle ) , hcv elisa ( 96 test kit ) , consumable , hcv kit card test ( 25 test / kit ) , digonstic , hdl kit ppt ( 2x50ml 200 test / kit ) , consumable , heamoglobin colour scale book with special strip complete ( 1 x 200 ) , consumable , hematology cell counter reagents as per requirement of cell counter cleaning solution 100 ml , hemoglobin color scale ( starter kit ) components ( 1 ) color scale 01 / kit ( 2 ) test strip 1000 / kit ( 3 ) printed literature for method of use / kit ( 4 ) lancet 1000 / kit , hiv ( rapid ) ( whole blood finger prick test kit ) , consumable , hiv elisa kit ( hiv micro elisa ag+ab 4th generation ) ( 96 test kit ) , consumable , hiv elisa test kit, pack size 96 wells per kit ( 1 kit containing 96 wells ) , consumable , hiv kit card ( 25 test / kit ) , hiv kit card ( 25 test / kit ) , kit , hole sheet ( 39x39 ) , consumable , hub cutter non electric lockable safety portable box for disposal of hypodemic needles. consumable , hydrogen peroxide ( conc. ) h2o2 ( 500 ml ) , consumable , i.v cannula ( two way ) size ( 16 nos ) , consumable , i.v cannula for single use ( intravascular catheters ) bis ( gauze 22, length 25 ) consumable ( each ) , consumable , i.v cannula size with inj. valve ( port ) ( 22g ) , consumable , i.v cannula size with injec. valve ( port ) ( 18g ) , consum. , i.v. cannula with injection valve ( 20g ) , consumable , i.v. cannula with injection valve ( size 24 g ) , consumable , ice pack ( 8 length x 6 widgth ) ( 200gm ) , consumable , identification tag , infant feeding tube ( catheter ) size: 3g , infant feeding tube ( catheter ) size: 4g , infant feeding tube ( catheter ) size: 5g , infant feeding tube ( catheter ) size: 6g , infant feeding tube ( catheter ) size: 8g ( each ) , consumable , infant feeding tube ( 10 g each piece, each ) , consumable , infant feeding tube ( 7g each piece, each ) , consumable , infant feeding tube ( size: 6g ) , consumable , infant mucus extractor sterile pvc ( each ) , surgical material , insulin syringe / each ( graduation upto 100 units ) 30 g needle, 40 units / ml ( 30 g needle, 40 units / ml ) , syrings , intravenous set with airway and needle ( children ) ( surgical material ) , consumable , intravenous set with airway and needle ( ( adult ) ) , surgical material , iv cannula ( two way ) size 20 , iv cannula ( two way ) size 22 , iv cannula ( two way ) size 24 , iv cannula size 26g ( ) , consumable , iv cannula with inj valve ( 16g ) , consumable , iv cannula with inj.valve ( port ) ( size 26g ) consumable , k3 blood vaccutainer ( edta 100 tubes / pkt ) , consumable , kellys pad disposable , kellys pad ( rubber / each ) , consumable , ladies livery set saree white polyester green / blue border with blouse ( 6.50 mtr ) , consumable , ladies livirise set redymade saree whote polyster green / blue border ( saree + blouse + peticot ) ( std.size ) , consu. , laryngo scope bulb , latex examination gloves ( large ) ( 100 / pkt ) , consumable , latex examination gloves ( medium ) ( 100 / pkt ) , consumable , latex examination gloves ( small ) ( 100 / pkt ) , consumable , ldh kit pack ( 50 ml bottle ) , consumable , leishman stain ( 500 ml bottle ) , consumable , liquid paraffin 50ml ( bottle ) , consumable , livery set pants and shirt without stitching ( 3 meter cloth ) , consumable , mackintosh ( as per attached specification ) , quantity amended as 136940 meter i.e. 6847 roll of 20 meter roll, rate should be quoted for 20 meter ( is 8164 1976 or conforming to is 8164 1976 ) , consu. , malaria antigen card pf / pv card ( as per nvbdcp guidelines ) ( 10 card, 10 dropper, 1 buffer solution ) , malaria antigen, p vivax, p falciparum rapid diagnostics bivalentt test card ( as per gio nvbdcp specification ) pack of 10 card test with 10 dropper, 1 buffer solution, 10 pricking lancet, and 10 alcohol swab , malaria bivalent antigen detecting rapid diagonstic tests ( rdts ) for p.f and pv ( 10 card, 10 capillary, 1 buffer solution, 10 alcohol swab, 10 sterile lancet ( 0.15 mm to 0.75mm diameter needle based lancet mounted on small non metallic pedastal for pricking, ( pack of 10 test., rate shall be quoted for pack of 10 ) , specification attached ) , consumable , malaria card ( antigen ) atleast 100 microbes / desi ltr. for both species , malaria pf / pv antigen card , malaria pf / pv rapid test , matresses 3x6 with raxine cover 4 density , mattress 10 kg. cotton ( 3x6 ) , consumable , mattress 5kg cotton 3 ft x 6 ft , mattress 5kg cotton ( 3 ft x 6 ft ) , consumable , mattress cover 3x6 ( for cover of above size mattress ) , consuma. , measure volume ( drip set ) , each , methyline blue ( 100 ml ) , solution , micro centrifuge tube 0.5 ml, polypropylene tubes, resistance to chemicals, mechanical stress and temperature extremes, ( autoclavable, dnase, rnase / endotoxin free ) , consumable , micro pipet 1000 fix and variable each , micro pipette tips 5 300ul ( 100 per pack ) , consumable , micro volume ( drip set ) , digonstic , microcentrifuge tube rack ( 20 tube / 24 tube capacity ) ( for 1.5 / 2ml tube ) , consu. , microcentrifuge tube rack ( 80 tube / 96 tube capacity ) reversible one side for 1.5ml tube and other ( side with 0.2 ml pcr tubes ) , consumable , micropiptte 100 1000 , microtips ( 2 200 ul ) 1x1000 ( each ) , consumable , n / 10 hcl 500ml , n 95 mask ( without exhalation valve ) ( as per specification ) , consum. , n 95 mask with valve, consumable , napkin sup. quality std size ( coloured ) , napkin sup. quality std size ( white ) , nebulization mask kit ( pediatrics ) , nebulization mask kit ( pediatrics ) , consumable , nebulization mask kit ( adult ) , nebulization mask kit ( adult ) , mask consumable , new born baby kit ( [ 4 piece set ] ) , consumable , non absorbable braided silk black ( 12 mm 3 / 8 circle reverse cutting micropoint 38 cm ) , consumable , non latex purple nitrile gloves ( as per attached specification ) ( large ) , consu. , non latex purple nitrile gloves ( as per attached specification ) ( medium ) , consu. , nutrient agar ( 500 grm ) , consumable , nutrient broth ( 500 gm ) , consumable , oxygen mask adult ( standard size ) , mask , oxygen mask paediatric ( standard size ) , mask , paediatric drip set ( set ) , digonstic , paper adhesive microporous surgical tape 3 inch x 5 m / roll ( 10 roll / pkt ) ( 3 inch x 5 m / roll ( 10 roll / pkt ) ) , consumable , paper adhesive plaster microporous surgical tape 1 inch x 9 m / roll ( 1 inch * 9 m / roll ( iso 13485:2016 ) ) , consum. , paper adhesive plaster microporous surgical tape 2 inch x 5m / roll , paper adhesive plaster microporous surgical tape 6 inch x 10 m / roll , paper adhesive plaster microporous surgical tape ( 2 inch x 5m / roll ) , consumable , paper adhesive plaster microporous surgical tape ( 4 inch x 9 m / roll ( iso 13485:2016 ) ) , consumable , paper adhesive plaster microporous surgical tape ( 6 inch x 5m / roll ) , consumable , para film sealing film, quantity 510 roll, rate should be quoted for per roll, parafilm, 100 mm width, 58m length, should withstand at temprature between 40deg c to +50deg c ( 100 mm width, 58m length ) , consumable , paraffin strip roll , patient suit for male / female ( std size ) , consumable , peadiatric drip set , peticote blouse cloth shuti rangeen , peticote / blouse cloth shuti bleach , pillow 1 kg. cotton ( 14x21 ) , consumable , pillow cover cloth bleach , pillow cover sup. quality ( 17 inch x 27 inch ) , consumable , pillow with 2kg cotton , pillow with 2kg cotton ( 16 inch x 26 inch ) , consumable , plain disposable vial 3ml ( each ) , consumable , plain vial with screw cap ( 12x75 ) , consumable , plaster of paris 410x5mtr , plaster of paris 6 15x 5mtr , plaster of paris bandage 10 cm x 2.7 mtr / roll, bandage , plaster of paris bandage 15cm x 2.7mtr / roll, bandage , plastic gloves ( large size ) , consumable , platelet dilution fluid ( 100 ml ) , consumable , poc kit for syphilis ( as per attached specification ) ( 10 test per pack ) , cons. , pregnancy test card ( 10 card pack ( mfg oscar medicare pvt ltd ) ) , consumable , ra factor 50 test kit qualicative , ra factor rapid kit ( 25 test / kit ) 1: ) should be based on latex agglutination slide test. 2: ) qualitative and semiquantitative testing facility possible. 3: ) test speed must be less than 2 minutes , ra factor rapid kit 1 ) should be based on latex agglutination slide test 2 ) qualitative and semi quantative testing facility possible 3 ) test speed must be less than 2 minutes ( 25 test / kit ) , consumable , rajai with cotton ( 60x90 ) , consumable , rangeen baag print kapda , rangeen design towel beev kapda , rangeen design weft stripe kapda , rbc dialuation fluid ( 500 ml bottle ) , consumable , reagent for hdl cholestrol test ( 100 ml ( 4 x 25 ) ) , consu. , reuse prevention syringe sterile single use reuse preve ntion syringe with detachable needles compliance to iso 7886:4 type i and b, flow wrap / blister pkg using medical grade breathable paper, eto sterilized ( 3ml ) , cons , reuse prevention syringe sterile single use reuse preve ntion syringe with detachable needles compliance to iso 7886:4 type i and b, flow wrap / blister pkg using medical grade breathable paper, eto sterilized ( 10ml ) , consumable , reuse prevention syringe sterile single use reuse preve ntion syringe with detachable needles compliance to iso 7886:4 type i, b, flow wrap / blister pack using medical grade breathable paper, eto sterilized ( 5ml ) , syrings , reuse prevention syringe sterile single use reuse preve ntion syringe with detachable needles compliance to iso 7886:4 type i, b, flow wrap / blister pack using medical grade breathable paper, eto sterilized ( 2ml ) , consu. , rib belt large ( each ) , each , rib belt medium ( each ) , each , rib belt small ( each ) , each , rpr test kit ( 100 test ) , kit , ryles tube ( pvc ) size : adult ( 18, each ) , tube , ryles tube ( pvc ) size : adult: 16 ( each ) , consumable , ryles tube ( pvc ) size ( children: 10 ) , consumable , ryles tube ( pvc ) size ( children : 12 ) , tube , ryles tube ( size 14 each piece ) , consumable , safe delivery kit 1 plastic desposable gown ( non woven plastic laminated, leak proof ) 2 ( 4*4 ) , ( 2 ) disposable goggles for protection of eyes 2 ( free size ) , ( 3 ) face mask 2 free size ( 4 ) plastic disposable cap ( non woven plastic laminated, leak proof ) ( ( 1pair, ( 5 ) long gloves elbow length 2pairs ( 6 1 / 2 and 7 ) ( 6 ) disposable shoe covers till calf ( plastic ) 2pair umbical cord clamps plastic material ( 1pair ) ( free size ) ( as per attached specification ) , consumable , safranine ( gram stain ) ( 500 ml bottle ) , consumable , salt testing kit ( as per attached specification , kit ) , consum. , sanitary napkins ( as per attached specification / pack of 6 pads ) , consum. , scalp vein set ( size 24g, disposable , each ) , consumable , serum amylase ( 2x25 ml ) , consumable , serum creatinine ( 100 ml bottle ( 2 x 50 ml ) consumable , serum electrolyte kit ( 50test per kit ) , consumable , serum t3 kit, elisa ( 96 test kit each ) , consumable , serum t4 kit, elisa ( 96 test kit each ) , consumable , serum tsh kit, elisa ( 96 / pkt ) , consumable , sgot ( 25 ml ) , consumable , sgpt100 ml ( 4 x 25 ) , consumable , sicklewive test kit , silicon mask adult size 3 with connection tube, reservoir bag and valve, high concentration, adult ( bains circuit ) ( make life o line technologist ) , consumable , silicon mask adult size 4 with connection tube, reservoir bag and valve, high concentration, adult ( bains circuit ) ( make life o line technologist ) , consumable , silk no 1 cutting needle 1x12 ( 1x12 ) , consumable , silver nitrate solution 1 ltr. , simcoe i / a cannula, direct, ( num ) , consumable , single blood bag ( as per attached specification ) , each , single umbilical catheter with leur lock ( fr 2 to fr2.5, l 40 cm ) consu , single umbilical catheter with leur lock ( fr 3 to fr3.5, l 40 cm ) consu. , single umbilical catheter with luer lock stopcock ( fr 4, l 40cm ) cons. , single umbilical catheter with luer lock stopcock ( fr 5, l 40cm ) cons. , slide blue star , sodium citrate 3.8% ( 500 ml bottle ) , consumable , sodium hypochlorite solution 5% ( 500 ml bott ) , consum. , spinal ( l.p. ) needle disposable ( 24g ) , consumable , spinal needle 26 g ( each ) , needle , spinal needle no. 23 , spirit lamp , sputum container ( 100 per box ) , consumable , steralised and autoclavable culture tube flat bottom, 15 ml ( plastic ) each ( 15 ml ) , consumable , steralised and autoclavable culture tube flat bottom, 5ml ( plastic ) consu. , sterile hypodermic syring with needle 20 ml , sterile hypodermic syring with needle ( 5 ml ) , syrings , sterile hypodermic syringe with needle 10 ml , sterile hypodermic syringe with needle, mfg by ph health care pvt ltd ( 20 ml ) , consumable , sticker type a blue color ( as per attached specification ) , consumable , sticker type b pink color ( as per attached specification ) , consumable , suction catheter assorted 10 no / each , suction catheter assorted 9 no / each ( each ) , consumable , suction catheter, sterile ( size fg 20 ( disposable, sterile each ) consum. , suction catheter, sterile ( size fg 22 ( disposable, sterile each ) ) , consum. , suction catheter, sterile ( size fg 6 ( disposable, sterile each ) ) , consum. , surgeon gown ( std size ) , consumable , surgical blade 15 no ( 100 / pkt ) , surgical material , surgical blade isi marked, size 15 ( 100 per packet ) , surgical material , surgical blade isi marked, size 22 ( 100 / pkt ) , surgical material , surgical blade isi marked, size 23 ( 100 / pkt ) , surgical material , surgical blade isi marked, size 24 ( 100 / pkt ) , surgical material , surgical blade isi marked, size 25 ( 100 / pkt ) , surgical material , surgical blade, size 11 , surgical spirit ip ( 500 ml ) , bottle , suture mersilk 8 0 ( 12 foil ) , synthetic absorbable suture 1 with 1 / 2 circle round body needle ( h ) size :1 40mm length 90cm polyglycolic acid ( pga ) ( 12 foils per pkt ) ( size :1 40mm length 90cm polyglycolic acid ( pga ) ( 12 foils per pkt ) ) , consumable , synthetic absorbable suture 2 / 0 with 1 / 2 cir rb needle size:2 / 0 30mm length 90cm polyglycolic acid ( pga ) 12 foils / pkt ( 12 foils per pkt ) , needle , synthetic absorbable suture 3 / 0 with 1 / 2 cir cutting needle ( size:3 / 0 36mm length 70cm polyglycolic acid ( pga ) 12 foils / pkt ) , needle , synthetic absorbable suture 3 / 0 with cd cutting needle size : 3 / 0 22mm length 45cm polyglycolic acid ( pga ) ( 12 foils per pkt ) ( needle circle size is 1 / 2 circle ) , needle , synthetic absorbable suture 4 / 0 with 1 / 2 cir rb needle size:4 / 0 20mm length 70cm poly glycolic acid ( pga ) ( 12 foils / pkt ) ( size:4 / 0 20mm length 70cm poly glycolic acid ( pga ) ( 12 foils / pkt ) ) , needle , syringe with luer lock technology ( 10 ml syringe ) , syrings , syringe with luer lock technology ( 5 ml syringe ) , syrings , table cloth rangeen ( large ) , table cloth rangeen ( small ) , table cloth ( 45x60 ) , consumable , tape roll , tericot sharee , test tube 12 x 100 ( medicm size ) 100 / pkt , test tube 12 x 75 ( small size ) 100 / pkt ( 12 x 75 ( small size ) 100 / pkt ) , tube , test tube 15x125 , test tube stand, polypropylene, 3 tier ( for keeping 10 ml vtm vials / tier ) , consumable , thermacol box , thermacol box for falcon tube ( box size should contain minimum 2 falcon tube ( 9x6x6 ) ( box size should contain minimum 2 falcon tube ( 9x6x6 ) ) , cons. , three layer surgical mask , three way conector ( 100 mm extention ) , consumable , three way stop ( cock ) , consumable , tips for auto pipettes 2 to 100 micro litres 1000 / pkt ( 2 to 100 micro litres 1000 / pkt ) , each , tips for auto pipettes 200 to 1000 micro litres 500 / pkt ( 200 to 1000 micro litres 500 / pkt ) , each , tips for auto pippetes 10 to 100 micro litres , tissue paper roll ( each ) , consumable , titaniumchemo port with silicon catheter ( 8 9.6 fr ) length 60cm 80cm, guide wire, peel away desilet, hubsite needle ( 22 g * 20 25.4mm ) , consu. , titanium adapter ( each ) , consumable , tooke corneal knife ( num ) , consumable , top and bottom bags ( for leukoreduction ) , consumable , total protein test kit ( 2x100 ml ) , consumable , tourniquet with belt ( good quality pairs ) , pairs , triglyceride kit enzymetic ( 5x20ml 200test / kit ) , consum. , triway cannula ( 3 way stop cock ) , consumable , typhoid card test kit ( for igg and igm antibody detection ) ( 25 test kit ) , typhoid test card ( an immunochromatography assay for the rapid visual detection of typhoid antibody igg / igm in human serum / plasma ) ( 50 test per pack ) , consumable , typhoid test card. , umbical cord clamps plastic material ( box of 100 clamps ) , consumable , umbical cord clamps ( plastic material ) , consumable , umblical cotton tape length 75cm. , urea kit berthelot ( 100 test / kit ) , consumable , uric acid ( 50 ml ( 2 x 25 ml ) , consumable , urinary drainage bag ( paediatric ) ( 100 ml / each ) , consum. , urinary drainage bag cap with non return valve ( eo sterile ) ( 2 litre, each ) , consu. , urine albumin & suger , urine bag 2 ltr. , urine container 5ml disposable ( 50 per pkt ) , urine container size of the container shall be 30ml disposable ( 50 per pkt ) , consumable , usg gel ( 250 ml bottle ) , consumable , usg thermal paper , utility gloves ( large ) , consumable , utility gloves ( medium ) , consumable , vdrl ( rpr ) 1x100 sd strip , vdrl kit ( strip ) ( 50 test / kit ) , consumable , vial 5ml, vial test tube, leak proof, ungraduated, polypropyl ene / polyethylene capacity 5ml each ( each ) , consumable , vicryl no. 1 rb , vicryl no. 2.0 rb , who hemoglobin color scale ( starter kit ) components ( 1 ) colour scale 01 / kit ( 2 ) test strip 1000 / kit ( 3 ) printed literature for method of use / kit ( 4 ) lancet 1000 / kit 10x100 ( nabl / cap accrediated lab test certificate for the batch no. must be enclosed with each supply delivered ) , consum. , widal 2x2 sera slide kit , widal 2x2 tube test kit , widal 4x5 ml , widal slide test ( 4x5ml with control ) , consumable , x ray film 08 x 10 50 sheets / pack , x ray film 10 x 12 50 sheets / pack , x ray film 12 x 12 50 sheets / pack , x ray film 12 x 15 50 sheets / pack , x ray film fixer ( powder to make 13.5 liters pkt ) , consu. , x ray film fixer ( powder to make 9 liters pkt ) , consuma. , x ray related , zipper polybag...

Directorate Of Health Services - Madhya Pradesh

38182360 supply of drug medicines supply of drugs medicines, consumble equipment and other item for the year 2023 24 , aceclofenac 100mg + paracetamol 325mg + chlorzoxazone 250mg tablet , aceclofenac 100mg + paracetamol 325mg + serratiopepdise10mg tablet , aceclofenac 100mg + paracetamol 325mg tablet , aceclofenac 100mg tablet , aceclofenac 50mg + paracetamol 125mg 60mlsyrup , aceclofenac 50mg/5ml syrup , acetazolomide 250mg tablet , acyclovir 200mg tablet , acyclovir 250mg injection , acyclovir 400mg tablet , acyclovir 500mg injection , acyclovir 800mg tablet , albendazole 200mg/5ml 10ml syrup , albendazole 400mg tablet , amikacin 100mg 2ml injection , amikacin 250mg 2ml injection , amikacin 500mg 2ml injection , amiodarone 100mg tablet , amiodarone 200mg tablet , amiodarone hydrochloride injection(50mg /ml) 3ml , amlodipine 10mg tablet , amlodipine 2.5mg + ramipril 2.5mg tablet , amlodipine 2.5mg tablet , amlodipine 5mg + atenolol 50mg tablet , amlodipine 5mg + ramipril 2.5mg tablet , amlodipine 5mg tablet , amoxicillin + clavulanic acid tablet kid 228mg. , amoxicillin 1000 + clavulanic acid 200mg tablet , amoxicillin 200mg + clavulanic acid 28.5 30 ml syp , amoxicillin 500mg + clavulanic acid 125mg tablet , amoxicillin 500mg + clavulanic acid 125mg+lactobaciluss 60 million spores , amoxycillin 1000mg+ potassium clavulanate 200mg injection , amoxycillin 250mg + potassium clavulanate 50mg injection , amoxycillin 500mg+ potassium clavulanate 100mginjection , amoxycillin trihydrate disp. tab. 125mg. , amoxycilline 250mg cap , amoxycilline 500mg cap , amoxycilline 5ml/125mg30 ml syp , amoxycilline injection 250mg , amoxycilline injection 500mg , amphotericin b 50mg. inj. , ampicilline + cloxacilline injection(250 mg +250mg ) , ampicilline + cloxacilline injection(500 mg +500mg) , ampicilline 125mg+ cloxacilline 125mg cap , ampicilline 250mg + cloxacilline 250mg cap , ampicilline 250mg cap , ampicilline 30ml /125mg syp , ampicilline 500mg cap , ampicilline injection 250mg , ampicilline injection 500mg , antacid 170ml syrup , antacid tablet , anti d immunoglobulin for iv/im use (monoclonal) inj 150mcg 1 ml vial , anti d immunoglobulin for iv/im use (monoclonal) inj 300mcg pfs/vial , anti scorpion venom injection 10 ml , anti snake venom inj polyvalent 10 ml (lyophilized) 10 ml vial , anti tetanus human immunoglobulininjection250 iu /vial , anticold 30ml drop , anticold 60ml syp. , anticold tab. , antifungal 5 gm oint . , antioxident cap , arteetherinjection1 ml , artemether + lumefantrine tab 20 mg+120 mg , artemether inj 80 mg/ ml 1 ml amp , artesunate + sulphadoxine + pyrimethamine(age group of less than 1year) tab artesunate 25mg(3tab) + sulphadoxine 250mg(1tab)+pyrimethamine 12.5mg tablets ip(1tab) 1 combi pack , artesunate + sulphadoxine + pyrimthamine (age group 15 or above) tab artesunate 200mg (3 tab) + sulphadoxine 750mg (2 tab) + pyrimethamine 37.5 mg (2 tab) tab. ip 1 combi pack , artesunate + sulphadoxine + pyrimthamine (age group between 1 4 years) tab artesunate 50mg (3 tab) + sulphadoxine 500mg (1 tab) + pyrimethamine 25 mg (1 tab) tab. ip 1 combi pack , artesunate + sulphadoxine + pyrimthamine (age group between 5 to 8 years) tab artesunate 100mg (3 tab) + sulphadoxine 750mg (1 tab) + pyrimethamine 37.5 mg (1 tab) tab. ip 1 combi pack , artesunate + sulphadoxine + pyrimthamine (age group between 9 to 14 years) tab artesunate 50mg (3 tab) + sulphadoxine 500mg (2 tab) + pyrimethamine 25 mg (2 tab) tab. ip 1 combi pack , artesunate 60 mg tablet , artesunate injection 60mg , arv rabies vaccine injection i.p. 2.5 iu single dose , ascorbic acid 500mg tablet , asprin 150mg tablet , asprin 75mg tablet , atenolol 100 mg tablet , atenolol 25 mg tablet , atenolol 50 mg tablet , atorvastatin 10 mg tablet , atorvastatin 20 mg tablet , atorvastatin 40 mg tablet , atracurium 10mg/ml 2.5ml vial/amp injection , atropine sulphateinjection 0.6mg/ml , atropine sulphate 1% 5ml eye drop , atropine sulphate eye 1% ointment , azithromycin 200mg/5ml 15ml syp , azithromycine 250mg tablet , azithromycine 500mg tablet , b complexinjection 3 ml , b complexminerals with zinc cap , bcomplex + zinc + ginsengcap. , b complex 100ml syp , b complex tablet nfi , benzoyl peroxide gel 5% 15gm tube , betahistidine 16 mg tablet , betahistidine 8 mg tablet , betamethasoneinjection 4mg ml 1 ml , betamethasone tab 0.5 mg , bisacodyl suppositories 5 mg , bisacodyl tab 5mg , boro spirit ear drops (0.183 gm boric acid in 2.08 ml of alcohol 10 ml vial) drop , botropase injection(haemocoagulase 1cu) 1ml , bromhexin (4mg ) + salbutamol (2mg) 60ml syp , bromhexine 4mg/5ml 50ml bottle syp , budesonide nebulising suspension containing budesonide(0.5 mg/2ml 2ml amp) suspension , bupivacaine hcl for spinal anaesthesia 4ml amp injection , bupivacaine hydrochloride 0.5% 20ml vial injection , bupivacaine hydrochloride with dextrose 5% spinalinjection , cabergoline tab 0.5 mg , caffine citrate drop , caffine citrate inj. , calamine lotion 50 ml bottle , calcium carbonate 500mg tablet . , calcium carbonate vita. d3500 mg tablet . , calcium chloride injection , calcium citrate vita d3 tablet , calcium dobesilate 15 gm oint . , calcium gluconate injection 10 ml , calcium with vitamin d tablets usp calcium carbonate 1.25g eq. to elemental(calcium 500mg and cholecalciferol ip 250 iu) tablet , calium with vit d 3 iu 100 ml syp , carbamazepine syp 100mg/5 ml 100 ml bottle , carbamazepine tab 200 mg , carbamazepine tab 400 mg , carbimazole 10mg tablet , carboprostinjection250 mg , carboxy methyl cellulose sodium drops 1% eye drops 10 ml , carboxymethyl hydroxyethyl cellulose , carboxymethylcellulose sodium eye drop 0.5% 10ml eye drop , carpinol (sunway) injection2 ml , cefaodoxil 125mg/30ml syp , cefaodoxil 250mg tablet , cefaodoxil 500mg tablet , cefazolin inj 1gm/vial vial , cefazolin inj 500 mg/vial vial , cefepimeinjection1000mg , cefepimeinjection500mg , cefepime 250mg. inj. , cefixime 100mg tablet , cefixime 200mg tablet , cefixime 50mg tablet , cefixime oral 100mg/5ml 30ml suspension , cefixime oral 10ml bottle drop , cefixime oral 50mg/5ml 30ml suspension , cefoparazone250mg injection , cefoparazone 1gminjection , cefotaxime sod500mg injection , cefotaxime sod 1gm injection , cefotaxime sod 250mg injection , cefozoline sodium 250mg injection , cefozoline sodium 500mg injection , cefozoline sodium1gm injection , cefpodoxime 100mg tablet , cefpodoxime 100mg/5ml 30ml syrup , cefpodoxime 200mg tablet , cefpodoxime 200mg with ofloxacin 200mg tablet , cefpodoxime 50mg tablet , cefpodoxime 50mg/5ml 30ml syrup , cefpodoxime tab 200 mg , cefpodoxime tab 50 mg , ceftazidimeinjection 250mg , ceftazidimeinjection1gm , ceftazidime inj 500 mg/ vial , ceftriaxoneinjection 125mg , ceftriaxoneinjection 1gm , ceftriaxoneinjection 250mg , ceftriaxone 1000mg + sulbactam sodium500mg vial injection , ceftriaxone 1000mg + tazobactum 125mg vial injection , ceftriaxone 250mg + sulbactam 125mg vial injection , ceftriaxone 500mg + sulbactam 250mg vial injection , cefuroximeinjection 250mg , cefuroximeinjection 750mg , cefuroxime 250mg tablet , cefuroxime 500mg tablet , cephalexin 250mg cap , cephalexin 500mg cap , cephalexin dispersible tablet 125 mg , cephalexin syp 125mg/5ml 30 ml bottle , cetrimide+chlorhexidine conc. solution 15% + 7.5% 1 litre bottle , cetrizine 10mg tablet , cetrizine 30 ml syp , charcoal activated (powder) oral powder 100 gram box/pouch , chloramphenicolinjection20ml , chloramphenicol + dexamethasone 10ml eye drop , chloramphenicol 10 ml eye drop , chloramphenicol cap 500 mg 10 x 10 , chloramphenicol eye ointment 0.5% ointment , chloramphenicol eye ointment 1% 4g/5g tube , chlorhexadineacetate 0.5% white soft parafin medicated gauze 1x10 , chlorhexidine gluconate mouthwash 0.2 % w/v solution50ml bottle , chlorine 75mg tablet isi mark , chlorocal h 1.5 gm eye oint , chloroquine phosphateinjection64.5 mg ml (5ml amp) , chloroquine phosphate syp 160mg /10ml(50mg/5ml base) 60ml bottle , chloroquine phosphate tab 250 mg , chlorphenaramine miltinjection10 ml , chlorphenaramine miltinjection2 ml , chlorpheniramine maleate 4mg tablet , chlorpheniramine(oral liquid 2 mg/5 ml 30 ml bottel),liquid , chlorpromazineinjection 25mg /ml 2ml , chlorpromazine 100mg tablet , chlorthalidone 12.5mg tablet , chlorthalidone 25mg tablet , chlorthalidone tab 50mg , chlotrimazole 2%+ metronidazole 10%45 gm oint . , cinnargin 25 mg tablet , cinnargin 50 mg tablet , ciprofloxacin + dexamethasone 5ml eye drop , ciprofloxacin 250mg + tinidazole 300mg tablet , ciprofloxacin 250mg tablet , ciprofloxacin 500mg + tinidazole 600mg tablet , ciprofloxacin 500mg tablet , ciprofloxacin eye drop , ciprofloxacin eye ointment 0.3% 3/3.5 gram tube , ciprofloxacin inj 200 mg/100ml 100ml ffs bottle infusion , clarithromycin 250mg tablet , clindamycin inj 150 mg/ ml 2 ml vial , clindamycine 150 mg tablet , clindamycine 300 mg tablet , clinidipne 10mg tab. , clobetasol propionate oint . , clofazimine 100mg capsule , clofazimine 50mg tablet , clomiphene citrate 50 mg tab , clonazepam 0.5mg tablet , clonazepam injection , clonidineinjection10ml vial (1mg ) , clonidine 100 mcgtablet , clopidogrel + aspirin 150mg cap , clopidogrel + aspirin 75mg cap , clopidogrel 75mg tablet , clotrimazole (vaginal tab) 100 mg (with applicator) tab. , clotrimazole + lignocaine ear drop 1% 5 ml vial , clotrimoxazole 15gm 1% tube oint . , clozapine(25 mg),tablet , clozapine(50 mg),tablet , cough drop 15ml , cpm + ammonium chloride+ sdodium citrate+ menthol 100ml syp , cyproheptadine 4 mg tablet , cytoheptadine 1.5 mg drop 15ml , dacarbazine (dtic) 500mg with solvent inj. , deferasirox dispersible 250mg tablet , dexamethasone eye drop(0.1%, 5ml),eye drop , dexamethasone sodium phosphate 8mg/2ml 2ml injection , dexamthasone 0.5mg tablet , dextromethorphan 10mg/5ml 100ml syrup , dextromethorphan 10mg/5ml 60ml syrup , diazepaminjection5 mg/2ml , diazepam 5mg tablet , diclofenac 50mg + paracetamol 325mg + chlorzoxazone 250mg tablet , diclofenac 50mg + paracetamol 325mg + serratiopeptidase 10mg , diclofenac 50mg + serratiopeptidase 10mg , diclofenac 50mg+ paracetamol 325mg tablet , diclofenac sodium 25 mg/ml(3ml amp),injection , diclofenac sodium 50mg tablet , diclofenac with menthol 30gm ointment , diclofenac(1%),gel 30gm ointment , diclophenic sodinjection 1ml , dicyclominedrop , dicyclomineinjection2ml , dicyclomine hydrochloride 20mg + paracetamal 325mg tablet , dicyclomine hydrochloride 20mg tablet , dicyclomine hydrochloride tab 10mg , dilitizem injection , diltizime 30 mg tablet , diltizime 60 mg tablet , diltizime 90 mg tablet , diphenhdramine hcl 12.50 mg + ammonium cloriede 125 mg + sodium citrate 55 mg syrup 100ml , diphenhydramineinjection50 mg /ml , diphenhydramine 12.5mg/ml. syp , diphenhydramine 25mg. cap , diphtheria antitoxin 10000 iu 10 ml vial , disodium hydrogen citrate (alkalizer) 100 ml syp , dist. water inj. 10ml vail , dist. water inj. 5ml vail , dobutamine 50mg/ml (5 ml amp)injection , dobutamine inj 12.5 mg/ ml 20 ml vial , domperidone 10mg tablet , domperidone 1mg per 1ml suspension 30 ml bottle , donepezil 5mg tablet , dopamine hydrochlorideinjection40mg /ml (5ml amp) , doxycycline dry 50mg/5ml syrup , doxylamine succinate tab 10 mg , drotaverine inj 40 mg/2 ml 2 ml amp , drotaverine tab 40 mg , dydrogesterone 10 mg tab , enalapril injection , enalapril maleate 10mg tablet , enalapril maleate 2.5mg tablet , enalapril maleate 5mg tablet , enoxaparin inj 40 mg equivalent to 4000 iu vial/pfs , enoxaparin inj 60 mg equivalent to 6000 iu vial/pfs , enzyme with vitaminsdrop 15ml , erithroprotine 10 k inj. , erithroprotine 2 k inj. , erithroprotine 4 k inj. , erlotinib 150mg tablet , erythromycine 250mg tablet , erythromycine 500mg tablet , escitalopram 10mg tablet , ethamsylate 250mg tablet , ethamsylate injection 2ml , etiophylline and theophylline 220mg/2ml injection , etophylline 231mg + theophylline 69mg sr tablet , etophylline 77mg + theophylline 23mg tablet , etoposide 100mg. inj. , fenofibrate 200mg tab. , fentanyl citrate 50 microgram/ml 2 ml amp , ferric ammonium citrate 110mg + folic acid1.5mg + cyanocobalamin 15mcg+ sorbitol solution syrup 200ml , ferric ammonium citrate ip 25mg + lysine hydrochlorideusp 50 mg. + cyanocobalamin ip 5mcg. + folic acid ip 200mcgper mldrop 15ml , ferric ammoniun citrate 200 mg+ folic acid 0.5 mg / 5ml 200ml syp , ferric carboxymaltose inj equ.to elemental iron 500mg/10ml , ferrous ascorbate 100 mg , folic acid 1.5 mg ,zink 22.5 ,d3 200i.u.,cynocobalamin 2 mg , ferrous ascorbate 100mg (elemental iron)+folic acid 1.5mg(tablet),tablet , filgrastim 300mcg. prefilled syring contains inj. , fluconaole 150mg tablet , fluconazole 100ml. inj. , fluconazole 400mg. tab. , flunarizine 5mg tablet , fluorouracil (5 fu) inj 500 mg /10 m lvial 10 ml vial , fluoxetine 20mg capsule , fluphenazine 1ml 25mg/ml injection , foleron (iron iii) hydroxide polymaltose complex tablet , folic acid 5mg tablet , framycetin sulphate 1% cream 30gm tube cream , frusemide 10mg/ml 2ml amp injection , furazolidone 100mg tablet , furazolidone 60ml syp , furosemide 40mg tablet , furosemide drop , fusidic acid cream/sodium fusidic ointment 2% 5gm 5gm tube , gamma benzene hexachloride solution/lotion 1% 100ml bottle , gentamicin + hydrocortisone ear drop (0.3%+1%) 5 ml vial , gentamicin 0.3% eye/ear drops 5ml , gentamicin 40mg/ml 2ml amp injection , gentamycine sulpfate 15gmoint . , glibenclamide 5 mg tablet , gliclazide tab 80 mg , glimepiride 1 mg tablet , glimepiride 2 mg tablet , glipizide 5 mg tablet , glucose pouch 75gm powder , glycereen 15% sod chlor 15% enema 20ml , glycerin oral liquid 30ml bottel liquid , glycerine ip solution 100 ml bottle , glycopyrolate 0.2mg/ml 1ml vial injection , griesofulvin 125mg tablet , haloperidol 5mg tablet , haloperidol 5mg/ml 1ml amp injection , haloperiodol 1.5mg tablet , heparin sodiuminjection 1000iu/ml 5ml , heparin sodiuminjection 5000iu/ml 5ml , human albumin solution 0.05 250ml injection , human albumin solution ip i/v 20% w/v 100 ml ffs bottle , human anti d. immunoglobulin (monoclonal)(300mcg/vial),injection , human chorionic gonadotropin(injection 10000 iu vial of 1 ml injection),injection , human chorionic gonadotropin(injection 5000 iu vial of 2 ml injection),injection , hyaluronidase , hydrochlorothiazid 12.5mg tablet , hydrochlorothiazide 25mg tablet , hydrochlorothiazide 50mg tablet , hydrocortisone 0.5% 15gm ointment or cream , hydrocortisone 1% 15gm ointment or cream , hydrocortisone sodium succinateinjection 200 mg/ml vial , hydrocortisone sodium succinate injection400 mg /ml vial , hydrocortisone sodium succinate injection 100 mg /ml vial , hydrogen peroxide 6% solution (who gmp certification exempted for this item)(400 ml ),bottle , hydroxy ethyl starch 200/3% inj. , hydroxy urea 500mg capsule , hydroxychloroquine 200mg tablet , hydroxyethyl (6% saline solution for infusion)(starch 6%ip 500 ml bottel),infusion , hydroxyethylstarch 6% solution with sodium chloride 0.9% iv infusion i/v 500 ml ffs bottle 0.90% , hydroxyurea dispersable 100mg tablet , hydroxyzine 25mg tablet , hyoscine butylbromide 20mg/ml 1ml vial/amp injection , hypersol 10 mleye drop , hypersoninjection5ml , i.v. (electrolyte m) 500ml ffs dextrose anhydous 5gm kcl 150mgnacl 100mgna acetate 280mgna meisulphite21 mg dibasic k phosphate 130mg/100ml 500ml ffs , i.v. 10% amino acid + electrolyte inj. , i.v. ciprofloxacine100ml ffs , i.v. d.n.s.500 ml plastic bottle500ml ffs , i.v. dextrose 5% plastic bottle500ml ffs , i.v. dextrose10%plastic bottle500ml ffs , i.v. dextrose 25% 25ml ffs , i.v. dextrose 25%(500ml ffs bottle),injection , i.v. dextrose 5%(500ml ffs bottle),injection , i.v. dextrose 50% 25 ml ffs , i.v. dextrose with saline(5% + 0.9% (500ml ffs bottle)),injection , i.v. dextrose(10% inj 500 ml ffs btl),injection , i.v. dextrose(25% 100 ml ffs bottle),injection , i.v. electrolyte‘p’ 500ml ffs dextrose anhydous 5gm kcl 130mg dibasic k phosphate 25mg na acetate 320mg na meisulphite21 mgcl2 31 mg /100ml 500ml ffs , i.v. electrolyte e i.v 500ml ffs/bfs bottle 500ml ffs. dextrose 5gsodium acetate 0.64gsodium chloride 5gpotassium chloride 75mgsodoium citrate 75mgcalcium chloride solution correcting water electrolyte & nutrition 52mg magnesium chloride 31 mg tabletsodium meta bi sulphate 20 mg , i.v. electrolyte p (multi electrolytes and dextrose injection type i ip) i/v fluid (each 100ml contains: anhydrous dextrose 5gm potassium chloride 0.13gm, sodium acetate 0.32gm, dibasic potassium phosphate 0.026gm)(500 ml ffs bottle),injection , i.v. glycin 3000ml. inj. bottle plastic , i.v. linozolidine ffs , i.v. mannitol 10% 100ml ffs , i.v. normal saline 0.9 % 100 ml plastic bottleffs , i.v. normal saline 0.9 % 500 ml plastic bottle ffs , i.v. ofloxacine 100 ml ffs , i.v. ornidazole 100ml ffs , i.v. ringer lactate plasticbottle 500 ml ffs , i.v. tinidazole 400ml ffs , i.v.( electrolyte ‘g’) 500ml ffs dextrose anhydrous 5 gmkcl 130 mgnacl 370 mg tabletammon cl 370 mg na sulphite 15 mg /100ml 500mlffs , ibuprofen400 mg + paracetamole 325 tablet , ibuprofen + paracetamole syrup , ibuprofen 200mg. tab. , ibuprofen 400mg tablet , ibuprofen 60ml syp , insulin soluble inj. 40iu/ml , insulins human mixtard30:70 injection10ml , intraperitoneal dialysis solution 0.015 1.5% 500ml solution , intraperitoneal dialysis solution 0.025 2.5% 500ml solution , intrvenous immunoglobulin inj. , ipratropium bromide 250 mcg/ml respules inhalation , ipratropium bromide inhaler 20mcg per puff(200 metered dose container),inhaler , iron and folic acid entric coated tab. ferrous suplhate ip 333.335mg equivalent to 100mg of elemental(red tablet),tablet [4710059] , iron & folic acid enteric coated red (as per nipi guidelines) 100 mg + 0.5 mg (tablet 10 x 10),tablet , iron & folic acid entric coated 100mgof elemental iron (adult)+fa 1.5mg tablet , iron & folic acid entric coated dessicated ip 67mg tablet equivalent to 20mgof elemental iron tablet , iron & folic acid sugar coated pink(as per nipi guidelines) 45 mg + 0.4 mg (tablet 15 x 10),tablet , iron 100ml syp. , iron 30ml drop , iron and folic acid enteric coated tab dried ferrous sulphate equ. to ferrous iron 100 mg and folic acid 0.5 mg (blue tablet) , iron and folic acid enteric coated tab dried ferrous sulphate ip eq. to 45 mg elemental iron and 400 mcg folic acid ip (pink color) wifs junior , iron and folic acid enteric coated tab. ferrous sulphate ip to ferrous iron 100 mg & folic acid ip 0.5 mg granules (red tablet) , iron ferras sulphate folic acid 100ml syp , iron folic acid sugar coated (blue tablet) ferrous sulphate ip equivalent to 60 mg elemental iron & 500 mcg folic acid ip(60 mg + 500 mcg),tablet , iron folic acid sugar coated (red tablet) ferrous sulphate ip equivalent to 60 mg elemental iron & 500 mcg folic acid ip(60 mg + 500 mcg ),tablet , iron folic acid sugar coated tablet dried ferrous sulphate ip eq. to 45mg ferrous iron and 400mcg folic acid ip (pink coloured tab) wifs junior ifa tablets (detail specification as per tender)(45mg + 400mcg),tablet , iron folic acid syrup, each ml containing 20mg elemental iron&100mcgfolic acid with suitable anti oxidant, antimicrobial agent and food grade flavouring agent.the bottle should have 6 fragmented markings at equal intervals(if an artificial sweetening is used it should be highlighted on the label. warning should be put on label medication should be kept out of reach of children. (as per attached specification) (50ml bottle with auto dispenser)),syrup , iron polymaltoseinjection , iron sucroseinjection 2.5ml , iron sucroseinjection 5ml , isoflurane inhalation , isosorbite dinitra.10 mg tablet(sub) {sorbitrate} , isosorbite dinitra.5 mg tablet(sub.) {sorbitrate} , isosorbite mononitrate 20 mg tablet , isoxsuprine 10mg tablet , isoxsuprine hcl injection , itraconazole cap 100mg , itraconazole cap 200mg , iv human immunoglobin 5% iv ig(5gm/100ml each),infusion , ivabradine 5mg tab. , ivermectin 12mg tablet , ketorolac eye drop 0.5% 5ml drop , labetalol inj 20 mg/4ml 4ml amp , labetalol tablet 100mg. , lactobacillus tab 60 million spores , lactulose 10gm/15ml 100ml bottle syrup , levocetirizine + monteleukast 2.5 mg + 4mg/5ml 60ml suspension , levocetirizine 5mg + montelukast 10mg tablet , levocetirizine dihydrochloride ip 2.5mg+ ambroxol hydrochloride ip 30mg per 5ml syp. 60ml , levocetrizine dihydrochloride 5mg tablet , levodopa (a) + carbidopa (b)(tablet 100 mg (a) + 10 mg (b) cr),tablet , levodopa (a) + carbidopa (b)(tablet 100 mg (a) + 25 mg (b) cr),tablet , levodopa (a) + carbidopa (b)(tablet 250 mg (a) + 25 mg (b)),tablet , levofloxacin inj 500 mg/100 ml 100 ml ffs bottle , levofloxacine250mg tablet , levofloxacoine 500mg tablet , levosalbutamol(50mcg/dose 30 capsule in 6 pack with 1 dispecing device),capsule , levosulbutamol(100 mcg 30 capsule in 6 pack with 1 dispecing device),capsule , levothyroxine(100 mcg),tablet , levothyroxine(50 mcg),tablet , lignocain spray , lignocaine 2 %(21.3 mg / ml (30 ml vial)),injection , lignocaine 2% + adrenaline 5 mcg/ml(30 ml ),vial , lignocaine 4%injection30 ml , lignocaine hydrochloride 2% 30gm tube gel , lignocaine hydrochloride 4% eye drops 5 ml vial , lignocaine hydrocloride and dextorse injection hevy 5% spinal 2 ml amp. , linagliptin 5 mg tablet , linezolid 600mg tablet , liq glycerol 100 ml , liquid formalin 450ml , liquid glycerin 500gm , liquid hydrogen peroxide 400ml , liquid icthamol 100gm , liquid icthamol glycerin 100gm , liquid lysol 5 ltr. jar , liquid paraffin light 400ml , lisinopril 5 mg tablet , lithium carbonate 300mg tablet , loperamide(2mg),tablet , lorazepam 2 mg / ml 1 ml vial , lorazepam(1 mg),tablet , losartan potassium 50mg tablet , losartan(10 mg tablet),tablet , benzyl benzoate 100 ml 25% lotion , gama benzyne hexachloride 100ml lotion , lquid cresol with soap solu. 400ml , luliconazole cream 10gm ointment , luliconazole cream 20gm ointment , luliconazole cream 30gm ointment , lycopene + antioxidant + multivitamine cap. , lycopene with multivitamins + multiminerals cap , m v iinjection10 ml , magnesium hydroxide+aluminium hydroxide tablet 500mg. + 250mg. , magnesium suplhate(50 % w/v (2ml amp)),injection , mannitol inj. 20% 350ml ffs bottle , mannitol(20% 100 ml ffs bottle),injection , mebendazole 100mg tablet , mebendazole 30ml syp , mebeverine(tab 200 mg 10 x 15),tablet , medroxy progesterone acetate(10 mg),tablet , medroxyprogesterone acetate(injection 150 mg 1 ml / vial),injection , mefenamic acid 250mg + dicyclomine 10mg tablet , mefloquine tab 250 mg , menadione (vit.k3) injection10mg/ml 2ml , mepafotic eye drop , mephentermine inj 30mg/ml(10 ml vial),injection , meropanam 1000mg inj. , meropanam 125mg inj. , meropanam 500mg inj. , metaclopromideinjection2ml (5mg) , metaclopromide 10mg tablet , metformin(1000mg),sr tablet , metformin(500 mg),tablet , methylergometrininjection(2mg ) 2ml , methyl ergometrine maleate0.125mg tablet. , methyl sacicylate 100gm oint . , methylcobalmin 1500mg cap , methylprednisoloneinjection1000 mg , methylprednisoloneinjection125 mg , methylprednisoloneinjection 250 mg , methylprednisoloneinjection 40 mg , methylprednisoloneinjection 500 mg , methylprednisolone 16mg tablet , methylprednisolone 4mg tablet , methylprednisolone 8mg tablet , metoclopramide inj 5 mg/ ml 2 ml amp , metoclopramide tab 10 mg , metoprololinjection1mg /ml , metoprolol tab 50 mg , metoprolol tab 25 mg , metronidazole 1% ointment 15 gram tube , metronidazole 200mg tablet , metronidazole 400mg tablet , metronidazole 500mg/100 ml(100 ml ffs bottle),injection , metronidazole oral suspension(200 mg/5ml (60 ml bottle)),suspension , miconazole ip cream 2% w/w 15 gram tube , micronised progestroninjection 200mg1 ml 2ml , midazolam 1mg/ml 5ml amp injection , mifepristone 200mg tablet , milk of magnasia 11.25ml liquid paraffin 3.75ml/15ml ( creamafin formula ) 170 ml syp , misoprostal200mcg4s tabletpack , montelukast 5mg tablet , moxifloxacine 5ml eye drop , multivitamin 200ml syp. , multivitamin sugar coated tab nfi formula multivitamin sugar(item with additional vitamin will also be considered),tablet , multivitamin with protein 100ml syp , multivitamin with protein 200ml syp , multivitamine 15ml drop , multivitamine with zincdrop , mupirocin cream/ointment 2% 15 gram tube , mupirocin(2% w/w (5 gm tube)),ointment , naloxoneinjection 0.4mg/ml 1ml(amp) , naloxone injection 0.1mg/ml 1ml(amp) , neomycin sulfate 10gm oint . , neosporin h 5gm eye oint , neostigmine(0.5mg/ml (1ml amp)),injection , nicotinamide 15mg + thiamine mononitrate (vitamin b1) 1mg+ riboflavine (vitamin b2) 1mg + pyridoxine hcl (vitamin b6) 0.5mg + cyanocobalamin (vitamin b12) 1mcg tab. , nifedipine capsule(5mg cap),capsule , nifedipine(10mg tab),tablet , nitroglycerine inj. 25 mg/5ml(5ml),ampule , nondrolon deconateinjection25 mg , nondrolon deconateinjection50 mg , noraderanaline bitartrate(2 mg base/2ml (2ml amp)),injection , norfloxacin + dexamethasone 10 ml eye drop , norfloxacin 5ml eye drop , norfloxacin(dispersible tablet 100 mg),tablet , norfloxacine 400mg + tinidazole 600mg tablet , norfloxacine 400mg tablet , normal saline(nasal drops: sodium chloride drops 0.05% w/v 10 ml vial),drop , ofloxacin 10 mleye drop , ofloxacin 200mg tablet , ofloxacin eye drops 0.3% w/v 5 ml vial , ofloxacin tab 400 mg , ofloxacine 200 + ornidazole 500 tablet , ofloxacine dexamethasone eye drop , olanzapine( 5 mg),tablet , olanzapine(10mg tab),tablet , olopotadine antiallergic eye drop 0.1% 5 ml vial , omeprazole 20mg+ domperidone10mg cap , ondansetroninjection 2 ml , ondansetron 4 mg tablet , ondansetron syp 2mg/5 ml 30 ml bottle , ornidazole 60ml. syp , ors who powder glucose anhydrous 13.5g/l, sodium chloride 2.6g/l, potassium chloride 1.5g/l, trisodium citrate 2.9g/l(as per attached pack specification),powder , oseltamivir ip 100ml. syp , oseltamivir ip 30mg cap , oseltamivir ip 45mg cap , oseltamivir ip 75mg cap , oxytocin inj(5 iu/ml (1ml amp)),injection , pantoparazoleinjection 40mg , pantoprazole 40mg + domperidone10mg tablet , pantoprazole 40mg tablet , paracetamol + phenylephrine hydrochloride + caffeine + diphemhydramine hcl tab. , paracetamol inj(150mg/ml 2ml amp(2ml amp)),injection , paracetamol syrup/suspension 125 mg/5ml (60ml bottle)(syrup),syrup , paracetamol 650mg tablet , paracetamol(125 mg/ml),drop , paracetamol 500mg tablet , paracetamole 325 mg + mefenamic acid 500mg tablet , pemetrexed 500mg injection , pentazocine lactate(30mg/ml (1 ml amp)),injection , peprazine citrate 30ml syp , permethrin cream 5% w/v(60 gm),tube , permethrin lotion 5% w/v(60 ml bottle),lotion , pheniramine maleate(22.75 mg/ml (2 ml amp)),injection , pheniramine meleate 25mg tablet , phenobarbitone 200mg/5ml syp , phenobarbitone(200 mg/ml),injection , phenobarbitone(30 mg),tablet , phenobarbitone(60 mg tab),tablet , phenytoin sodium oral suspension 25mg/ml 100 ml bottle , phenytoin sodium(100mg),tablet , phenytoin sodium(50 mg/ml (2ml amp)),injection , phytomenadione injection(10 mg/ml),injection , pilocarpin pfs injection , pilocarpine eye drops 2%(5ml),vial , pilocarpine eye drops 4% 5 ml vial , piperacillin 1gm + tazobactam 125mg injection , piperacillin 2gm + tazobactam 0.25mg injection , piperacillin 4gm + tazobactam 0.5gm injection , piroxicam 20mg cap. , piroxicam gel 30gm oint . , potassium chloride injection150 mg/10 ml , potassium chloride oral solution 100mg/ml(200ml bottle),bottle , povidine iodine germicide(gargle 20% w/v 100 ml bottel),bottle , povidone iodine + metronidazol 15gm ointment , povidone iodine cream 125gm oint . , povidone iodine cream 15 mg oint . , povidone iodine cream 250gm oint . , povidone iodine solution 5% 100ml , povidone iodine solution 5% 500ml , povidone iodine solution 7.5% 100ml , povidone iodine solution 7.5% 500ml , povidone iodine surgical scrub 7.5% 500ml bottle , povidone iodine vaginal(200 mg),pessary , powder acriflavin 20gm , powder bleaching 25kg , powder boric acid 400gm , powder cetrimide 100gm , powder glucose 100 gm , powder magnesium sulphate 400gm , powder mercurochrome 20gm , powder nitrofurazone 20% w/n 10gm , powder povidoine , powder sulfanilamide dusting 400gm , pralidoxime (pam)injection25 mg/ml 20 ml , pralidoxime chloride (2 pam)injection , prazosin tab 1mg , prednisolone 10mg tablet , prednisolone 20mg tablet , prednisolone(drops 1% eye 5 ml drop),drop , pregabalin(tablet 150 mg),tablet , primaquin 15mg tablet , primaquin 2.5 mg tablet , primaquin 7.5 mg tablet , procarbazine 50mg. cap. , promethazine 25 mg/ml(2 ml amp),injection , promethazine 5 mg/5ml(60 ml bottle),syrup , promethazine tab 25 mg , proparacaine hydrochloride eye drop , propofal(injection 10 mg/ml 1 ml /vial),injection , propranolol 40mg tablet , propranolol tab(10 mg),tablet , protamine(injection 50 mg/5 ml 5 ml vial),injection , proteine hydrolysate 1gm + choline citrate 1mg pyridoxine hcl 2mg cyanocobalamin 10 mcg + folic acid 1mg per 15ml syp200ml , protin hydrolysate + pyridoxin + niacinamide + iron cholin citrate + magnesium chloride + maganese chloride + zinc sulphate + lysine , pyridoxine tablet , quinine dihydrochloride(300mg/ml (2ml amp)),injection , quinine sulphate(300mg),tablet , rabeprazole 20mg + domperidone 30mg cap , rabeprazole 20mg + domperidone10mg tablet , rabeprazole 20mg tablet , rabies immunoglobinesinjection150iu , rabies immunoglobulin inj 300 iu((2ml vial pfs)),injection , rabies vaccine human (tissue culture) id/im(inj 2.5 iu/ ml 1 vial with 1 ml diluents),injection , rabies vaccine human injection. (intra dermal) , ramipril 2.5 mg tablet , ramipril 5 mg tablet , ranitidine 150mg tablet , ranitidine 300 mg tablet , ranitidine 150mg + domperidone 10mg tablet , ranitidine(50mg/2ml , 2ml amp),injection , reduced osmolarity ors pkt. who formula sodium chloride 2.5mg potessium chloride 1.5mgsodium citrtr 2.09g dextrose 13.6g 20.5gm , risperidone(12.5 mg ),injection , risperidone(2 mg),tablet , roxithromycin50mg tablet , roxithromycin 150mg tablet , roxithromycine 30 ml syp , salbutamol inhalation ip 100mcg/dose(200 metered dose container),inhaler , salbutamol sulphate 2mg/5ml 60ml syrup , seratiopaptidase 10mg tablet , seratiopaptidase 5mg tablet , silver sulphadiazine cream1% 25gm tube , sitagliptin 100mg tablet , sitagliptin 50mg tablet , sodium bicarbonate inj. 7.5% 10ml ampoule , sodium thiopentone 0.5gm powder/vial(20ml vial),injection , sodium valproate oral solution 200mg/5ml 100 ml bottle , sodium valproate 200mg tablet , sodium valproate 500mg tablet , soframycine 1.5gm eye ointtube , solution chloroxylenol4.8%w/v terpineol 9%v/v alcohol absolute 13.1%v/v ( detol formula} , solution chloroxylenol4.8%w/v terpineol 9%v/v alcohol absolute 13.1%v/v ( detol formula}hw , streptokinaseinjection15 lac unit , streptokinaseinjection 750000iu , succinyl choline(50mg/ml (10 ml vial)),injection , sucralfate 20mg tablet , sucralfate(1gm/5ml),syrup or suspension , sulfacetamide eye drops 20% 10 ml vial , sulfadimidine 500mg tablet , sulfamethoxazole +trimethoprim suspension (200 mg + 40 mg) / 5 ml suspension(50 ml bottle),suspension , sulfamethoxazole 200mg +trimethoprim 40mg tablet , sulfamethoxazole 100mg +trimethoprim 20mg tablet , sulfamethoxazole 400mg +trimethoprim 80mg tablet , sulfamethoxazole 800mg +trimethoprim 160mg tablet , surfactant suspension(inj 25 mg/ml),injection , surgical sprit 100 ml , surgical sprit 500 ml. , tamsulosin 0.4mg. tab. , telmisortan 20mg tablet , telmisortan 40mg tablet , temozolimide 100mg. cap. , temozolimide 20mg. cap. , temozolimide 250mg. cap. , teneligliptin 20mg tab. , terbutanil sulphate 1.5 mg + bromhexine 4 mg + guaiphensin 50 mg 100ml syp , tetanus immunoglobulin(usp/ip 250 iu/vial),injection , tetanus toxide injection 0.5ml , tetanus toxide injection 5ml , thiamine hydrochloride 2.25 mg + riboflavine 2.5mg + pyridoxine hydrochloride 0.75mg +cyanocobalamin 2.5mg + nicotinamide 30mg + d panthenol 2.5mg flavoured syrup200ml , thyroxine sodium. 100mcg tablet , thyroxine sodium. 50 mcg tablet , timolol maleate eye drop i.p. 0.5 %w/v (5 ml vial)(5 ml),solution , tincture benzoin 450ml , tincture iodine 450ml , tinidazole 300mg tablet , tinidazole 500mg tablet , tobramycin 10ml eye drop , torasemideinjection100mg/2ml , torasemide tab 10 mg , torasemide tab 20 mg , tramadol100mg tablet , tramadol50mg tablet , tramadol injection(100mg/ml) 2 ml , tramadol injection(50mg/ml) 2ml , tranexamic acid injection 5ml amp , tranexamide acid 500 mg tablet , trihexyphenidyl tab 2 mg , tropicacl phenylephrine hydrochloride eye drop , tropicacyl plus 5 ml eye drop , tropicamide(1% 5ml vial),eye drop , tropicasyl plus (ophth) 10ml eye drop , turpentine liniment 400ml , urokinase inj 5 lac iu/vial vial , valethamate bromide ( epidosin ) injection , vancomycin hydrochloride(1000mg vial),injection , vancomycin hydrochloride(500mg),injection , vecuronium bromide inj 2mg/ml (2ml amp) , vitamin a ip 2500 iu + vit b1 1mg + vit b2 1.5mg+ vit b6 1mg + vit b12 1mcg + vitamin c 50mg+ vit e 5mg + vit e 5mg + niacinamide 15mg + folic acid ip 0.15mg elemental calcium ip 75mg + phosphorus 58mg+ ferrous fumarate ip 30mg + zinc sulphate ip 10mg +magnesium sulphate ip 0.50mg + coppersulphate usp 0.50mg + potassium iodide ip 0.01mg + ginseng usp 42.50mg cap. (with mono cartan) , vitamin a syrup(100000 iu/ml with market spoon for 1ml and 2 ml (100 ml bottle)),syrup or solution , vitamin c(100 mg),tablet , vitamin kinjection(10mg /ml) 1 ml , vitamin k1(1mg/0.5ml (0.5 ml amp)),injection , vitamin. b complex nfi (prophylactic)(b12 mg, b22mg, b6 0.5 mg, niacinamide 25 mg, calcium pantothenate 1 mg),tablet , warfarin sodium 5mg tablet , warfarin 1mg tablet , warfarin 2mg tablet , water for injection 10 ml amp , water for injection 5 ml amp , water for injection 2 ml amp , xylometazoline 0.05% nasal 10ml(0.05% 10ml),drop , xylometazoline nasal(0.1%w/v (10 ml vial)),drop , zinc dispersible(20mg),tablet , zinc sulphate dispersible(10mg),tablet , zinc sulphate syrup 50ml , zine sulfate monohydrate 20mg + thiamine mononitrate 10mg + riboflavine 10mg + pyridoxine 3mg +cyanocobalamin 5mcg + nicotinamide 50mg + calcium pantothenate 12.5mg + folic acid 1000mcg + magnesium sulfate monohydrate 10mgcap. , each film coated , extended release tab contains: metoprolol succinate usp 47.5 mg eq.to metoprolol tartate 50mg , each sugar coated tablet contain : paracetamol (i.p.) 325mg, diclofenac sodium (i.p.) 50mg , each uncoated tablet contains: nicorandril 10mg , each oval filim coated tablets contain clarithromycin ip 250mg , each tablet contains: metronidazole i.p. 400mg , each uncoated sustained release tablet contains: nicorandil ..10 mg , each uncoated tablet contains carbimazole ip 5 mg , each hard gelatin capsule contains pregabalin 75 mg + methylcobalamin 750 mcg , each uncoated tablet contains: telmisartan 40mg. , each film coated tablets contains: montelukast sodium ip equivalent to montelukast 10 mg faxotenadine hd ip 120mg colour quinoline yellow , each uncoated bilayered tablet contains: glimepiride 1mg + metformin hci 500mg (in sustained release form). , each uncoated tablet contains diluted nitroglycerin equivalent to nitroglycerin 6.4 mg (in controlled release form) , each uncoated tablet contains :telmisartan 40 mg + amlodipine besylate b.p. equivalent to amlodipine 5 mg , each vial contains: 80mg of gentamicin sulphate i.p.=gentamicin base 40.0 mg , each uncoated bilayered tablet contains: glimepiride 2mg + metformin hci 500mg (in sustained release form). , each uncoated tablet contains:diluted isosorbide mononitrate ip equivalent to isosorbide mononitrate 20 mg , each uncoated bilayered tablet contains: telmisartan i.p. 40 mg, chlorthalidone i.p. 12.5 mg , each vial contains :nicorandil i.p 48mg excipients qs , each uncoated tablet contains: telmisartan 40mg + hydrochlorothiazide12.5mg. , each uncoated bilayered tablet contains: telmisartan i.p. 40 mg, chlorthalidone i.p. 6.25 mg , each uncoated bilayered tablet contains glimepiride u.s.p. 2 mg, pioglitazone hydrochloride equivalent to pioglitazone 15mg, metformin hydrochloride i.p. 500mg (in extended release) colour : erythrosine , beclometasone dipropionate 0.025% + clotrimazole 1% + neomycin sulfate 0.5% , each uncoated tablet contains: telmisartan 20mg. , diclofenac potassium 50mg + serratio peptidase 10mg + paracetamol 325mg , each film coated bilayered tablet contains:metoprolol succinate 25 mg + telmisartan ip 40 mg , each uncoated dispersible tablet contains: diclofenac free acid 46.5 mg(equivalent to diclofenac sodium ip 50 mg) , each film coated tablet contains verapamil hydrochloride ip equivalent to verapamil 40 mg. , each enteric film coated tablet contains: serratiopeptidase i.p. 10 mg(20,000 serratiopeptidase units) colour: sunset yellow fcf , isabgol husk 300gm , camylofin dihydrochloride 50 mg + nimesulide 100 tab , camylofin dihydrochloride 12.5 mg + paracetamol 125 mg / 5 ml , camylofin dihydrochloride 25 mg /ml , each ml contains : triamcinolone acetonide i.p. 40 mg, benzyl alcohol i.p. 0.9% , each film coated tablet contains camylofin hcl 50mg+mefenamic acid ip 250mg , each film coated tablet contains: atorvastatin calcium equivalent to atorvastatin 10mg. , each tablet contains: atorvastatin 40 mg , camylofin dihydrochloride 25 mg /ml , each film coated tablet contains: atorvastatin calcium equivalent to atorvastatin 20mg. , each uncoated bi layered tablet contains glimepiride 1 mg + metformin sr 1 gm , each film coated tablet contains : atorvastain calcium ip equivalent to atorvastain 80mg , each hard gelatin capsule contains tacrolimus 1 mg , each tablet contains: atorvastatin calcium eqvt to atorvastatin 10 mg+fenofibrate 160 mg , each uncoated tablet contains 2 mg of nicoumalone i.p , each uncoated tablet contains 1 mg of nicoumalone i.p , camylofin dihydrochloride 12.5 mg + paracetamol 125 mg / 5 ml , imipenem 500+cilastatin 500 inj. , tirofiban hydrochloride 5mg, sodium chloride 0.9% w/v , vial contains 500 mg clarithromycin lactobionic acid sodium hydroxide ph eur , each film coated tablet contains : etoricoxib 90mg excipients q.s. , each ml contains : triamcinolone acetonide i.p. 10 mg, benzyl alcohol i.p. 0.9% , each film coated tablet contains spiramycin 3.0 m.i.u. , each film coated tablet contains febuxostat 40 mg. , each sugar coated tablet contains: piroxicam ip 20 mg colours: indigo carmine and sunset yellow fcf , each film coated slow release tablet contains: diluted isosorbide mononitrate ip equivalent to isosorbide mononitrate 40 mg.colour: titanium dioxide ip , each capsule contains : chloramphenicoli.p. 500mg , each uncoated bilayered tablet contains: voglibose 0.2 mg, glimepiride ip 1 mg,metformin hydrochloride (as sustained release form) ip 500 mg , excipients qs colour: quinoline yellow lake. , each film coated , extended release tab contains: metoprolol succinate usp 95 mg eq.to metoprolol tartate 100mg , each film coated tablet contains: etoricoxib ip…60 mg, thiocolchicosideip….4 mg , each uncoated tablet contains carbimazole ip 20 mg , each uncoated tablet contains carbimazole ip 20 mg , each film coated tablet contains: cilnidipine ip……….10 mg, telmisartan ip………..40 mg, colour: titanium dioxide ip , each uncoated tablet contains 2.5mg of enalapril maleate , each uncoated tablet contains 10mg of enalapril maleate , each uncoated tablet contains: diluted isosorbide dinitrate ip equivalent to isosorbide dinitrate 5 mg , each film coated tablet contains : etoricoxib 120mg excipients q.s. , each film coated tablet contains : etoricoxib 60mg excipients q.s. , each ml contains: diclofenac sodium (b.p.) 25mg, benzyl alcohol (i.p.) 40mg, water for injection (i.p.) q.s. , each film coated tablets contains: diclofenac 50 mgparacetamol 325 mg serratiopeptidase 10 mg , each hard gelatin capsule contains—itraconazole bp 200 mg (as 32.25% pellets) excipientsq.s. approved colors used in capsule shell , each hard gelatin itraconazole capsules bp 100mg , each gram contains; triamcinolone acetonide i.p…............ 1mg, benzyl alcohol i.p….........2%w/w (as reservative) in a cream base....q.s. to 100 , triamcinolone acetonide ip …..0.1% w/w, in buccal paste ….q.s. preservatives: methylparaben ip ……………….. 0.09% w/w, propylparaben ip ………………… 0.01% w/w , each uncoated tablet contains:voglibose 0.2 mg , each uncoated tablet contains:voglibose 0.3 mg , each uncoated mouth dissolving tablet contains: voglibose i.p.0.2 mg, excipients q.s. , each uncoated bilayered tablet contains:voglibose0.2mg,metformin hcl ip500mg(in sr form) , each uncoated bilayered tablet contains:voglibose0.3mg,metformin hcl ip500mg(in sr form) , each uncoated bilayered tablet contains glimepiride u.s.p. 1 mg, pioglitazone hydrochloride equivalent to pioglitazone 15mg, metformin hydrochloride i.p. 500mg (in extended release) colour : erythrosine , each uncoated bilayered tablet contains: voglibose 0.2 mg, glimepiride ip 2 mg,metformin hydrochloride (as sustained release form) ip 500 mg , excipients qs colour: quinoline yellow lake. , each film coated tablet contains: olmesartan medoxomil 20 mg + hydrochlorothiazide 12.5 mg , each film coated tablet contains: olmesartan 40 mg + amlodipine 5 mg , each 5 ml contains: lactulose concentrate uspequivalent to lactulose3.335 g , each film coated tablet contains: dydrogesterone bp 10 mg excipientsq.s. colour: titanium dioxide ip , each uncoated tablet contains : ursodiolusp 300 mg(ursodesoxycholic acid) excipients q.s. , each uncoated tablet contains : ursodiolusp 150 mg(ursodesoxycholic acid) excipients q.s. , each orally disintigrating strip contains: betahistine hydrochlorideip 24 mg excipientsq.s.colour: titanium dioxide i.p. , each uncoated tablets contains : terazosin hydrochloride equavalent to terazosin 2mg excipients q.s. contains sunset yellow fcf lake as colourant , clerithromycine 150 mg tab , cpk mb kit 1x10ml , torch rapid96 test , sgot 4x20ml , sgpt 4x20ml , alk po4 50x1ml , g 6 pd deficiency 10 test , serum creatine/protein 2x100ml , ra factor 25 test , hbsag , vdrl , hcv , hiv , crp 100 test , blood sugar 2x500ml , serum urea 2x25ml , serum cholesterol 4x25ml , serum bilirubin 2x1ooml , typhoid card test , bt, ct 100 , esr tube , haematology cel counter , elisa reader with printer & washer , coagulometer , electrolyte analyzer , microscope , semi autoanalyser , colorimeter , hemocytometer , water bath , acetone 150 test , slides cover slips 10gm , slides 1x50 , neubars chamber , chickenguinea , field stain a 500ml , field stain b 500ml , n/10 hcl solution , leishmen stain 250 ml , carbol fusion 100 ml , platelet diluting fluid 100 ml , wbc diluting fluid 500 ml , rbc diluting fluid 500 ml , semen diluting fluid 100 ml , h2so4 acid 20% 500 ml , jsv stain 1 2x500ml , jsv stain 2 2x500ml , methelyne blue 500 ml , hypochloride solution 5ltr , berium chloride powder 500gm , fouchets reagent 150ml , sulfur powder 500 gm , urine/sputum container , micropipettes , micropipettes 1000 tips , haemoglobin colour scale book , hdl kit 1x40 ml , thyroid test t3 96 test , thyroid test t4 96 test , thyroid test ths 96 test , disposable pricking lancet {100pcs} , maleria antigen for pv/pf , test tube 3 , test tube 4 , test tube 6 , test tube rack , stain rack , triglyceride kit 4x50ml , glucometer strip , centrifuse machine , glass beaker , measuring cylender , glass pipette , esr stand , blood collection tube , albumin , band aid strips , beaker 100 ml , beaker 1000 ml , beaker 500 ml , billirubin capillary tube , bilurubin (total) , bilurubin standard , borosilicate glass beaker 100ml. , borosilicate glass beaker 500ml. , borosilicate glass beaker 50ml. , carbol fuchsin (zn strong) , crp/hs crp standard , culture tube flat bottom 15ml. , culture tube flat bottom 30ml. , culture tube flat bottom 5ml. , digital balance 1 mg to 300 g , disttiled water 5 ltr , droper 2 ml , droping bottle 50 ml , dropping bottle , e d t a powder 500 gm , e d t a solution 500ml , filter papper 12.5 , funnel 75 ml , g6pd , glacial acetic acid , glass funnel big size , glass funnel small size , glass pipette stand , glass rod , grams stain kit (ready to use) , immersion oil (microscopy grade) dropping bottle , incubator 14x14x14 , k3 edta vail , lens cleaning paper , lieshmen stain500ml. , measuring cylender glass 100 ml , measuring cylender glass 1000 ml , measuring cylender glass 500 ml , measuring cylinder 50 ml , methylene blue 500ml , methylene blue powder 25 gm , micro cover slip 18x18 mm , micro pipette 0 50 ul , micro pipette 2 ml ( fix) , micro pipette 50 200 ul , micro pipette 50 1000 ul. , micro pipette fixd volume , micro pipette variable volume , micro pippette tips 0 50 ul. , micro pippette tips 1 ml , micro pippette tips 2 ml , micro pippette tips 50 200 ul. , micro pippette tips 50 1000 ul. , micro tips big 1000 ul , micro tips small 2 200 ul , microglass slide 75mm x25mm fine , microglass slide 75mm x25mm fine , micropipette stand , micrpglass slide 75mm x25mm fine , pipette graduated 0.5 ml , pipette graduated 1.0ml , pipette graduated 10.0 ml , pipette graduated 2.0 ml , pipette graduated 5.0 ml , plastic test tube 12x75mm. , platelet diluting fluid 100 ml , pricking needle , protein (total) , r.a. test ( latex) 25 tests , r.p.r (vdrltest) , rapid crp(latex slide test) , rbc pipette , reagent bottle 500ml. , regent bottle 1000 ml , regent bottle 250 ml , sputum collection cup with screw lid , sterilium 450 ml , sulpher powder 1x500gm. , surgical spirit (isopropyl rubbing alcohol) 1x450 ml , tuerculin (p.p.d) 10 tu , tuerculin (p.p.d) 5 tu , turniket , urea bethalot , uric acid , vaginal spetula , vaseline white / yellow 1 kg , abgel , absorbent cotton 100gm , absorbent cotton 200 gm , absorbent cotton 500gm , absorbent sheet (under pad): ( highly absorbent sheet made up of one side water proof and the other side is spun lace non woven fabrics) , adhesive plaster 10cm x 5mtr , adhesive plaster 10cm x 9mtr , adhesive plaster 15 cm x 5mtr , adhesive plaster 15cmx9mtr , adhesive plaster 7.5cm x 9mtr , adult diaper : made of ultra absorbent material with leakage barrier & having soft, flexible leg elastic. with wetness indicator. made up of woodpulp, sap, absorbent nonwooven fabric.. , ambu bag silcone adult , ambu bag silcone child , ambubag infant silicone , auto disable syring with needle 2 ml , auto disable syring with needle 5 ml , baby suit 6pcs( each set contains jabla,nappy ,sheet,blanket,bip,cap,) , biomedical disposable waste bag with colour (red, black, blue, yellow) per piece size 20 lt as per pollution control board norm , biomedical disposable waste bag with colour (red, black, blue, yellow) per piece size 60 lt as per pollution control board norm , biomedical disposable waste bag with colour (red, blacki, blue, yellow) per piece size 40 lt per pollution control board norm , cannula fixator made of elastic adesive bandage, single sterile pack, use to fix cannula , chlorohexide gluconate+cetrimide antiseptic lotion 500ml (savlon type) , connector for infusion pump , crepe bandage box pack 5cm ( fast edges ,flesh co lour , used for varicose veins,strains,sprains,and also as a pressure bandage in burns and skin grafts) , crepe bandage box pack 8cm ( fast edges ,flesh c olour , used for varicose veins,strains,sprains,and also as a pressure bandage in burns and skin grafts) , crepe bandage box pack 10cm : ( fast edges ,flesh colour , used for varicose veins,strains,sprains,and also as a pressure bandage in burns and skin grafts) , crepe bandage box pack 15cm ( fast edges ,flesh c olour , used for varicose veins,strains,sprains,and also as a pressure bandage in burns and skin grafts) , chromic catgut , curved suture needle cutting edge, pack of six isi mark surgeon makemanu quality needles pvt ltd noida make only 14 no , disposable baby suit kit four piece sterlised , disposable dressing kit: (gauze swabs 10x10x8ply 5pcs,drsssind pad 10x10 1pcs,cotton 50gm,papertape 1pcs,bandage 10cmx2mtr 4roll,savlon 100ml,povidone iodine 10gm) , disposable apron : made from non woven fabrics50 gsm soft & smooth fabrics,neck strind,water repellent,air permissible,single poly pack. , disposable bedsheet made from polythene laminated,imperivious material,nominal size 60x90 , disposable blood donour kit: contains (blood set 1pcs,iv canula 1pcs,cannula fixator 1pcs,syr 5ml 1pcs,alcholo swabs) , disposable delievery kit: each kit contains(gynaec drape,drape sheet ,absorbent cotto 20 gm,gloves 6.5 no,cord clamp,umblical tape,antiseptic lotio 10ml,surgical blade,carbolic soap,disposable cap,disposable mask,pack in asingle poly pack , disposable drip kit: (ivset,iv cannula,cannula fixator,syr 5ml,alcholo swabs,) , disposable eye pad sterlised single pcs pack , disposable gogle , disposable gown made from non woven fabric50 gsm,soft&smooth fabrics,full uper body covered,water repellent,air permissible,single poly pack. , disposable hiv kit (each kit containsprpto gown 1pcs,hood cap 1pcs,surgeons face mask 1pcs,shoe cover 1pcs,super protection double pair gloves1pair,pesheet 1pcs,gogles 1pcs,carry bag 1pcs,) , disposable hysterectomy kit: (gauze swabs 10x10 4pcs,dressing pad 10x101pcs,cotton 500gm 1pcs , disposable kelys pad (made up of fluid resistancenon woven material,with absorbent sheet with fluidcollection pouch,sterile poly pack) , disposable mother and chilkd care kit: eachkit contains(abdominal sponge,drape sheet,surgeons gown,disposable face mask,disposable cap,disposable non wowven towel,placenta bag black colour,b.p. blade with handle,gloves 6.5no.7no,7.5no,feeding tube,cotton 50gm,cord clamp,carbolic soap,pack in single poly pack , disposable mouth piece : {face mask}:made from non woven fabric 45gsm, soft & smooth fabric, three layered, water repellent, air permeable, can be use as pollution mask packing: single in polybag , disposable o.t.kit large contains (gown ,face mask,surgeons cap,disposable shoe cover,pair of eva gloves,&bedsheet,in a single poly pack) , disposable o.t.kit small contains (apron,face ,mask,cap,shoe cover,pair of e.v.a. gloves,bedsheet,single poly pack) , disposable shoe cover: made upof non woven fabrics 35 gsm,per pair pack in , disposable syr with needle 50ml ribbon pack , disposable syr with needle 20ml ribbon p ack , disposable syring with needle 1 ml ribbon pack , disposable tounge dipressor: pack of 500pcs , endotrachael tube uncuffed : childmade of special thermo sensetive material readily conforming to body cuvature, at body temperature, proximal end fitted with standard 15mm connector, x ray, opaque line on the tube to facilitate easy loctaion of tube, normal size 2,2.2,3,3.5,4,4.5, , endotracheal tube cuffed : adult aprrox internal tube daimeter are 5.5mm, 6mm, 6.5mm, 7mm, 7.5mm, 8mm, 8.5mm, 9mm, 9.5mm, 10mm , foleys baloon cathther: blockage free balloon,eliptical side eye ,maximum fluid flow, t rauma free catherization,colour coded valve sleeve, sizes available from 12 24 fg 2 way , gloves powder 400 gm pack , glutaraldehyde solution 2% : for effective , safe and repid disinfection and sterilization of endoscopes surgical instruments , anasthetic equipment, urology instruments, neonatal care instruments, dental instruments. availeble in 1litre and 5 litre. , glycerine ip 500ml bottle , hypoallergenic tape 1.25cm: gental, skin barrier, highly air permiable, optimum skin adhesionpainless removable,nominal size 1.25cmx9mtr , hypoallergenic tape 2.5cm: gental, skin barrier, highly air permiable, optimum skin adhesionpainless removable,nominal size 2.5x9mtr , hypoallergenic tape 7.5cm : gental, skin barrier, highly air permiable, optimum skin adhesionpainless removable,nominal size 7.5cmx9mtr , hypoallergenic tape5cm : gental, skin barrier, highly air permiable, optimum skin adhesionpainless removable,nominal size 5cmx9mtr , i.v. canula 26no : specially tapered ptfe catheter is a precision formed to perfection, kink resistant for easy vein puncture with minimum trauma, cannulas have a imported needle and luer lock plug , iv canual 24no , iv canual 18/20/22no , k 90 plain catheter , kelisys pad rubber , measured volume set : precisely graduated chamber., semi rigid burette chamber with easy to read scale. automatic shutoff valve., micro drops 60 drops/ml., 150cm super smooth kink resistant tubing. efficient roller controller for accurate and unrestrited flow. , nebulizer kit : (each kit contains tubingmask,medication cap,tow part,suitable for all nebulizers,clear non toxic pvc ) , oxygen hood , oxygen mask made of medical grade ,soft vinyle mask,latex free,soft elastc strap,and adustable nose.available for adult/child , patient identification tag : (mother & baby)size nominal 18 cm l, 2.5 cm w, skin friendly polymer fiber reinforced paper tamper evident fixing (button / adhesive), printing is done with non toxic ink, each pack have one mother tag & infant tag. pair , plaster of parispowder , plaster of paris 10cm bandage , plaster of paris 15cm bandage , postmartum gloves : (made up of thick rubber elbow length) , prolin 1.0 & 2.0 with needle , ryles tubes all no , silk threads asorted sizes , skin grafting blade , sofroll 10cm , sofroll15cm , spinal needle all sizes , staright suture needle : cutting edge, pack of six isi mark surgeon makemanu quality needles pvt ltd noida make all sizes , sterlized gauze pad , suction catheter all sizes , ulterasound gally (250 ml) , ulterasound roll , uretheral cathther made of non toxic medical pvc pyrogen free, , vikril no. 1.0 & 2.0 with needle , wooden tongue depressor nominal size: 15cm x 2cm, made up of wood, 500pcs/box , yankauer suction set: made of non toxic pvc, medical grade; consist of yankauer suction tip and connection cannula, sterilized by eo, packing in individual peelable polybag pack; soft connectors at both ends of the tube for easy connection, suitable for use with or without vent control facility, approx tube length : 2000mm (2mtr.), approxtube diameter : 9.00mm , allice tissue forcep (made of stainless steel) 15.0cm , allice tissue forcep (made of stainless steel) 20.0cm , artery forcep kocher st/cr. (made of stainless steel) 12.5cm , artery forcep kocher st/cr. (made of stainless steel) 15.0cm , artery forcep mosquito st/cr. (made of stainless steel) 12.5cm , artery forcep mosquito st/cr. (made of stainless steel) 17.5cm , artery forcep spencer well st/cr. (made of stainless steel) 12.5cm , artery forcep spencer well st/cr.(made of stainless steel) 17.5cm , autoclav lable , artery forcep spencer well st/cr.(made of stainless steel) 20.0cm , autoclav 12*15 : body and lid made of heavy aluminium top, fitted with double safety valve and pressure gauge. base is fitted with automatic cutt off electric heating element, supplied with stand and container isi wire and isi element , automatic soap dispenser : for automatic supply of liquid soap/gel with sensor based on ir detection capicity 500ml power. dc 6v induction distance 5~15 dispensor normal. low battery indicator with aa size alkaline battery. , b.p. machine bulb , b.p. machine cuff , babcock tissue forcep (made of stainless steel) 15c m , baby tray s.s. 12x15 , baby tray s.s. 15x18 , baby tray without cover 18 x 12 x 3 (made of st ainless steel) , bed pan female s.s with cover , bed pan male s.s with cover , clinical thermometer isi , compleet dental instrument set , d & c kit , dissecting forcep plain (made of stainless steel) 12. 5cm , dissecting forcep plain (made of stainless steel) 15. 0cm , dissecting forcep plain (made of stainless steel) 17. 0cm , dissecting forcep plain (made of stainless steel) 20. 0cm , dressing drum (made of stainless steel) 11 x 9 , e.n.t.set , electric sterlizer ss 20x6x4 : electrically operated with heating element shock proof & automatic cut off , enema can, aluminum , examination light , fiber medicine box regular , fire extingusher water co2 type 4.5 lit , fire extingusher water co2 type 9lit , flying insect killer best servicer , foetoscope , formaline chamber, 14: small made of 5mm high quality acrylic sheet with 2 shelves top open nominal dimention l 14x w 7 x h,7.5 , formaline chamber, 26: largmade of 5mm high quality acrylic sheet with 3 shelves top open nominal dimention l 26x w 8 x h,8.5 , fumigator for sterilization , height measurment stand , i u d kit (sponge holding forcep 1, artery forcep straigh 6” 1, tenaculam frocep 11” 1, vulsalum 10” 1, dressing scissors 6” 1, utairine sound 1, vaginal wall retractor 1, dissecting forcep 1x2 teath 10” 1, sims spaculum 1, cusco spaculum small 1, cusco spaculam medium 1, ss boul 1 ltr, surgical tray 10x12 1, surgical sterilizer gloves 6 no in raxine bag size 15x12) , infantometer , infra red lamp , instrument tray with cover 10 x 8 (made of stainle ss steel) , instrument tray with cover 12 x 8 (made of stainle ss steel) , instrument tray with cover 15 x 12 (made of stainl ess steel) , instrument tray with cover 8 x 6 (made of stainles s steel) , kidney tray 6 (made of stainless steel) , kidney tray 8 (made of stainless steel) , laryngoscope set (made of stainless steel) with 2 blade set , laryngoscope set (made of stainless steel) with 5 blade set , lotion bowls s.s. 50mm dia , matresse coir with rexine cover zip 3x6 , metress examination table , n.s.v.t. kit : contains : ss ( ring forceps 15cm 1pc,mosquito type forceps fine 12.5cm 1pcs , with bag.) , nibp cuff , nitrous cylinder 40cft : , oxygen cylinder, jumbo size : , oxygen rotometer : oxygen adjustment valve with rotameter & humidif ier polycarbonate bottle, capacity approx. 250ml, autocl avable , pediatric stethoscope : , postmartum set : saw ari blade24crn s.s. 1 ,1 blowpipe s.s. 1 no. scissor heavy s.s. 18cm 1 no. scissor s.s. 15crn sharp/blunt 2 no. , scalpal s.s.1.5 and 2.5 cutting part handle nos., postmortem knife s.s. 18cm, 1no., cutlery knife 10cm s.s. 1nos. , resuction kit , room temprature thermometer : , sponge holding forcep (made of stainless steel) 15c m , sponge holding forcep (made of stainless steel) 20c m , stethescope , superior: dtuneable diaphargm offers an increse in sound intensity, snap tight soft sealing ear tip designed to ensure an excellent acoustical seal in the ear canal along with maximum comfort., sall aluminiul duel chest piece., light weight sand anodized chest piece., high acoustic senstivity., pvc u shaped tube., soft sealing eartips., cromeplated headset and comfortabley angled. , trail lence set imported , vaporizer:made from medical grade plastic,shock free electric operated,use in cold,& cough. , vertical high pressure autoclave size 12x22 both chamber made of superior heavy s.s. sheet,lid made of stainless steel and gun metal combined fitted with double safety valve and pressure guage. , vertical high pressure autoclave size 16x24 both chamber made of superior heavy s.s. sheet,lid made of stainless steel and gun metal combined fitted with double safety valve and pressure guage. , vision drum wall mounted , vulselum forcep (made of stainless steel) , water bed: made of rubberised fabrics,size w90cmxl200cms,leak proof with nozel,&plug,tool kit in single pack , waiting chair 3 seater , acute care height adjustable icu bed with collapsible side railings, product should be ce approved. overall size should be 2350mm (l) x 1050mm (w) x height adj. from 550mm to 750mm should be made uo of 60mm x 30mm crca tubular frame work, with four section perforated crca sheet top. back rest, knee rest, trendelenburg, reverse tredelenburg and height operated by screw and lever mechanism with four separate attached s.s. folding handles.polymer moulded head and foot board, with four heavy duty swivel castors of 125mm dia (two with break)should be pretreated and epoxy coated. , bed side screen (3 fold/ panel): overall approx size 1680 h x 2450 mm w ms tubler constraction in three section mounted on six swivel twine wheel non rusting castors 500 mm dia middle span 1210 mm wide side span 610 mm wide each supplied with hook and spings without curtain preteated and powder coated , bedside loker with drawer & ss top : 40cm x 40cm x 75cm machine pressed cr ms cupboard with ventilating louvers on press lock door fixed with squair cr erw tubuler legs on two swivel coster and two stumps die pressed steamless and wooden top with raised edges on..preteated and powder coated , biomedical disposable waste trolley with set of thre e container iron.preteated and powder coated , blood donour couch : fully automatic with height adjustments , cradle maternity , dental chair : with accessories fully automatic , double fold folding stretcher : made from aluminium normal size 70 x 22 length 7fit double side fold. , textron fabric cloth with outer cover bag. , double tier bowl stand pretreated epoxy powder co ated. , examination table : 183cm x 51cm x 75cm with ss top pretreated epoxy powder coated. , folding walker : walker made of epoxy powder coted 18g 1.0 height 76 to 85cm easy to hold and use.round ms pipe . , one button folding walker with 8 adjustable section , fowler bed : , general purpose hospital cot,: sheet top, size 197cm long 90cm wide ,60 cm height pipe gaze 18 dia &sheet gaze 20 , gynace examination couch fully motorised : , icu bed fully motorised : , labour table fully motorised with guarantee heavy duty , labur table mannual ss top : , linen trolly : with canvas bag overal approxsize 91 cmx51 cm. dia, ss tubler fram work fitted with threeswivel castors 100mm. dia. , obsteric labourtable, complete ss motorized: , obstetric labourtable, 183cm x 77cm x 76cm ss to p steel sheet : preatreated & powder coated. , over bed table ss top 10cm x 45cm x 95cm : preatreated & powder coated. , oxygen cylender : trolley cylenderms tubler fram work fitted with two wheel 100 mm diatrollywith ss basepreatreated &powder coated. , patient stool s.s. top preatreated &powder coated. , postmartum table: 187cm.x 75 cm.x 75 cm.ss top preatreated &powdercoated. , resusitation trolley with all accessories : preatreated & powder coated. , revolving stool, 50 cm.x45cm wih top of 30 cm.s.s. : machine pressed bent top made from crc heet , tubular frame work fitted with rubber shoes. , pretreated & epoxy powder coated. , saline stand / iv stand with wheels: stong ms tublerconstractionmountedon five prolonged rectagular base fitted with fiveswivel twin wheel non rustingcoster 50mm dia ss rod with double hooks high adjustment rom approx 1620 mm to 2340 mm preatreated &powdercoated. , semi fowler bed: , product should be ce approved, overall size 2060mm (l) x 1050mm (b) x 590mm (h) should be made uo of 60mm x 30mm crca tubular frame work, with two section perforated crca sheet top. back rest operated by screw and lever mechanism with attached s.s. folding handles, with collapsible side railings.polymer moulded head and foot board, with four heavy duty swivel castors of 125mm dia (two with break)should be pretreated and epoxy coated. , single tier bowl stand pretreated and epoxy coated. , stretcher on trolley with mattress and belt big we heel 12 inch: nominal size 2140mm l x 570mm w x 820mm h, tubular frame work, trolley mounted on., removable stretcher top. foam mattress size 2140mm l 570mm w and h 50mm with rexin cover. pretreated & epoxy powder coated. , stretcher trolley with lift off : , 1) trolley 122cm x 61cm x 78cm 2) stretcher , telescopic labour table : size l 1830mmx w 870mmx h 800mm mounted on 50mm x 25mm rectangular stainless steel tube with three section stainless steel top and stainless steel base, backrest on ratchet with handgrip on both sides, head low/up (t & rt) by screw maechanism, middle section having perianl u cut with bowl, sliding foot end and railing on three sides. , trauma cash cart trolley : , waiting chair 3 seater s.s.: , wheel chair , non folding : overall approx size67 cm. (w) x112 cm(d)92 cm. (h) ms tubelar framwork fittedwith metal seat & back adjustable alluminium foot rests two solid rubberlyred bicycle wheel withbrack and self properlling ss hoops two swivel castor 200 mm. dia infront preatreated & powder coated. , air bed spesifications (1) dimensions 196mm (l) x 134mm (w) x 85mm (h) , (2) w , b.p. stand model, mercular : isi specification ( with all standard acessoriescovered with warranty ) , b.p.apparatus mercurial: ( with long tubing & velcro,cuff,clear mercury tube, tube cleaning brush) , digital thermometer :renge 32.0c, 42.9c(90.0f, 109.9f) , display liquid crystal display,3 1/2 digit with batters , battery life 200 houre of continuos opration, weight approx 13.5 grams inc.battery , alarm: approx 10 seconds sound signal when peak temperature reached. , bipep machine : temperature 5 to 40c 209 to 55 c, humidity: <80% non condensing <93 non condensing, iso 17510 sleep apnea breathing therapy, made of operation: continuous , ac power consumption: 100 240vac, 50/60 hz, pressure range : 2 to 20hpa (in 0.5hpa increments), pressure stability: 2 to 20hpa (+ 0.5 hpa) , sound pressure level:<30db, maximum flow: >15lpm , pressure display accy: + 0.5 hpa. , boyless appratus: 2x2 made of full ss body with hy posia guard and circle absorbent with all standard acessories covered with warranty. , bubble c pap : with humidifier heating sensor wives with guarantee and installation , c pap: inspiration triger for auto start up,integtrated designed inh2 tm heated humidifier, ,a , calorie meter , cardiac monitor: with all accessories with warranty, free installation, service center in ( m.p.) , cautery machine: with all accessories and guarantee , color doppler : with all echo cardiography all accessories and installation , counting chamber , ctg machine:with all accessories and guarantee with warranty, free installation, servic , defribillator: biphasic : 100 charge/ discharges of 360 joules on a single charge., storage, recall and priting of events, record ecg before and after shock. , defribillator: monophasic : portable and battary oprated with synchronised cardio version., less than 5 second to charge to 360 joules.storage ,recall and priting of events. lcd screen for ecgdisplay., integrated adult and paediatric., internal defibrillation capability , dental x ray machine 60ma : with all accessories and installation and guarantee opg , digital foetal doppler table top model: 8.4 colorized lcd large screen, three in one probe, reduce the line winding., 12 hours data & waveform strong and review twins montitoring function option. , bulit in pc network can be connected to the central monitoring system. ,toco rang :0 100(relative uint) , display: fhr, toco, fm. mark, time, freeze, replay. , power: ac 220v_20%, 50hz,. power consumption: 20w. with waranty. , digital handheld fetal duppler:the ultrasound dosaga is under 50% of the national ultrasonic power standard , litgh weight handset portable , large lcd display with bule backlight , built in louspeaker, more clearly & lodly , ultrasound probe solid durable anti falling down. , ultrasound frequncy: 2/2.5/3 mhz+3% ultrasound intnsity: 2.5mw/cm2 , power : ac 220v 50hz, bulit 0.25kg, temperature: 5c 40c , humidity: 0 85% , e.c.g. machine digital 3 channel:simultaneous acquisitoon of 12 lead ecg data , screen display: 3.8 inch lcd screen, 12 leads display and working status display, rrecording mode: 3ch, 3 1ch, 60 sec compressibile wavefrom record, record pepar: 80mmx20/30m , data stroage: sd card for data storage ( optional) , power supply: ac 100 240v(50/60hz), dc 12v/1500mah. , ecg machine 6 channel: 7 tft, touch screen, led backlight , patient isolation technology and signal pro cessing solution, digital filter , patient management, name and age and id., bulit in language rechargeabal battery, wide thermall printing system , memory: buily in memry or mini sd memory card. store more than 1000 pieees of archive , laed: standard 12 leads , frequnecy response:0.05 150hz( 3db) , time constand: >3.2s , cmrr:>100db , dimention of recoding paper:80mmxx20m . , ecg machine single channel: ample clear ecg tracings, automatic & manaul modes, feather tuch key operation, parameters display on backlit lcd, in built rechargable battery with charger. , ecg machine twelve channel : simuultaneous acquisition of 12 lead ecg data, real time recording and printing of 12 channel ecg waveform , graphic display of 12 lead ecg waveform, built in analysis software of age witch assures accurate reslt, auto measurement, auto interpretaion, wavefrom playback and storage of egc data, literal and graphic opreation interface , powerful filters to minimize interfeence, heart rate measurement and pace maker protoction cricuit, ac,dc, or built in lithium battery power supply, alarm of battery weak and lead off. , electric suction machine: heavy duty with battery back up with guarantee. , electril drill: with all standard acessoriescovered with warranty. , fluxmeter : with all standard acessoriescovered with warranty. , hand dryier automatic : , high pressure jet machine : with all standard acessoriescovered with warranty. , infusion pump : the infusion pump has aubidle and visual alarm for occlusion, empty, low battery, end of infusion, door open,wrong seetting ect., the infusion pump is compatible with any brand of infusion ests after correct calibration , the pump has purge function , this infusion pump also can automatically record the settings for last transfuion,speed range 1ml/h 1200ml/h(increment of 1ml/h), infusion accurancywithin+ 5% , high speed infusion 100ml/h 1200ml/h(can be calibrated), volume limit 1ml 999.9ml(increment of 0.1ml), infusion volume done9999ml(increment of 0.1ml). , mtp suction appartus : with all standard acessories covered with warranty. , multi para monitor five para : screen size 12.1 ,5 standard parameters : ecg, resp, nibp, spo2,1 temp, on line help and patient info management, up to 4 hours working capacity of built in rechargable battery,ecg: lead mode :5 lead(r.l.f.n.c) wavefrom: 3 and 7 channel selectable , heart rate range: adult: 15 300bpm: neonate:/pediatric:15 350bpm, resolution: ibpm filter: surgery mode;1 20hz , alarm range: 15 1350bpm s t segment detecton: measurement range: 2.omv +2.omv, alarm range: 2.00mv +2.0.om v, accuracy: 0.8mv +0.8mv error: +0.02mv. , multi para monitor : , nebulizer : , o.t.light celling led 4x4 , operating microscope : high resolution all accessories and installation , oxygen concentrator : psa technology, adjustable folwrate, large lcd display,digital pressure digital, maintenance reminding. flow rate 0 5/min purity 93% , outlate pressure 0.04 0.07 power ac220v , timer accumulating timing, alarm power failure , high & low pressure. , phototherapy unit double surface : with all standard acessories covered with warranty. , phototherapy unit single surface : with all standard acessories covered with warranty. , portable x ray machine 60ma with all accessories and installation and guarantee , pulse oximeter hand held model : spo2 & pluse rate measurement,bright easy to read large led display, audible/visual alarms with adjustable alarm limits, can be used for spot check and continuous monitoring, suitable for audult pediatric and neonate.durable compact and lightweight. , pulse oxymeter bedside with nibp: 2.4 color lcd, auto mesure ime 1~250 minutes adjustable, measurement range 10~270 mm hg,resolution 1mm hg, alarm systolic diastolic mean pr spo, high bright leds display of nibp,spo,up to 2000 groups nibp data storage or spo data up to 10 hours.measurement range 0~100%, resolution 1%, accuracy 70~100% . , scrubber and dryer , semi auto biochemestry analyser : with all accessories with guarantee and installation , shadowless mobile operation lamp,: floor mobile 18 reflected with remote centre controll , shadowless mobile operation theatre lamp,: floor mobile reflector 14 , sodium+pottasium analyzer , shadowless mobile operation theatre lamp,: floor mobile reflector 16 , sonography machine with all accessories and gua rantee , syringe needle destroyer manual; stainless alloy adjustable blade, compact & standred , syringe needle distroyer electric. : electric operated compact equipment , adequate safeguard against accidental pricks, simple to operate, portable sharp. , syringe pump: easy speed mode, time volume mode, dosage weight mode,function to remove bubbles in the tube fast,function to handle fast speed and larg volume the system automatically opens up kvo after injection.machine will autometically records the setting for last injection, function to auto define a syringe.freely stackable. , tonometer with all accessories , touch doppler : operating probe frequency 2.5mhz for obstetries & gynecological a , transport incubator with all accessories , vaccum cleaner , ventilator with all accessories adult with installati on guaranteed child , portable ventilator for ambulance , x ray machine 300ma , x ray machine 100ma , a.c 1.5 ton , acid 5 ltr. , bath soap 100gm , bucket ss , bucket plastic , detergent soap 100gm , domestic refridgerator 250ltr , dust control mobe , doctor sliper , electronic watch wall mounted , emergency light two tube isi mark , finit 500ml , finit pump , full jhadu , inverter with battery for back off five hrs , iron bucket big , kick bucket (powder coated) , led 40 watt , lock big size , nephthallins ball 100gm pkt , plastic chair , rassi pocha 1/2 kg , room heater , room spray , sikh jhadu , stabilizer 5 kilowatt , sweeper jhadu , toilet clener per ltr , torch , tube lite complete , viper , washing powder 1kg , water cooler 40/80 litre full ss body , water purify system , white phenoyl 5ltr , room coolerroom cooler 18 exahust fan crompton motor galvenised matel sheet body window hight stand in angeled iron , x raydeveloper 13.5 ltr. , x ray casette k4 10x12 , x ray casette k4 12x12 , x ray casette k4 12x15 , x ray casette k4 6x8 , x ray casette k4 8x10 , x ray chest stand floor mounted , x ray chest stand wall mounted , x ray dark room safe light , x ray developing tank 13.5ltr , x ray developing tank 22.5ltr , x ray film 12x12 , x ray film 6.5x8.5 , x ray film dryingrack for 12 film , x ray fixer 13.5ltr , x ray hanger s.s. all size , x ray lead appron , x ray lead gloves , x ray lead letter , x ray lead partition with lead glass , x ray screen kirn h.s. 8x10 , x ray screen kirn k4 10x12 , x ray screen kirn k4 12x12 , x ray screen kirn k4 12x15 , x ray screen kirn k4 6x8 , x ray screen kirn kg4 12x12 , x ray screen kirn kg4 12x15 , x ray screen kirn kg4 6x8 , x ray screen kirn kg4 8x10 , x ray screen kirn kg4. 10x12 , x ray developer 9ltr , x ray devloper 22.5lte , x ray fixer 9ltr , x ray fixer 22.5ltr , x ray film digital 8x10 , x ray film digital 10x12 , x ray film digital 12x15 , x ray lead gogoles , x ray dying rack , x ray dying cabinet , x ray dying cilp , prinkingneedle , microslide 75 mm x25 , disposable mother and child care kitt , digital hb hemo metter , digital hb hemo metter strip 50strip , kmc chairms , fogger machine , binocular microscope: high resolution for 1yr guarantee with all accessories , binocular microscope: low resolution best quality guaranteed , blood bag tube sealer:with all standard acessories covered with warranty. , blood bag weiging scale: with all standard acessoriescovered with warranty. , blood bank refridgerator 150bags capacity: with all standard acessoriescovered with war , blood collection monitor with guarantee: with all standard acessoriescovered with warra , blood donour couch fully automatic with aceessories , blood gas analyser: with all standard acessories covered with warranty. , centrifuge machine with timer 4 tube : four tube centrifuge is used to spin whole blood samples and separate plasma capicity :4nos.tube,(swing out head),mains input:,220v,50hz,|110v,60hz,max.speed,more than 3200 rpm,max.r.c.f.,1600x g,w x d x h, 317x317x300mm,weight,6.2 kg.net,motor,universal (ac/dc carbon brush type ,body,aluminium body,timer,0 to 30 minutes,auto off , centrifuge machine with timer 6 tube : six tube centrifuge is used to spin whole blood samples and separate plasma capicity :6nos.tube,(swing out head),mains input:,220v,50hz,|110v,60hz,max.speed,more than 3200 rpm,max.r.c.f.,1700x g,w x d x h, 317x317x300mm,weight,6.2kg.net,motor,universal (ac/dc carbon brush type,body,aluminium body,timer,0 to 30 minutes , auto off , centrifuge machine with timer 8 tube : eight tube centrifuge is used to spin whole blood samples and separate plasma capicity :8nos.tube,(swing out head),mains input:,220v,50hz,|110v,60hz,max.speed,more than 3200 rpm,max.r.c.f.,1800x g,w x d x h, 315x315x300mm,weight,6.3kg.net,motor,universal (ac/dc carbon brush type,body,aluminium body,timer,0 to 30 minutes , auto off , fully automatic blood cell counter with all standard acessoriescovered with warranty. , fully automatic chemistry analyser : with allstandard acessoriescovered with warranty. , fumigator : with all standard acessoriescovered with warranty. , haemoglobinometer : sahllis best quality.german made , hot air oven : with all standard acessoriescovered with warranty. , incubator : with all standard acessoriescovered with warranty. , pt, aptt coagulometer , stop watch , vdrl shaker , water bath , mini laprotomy set , new pahel kit , hbnc kit , venturi mask , nasophrangeal mask , gudel airway , oxygen concentrator bootle , bipap machine , matratva bag , ppe kit , n95 , long body cover suit , diaposable cap , parrafin tape , thermocall box , zip polythene , matratva bag , paed stetescope , sterile gloves , disposbale examination gloves , disposable nitrile gloves , face shield , hand sanitizer 500ml , hand sanitizer 5ltr , sodium hyphochloride solution 5ltr , handwash 500ml , baby diapper , dresing pad 10x10 , dressing pad 10x20 , dispoable bedsheet , blood donar set , urobag , paper gloves , dustbin 30ltr , dustbin 50ltr , pregnancy card , raidant warmer , glucometer kit , n10 hcl , digital bp monitor , bed side stool( patient stool ) , double foot step , 3 buket mopping trolley , dressing trolley , instrument trolley , dustbin 10ltr , stetscope adult , antiseptic lotion , ambu bag 0 size , dressing pad 10x10 , dressing drum(9x9) , masquito artery curved and staright , needle holder medium size & large size , scissor straight,curve & state,small,medium,large 12,15,18 , sponge holder,small,medium,large , allis forceps ,12,15,18 , baby tray 12x18 , envipure 5ltr solution , spray pump(heavy quality) , non contact infrared thermameter , digital thermameter , goggle , oxygen flow meter , spirometer , oxygen cylinder trolley small , oxygen cylinder trolley jumbo , bipap mask , nebulizer , automatic sanitizer dispemnser , disposable gown , rnaextraction kit , rtpcr kit , dual testing kit for hiv and syphylis , mtb truenat rx chip kit , suture abaorbable polyglycolic acid 1/2 cir size 5/0(each),consumable , suture absorbable chromic catgut1/2 cir with rb needle 5/0(each),consumable , suture absorbable chromic catgut1/2 cir with rb needle 6/0(each),consumable , suture absorbable polyglycolic acid 1/2 cir size 6/0(each),consumable , suture absorbable polyglycolic acid 1/2 cir size 6/0(each),consumable , suture copolymer of glycolide and e caprolactone(2 0,,20cm,26mm,20 anchors /inch unidirectional),consumable , suture copolymer of glycolide and e caprolactone(3 0,30cm,3/8 circle rc 24mm needle,20 anchors /inch unidirectional),consumable , suture copolymer of glycolide and e caprolactone(3 0,30cm,3/8 circle rc 24mm needle,20 anchors /inch unidirectional),consumable , suture dyed polyester poly (p dioxanone)(1,36x36 cm, 1/2 circle cutting 40mm,20 anchors/ inch biderctional),consumable , suture dyed polyester poly (p dioxanone)(1,36x36 cm, 1/2 circle cutting 40mm,20 anchors/ inch biderctional),consumable , suture dyed polyester poly (p dioxanone)(2 0,30cm, 1/2 circle 36mm rb, 20 anchors /inch unidirctional),consumable , suture dyed polyester poly (p dioxanone)(2 0,30cm, 1/2 circle 36mm rb, 20 anchors /inch unidirctional),consumable , suture dyed polyester poly (p dioxxanone)(1 0,14x4 cm, 1/2 circle 36mm rb, 20 anchors / inch bidirctional),consumable , suture dyed polyester poly (p dioxxanone)(1 0,24x4 cm, 1/2 circle 36mm rb, 20 anchors / inch bidirctional),consumable , suture free securement hydrocolloid device for picc line catheter(1x1),consumable , suture free securement hydrocolloid device for umbilical catheter(1x1),consumable , suture needle curved stainless steel, girth : 3 inch /76mm(gauge 18),consumable , suture needles curved 1/2 circle round bodyassorted size 11 15 , suture needles curved 1/2 circle round bodyassorted size 1 5 , suture needles curved 1/2 circle round bodyassorted size 16 20 , suture needles curved 1/2 circle round body assorted (size 6 10 6 nos/pkt),consumable , suture needles curved and cutting 1/2 circle cutting (size 6 10 6 nos/pkt),consumable , suture needles curved and cutting 1/2 circle (size 11 15 6nos/pkt),consumable , suture needles curved and cutting 1/2 circle (size 16 20 6 nos/pkt),consumable , suture needles curved and cutting(1 5 6 nos/pkt),consumable , suture needle straight stainless steel, girth : 3 inch /76mm(gauge 18),consumable , suture non absorbable polymide 1/2 cir with cutting needle 3/0(each),consumable , suture nylone 1.0(pack of 1x12pc),consumable , suture nylone 2.0(pack of 1x12pc),consumable , suture nylone 3.0(pack of 1x12pc),consumable , sutures 10 0 silk(12 foils/pkt),consumable , sutures 6 0, braided coated polyglycolic acid / polyglactin 910, violet absorbable surgical suture with needle,1/4th micropoint spatula 8mm double arm(12 foils/packet),sutures , sutures 6 0 vicryl. 12 foils/pkt. braided coated polyglycolic acid violet absorbable surgical suture with needle. 1/4th micropoint spatula 8mm double arm. 12 foils/packet(12 foils/packet),consumable , sutures 8 0 vergin silk,(12 foils/pkt),consumable , suture silk 1/2 cir with rb needle 5/0(each),consumable , suture silk 1/2 cir with rb needle 6/0(each),consumable , suture silk 1/2 cir(with rb needle 6/10),consumable , suture vicryl 1.0(pack of 1x12pc),consumable , suture vicryl 2.0(pack of 1x12pc),consumable , suture vicryl 3.0(pack of 1x12pc),consumable , catgut chromic length (150 cm size 1),consumable , catgut chromic length(150 cm size 3),consumable , catgut chromic size:2/0 length 150 cm , catgut chromic with 1/2 cir cutting needle 12mm(length 70cm no.3 0, 12 foils per pakt),consumable , catgut chromic with 1/2 cir rb needle 30 mm length 70cm no. 1 0, 12 foils per packet(needle 30 mm length 70cm no. 1 0, 12 foils per packet),consumable , catgut chromic with 1/2 cir rb needle 40 mm length 75cm no. 1 consumable , catgut chromic with 1/2 cir rb needle 40 mm length 75cm no. 2 consumable(each),consumable , 5 0 silk braded with 3/8 circle(reverce cutting needle),consumable , orthopaedic drill machine , digital tourniquet machine...

Government College - Madhya Pradesh

38007489 rate contract for medical items , equipments / instruments , hbsagcard 50 , hiv card 50 , urine for albumin / sugar 100 , urine for pregnancy stip and card 50 , malaria antigen pf / pv 50 , urine strip for 5 para 100 , syphlis card for vdrl 50 , rapidaso ( latex slide test ) 20 , rapid crp ( latex slide test ) 20 , rapid ra ( latex slide test ) 20 , rapid widal ( o, h, ah, bh ) slide test 4*5ml , widal ( o, h, ah, bh ) test tube method 4x50ml , blood group kit ( antisera ) 3*10ml , glucose ( god pod ) 4x50ml , cholesterol ( chod pod mathod ) 4x25ml , direct hdl cholesterol 2 x 24 / 2 x 8 ml , triglycerides ( gpo pap 4x25ml , bilirubin ( t&d ) ( modified jendrassik method ) 4x50ml , sgot ( ast ) kinetic 5*10ml , sgpt ( alt ) kinetic 5*10ml , alkaline phosphatase ( pnpp ) kinetic 3*10ml , uric acid ( uricase ) 5x5ml , urea ( ned kinetic ) 4 x 20 / 4 x 5ml , creatinine fk ( kinetic ) 2 x 25 / 2 x 25ml , ra ( quantitative immune turbid metric 50ml , aso ( quantitative ) 50ml , calcium ( ocpc ) 1x50ml , crp ( rapid quantitativetest finecare ) 25 test , crp ( quantitative ) 2 x 20 / 2 x 5ml , hba1c ( rapid quantitativetest finecare ) 25 test , sodium hypochlorite 5 lt , vitamin d ( rapid quantitativetest finecare ) 25 test , psa ( rapid quantitativetest finecare ) 25 test , ca 125 ( elisa ) 96 test , vitamin b12 ( elisa ) 96 test , lh ( elisa ) 96 test , fsh ( elisa ) 96 test , prl ( elisa ) 96 test , hbsag ( elisa ) 96 test , ferritin ( elisa ) 96 test , t3 ( rapid quantitativetest finecare ) 25 test , t4 ( rapid quantitativetest finecare ) 25 test , tsh ( rapid quantitativetest finecare ) 25 test , il 6 ( rapid quantitativetest finecare ) 25 test , d dimer ( rapid quantitativetest finecare ) 25 test , t3 ( elisa ) 96 test , t4 ( elisa ) 96 test , tsh ( elisa ) 96 test 96 test , bariumchloride 10% w / v 500ml , benedictsreagent 5lt , fouchet’s reagent 250ml , drabkins solution with standard ( for hb ) 5000ml , glacial acetic acid 500ml , edta 5% w / v 500ml , sulfuric acid con. 500ml , field stain a 500ml , field stain b 500ml , hydrochloric acid n / 10 500ml , immersion oil ( microscopy grade ) dropping bottle 30ml , immersion oil ( microscopy grade ) dropping bottle 25 ml , wbc diluting fluid 500ml , rbc diluting fluid 500ml , reticulocyte counting fluid ( biolab ) 25 ml , semen diluting fluid 100ml , formalin 5 lt , formalin 30lt , fructose 100ml , acetone 250 test , leishman stain with buffer 250ml , sulphur powder 500g , liquor ammonia solution 500gm , sodium nitroproside 100gm , carbol fuchsin ( zn strong ) 500ml , methy line blue 500ml , xyline 2.5ltr , needle 23, 24 1x100nos , spirit 4.5 ltr ( methy ) , distilled water 5ltr , paps smear staining , slide stand albuminium , esr niddle , micropipet stand , hemocytometer , glucometre dr morphen , glucometerstrips 1x50nos dr morphen , micropipette fix volume , micropipette variable volume 0.5 5ul , micropipette variable volume 5 50ul , micropipette variable volume 10 100ul , micropipette variable volume 20 200ul , micropipette variable volume 100 1000ul , incubator ( inner chamber ss digital with fan ) 14x14x14 , water wath ( digital ) 10x12x7 , hemoglobin meter with set , urinometer , slide box , pipette glass 2.0ml , pipette glass 5.0ml , pipette glass 0.2ml , pipette glass 0.1ml , pipette glass 10*75mm , pipette glass 10*75mm , test tube without rim plastic 1x100nos , test tube without rim 1x100nos , glass rod , rbc pipette 100 , wbc pipette 10gm , capillary tube 1x100nos , cover slip 18, or 22mm 1x20 nos pack , wintrobe tube for esr , test tube cleaning brush , pipette bulb , test tube holder , tourniquet , citrate vail , edta k3 vail , fluoridevail , plain vail ( activator ) , ria vail 100 , chattels forceps straight ss , urine container sterile 30 ml 1 pack , micropipete tips 10 100 u and 100 1000 u, 1 pack , tissue paper roll , filterpaper 100 pack , insulin syringe , polythene gloves 100 , surgical gloves 6; no 7 n0 , non dispo gloves 100 pack , postmortem gloves 1 pack , syringe 50ml , syringe , 20 ml , syringe 10 ml , syringe , 5ml , syringe 2ml , ecg gelly 250ml , usg gelly 250ml , cotton roll 500 g , usg roll upp 1105 in ( 110mmx20m ) thirmal print media ) , povidione solution 500 ml , povidione ointment 15gm , savlon 1ltr , dettol 1ltr., , dettol500ml, , hydrogen peroxide 450 ml , lignocaine gelly 2% , lignocaine inj with adrenol 2% 30ml , lignocaine spray 10 % , lignocaine inj 2% , lignocaine inj 4% , lignocaine tropical vial 4% , tinbenzone 100ml , bandage ( antiseptic ) , micropore 2inch , micropore 4inch , n. saline, dns, d5, d10 , scalpvan set , berbar thred 20 no. , enema pot , enema pipe with nozal , hot water beg , rubber catheter red , bandage than , roll bandage 0.5x 0.5, 7 , roll bandage 5x 5 , roll bandage 10x5 , ecg roll ( 12 channel gotiz ) , mechintosh1 mtr , head cap disposable 100 , sanitizer 100 ml with sprey , x ray film digital fuzi 14x17 , x ray film digital duzi 8 x 10 , nylon silk suture4.0 , 31inch*72inch color white non woven fabric for single use bedsheet , weighing machine adult , weighing machine child , weighing machine digital , stethoscope adult , stethoscope child , bp instrument led mercury , glucometer strips 1x50nos dmorphen , formalin4.5 lt , pulse oximeter , non contact thermometer , face mask disposable 3 layer , n 95 face mask , occult blood card , lugols iodine ( bottle 100ml ) , diluent ( 5pda ) ( 20l ) merril , fbh lyse ( 500 ml ) merril , fdoi lyse ( 500 ml ) merril , fdti ( 200ml ) merril , celquant 5 detergent ( 4x100ml ) merril , stop watch digital , rectangular mildred glass jars with lids sizes5.5 cm length4.5cm width 9. 5cm height , rectangular mildred glass jars with lids sizes10.5 cm length 8.5 cm width 15.5 cm height , foetal doppler , iui canula ( 17cm ) , fumigator , infant feeding tube , sterilizer 10*12 , oxygen cylinder 40 tft , dressing drum ( big ) 8*10 , dressing drum ( big ) 10*12 , dressing drum ( big ) 12*12 , surgical scissor medium ss , surgical forceps medium ss , needle holder medium ss , surgical artery forcep mediumss , hole sheet 2 ½, 4 cotton , plan sheet 2 ½, 3cotton , ot table cover 3, 7cotton , plastic apron , restoration gic , light cure composite kit ( tech econom plus ) , light cure flowable gic , light cure caoh2 dressing , suture needle holder , suture cutting scissors , 3 0 silk suture reverse cutting edge , mouth prop ( small ) , mouth prop ( medium ) , mouth prop ( large ) , cryer elevator , root elevator standard , mouth mirror , kidney tray medium ss , composite filling instruments kit ( plastic filling instrument ) , normal big size scissors , matrix band kit , wedges , patient drape , 3ml syringe 26g 1½, needle ( unolock ) luer lock , explorer , periosteal elevator , root elevator ( right&left plain ) , luting gic , diamond bur round , diamond bur inverted cone 2 , diamond bur flame shape , airotor ( push button ) , scaler tips ( dte d1 ) 1set , avilinjection 2 ml , dexamethasoneinjection 2 ml , atropine injection 1ml , hydrocort injection 10ml , compose injection 2ml , i v metrogyl 100ml , i v ciplox100ml , dynapar injection 1ml , botroclot solution , tab formalin , iv set , silk thread 1 , silk thread 0, 2 , silk thread 0, 3 , silk thread 0 , wikoryl throat 2.0 , catgut 2 , catgut 0, 1 , catgut 0 , catgut 01 , catching needle 01 no , iv cannula 20 no , iv cannula 22 no , surgical blade 11 no , model dissection of the right mammary gland , model anastomosing arteries around the scapula , model dissection of left gluteal region. gluteus maximus and gluteus medius have been removed, and quadratus femoris has been reflected. in the specimen, the inferior gluteal artery was medial to the internal pudendal instead of lateral to it. , model dissection of left popliteal fossa. the upper boundaries have been pulled apart and the aponeurosis to which the two heads of the gastrocnemius are attached has been split and the heads separated. for deeper dissection. , model dissection of gluteal region and back of thigh , model dissection of front and lateral side of leg. , model284:304dissection of+b273 dorsum of foot , model superficial dissection of leg viewed from posteromedial side, showing veins and nerves. note the numerous anastomoses between the great and the small saphenous veins , model superficial dissection of leg viewed from posterolateral side showing veins and nerves. in the specimen there were numerous large anastomosing channels between the small and the great saphenous veins , modeldeep dissection of back of leg , modeldissection of medial side of ankle, showing the relations of the flexor retinaculum. ( model no. 1 ) , modeldissection of leg and foot showing synovial sheaths. ( model no. 2 ) , modelsuperficial dissection of sole of foot to show plantar aponeurosis. the skin and superficial fascia, except the superficial transverse ligament, have been removed, and the fibrous flexor sheaths partially opened. , modelsuperficial dissection of sole of foot. the plantar aponeurosis has been revomed. the abductor digiti minimi & the abductor hallucis have been pulled aside , modeldissection of sole of foot. most of the flexor digitorum brevis has been removed. deep dissection of sole of foot… model 1 , model dissection of sole of foot. most of the flexor digitorum brevis has been removed. deep dissection of sole of foot…model 2note : allmodels are of 18x34 or 18x20 inchesin size , made up of fiber glass, unbreakable, washable and again paintable. note : allmodels are of 18x34 or 18x20 inchesin size , made up of fiber glass, unbreakable, washable and again paintable. , specimen jars with knobbed stopper ( 4x1.5 ) , specimen jars with knobbed stopper ( 6x2 ) , specimen jars with knobbed stopper ( 8x2 ) , specimen jars with knobbed stopper ( 10x2 ) , specimen jars with knobbed stopper ( 12x2 ) , specimen jars with knobbed stopper ( 8x3 ) , specimen jars with knobbed stopper ( 10x3 ) , specimen jars with knobbed stopper ( 12x3 ) , specimen jars with knobbed stopper ( 15x3 ) , specimen jars with knobbed stopper ( 6x4 ) , specimen jars with knobbed stopper ( 8x4 ) , specimen jars with knobbed stopper ( 10x4 ) , specimen jars with knobbed stopper ( 12x4 ) , specimen jars with knobbed stopper ( 15x4 ) , specimen jars with knobbed stopper ( 8x6 ) , specimen jars with knobbed stopper ( 12x6 ) , specimen jars with knobbed stopper ( 15x6 ) , baird parker agar medium , bismuth sulphite agar medium , caseinsoyabean digest agar medium , cetrimide agar medium , brilliant green agar medium , macconkey agar medium , macconkey brothmedium , mannitol salt agar medium , nutrient agar medium , nutrient broth medium , urea broth medium , vogel johnson agar medium , dioxysholate citrate agar medium , sabouraud dextrose agar medium , plate count agar ( pca ) , primary secondry amine , 1% acetic acid in acetonitrile , benedicts reagent , tollen reagent , molish reagent , sudan iv , millon reagent , mayer reagent , hagers reagent , dragendorffs reagent , anisaldehyde sulphuric acid , vanillin sulphuric acid , india ink stain , alvert stain , mrvp agar , motility agar , mrvp reagent , andole reagent , bhi broth , cled agar , sda agar , oxidase disc , lj media , hi crome agar , kovacs reagent , 2% glucose mha , afb stain , mucller hinton agar , triple sugar iron agar , peptone , gram stain , safaranin solution , lead apron ( for x ray ) , thyroid shield ( for x ray ) , gonad shield ( for x ray ) , lead gloves pair ( for x ray ) , lead goggles ( for x ray ) ...

Police Department - Madhya Pradesh

38003211 tender for supply of various equipments absolute alcohol acetic acid glacial acetone ammonium sulphate ammonia benzene chloroform diethyl ether p nehape n heptane methanol nesslers reagent palladium chloride petroleum ether (60 80°c) petroleum ether (40 60°c) silica gel silica gel g 60 f254 pre coated tlc plate aluminium sheets (20 x 20 cm) silica gel g glass plate (20 x 20 cm) schiffs reagent test tubes 20 ml bromoform 98% benzidine hydrogen peroxide eosin prepared reagent haemotoxilin prepared reagent glacial acetic acid microscopic cover glass/cover slips marker for body examination fluid filter paper 46x 57 cm or more filter paper size 18 x 22 inch or more sanitizer/hand disinfectant hand wash tough tag dropper/ pasteur pipette surface sterilizer test tubes 200 test tubes 100...

Directorate Of Health Services - Madhya Pradesh

37800141 tender for supply of drugs and medicines during the year 2023 2024 1 (group a medicine) year 2023 24 2 inj.acyclovir 250mg/vial 3 inj.adenosine2 ml amp. 4 inj.adrenaline i.p. 1 mg/ ml 5 inj.adrenochrome monosemicarbazone 0.75 mg/ml 6 inj. anti diptheria serum vial 7 inj.alfa beta artether 2 ml/im 8 inj.amikacin 500 mg 9 inj.amikacin 100 mg/ 2ml vial 10 inj.amikacin 250 mg/ 2ml vial 11 inj.aminophylline 25 mg/ml 10 ml amp 12 inj.ampicillin 250 mg/ vial 13 inj.ampicillin 500 mg/ vial 14 inj.ampicillin 1gm/vial 15 inj. ampicilline + chloxacilline 250mg+250mg 16 inj amoxycillin 500mg 17 amoxycillin and potassium clavulanate injection i.p. (1 gm + 0.2 gm)/10 ml 18 inj amoxicilin + clavulanic acid 19 inj anawin 5ml spinal anaesthesia 20 inj. act1nomycin d 0.5 mg 21 inj.anti d vaccines vial 22 inj.antitetanous immunoglobuline 250 iu vial 23 inj.artesunate 60mg/vial 24 inj.atropine sulphate 0.6 mg/ ml (sc/im/iv) 2ml 25 inj.b1, b6, b12 10ml 26 inj.b complex 10ml 27 inj.benzathine penicilline 12 lac unit 28 inj.benzathine penicilline 6 lac unit 29 inj.betamethasone 1 ml 30 inj.botrapase 31 inj. bortezomib 2 mg 32 inj.budesonide 0.25 m/g 2ml amp 33 inj.bupivacaine hydrochloride 0.25 % 10 ml vial 34 inj.calcium chloride 1.4mg/ml 10ml 35 inj.calcium gluconate 10% 10 ml amp 36 inj.calcium with vitamin d 3 37 inj.capnea 2ml 38 inj.carboprost250 mg pgf2a 39 inj. calcium leucovorin 50 mg 40 inj. carboplatin 150 mg 41 inj. carboplatin 450 mg 42 inj. carmustine 100 mg 43 inj. cetuximab 100 mg 44 inj. cetuximab 500 mg 45 inj. cisplatin 10 mg 46 inj. cisplatin 50 mg 47 inj. cyclophosphamide 200 mg 48 inj. cyclophosphamide 500 mg 49 inj. cytra.bine 100 mg 50 inj. cytrabine 1000 mg 51 inj. cyenocoballine 30mg 52 inj.cefaparazone 1 gm. 53 inj.cefaparazone 2 gm. 54 inj.cefaparazone 1000mg + sulbactan 1000mg 55 inj.cefazolin sodium500mg 56 inj.cefazolin sodium 1gm 57 inj.cefazolin sodium 250mg, 58 inj.cefotaxime sodium 1 gm 59 inj.cefotaxime sodium 250mg 60 inj.cefotaxime sodium 500mg 61 inj.cefotaxime + subectum 1gm+500mg 62 inj.ceftazidine 1 gm. 63 inj.ceftazidine 250 mg. 64 inj.ceftazidine 500 mg. 65 inj.ceftriaxone+tazobactum 1gm+125mg 66 inj.ceftrioxone 1 gm. / vial 67 inj.ceftrioxone 250 mg/ vial 68 inj.ceftrioxone 500 mg./ vial 69 inj.ceftriaxone + sulbectum 1gm+500gm 70 inj.ceftriaxone + sulbectum 500+250 71 inj.cefurexime 250 mg 72 inj.cefurexime 750 mg 73 inj.chloroquine phosphate 64.5 mg./ml 30 ml vial 74 inj.chlorpheniramine maleate 10mg/ml 10ml 75 inj.clonidine 1mcg/10 ml 76 inj.desferrioxamine 500mg vial 77 inj.desmopressin 40mg/ml 2ml 78 inj.dexamethasone sodium phosphate 4 mg/ ml vial 79 inj.diazepam 5 mg./ ml 2 ml amp. 80 inj.diclofenic sodium 25 mg. / ml 3 ml amp 81 inj.dicyclomine 10 mg./ ml 2 ml amp. 82 inj.digoxin 250 mg/ ml 2 ml amp 83 inj.diltizem im 5mg/ml 5 ml 84 inj.diphenhydramine 50mg/ml 2 ml 85 inj.diptheria antitoxin 10000 iu 10 ml 86 inj.dobutamine 50 gm / ml 5 ml amp 87 inj.dopamine 40 mg/ml 88 inj.drotaverine 40 mg /ml 10ml vial 89 inj. doxorubicin 10mg (lypholized) 90 inj.doxorubicin 10mg (ready to use) 91 inj. dacarbazine (dtic) 200mg 92 inj. dacarbazine (dtic) 500 mg 93 inj.daunorubicin 20mg 94 inj.decitabine 50mg 95 inj.docetaxel 120mg with solvent 96 inj.enalapril maleat 1.25mg/ml 2ml amp. 97 inj.epinephrine hydrochloride 1 mg/ ml of adrenaline ( 1 ml amp.) 98 inj.etophylline+theophylline 220mg/2 ml amp. 99 inj.epirubicin 10mg 100 inj.epirubicin 100mg 101 inj.epirubicin 50mg 102 inj.erythropoietin 10000 iu 103 inj.fresh frozen plasma 7 unit plasma 200 250 ml vial 104 inj.frusemide10mg/ml 2ml 105 inj. 5 fluro uracil 250mg 106 inj. 5 fluro uracil 500mg 107 inj.gentamycin 40 mg/ml 108 inj. gemcitabine 1 gm 109 inj. gemcitabine1.4gm 110 inj. gemcitabine200mg 111 inj.granisetron 3mg 112 inj. granulocyte colony stimulating factor 300 microgram prefilled syringe 113 inj. granulocyte colony stimulating factor prefilled syringe (pegylated) 6 mg 114 inj.glyceryl trinitrate 5 mg/ ml 115 inj.haloperidol 5 mg.1 ml 116 inj.halothane bp 250 ml 117 inj.heparin 1000 iu / ml 5 ml vial 118 inj.heparin 5000 iu / ml 5 ml vial 119 inj.hyaluronidase 1500 iu. 1 ml vial 120 inj.hydrocortisone sodium succinate 100 mg. / vial 121 inj.hydrocortisone sodium succinate 200 mg. / vial 122 inj.hydrocortisone sodium succinate 400 mg. / vial 123 inj.hyoscine butylbromide 20 mg./ ml 1 ml vial 124 inj.i.v. ciprofloxacin 100mg/50ml (100 ml bott.) 125 inj.i.v. dextran 70 solution 500 ml 126 inj.i.v. dextrose 10% 500 ml 127 inj.i.v. dextrose 25% 500 ml 128 inj.i.v. dextrose 5% 500 ml 129 inj.i.v. dextrose 50% 50 ml 130 inj.i.v. dextrose with saline (5%+0.9%) 500 ml 131 inj.i.v. electrolyte e(dextose 5gm sodium acetate .64gmsodium chloride 5gm potassium chloride 75mg sodium citrate 75mg calcium chloride 52mg magnisium chloride 31mg sodium meta bi sulphate 20mg) 500 ml 132 inj.i.v. electrolyte g 500 ml 133 inj.i.v. electrolyte m 500 ml 134 inj.i.v. electrolyte p 500 ml 135 inj.i.v. mannitol 10% 350ml 136 inj.i.v. mannitol 20% 350ml 137 inj.i.v. metronidazole 500mg/100ml 138 inj.i.v. ofloxacin 100 ml bottle 139 inj.i.v. omperazole 100 ml bottle 140 inj.i.v. pentaprazole 100 ml bottle 141 inj.i.v. ringer lactate500 ml 142 inj.i.v. sodium chloride 0.9% 500 ml 143 inj.insulin 30:70 mixtard 10 ml vial 144 inj.insulin soluble 40 iu / ml 10 ml vial 145 inj.iron dextran 50 mg. el iron / ml 1.5 ml amp. 146 inj.iron sucrose 50 mg/ml 1.5ml amp. 147 inj.isoxsuprine 5 mg. / ml 2ml amp. 148 inj. ifosphamide + mesna 1gm 149 inj. ifosphamide + mesna 2gm 150 inj.ketamine hydrochloride 10mg/ ml vial 151 inj.lignocaine 2 % (21.3 mg/ml) 30 ml vial 152 inj.lmwh low molecular weight heparin 4000 iu/ml 153 inj.magensium sulphate b.p. 50 % w/v 2 ml amp. 154 inj.mephentermine 30mg/ml 155 inj.metaprolol 1mg/ml 5ml vial 156 inj.methyl ergometrine 0.2 mg/ml 1 ml amp. 157 inj.methyl prednisolone sodium succinate usp 500 mg. vial 158 inj.methotraxate 1.5mg( preservative free) 159 inj.methotraxate 50mg 160 inj.metoclopramide 5 mg/ ml 10ml vial 161 inj.metoclopramide 5 mg/ ml 2 ml amp. 162 inj.micronised progestron 200 mg. 50 mg/ 1 ml 2ml amp. 163 inj.midazolam 1mg/ml 164 inj.morphine sulphate i.p. 10 mg / ml 1 ml amp 165 inj.mvi 10ml amp 166 inj.meropenem inj 1000 mg (vial) 167 inj.meropenem 500 mg / vial 168 inj.mephentermine inj 15mg/ml 10ml vial 169 inj.naloxone 0.4 m/g ml 1 ml amp 170 inj.neostigmine 0.5mg./ml 171 inj.nikethamide 2ml amp.b18 172 inj.nitroglycerine 25 mg. / 5 ml amp. 173 inj.noradrenaline 2mg base/2ml amp. 174 inj.ondancetron 2mg/ml 2ml 175 inj.oxytocin 5 iu/ ml 1 ml amp. 176 inj.oxaliplatin 100mg 177 inj.oxaliplatin 50mg 178 inj.pancuronium 2mg/ ml amp. 179 inj.pemetrexed 100mg 180 inj.pemetrexed 500mg 181 inj.phenergan 2ml 182 inj. paclitaxel 100mg 183 inj. paclitaxel 260mg 184 inj. paclitaxel 30mg 185 inj. paclitaxel 300mg 186 inj.palonosetron 0.25mg 187 inj.pentaprazole 40mg vial 188 inj.pentazoin lactate 30 mg. ml 1 ml amp. 189 inj.pethidine hydrochloride 50mg/ml 190 inj.pheniramine maleate 22.75 mg/ ml 2 ml amp. 191 inj.phenobarbitone 200 mg. / ml 1 ml amp. 192 inj.phenytion sodium 50 mg/ ml inj.2 ml amp. 193 inj.piperacillin 4mg+ tezobactan .5mg 194 inj.potassium chloride150 mg. / 10 ml amp. 195 inj.powder for crystalline penicillin 10 lac 196 inj.powder for crystalline penicillin 5 lac 197 inj.pralidoxime (pam) 25 mg. / ml amp. 198 inj.procaine penicillne 4 lac i.p.vial 199 inj.promethazine 25mg/ml 2ml amp. 200 inj.propofol 1 % 10 mg/ ml 10 ml amp 201 inj.protamine sulphate 10mg/ml 202 inj.pyroxicam 2ml amp. 203 inj.quinine sulphate 300 mg./ ml 2 ml amp. 204 inj.rabies immunoglobines 150iu vial 205 inj.rabies immunoglobines 300iu vial 206 inj.rabies vaccine i.p. human (chick embryo/vero cellculture) 2.5 iu/single dose 207 inj.rabies vaccinetissue culture vaccines vial2.5 iu/single dose 208 inj.ranitidine 50 mg/ 2 ml amp. 209 inj rituximab 100mg 210 inj rituximab 500mg 211 inj.snake venom anti serum 30 ml vial polyvalent anti snake. venum serum enzyme refined reconstitute with 10 ml of sterile water for injection. contain equivalent of 10 ml of purified equine globulins, 1 ml of reconstued serum 10 ml 212 inj.snake venom anti serum ip (liquid form ) 213 inj.sodium bicarbonate 7.5% w/v 10 ml amp. 214 inj.sodium chloride 1/2normal, hypertonic & dextrose 5% 215 inj.sodium thiopentone 0.5 gm powder / vial 20 ml vial 216 inj.streptokinase 7.5 lac set. 217 inj.streptokinase 1500000 iu vial 218 inj.succinyl choline 50 mg/ ml 10 ml amp. 219 inj.surafactant bovine (intracheal) nature4ml 220 inj.tebutaline sulphate 0.5 mg/ ml 1 ml amp. 221 inj.tetanus immunogobulin sup 250 iu / vial 222 inj.tetanus toxiod 5 ml vial 223 inj.tetanus toxiodamp 224 inj.torasemide 100mg/2ml 225 inj.tracrium amp 226 inj.tramadol 100 mg 2ml amp. 227 inj.tramadol 50mg/ml 2ml amp. 228 inj.tranexamice acid 125mg/ml 229 inj.trimcinolone acetate 10 mg 40 mg/ ml 1 ml amp. 230 inj trastuzumab 150mg 231 inj trastuzumab 440mg 232 inj.valethamate bromide 8 mg/ml 1 ml amp. 233 inj.vit. a 1 lac iu/2ml 234 inj.vit. k 10 mg. / ml 1 ml amp. 235 inj. vit.k1/kanadium 236 inj. vit.k3 237 inj.water for inj. 5 ml 238 inj zoledronic acid 4mg 239 cap anti oxidente 240 cap amoxicillin 250 mg 241 cap amoxicillin 500 mg 242 cap amoxicilline 250mg+ chloxacine 250mg 243 cap amoxicilline 250mg+ chloxacine 250mg + lacticacid bacillius 244 cap ampicilline 250 mg 245 cap ampicilline 500 mg 246 cap ampiciline 250mg+ chloxacine 250mg 247 cap b complex with vit.c 248 cap cephalexine 250 mg. 249 cap cephalexine 500 mg. 250 cap chloxacilline 250mg 251 cap chloxacilline 500mg 252 cap doxycilline 100 mg 253 cap fluoxetine bp 20 mg 254 cap indomethason 25mg 255 cap. imatinib mesylate 100 mg 256 cap. imatinib mesylate 400 mg 257 cap nifedipine 10mg 258 cap nifedipine 5mg 259 cap methylcobaline 260 cap omeprazole 20 mg. 261 cap. procarbazine 50 mg 262 cap remipril 1.25 mg. 263 cap remipril 5 mg. 264 cap tetracycllin 500mg 265 cap. procarbazine 50mg 266 cap. temozolomide 100 mg 267 cap. temozolomide140 mg 268 cap. temozolomide180 mg 269 cap. temozolomide20 mg 270 cap. temozolomide250 mg 271 cap vit. a usp soft gelatin capsule each vit.a 1 lac iu 272 cap vit. a usp soft gelatin capsule each vit.a 2 lac iu 273 cap vitamin a&d 274 tab.acetazolamide 250 mg. 275 tab. aceclofenac + paracetamol + serritiopeptadase 276 tab. aceclofenac + paracetamol + chloraxone 277 tab.acyclovir ip 200 mg 278 tab.acyclovir ip 400 mg 279 tab.albendazole ip 200 mg. 280 tab.albendazole ip 400 mg. 281 tab.alprazolam 0.25 mg 282 tab.alprazolam 0.5 mg 283 tab.amitriptyline ip 25 mg. sugar coated 284 tab.amlodepine 10mg 285 tab.amlodepine 10mg + losartan 50mg 286 tab.amlodepine 5mg 287 tab.amoxycilline dispersible usp. 125 mg. 288 tab.amoxycilline+clavulanic acid dispersible228 mg 289 tab.amoxycilline+clavulanic acid dispersible625 mg 290 tab.aspirine low dose 75 mg 291 tab.asprin ( low dose ) 100mg 292 tab.asprin ( low dose ) 150mg 293 tab.atenolol 100 mg 294 tab.atenolol 50 mg 295 tab.atorvastatin ip 10 mg 296 tab.azithromycin 250 mg 297 tab.azithromycin 500 mg 298 tab.betamethasone 299 tab.bisacodyl5 mg. 300 tab.calcium carbonate 500 mg 301 tab.calcium gluconate 500 mg 302 tab.calcium with vit. d 303 tab.calcium with vit. d3 304 tab.carbamazepine 200 mg 305 tab.cefixime 100 mg 306 tab.cefixime 200 mg. 307 tab.cetrizin 10mg 308 tab.chlorine isi mark 0.5 mg. 309 tab.chloroquine phosphate 250 mg. 310 tab.chlorpheniramine meleate4 mg. 311 tab.ciprofloxacin500 mg. 312 tab.ciprofloxacin 250 mg. 313 tab.ciprofloxacine & tinidizole (250 mg.&300mg) 314 tab.ciprofloxacine &tinidizole (500 mg.&600 mg) 315 tab.clonidine 100 mcg 316 tab.clopidogrel75mg. 317 tab.clotrimazole vaginal pessary 100 mg. 318 tab.cyclophosphamide 50mg 319 tab.dexamethasone 320 tab.diazepam 5 mg. 321 tab.diclofenic sodium & paracetamole (325 mg. & 50 mg.) 322 tab.diclofenac + paracetamol + serritiopeptadase 323 tab.diclofenac + paracetamol + chloraxone 324 tab.diclofenice sodium 50 mg. 325 tab.dicyclomine 10 mg 326 tab.dicyclomine 20 mg 327 tab.dicyclomine with diclofenic sodium 328 tab.diethylcarbamazine 100 mg. 329 tab.digoxin 0.25mg. 330 tab.dilantin sodium 331 tab.diltiazem 30 mg. 332 tab.diltiazem 60mg 333 tab.domperidon 10 mg 334 tab.domperidone + pentaprazole 335 tab.doxycyciline 100 mg 336 tab.doxylamine succinate10mg.+pyridoxine10 mg 337 tab.enalapril maleate 2.5 mg. 338 tab.enalapril maleate 5 mg. 339 tab.erythromycine 250mg 340 tab.erythromycine 500 mg. 341 tab.etophylline+theophylline sr 300 mg 342 tab everolimus 10mg 343 tab everolimus 5mg 344 tab.exemestane 25mg 345 tab.fluconozole 150 mg 346 tab.fluconozole 50 mg 347 tab.folic acid ip 5 mg 348 tab.formaline 349 tab.frusemide 40 mg 350 tab.glibenclamide 5mg 351 tab.gliclazide 80 mg. 352 tab.glimepiride 1 mg. 353 tab.glimepiride 2 mg. 354 tab.glyceryl trinitrate 0.5 mg sublingual 355 tab.grisofluwin ip 125 mg. 356 tab.haloperidol 1.5 mg 357 tab.haloperidol 5 mg 358 tab.hyoscine butylbromide10 mg. 359 tab.ibuprofen + paracetamol(400 mg+325 mg) 360 tab.ibuprofen 200 mg. 361 tab.ibuprofen 400 mg. 362 tab.iron & folic acid entric coated of elemental iron (adult)+fa 0.5mg 363 tab.iron & folic acid entric coated. dessicated ip 67 mg equivalent to 20 mg of elemental iron 364 tab.iron folic acid ferrous sulphate dessicated ip 333 335 mg (equivalent to 100 mg of elemental iron ) + folic acid ip0.5 mg. tab.ferrous sulphate of elemntal iron ) + folic acid ip 0.5 mg. tab.ferrous sulphate dessicated ip 67 mg. (equivalent to 20mg of) 365 tab.isosorbide dinitrate ip 5 mg 366 tab.isosorbide mononitate 20mg. 367 tab.isoxsuprine 10 mg. 368 tab.labetalol 369 tab.lactobacillus 60 million spores 370 tab.levonorgeastrel emergency contraceptive 0.75mg 371 tab.losartan 25mg 372 tab.losartan 50 mg. 373 tab letronazole 2.5mg 374 tab.magnesium hydroxide + aluminium hydroxide (500 mg + 250 mg) 375 tab.matronidazole 200mg 376 tab.matronidazole 400mg 377 tab.mebendazole 100 mg 378 tab.metachlopramide 10 mg. 379 tab.metformin 500 mg 380 tab.methyl ergometrine maleate .125 mg. 381 tab.methyl prednisolone sodium suc.8mg 382 tab.methylclopramide 10mg 383 tab.methyldopa 250 mg 384 tab.metopropolol25 mg. 385 tab.metopropolol50 mg. 386 tab.mifepristone 200 mg. 387 tab.misoprostal 200mg 388 tab.multivitamin nfi formula sugar coated vit a 2500 iu.vit. b119mg b 1 2 mg. vit b 6 0.5 mg. vit c 50 mg, vit d 3 200 iu, vit b2 2 mg.niacinaide 25 mg. folic acid 0.2 mg, ( with appropriate overages) 389 tab.nemuselide + serritiopeptadase 390 tab.nalidixic acid 250mg 391 tab.nifedipine 10 mg 392 tab.nirlotinib 150mg 393 tab.nirlotinib 200mg 394 tab.norflox + tinidazole 395 tab.norfloxacin100 mg 396 tab.norfloxacin400 mg 397 tab.ofloxacine200 mg. 398 tab.ofloxacine400 mg. 399 tab.ofloxacine + tinidazole 200+500mg 400 tab.ofloxacine with ornidazole 200+500mg 401 tab.ondencetrone 10mg 402 tab.ornidazole 200 mg. 403 tab.ornidazole 500 mg. 404 tab.paracetamol500 mg. 405 tab.pentaprazole + domperidom 406 tab.pentaprazole 40 mg. 407 tab.phenobarbitone 30mg 408 tab.phenobarbitone 60 mg. 409 tab.phenytoin sodium 100 mg. 410 tab.piogliatazone 30 mg 411 tab.povidine iodine vaginal pessary 200 mg 412 tab.prazosin 5 mg 413 tab.prednisolone 10mg 414 tab.prednisolone 20mg 415 tab.prednisolone 5mg 416 tab.primaquin7.5mg. 417 tab.primaquin2.5mg. 418 tab.primaquin 15 mg. 419 tab.quinine sulphate 300 mg. 420 tab.ranitidine 150 mg. 421 tab. salbutamol 4 mg 422 tab.serritopeptidase 5mg 423 tab.sodium valporateip 200 mg. enteric coated 424 tab.sulfadoxine+pyrimethamine 500 mg.+25 mg. 425 tab.sulfamethoxazole + trimethoprim800 mg. + 160 mg 426 tab.sulfamethoxazole + trimethoprim 400 mg + 80 mg 427 tab.sulfamethoxazole +trimethoprim 100 mg. + 20 mg 428 tab.terbutaline sulphate 2.5 mg. 429 tab.throxine sodium 100 mcg. 430 tab.thyroxine sodium 100mcg 431 tab.thyroxine sodium 50mcg 432 tab.thyroxine sodium 25mcg 433 tab.thyroxine sodium 12.5mcg 434 tab.tinidazole 500 mg. 435 tab.torasemide 10 mg 436 tab.tramadol 100 mg 437 tab.tramadol 50 mg 438 tab.tamoxifen 10mg 439 tab.tamoxifen 20mg 440 tab.verapamilip 40mg sugar coated 441 tab.vit. c 500 mg. 442 tab.vit.b complexnfi(prophylactic ) b1 2mg. b2 2mg.b6 0.5 mg. niacinamide 25 mg. calcium pantothanate 1 mg. (with appropriate overage) 443 tab. furazolodine 100 mg 444 tab dispersable zinc 20mg 445 syp.albendzole 200mg/5ml (10mlbott.) 446 chlormphenicol eye applicate (1x100) 447 drop. dicyclomine 100 mg./ ml 10 ml 448 drop. iron (elemental iron 10mg. in 1 ml 25 ml) 449 drop.ciprofloxacin eye drops 450 drop. zinc (elemental zinc 20 mg in 1 ml 25ml) 451 drop gentamicin eye/ear drop 5ml 452 drop moxifloxacin eye drop 5ml 453 drop toberammycine eye drop 5ml 454 drop norfloxacine eye drop 5ml 455 drop dexamethasone eye drop 5ml 456 drop chlormphecol eye drop 5ml 457 ofloxacin 10 ml eye drop 458 drop.multivitamin(approx 22drops)each mlcotains vit a ip3000 iu.vit b1 ip1mg. riboflavine phonsphate sodium ip 2mg. d panthenol ip 2.5mg.niacinamide ip 10mg.pyridoxine ip 1mg. cyanocobalamine ip1mcg,lysine hcl usp10mg. 15ml 459 syp. b.complex( vitamin a, c, d, e, b12, b1, b6, cupper, k without iron folic acid) 25 ml bottel 460 syp. diphenhydramine 12.5mg/ml (100 ml) 461 syp. drop amoxciline 100 mg. in 1 ml 25 ml 462 syp. iron (elemental iron 30 mg. in 5 ml without folic acid 100 ml.bottle) 463 syp. iron folic acid 100ml (pedr.) 464 syp. zinc 20mg. in 5ml. 100 ml 465 syp. zinc sulphate 100ml 466 syp.alkaline citrate with potassium15 ml 467 syp.amoxycillin 125mg/5ml 30 ml 468 syp.azithromycin suspension 200 mg / 5 ml 15 ml 469 syp.barium sulphate . 95%w/v 470 syp.bromhexine hydrochloride 4mg./ 5ml 50ml 471 syp.cephalexine 125 mg/ 5ml 30ml 472 syp.chloroquine phosphate 160 mg / 10 ml 60 ml 473 syp.ciprofloxacin + tinidazole 30 ml 474 syp.co trimexazole 60ml 475 syp.cough mixtur 100 ml 476 syp.cough mixtur 450 ml 477 syp.dextromethorphan 30 mg. / 5 ml 50 ml 478 syp.domperidone susp. 1 mg/ ml 30 ml 479 syp.erythromycin 40ml 480 syp.etophylline+theophylline paed.(46.5+14 mg/5 ml)100 ml 481 syp.furazolidone susp. 25 mg. / 5 ml 60 482 syp.ibuprofin 60ml 483 syp.magnesium hydroxide + aluminium hydroxide gel (625 mg + 312 mg/ 5 ml) 120 ml 484 syp.metronidazole + norfloxacin 30 ml 485 syp.metronidazole 60 ml 486 syp. mulitivitamin 100 ml 487 syp. mulitivitamin 200 ml 488 syp.ofloxacine suspension 50 mg / 5 ml 60 ml 489 syp.paracetamol125 mg/ 5 ml 60 490 syp.phenobarbitone 200mg/5ml 491 syp.phenytoin sodium 25mg/ml 492 syp.potessium chlorid 1.5gm/15ml 100ml bott. 493 syp.promethazine 5 mg / 5 ml 60 ml 494 syp. protein tonic 100ml 495 syp.sulfamethoxazole+trimethoprim 200mg+40mg/ 5 ml 50ml 496 syp.tinidazole powder for susp.150mg./5ml 60ml 497 syp.vitamin a 100000 iu/ml 100ml with spoon 498 oint. povidine + iodine500 gm. 499 oint. povidine + iodine 15 gm. 500 oint. povidine + iodine 10 gm. 501 oint. povidine + iodine 20 gm. 502 noesprin powder 503 ors (who) sodium chloride 3.5 g, potassium chloride 1.5g,sodium citrate 2.9, dextrose 20 g 27.9 g pouch 504 syp. oflaxacin+ornidazole 30ml 505 syp. ammoxicillin+clavulanic acid 30ml 506 tab oflaxacin+ornidazole 507 inj. mithyl ergometrin 508 gel. diclofenac + menthol 509 oint. povidine + iodine 250 gm. 510 inj. chlorpheniramine maleate 511 syp. cetrizine 30ml 512 syp. ibuprofen + paracetamol 513 tab. aceclofenac + paracetamol 514 tab. diclofenac + serretiopeptidase 515 syp. iron + folic acid 50ml 516 drop ondancetron 30ml 517 drop paracetamol 30ml 518 enzyme syrup 100ml 519 enzyme syrup 200ml 520 enzyme drop 15ml 521 tab. pantoprazole + domperidone 522 eye drop mxifloxacin 523 eye drop ciprofloxacin + dexamethasone 524 gentian violet paint 525 tab. iron and folic acid 45 mg 526 gamma benzyl benzoate 100 ml 527 multivitamin and protien 200ml 528 tab. calcium citrate 250 mg 529 (group b pathology regents & material ) year 2023 24 530 10% sodium tungstar 531 10xlens 532 2/3 sulphuric acid 533 22% bovine albumin 10 ml 534 3.8 sodium citrate(500ml bottle) 535 5xlens 536 acid phosphates kit erba,coral,span 537 albert stain a& b 538 aliguli plastic test 539 alkaline phosphate kit erba,coral,span 540 ammonium chloride 541 ammonium sulphate (500 gm pkt) 542 amylase kit erba,coral,span 543 anti a1 5 ml 544 anti h5 5 ml 545 anti sera ab set 10ml 546 anti sera abd set 10ml 547 anti sera abd set 5ml 548 antihuman globin 10 ml 549 aso titler test kit erba,span,coral 550 australian antigen card(hbs ag) 551 australian antigen strip (hbs ag) 552 australian antigen test kit (hbs ag) 553 auto analyser (erma)paper roll 554 auto analyser (aspen)paper roll 555 auto clean for c.b.c (aspen) 556 auto dil for c.b.c (aspen) 557 auto lyse for c.b.c (aspen) 558 barium chloride 559 benedict solution qualitative 560 benzdin powder 561 bilirubinometer 562 biochemistry analyser fully automatic 563 biochemistry analyser semi automatic 564 blood culture complete kit 565 blood culture complete media 566 blood sugar kit (span,erba,becon) 567 blood sugar strip for glucometer (acu. chek/dr. morpan) 568 blood urea kit (span,erba,becon) 569 c.p.d. blood collection bag 100 ml (j mitra ,polymod,span,coral) 570 c.p.d. blood collection bag 350 ml (j mitra ,polymod, span,coral) 571 calcium test kit erba, coral, span 572 calorimeter 573 capillary tube 574 carbol fuchsin 575 cbc tube rotater 576 cell counter 577 centifuge tube 578 centrifuge machine 12 tube 579 centrifuge machine 6 tube 580 centrifuge machine 8 tube 581 chikenguniya test kit 582 chloride test kit erba, coral, span 583 ckmb test kit erba,coral,span 584 cleaning solution b 585 complete stain kit 586 copper solution 587 cover slip 588 crp analyser 589 crp kit erba,coral,span 590 crp lates 591 culture pot 592 dengue test kit 593 dengue test kit (ns1) 594 dionised distiled water (d.w.) 5ltr. can 595 dispo. mug for urine 596 e.d.t.a. powder 597 e.d.t.a. vial for blood sample collection 598 e.s.r. tube 599 e.s.r. tube stand 600 field stain a 500 ml 601 field stain b 500 ml 602 filter paper 603 folin wu tube for sugar 604 fouchet reagent 605 g 6 pd 606 germs iodine 607 giemsa stain 608 glacial acetic acid 609 glass pipette 0.1 ml 610 glass pipette 0.2 ml 611 glass pipette 0.5 ml 612 glass pipette 10 ml 613 glycerine 614 gram stain 615 h.c.l. n/10 500 ml 616 h.c.v. card (span,sd,jmitra,aspen) 617 h.c.v. kit rapid(span,sd,jmitra,aspen) 618 h.c.v. strip(span,sd,jmitra,aspen) 619 h.d.l. d cholestrol test kit erba,coral,span 620 h.i.v. card 1/2 (biodot)(jmitra ,span) 621 h.i.v. combaiaids(span,sd,jmitra,aspen) 622 h.i.v. kit of card(span,sd,jmitra,aspen) 623 h.i.v. strip(span,sd,jmitra,aspen) 624 h2o2(hydrogen peroxide) 625 haemocitometer 626 haemoglobinometer 627 hemoglobin pipette 628 hemoglobin tube 629 hemoglobin tube graduated 630 hemoglobinomter hemotocrom digital 631 hdl cholestrol (span,coral,erba) 632 incubator 633 k3 e.d.t.a. vails with plastick cap 634 l.d.l. d cholestrol kiterba,coral,span 635 leishman stain solution 636 lence cleaning paper 637 lieshman stain solution 638 lint roll 639 liqour ammonia 500 ml 640 liquid paraffine oil 500 ml 641 liquor ammonia 500 ml 642 litmous paper blue 643 litmous paper red 644 lugol lodine 645 magnesium cylinder 100 ml 646 malaria antibody card 647 malaria test antigen card (pf & pv)sd,span,jmitra,bacon 648 malaria test card (pf & pv)sd,span,jmitra,bacon 649 measuring cylinder 100 & 500 ml 650 methylene blue 651 micro centrifuge 652 micro pippete 0 100 micro litre 653 micro pippete 0 50 micro litre 654 micro pippete 100 micro litre 655 micro pippete 1000 micro litre 656 micro pippete 30 micro litre 657 micro pippete 500 micro litre 658 microscope glass slide 659 microscope lens 660 midrofin lenc big size 661 multi stick for urine test 662 multi strip for urine test 663 nitric acid (conc.) 664 nitro phurisite 665 oil immursion lens 666 pandys reagent 667 ph strip for stool test 668 phosphomolybdate reagent 669 pilot test tube 670 pipette (teath) pump 671 pipette tips large 672 pipette tips small 673 posture pipette with ruber tubes 674 potassium test kit erba,coral,span 675 pregnancy test kit 676 pricking needle 677 ptt test coagulometer 678 pus. culture complete. kit media 679 pus. culture media 680 r.b.c. diluting fluid 681 ra factor kit erba,coral,span 682 rapid esr analyser 683 ruber teeth pippet 684 s. bilirubin kit (span.erba,coral) 685 s.g.o.t. (coral,span.erba) 686 s.g.p.t. (coral,span.erba) 687 semen diluting fluid 688 serum bilirubin kit (span,erba,becon) 689 serum cholestrol kit (span,erba,becon) 690 serum creatinine kit (span,erba,becon) 691 serum. protein test kit erba,coral,span 692 sodium citrate 3.8% solution 693 sodium citrate 3.8/5 694 sodium fleride crystals 695 sodium nitrophuside crystle 696 sodium test kit erba,coral,span 697 sprit lamp (steel) 698 sulfur powder 699 sulphuric acid (conc.) 700 t3, (elisa mehod) 701 t4, (elisa mehod) 702 test tube 10x75 mm 703 test tube 12x100 mm 704 test tube 12x75 mm 705 test tube holder 706 test tube rack plastic 12 tube 707 test tube rack plastic 6 tube 708 thermal printing paper 709 throat swab culture 710 thyroide analyser 711 tissue paper roll 712 torch penal test lgg 713 torch test lgm 714 triglyciride test kit erba,coral,span 715 tsh, (elisa mehod) 716 turnicate 717 typhoide test card 718 uric acid kit erba,coral,span 719 urine culture complete kit 720 urine culture complete media 721 urine jar 722 urino strip (urine sugar & albumin) 723 urinometer 724 vdrl card (rpr) 725 vdrl rotater 726 vdrl test kit (antigen) (rpr) 727 w.b.c. diluting fluid 728 wafer 729 wen(sheeling capillary) 730 widal test kit (j mitra, span,erba) 731 wintro tube for e.s.r. 732 wintro tube stand 733 slide box for hundrad slide 734 slide box for fifty slide 735 disposable sputum container 4.5cm x 4 cm 736 slides (microscopic 76x26 m.m,1.1 1.3 , mm thick) 737 lens cleaning paper 738 toilet tissue roll 739 concentrate h2so4 500mlpackpurity 95 97 %, color clear 740 concentrate h2so4 500mlpackpurity 95 97 %, color clear 741 methylene blue powdermethylthionine chloride, [c16h18cln3s, molecular wt: 319.9.] 742 methylene blue powdermethylthionine chloride, [c16h18cln3s, molecular wt: 319.9.] 743 methylene blue powdermethylthionine chloride, [c16h18cln3s, molecular wt: 319.9.] 744 powder carbol fuchsin basic(:pararosaniline hydrochloride, chemical structure: c20h20cln3 mol wt:337.86) 745 powder carbol fuchsin basic(:pararosaniline hydrochloride, chemical structure: c20h20cln3 mol wt:337.86) 746 powder carbol fuchsin basic(:pararosaniline hydrochloride, chemical structure: c20h20cln3 mol wt:337.86) 747 phenol crystal ( carbolic acid crystals) c6h5oh, molecular wt:94.11, melting point:40°c + 2, 748 phenol crystal ( carbolic acid crystals) c6h5oh, molecular wt:94.11, melting point:40°c + 2, 749 methylated spirit chemical name: ethanol denatured + 5% lsopropyl alcohol + 5% methanol, molecular structure: c2h5oh, molecular wt: 46.07. 750 methylated spirit chemical name: ethanol denatured + 5% lsopropyl alcohol + 5% methanol, molecular structure: c2h5oh, molecular wt: 46.07. 751 methylated spirit chemical name: ethanol denatured + 5% lsopropyl alcohol + 5% methanol, molecular structure: c2h5oh, molecular wt: 46.07. 752 filter paper15 c.m. 753 auramine o (25gm)(for led microscope) 754 alcohol (abs 99.9% ethanol) (for led microscope) 755 potassium permanganate(for led microscope) 756 hydrochloride acid (con.) 757 distilled water 5 lit. 758 diamond marker 759 immersion oil 760 burning spirit 761 burning spirit 762 burning spirit 763 glass rod (solid) 764 slide stand 765 measuring cylinder 766 measuring cylinder 767 measuring cylinder 768 measuring cylinder 769 measuring cylinder 770 dropingglass bottle 771 funnel 772 flask (flat bottom) 773 flask (flat bottom) 774 flask (flat bottom) 775 flask (flat bottom) 776 flask (flat bottom) 777 phenolic compound (phenyle ) household disinfectant, containg phenolic compounds such as monochlorophenol, chloroxylenol, coal tar acid, oils & emulsifiers etc. 778 spirit lamp 779 savlon solution (hospital concentrate) 780 foot operated buckets for phenol solution 10 litter 781 foot operated dust been 10 litter 782 falcons tube(provide sample) 783 paraffin strip (parafilm bundle)(provide sample) 784 face mask standard (provide sample) 785 disposable gloves standard (provide sample) 786 absorbent cotton bundle450gm pack 787 small cardboard box with lid facilitating one falcon tube into i.e. slightly bigger than falcon tube(provide sample) 788 big cardboard box with lid facilitating six small cardboard boxes inside 789 ice jell pack(provide sample) 790 ice jell pack(provide sample) 791 sputum sample carrier (provide sample) 792 thermacol box (provide sample) 793 glucometer 794 weighing machine 795 weighing machine 796 variable pipette(provide sample) 797 variable pipette(provide sample) 798 amber colour bottle(provide sample) 799 amber colour bottle(provide sample) 800 amber colour bottle(provide sample) 801 amber colour bottle(provide sample) 802 selwinhoffs reagent 803 absolute methanol 804 blood grouping antiserum abd 805 total protien kit 806 serum creatinin kit 807 sgpt kit 808 sgot kit 809 3.8%sodium citrate 810 bilirubin kit 811 cholesterol kit 812 urea kit 813 10% barium chloride 814 fouschets reagent 815 sulphur powder 816 n/10 hcl 817 plan (biochemistry vacutaner tube) 818 urine & sputum container 50ml 819 heamoglon colorscale book for hb testing (1*1000test) 820 glucose kit (god,pod) 821 (group cequipments & machinery) yaer 2023 24 822 2.4 thresded rill guide for 1.8 mm drill bit 823 2.7 thresded rill guide for 2 mm drill bit 824 abdominal hysterectomy kit ( (polyglactin 910 violet) sutre 180 cm. size 1. 40 mm 1/2 circle round body tapercut double needle, 1 foil (polyglactin 910 violet) suture 90 cm, size 1, 40mm 1/2 circle round body needle, 1 foil (polyamide black) suture 70 cm, size 2 0, 45mm 3/8 circle reverse cutting needle, 1 foil 825 absorbent cotton wool ip 100gm 826 absorbent cotton wool ip 500gm 827 adhesive paper tape size 2.5cmx9mts 828 adhesive plaster usp 10 cm x 10 mts / roll 829 adhesive plaster usp 10 cm x 5 mts / roll 830 adhesive plaster usp 7.5 cm x 5 mts / roll 831 air rotor burs 832 air rotor hand piece oil spray 833 allen key for drill bit stopper 834 allis forceps s.s. size 6inch 835 allis forceps s.s. size 8inch 836 almirah steel full size (3ft x 6 ft x1.5 ft) 837 ambu bag adult 838 ambu bag child 839 amputation saw and sealed 840 artery forceps straight size 6inch s.s. 841 artery forceps curved size 6inch s.s. 842 artery forceps straight size 8inch s.s. 843 artery forceps curved size 8inch s.s. 844 articulating pack 845 autoclave electric doubledrum 846 autoclave electric single drum 847 b. p. apparatus (dial type) 848 b. p. apparatus with led light 849 b.p. handle s.s. n0. 3 & 4 850 b.p. instrument mercury 851 b.p. instruments digital 852 b.p. instruments digital with newnate cuff 853 b.p. instruments mercury stand model 854 baby masks size 0, 1 855 baby towel std. size white 856 baby tray 12x18 inch 857 bacillocid 500 ml 858 backout 5liter jar 859 bandage roll 10cm x 1mtr. 860 bandage roll 10cm x 5mtr. 861 bandage roll 4 inch x 1mtr. 862 bandage roll 5 inch x 5mtr. 863 bandage roll 5cm x 1mtr. 864 bandage roll 7.5 inch x 5mtr. 865 bandage than1mtr x 20 mtr 866 barbed broachessize 21mm size 25mm 867 bed pan with cover m & f polythene 868 bedsheet coloured printed (4ftx6ft) 869 benzyl benzoate emulsion 25% 100 ml 870 benzyl benzoate emulsion 25% 450ml 871 bio medical waste dispoable beg red & black(biodegradable non chlorinated polymer material with minimum thickness of 55 micron.) 872 bleaching powder 25 kg bag 873 bone awl with eye 874 bone gauze fiber handle 10 mm 875 boric acid 400 gm 876 bp apparatus (air dial) 877 broken screw removal hollow mill shaft for 2.7mm screws 878 broken screw removal hollow mill shaft for 4.5/5mm screws 879 broken screw removal hollow mill shaft for3.5mm screws 880 bucket g.i. sheet without cover12inch 881 bucket with cover e.i. 12inch 882 bucket with cover s.s. 12inch 883 caesarean section kit i (polyglactin 910 violet) sutre 180 cm. size 1. 40 mm 1/2 circle round body tapercut double needle, 1 foil (polyamide black) suture 70 cm, size 2 0, 45mm 3/8 circle reverse cutting needle, 1 foil 884 caesarean section kit ii ( (polyglactin 910 violet) sutre 180 cm. size 1. 40 mm 1/2 circle round body tapercut double needle, 1 foil (ploylecaprone 25 undyed) suture 70 cm, size 3 0, 25mm 3/8 circle cutting needle, 1 foil ) 885 calcium hydroxide powder and zinc phosphate cement 886 cbc analyzer (semiautomatic) 887 cheatle forcep 888 codon set 889 composite anterior micro fill 890 composite material nano hybrid (light cure) 891 computer chair (standard size revolving) 892 computer set(i3 processor,8gb ram, 20 inch led monitor,1000 gb hard disk) 893 computer set(i5 processor,8gb ram, 20 inch led monitor,1000 gb hard disk) 894 computer table (standard size) 895 conical extraction t handle for 3.5mm screws 896 conical extraction t handle for 4.5/5mm screws 897 cotton thread n0. 10400 mtr. (janger brond ) length 898 cotton thread roll for stitch 899 counter sink for 3.5/4.5 mm screw 900 counter sink for 4.5/6.5 mm screw 901 countersink quick coupling for 2.4/2.7mm screws 902 countersink quick coupling for 3.5mm screws 903 countersink quick coupling for 4.5/5mm screws 904 crabe bandage 4 inch 905 crabe bandage 6 inch 906 cream betamethasone valerate ip 0.12% 15 gm. 907 cream cetrimiedbp 20 gm 908 cream cetrimiedbp 500 gm 909 cream cetrimiede+chlorhexidine (conc.)15%+7.5%) 1 ltr. 910 cream clotrimazole cream 1% 15gm 911 cream nitrofurazone 500g 912 cream silver sulphadiazine usp 1% w/w 25 gm 913 cream silver sulphadiazine usp 1% w/w 500 gm 914 cream whitefields oint. 25gm 915 cresol with soap solution 5ltr. 916 cuff for b.p. instrument 917 delivery cord clamp 918 delivery tray 919 dental instruments set s.s. 920 deodrizine disinfec solution 1ltr 921 depth gauze for 2.7mm screws 922 depth gauze for 2/2.4mm screws 923 depth guage measuring range upto 110 mm 924 depth guage measuring range upto 60 mm 925 detachable slide hammer 926 developer 13.5 liter 927 developer 22.5 liter 928 diagnostic sticks for urine (sugar + protiene) 100 no. 929 dialysis part a 930 dialysis part b 931 dialyzer 932 digital weighing machine (adult) 933 disectingforceps plain & teeth size 6inch s.s. 934 disposable needle 18 g (single use) 935 disposable needle 20 g (single use) 936 disposable needle 22 g (single use) 937 disposable needle 23 g (single use) 938 disposable needle 24 g (single use) 939 disposable needle 26 g (single use) 940 disposable needle assorted size 1inch&1.5inch 941 disposable plastic gloves 942 disposable scalpe vein set size 22 g 943 disposable scalpe vein set size 23 g 944 disposable scalpe vein set size 24 g 945 disposable suction cather size 12, 14 946 disposable surgical blade with handle 11no. 947 disposable surgical blade with handle 22no. 948 disposable syringe with needle 0.5 ml 949 disposable syringe with needle 1 ml 950 disposable syringe with needle 2 ml 951 disposable syringe with needle 3 ml 952 disposable syringe with needle 5 ml 953 disposable syringes with needle 10 ml 954 disposable syringes with needle 20 ml 955 disposable syringes with needle 50 ml 956 double drill guide 2.4/1.8mm 957 double drill guide 2.7/2mm 958 double drill guide 3.5/2.5mm 959 double drill guide 4.5/2.5mm 960 double drill guide 4.5/3.2mm 961 double drill guide 6.5/3.2mm 962 double femoral line set 963 dressing bowl 964 dressing drum s.s. 12inchx10inch 965 dressing drum s.s.11inchx9inch 966 dressing drum s.s.12inchx15inch 967 dressing scissor curved size 6inch s.s. 968 dressing scissor curved size 7inch s.s. 969 dressing scissor curved size 8inch s.s. 970 dressing scissor st size 6inch s.s. 971 dressing scissor st size 7inch s.s. 972 dressing scissor st size 8inch s.s. 973 drill and tap sleeve 3.2mm/4.5mm 974 drill bit 1.8mmx100mm quick coupling 975 drill bit 2.4mmx100mm quick coupling 976 drill bit 2.5 mm x125mm quick coupling 977 drill bit 2.7mmx100mm quick coupling 978 drill bit 2.8 mm x165 mm with stopper quick coupling 979 drill bit 2mmx100mm quick coupling 980 drill bit 3.2 mm with quick coupling 981 drill bit 3.5 mm for neutral and load position 982 drill bit 4.3 mm x221 mm with stopper quick coupling 983 drill bit 4.5 mm for neutral and load position 984 drill bit plane2.7 mm 985 drill bit plane3.2 mm 986 drill bit plane4.5 mm 987 e.c.g. rol 105 mm x 20 meter 988 e.c.g. rol 60 mm x 20 meter 989 e.t. tube 2 no. 990 e.t. tube 2.5 no. 991 e.t. tube 3 no. 992 e.t. tube 3.5 no. 993 e.t. tube 4 no. 994 ecg gel 250 gm tube 995 ecg paper (wax coated) 50 mm x 30 mts. 996 ecg paper computerzed triple channel 997 edta gel 998 edta solution 999 elastic nail impactor 2.0mm 1000 elastic nail impactor 2.0mm 1001 elastic nail impactor 2.5mm 1002 elastic nail impactor 3.0mm 1003 elastic nail impactor 3.5mm 1004 elastic nail impactor 4.0mm 1005 elastic nail impactor oblique4.5mm 1006 elastic nail inserter rod 1007 elastic nail inserter with universal ss chuck 1008 electrolyte analyser 1009 electrolyte reagent 1010 endodontic absorbent paper points size 15 40 1011 endoflox 1012 epistomic scissor 1013 executive chair (revolving standard size) 1014 extraction screw 3.5mm 1015 extraction screw 5mm 1016 f toll reduction 1017 featal dopler 1018 feeding tube 5 no. 1019 feeding tube 6 no. 1020 feotal doppler 1021 feotal moniter 1022 fistula needle 16 no 1023 fixer 13.5 liter 1024 fixer 22.5 liter 1025 flower cleansing solution 1ltr 1026 foeto scope 1027 foleys catheter 16 no. 1028 foleys catheter 18 no. 1029 formalin 1 litre bottle 1030 fowler bed 1031 fully automatic random access clinical chemistry analyzer should be a fully automated random access bench top model clinical chemistry analyzer to perform end point,kinetic, fixed time kinetic,and immunoturbidimetry tests.minimum through put should be 250 tests/hour,minimum requirement of 40 cooled position for reagents.should have 90 individual reusable cuvettes on board.final reaction volume of reagent should be 150ul for reducing cost of tests.should have capacity to increase reagent volume in steps of 1 micro litre.should have minimum of 40 cooled sample positionsreagent /sample probe in the system should teflon quoted and should have facility to wash the probes inside and outside using pre warmed distilled water for reducing carry over.photometric absorbance range should be from 0 to 4.0 abs.have static photometer connected with fiber optics for better precision should have a minimum of 9 measurement wavelenghts from 340nm to 700nm.should have a separate mixer probe for mixing of reagents and samples.should have facility 1032 g.v.paint 50 ml bottle 0.25% 1033 g.v.paint 50 ml bottle 0.5% 1034 gauze than 90cm x 20 mtr 1035 gel. diclofenic sodium30 gm. 1036 gentamaycin 25 gm. ointment 1037 glass ionomer silver reinforced 1038 glass ionomer cement (gic) type 2 1039 glucometer digital 1040 glucometer strip 1041 gluteraldehide 5% (5ltr) 1042 glycerine ip 500 ml 1043 granulated high density glass ionomer powder +filling purpose 1044 graphics aluminium box with silicone fitting 1045 guide sleeve for 1.2mm k wires 1046 guide sleeve for 2mm k wires 1047 guide wire threaded trocar 2mm x 280 mm 1048 gutta percha points(all sizes ) in sepearte boxes. gutt percha individual size 15,20,25,30,35,40,45 ,50,55,60,65,70,75,80 15 40 and 45 80 each pack contrain 100 no. and 28mm long flat ended gp ponts 1049 h2o2 1050 hammer fiber handle 500 gm 1051 hammer s.s. size large 1052 hammer s.s. size medium 1053 hammer s.s. size small 1054 hand rub solution 500ml jar 1055 hand wash soap solution with dispenser 500ml 1056 handle screw head removal forceps ratchet lock 1057 handle screw head removal forceps speed lock 1058 hba1c analyser to measure hba1c by hpcl method. measuring range 3 % 18 % with repeatability cv< 3% & stability cv< 5% result in 4 mins/sample. auto sample loader with 28 positions. automatic addition of hemolysin and sample pretreatment.photometer of 415nm chromatography column upto 220 test 8 tft true color lcd touch screen. display barcode scanner or touch keyboard.10,000 sample result storage rs 232 connection. compatible with his/lis system power 100 240 v, 50/60 hz, 150 va weight < 20 kg 1059 head light comp. with transformer elect. operated 1060 head mirror complete 1061 heavy duty nail cutter 1062 heggerinch™s dilator set complete 1063 hemoglobin analyser hpcl method .should have standard mode, variant analysis mode, b thalassemia analysis mode. test range 3% 18% with cv< 1%. test speed 1.5sample venous blood, finger periphred blood , lyophilized whole blood. sample volume <7 ul. auto sample station with 110 position + 1 stat position photometer 415 nm+500 nm led> 19000 hrs. life span chromatography column: available test > 1500 t, filter > 400 t.lcd touch screen 8 tft. windows xp software reagents: eluents, a, b, c hemtycin, calibrator, qc material , information input by scanner or touch key pad. storage 719 000 samples rs232, usb lan & lis compatible. thermal printer. external laser. printer attachment. power ac100 inch“ 240 v 50/60hz, s 150 va weight 50 kgmin/sample. 1064 herat men forceps s.s. crocodile 1065 hexagonal lade screw driver 1066 hexagonal screw driver shaft quick coupling for 2.4/2.7 mm screws 1067 hexagonal screw driver shaft quick coupling for 3.5 mm screws 1068 hexagonal screw driver shaft quick coupling for 4.5/5 mm screws 1069 h files 15 40 (21mm,25mm,31mm) 45 80 (21mm,25mm,31mm) headstorm files h files size no. 15,20,25,30,35,40,45,50,55,60,65,70,75,80 15 40 and 45 80 1070 hohmann recactor 6mm 1071 hohmann retractor 12 mm 1072 hohmann retractor 25 mm 1073 hot plate electrically operated 1074 hot water bag i.r. hospital size 1075 humpfys knife with blades 1076 i.v. set (micro)/pediatric drip set 1077 i.v. set adult 1078 i.v. stand heavy base 1079 icu bed 1080 infussion pump (not syringe pump) 1081 infussion pump (syringe pump) 1082 insert drill sleeve 3.5/2.5mm 1083 insert drill sleeve 4.5/3.2mm 1084 instrument sterilizer electrically operated s. 12inchx6inchx4inch 1085 instrument sterilizer electrically operated s. 16inchx6inchx4inch 1086 instrument sterilizer electrically operated s. 20inchx8inchx6inch 1087 instrument sterilizer electrically operated s.10inchx5inchx3inch 1088 instrument sterilizer electrically operated s.18inchx8inchx6inch 1089 intrauterine contraceptive devices ( te/ cu 250 3years, te/tu375 5years te/tu 380 10years) 1090 ishra colour book imported 1091 iv cannula ( two way ) size 23 g 1092 iv cannula ( two way ) size 24 g 1093 iv cannula ( two way) size 18 g 1094 iv cannula ( two way) size 22 g 1095 iv cannula ( two way) size 26 g 1096 iv. cannula sizes 18 g with injection valve (port) 1097 iv. cannula sizes 24 g with injection valve (port) 1098 kallian nasal gouge 1099 karrich adjustable alluminum 1100 karrich adjustable wooden 1101 k claver leaf nails for femer size 32, 34, 36, 38, 40, 42, cm.x 5,6,7,8,9,10,11,12 mm. 1102 kelleyinch™s pad disposable 1103 kelleyinch™s pad rubber for douching i.r. 1104 k files 15 40 (21mm,25mm,31mm) 45 80 (21mm,25mm,31mm) endodontic files kfiles size no. 15,20,25,30,35,40,45,50,55,60,65,70,75,80 15 40 and 45 80 1105 kidney tray 1106 kirschner wire 1.8 x150mm 1107 k nail extractor 1108 kunteschers nails femer 9,10,11 mm. x 38,40,42 cm. 1109 k wire both ended pointed all size 1110 k wire introducer 1111 l.p. needles assorted size 1112 laringoscopesadult 1113 laringoscopes paediatric 1114 laryngoscope complete with 3 blades s.s. 1115 lions bone holding forceps for femer 1116 locking pliers 1117 lotion povidine iodine 5% 100 ml 1118 lotion surgical scrub povidine iodine7.5% 500 ml 1119 lower root forceps 1120 lowmaninch™s bone holding forceps for femer 1121 lowmaninch™s bone holding forceps for radius ulna 1122 mackintosh double colur water proof 1123 microscope (binacular) 1124 microscope (monocular) 1125 mosquito forceps st/curved s.s. 5inch 1126 mosquito haemostatic forceps st/curved s.s. 1127 mother and child care kit ( sterlised surgical gloves 6.5 no. one pair ,sterlised surgical gloves 7 no. one pair,bp blade 15 no.,infant feeding tube,bp handle for blade,absorbent cotton 50 gm, gauze sponge 20x20 cm, disposable suction bulb, umblical cord clamp, polysheet 60x60 cm, disp non woven towel, disposable gown, placenta bag 14x9 size, carbolic soap) 1128 n95 mask 1129 nebulizer 1130 needle cutter 1131 needle holder s.s. size 6inch 1132 needle holder s.s. size 8inch 1133 needle hypodermic insulin needle (metallic non. sterile ) size 26 g x 1/2 1134 needle syringe distroyer electric 1135 new born kit with 4 pieces (cotton cloth) 1136 new born kit with 6 pieces (cotton cloth) 1137 nitrous oxide cylinder 20 cft. 1138 oleraven screw 3inch, 4inch,5inch 1139 operation table pad complete. 1140 ophthalmoscope electrically operated 1141 ophthalmoscope electronic operatedwith remote 1142 orthopedic bedcomplete 1143 orthopedic table 1144 osteotome s.s. assorted size 1145 ovum forceps s.s. 10inch 1146 oxygen concentrator 1147 oxygen cylinder complete 40 qft. 1148 oxygen cylinder complete220 cft. 1149 oxygen flowmeter with humidifier bottle 1150 oxygon flow meter tube with metal complete 1151 p.m. gloves assorted size 1152 paper adhesive plaster microporous surgical tape 1 inch x 9 m / roll [700122] 1153 paper adhesive plaster microporous surgical tape 2 inch x 5m /roll [700124] 1154 paper adhesive plaster microporous surgical tape 4 inch x 9 m / roll [700123] 1155 paper adhesive plaster microporous surgical tape 6 inch x 5m /roll [700125] 1156 parda printed (4ftx4ft) 1157 parda printed (4ftx6ft) 1158 periastel elevator fibre handle 10mm 1159 periastel elevator fibre handle 6mm 1160 phenyl isi mark grade i 1161 phosphoric acid etchant 1162 photo therapy double single surface 1163 photo therapy unit single surface 1164 pin cutter for nail 14 inches 1165 pine cleaner 500ml 1166 plair with cutter 1167 plaster cutter s.s. large 1168 plaster cutter s.s. medium 1169 plaster cutter s.s. small 1170 plaster of paris 1171 plastic tubing for suction apparatus. 1172 plate bender 1173 plate bending template 1174 plate holding forceps ratchet lock 1175 proctoscope s.s. adult 1176 proctoscope s.s. child 1177 prolene n0. 1 on needle 1178 prolene n0. 1 0 on needle 1179 prolene n0. 2 on needle 1180 prolene n0. 2 0 on needle 1181 pully for skin traction 1182 pulp devitalize 1183 puls oxymeter new nets 1184 pulse oxymeter (finger tip) 1185 radiant warmer 1186 radio opaque calcium hydroxide cavity liner paste of ca(oh)2 paste and catalyst 1187 radious and ulna nails extractor 1188 reduction forcep bend tip ratchet lock 1189 reduction forcep pointed ratchet lock 1190 reduction forcep pointed ratchet lock 150 mm 1191 reduction forcep pointed ratchet lock 200 mm 1192 reduction forcep serratedratchet lock 150 mm 1193 reduction forcep serratedratchet lock 200 mm 1194 reduction forcep serrated ratchet lock 1195 refrigerator 1196 room heater 1197 root canal disinfectant consisting of thymol dexamethasone 1198 root canal sealer 1199 rubber catheter n0. 4 ,5, 6 ,7, 8 1200 ryles tube (p.v.s) children size 10, 12 1201 ryles tube (p.v.s) children size 16, 18 1202 ryles tube (p.v.s) children size 5 1203 ryles tube (p.v.s) children size 6 1204 ryles tube (p.v.s) children size 8 1205 safe delivery kit 1206 salbutamal sol. for nebulizer 5mg/ml 1207 salbutamol repsule inhaler for inhalation 1208 salbutamol sulphate inhalation 1209 sanitary/maternity pad/napkin with belt large weight 8 10gms (10 pad pack) 1210 sanitary/maternity pad/napkin without belt regular weight 6 8gms (6 pad pack) 1211 savlon 500ml 1212 scale with guge s.s. 1213 scalerinch™s universal, push marginal and sickets. 1214 scissor curved s.s. size 6.5 1215 scissor curved s.s. size 7.5 1216 scissor curved s.s. size 8.5 1217 scissor straight s.s. size 6.5 1218 scissor straight s.s. size 7.5 1219 scissor straight s.s. size 8.5 1220 screw driver hexagonal holding sleeve for 27mm locking screws 1221 screw driver hexagonal holding sleeves 2.5 mm tip 1222 screw driver hexagonal holding sleeves 3.5 mm tip 1223 screw driver quick coupling for 2.4/2.7 mm locking screws 1224 screw driver quick coupling for 3.5mm locking & 3.5mm cortical 1225 screw driver quick coupling for 5mm locking & 45 mm cortical 1226 screw driver torque for 2.4/2.7 mm locking screws 1227 screw driver torque for 3.5mm locking screws 1228 screw driver torque for 5mm locking screws 1229 screw holding forceps 1230 screws impactor shaft quick coupling large 1231 screws impactor shaft quick coupling medium 1232 screws impactor shaft quick coupling small 1233 self centering bone holding forcep speed lock 190mm 1234 self centering bone holding forcep speed lock 250mm 1235 semi automated biochemistry analyser 1236 semi fowler bed 1237 sharp hook 1238 slottted screw driver shaft quick copuling for large 1239 slottted screw driver shaft quick copuling small 1240 sodium hypochloride 5ltr jar 1241 sonography roll 1242 spary ethyl chloride 1243 spinal needdle 23 no. 1244 sponge holding forceps s.s. 10inch 1245 sponge stone complete. 1246 spreader 15 40 (21mm,25mm,31mm) 1247 sprit lamp 40 z 1248 sputam afb test reagent 1249 squar nails for radious & ulna 2, 2.5, 3 mmx 18,20, 22 cm. 1250 steel rack three side cover full (3ft x 6 ft x1.5 ft) 1251 steinmin pin s.s. 1252 sterile gloves size 6 isi mark 1253 sterile gloves size 6 1/2 isi mark 1254 sterile gloves size 7 isi mark 1255 sterile gloves size 7. 1/2 isi mark 1256 sterile gloves size 8 isi mark 1257 sterillium 500 ml 1258 stitch cutting scissor s.s. 1259 stomatch tube i.r. 1260 stop watch complete 1261 suction disposable tips 1262 suction machein isi mark electronic opp. with pollycorbonate jar 1263 suction tube no. 6 1264 suction tube no. 8 1265 surgeon apron plastic full size 1266 surgical blade size 22 (100 in each pack) 1267 surgical spirit 100 ml 1268 surgical spirit 500 ml 1269 surgical tray 10x12inch 1270 surgical tray 8x10inch 1271 sutur mersilk 2 0 for nsv 1272 t handle quick coupling 1273 tailor scissor 1274 tap 4.5mm 1275 tap for 2.4 mm screws quick coupling 1276 tap for 2.7 mm screws quick coupling 1277 tap for 4.5mm cortical screw quick coupling 1278 tap for 6.5mm cortical screw quick coupling 1279 tap t handle for 3.5mm cortical screw 1280 tap t handle for 4mm cancellous screw 1281 temperorary restoration material 1282 test tubeborosil size 3inch 1283 test tubeborosil size 4inch 1284 test tubeborosil size 5inch 1285 test tube basket 1286 test tube stand s.s. 1287 test tubes holder 1288 thomus splint large 1289 thomus splint mediun 1290 thomus splint small 1291 threaded drill guide 3.5 for drill bit 2.8mm 1292 threaded drill guide 5.0 for drill bit 4.3mm 1293 three layer surgical mask 1294 thyoride analyser fully autometic 1295 tincture benzoin 500 ml 1296 tincture iodine 500 ml 1297 toilet cleaner 1ltr jar 1298 toilet soap 1299 tongue forceps s.s. 1300 tonometer complete imported 1301 tonsil snare complete s.s. 1302 towel clip cross action s.s. 1303 tracheotomy tube silver asserted size 1304 trephine 1305 trial case complete 1306 tubing 1307 turkis towel white std size 1308 u.s.g. gel 100ml 1309 urinary drainage bag 1310 urine accession strip 1311 urine collection bag 1312 uterine dressing forceps s.s. 10inch 1313 weghing machine adult size isi mark 1314 weghing machine electronic for child 1315 weighing machine child size isi mark 1316 wheel for stretcher rubber size 2inch 1317 wheel for stretcher rubber size 3inch 1318 wheel for stretcher rubber size 4inch 1319 wheel for stretcher rubber size 6inch 1320 wheel for stretcher rubber size 8inch 1321 x ray developer 1322 x ray film 10inchx 12inch 1323 x ray film 12inchx15inch 1324 x ray film 8inchx 10inch 1325 x ray film size 2.2cmx3.5cm 1326 x ray film size 3cmx4cm 1327 x ray film6 .5inchx 8.5inch 1328 x ray fixer 1329 zinc oxide powder 1330 zinc oxy phosphate cement powder with liquid (heaved cement) ...

Madhya Pradesh Police Department - Madhya Pradesh

37668647 tender for supply of chemical items of dna units of m.p. 1 chemical item 2 absolute alcohol 3 acetic acid glacial 4 acetone 5 ammonium sulphate 6 ammonia 7 benzene 8 chloroform 9 diethyl ether 10 n hexane 11 n heptane 12 methanol 13 nesslers reagent 14 palladium chloride 15 petroleum ether ( 60 80oc ) 16 petroleum ether ( 40 60oc ) 17 silica gel 18 silica gel g 60 f254 pre coated tlc plate aluminium sheets ( 20 x 20 cm ) 19 silica gel g glass plate ( 20 x 20 cm ) 20 schiff’s reagent 21 test tubes 20 ml 22 bromoform 98% 23 benzidine 24 hydrogen peroxide 25 eosin prepared reagent 26 eosin prepared reagent 27 haemotoxilin prepared reagent 28 haemotoxilin prepared reagent 29 glacial acetic acid 30 microscopic cover glass / cover slips 31 marker for body fluid examination 32 filter paper 46x 57 cm or more 33 filter papersize 18 x 22 inch or more 34 sanitizer / hand disinfectant 35 hand wash 36 tough tag 37 dropper / pasteur pipette 38 surface sterilizer 39 test tubes 200 40 test tubes 100...

Government Medical College - Madhya Pradesh

37436544 supply for central lab consumable and other items supply for central lab consumable and other items in gmc ratlam , three part automated cell counter model : swelab alfa plus basic close system , swelab alfa plus diluents , swelab alfa plus lyser , boule control normal , boule control low , boule control high , automatic coagulation analyzer model : sta compact max 3 close system , stac cacl20, 0025m (00367) , sta cephascreen 10(00310) , sta cleanser solution 6x2500ml(00973) , sta coag control n+p(00679) , sta desorb u24x15ml (00975) , sta liatest control n+p (00526) , sta liatest d di (00662) , sta @ neoptimal 5. (01163) , sta owren koller 24x15ml(00360) , chemicals , xylene (sulphar free) , paraffin wax (58 60 temperature) , acetone , eosin (2%) , distyrene plasticizer xylene (dpx mountant) , glacial acetic acid , formic acid (100%) , nitric acid (100%) , propanol (45%) , sodium metabisulphate , sodium nitroprusside , liquor ammonia , ammonium sulphate , sulphosalicilic acid solution , og 6 , ea 50 , semen analysis diluting fluid , formaline , spirit alcohol , sulphuric acid , reticulocyte count fluid , distilled water , sodium hypochloride , methanol , glucose pouch , perls stain (long expiray) , pas stain (long expiray) , mpo sstain (long expiray) , benzidine solution (long expiray) , alpha napthol , copper acetate , glucose (dextrose) 1 , fructose , iodine cristal , resorcinol , sprit lamp (steel) , sprit 100% (flammable) , sodium hydroxide , starch soluble , sodium nitrite , lead acetate , sodium carbonate , trichloroacetic acid , ammonium malybdate , sulphar powder , ammonia solution , egg albumin powder , fouchets reagent , organic solvent (sprit) , funnel poly lab , mercuric sulphate , copper sulphate , ninhydrin ar , bile salt , kits , reticulocyte count kit , field stain kit , giemsa stain kit , pt/inr kit , hbsag elisa kit , hbsag rapid cards , reagent , benedict reagent (long expiray) , ehrlich’s reagent (long expiray) , esbech’s reagent (long expiray) , fouchet reagent (long expiray) , other consumable items , casset , glass dish staining jar , hand wash , bubbler (plastic screw) , volumetric flask 100ml , filter paper 12.5dm , diamond pencil , knife (grossing) , speciman jar with lid (glass) (200x200x70 mm) , speciman jar with lid (glass) (150x150x60mm) , museum jar with lid (glass) (220x150x100mm) , museum jar with lid (glass) (220x195x80mm) , museum jar with lid (glass) (250x165x140mm) , museum jar with lid (glass) (360x150x100mm) , museum jar with lid (glass) (150x150x80mm) , museum jar with lid (glass) (250x250x120mm) , museum jar (10x10x15 inches) , museum jar (18x12x12 inches) , museum jar (25x15x10 inches) , pippette 1 ml (borosilicate) , pippette 5 ml (borosilicate) , glass rod (solid ) , slide holder (steel) , slide staining rack , application plastic stick , sprit lamp glass , tube holder , rbc pipette , wbc pipette , pasture pipette , tissue embedding mold , embedding o ring , test tube 15 ml , test tube 20 ml , centrifuge tube 15ml , centrifugr graduated tube 15 ml , reagent bottle 100 ml , reagent bottle 250ml , measuring cylinder 100 ml , measuring cylinder 5 ml , detergent powder , culture media , agar powder , alkaline peptone water , anhydrous barium chloride , arabinose , arginine dihydrolase powder , automated blood culture bottle (adult) compatible withbact/alert 3d 480, bio merieux , automated blood culture bottle (paediatrics) compatible withbact/alert 3d 480, bio merieux , lowenstein jansens medium(ready prepared) , lactose , lysine decarboxylase , macconkey broth single strength (for water testing) , maltose , mannitol , pyr agar , robertson cooked meat medium base , sodium deoxycholate , sucrose , tcbs agar , antibiotic disc , cefepime 50ug , cefoperazone / sulbactum , cefotaxime+clavulanate , cefpodoxime , ceftazidime+clavulanate , ceftriaxone sulbactum 30/15ug , colistin (0.016 256 mcg/ml) , cotrimoxazole(25 ?g) , doripenem(10 ?g) , ertapenem(10 ?g) , imipenem 10 mcg , meropenam 10ug , novobiocin(5 ?g) , quinopristin dalfopristin(15 ?g) , teicoplanin , ticarcillin clavulanate(75/10 ?g) , vancomycin (0.016 256 mcg/ml) , bacitracin(0.4 u) , sterile disc , v factor , x factor , x+v factor , optochin(5 ?g) , kits & chemical , acetone solution , acid fast staining kit , albert’s metachromatic stain kit , andrade’s indicator , anti hav igm (elisa kit) , anti hcv antibody kits (elisa kit) , aso kit(25 test/packet),consumable , basic carbol fuchsin for afb staining(powder) , conc hcl , crystal violet powder , formaldehyde solution , filarial antigen card test , ferric chloride (500 gm) , formaldehyde 40% (conc. formaline) , giemsa stain (merck / span) , glycerol , gram iodine , gram staining kit , h2so4 (sulphuric acid) 25% , hbv elisa test kit , hepatitis e virus anti hev igm antibody (elisa) , hydrogen peroxide 6% solution , india ink , kovac’s reagent (indole) , lacto phenol cottons blue stain , lead acetate strip , leishman stain , liquid paraffin , methyl blue for (z n) , methyl alcohol , nitrate reagent a , nitrate reagent b , oxidase disc , oxidase reagent (tetra methyl para phenylene di amine di hydro chloride) , phenol crystals , pyr reagent , urea 40% supplement (for urea agar base) , voges proskauer reagent a , voges proskauer reagent b , xylene , zinc dust , biological indicator for autoclave (indicator vial) , glassware, plasticware& other item , autoclavable aluminium foil , autoclavable reusable transparent bags , bcg(1 ml each) , bloting paper (paper) , burning sprit , cedar wood oil , concavity slide , cover slip , cryogenic vial , disposable plastic loop 2mm , disposable plastic loop 4mm , disposable sharp collection containers(5 ltr) , dropping bottle plastic 100 120 ml capacity , durham’s tube , filter paper sheet((whatmann no 01) , gaspak (3.5 liter) , glass marking pen (diamond ) , glass reagent bottle (5 litre) , glass test tube 12 x 50 borocilicate glass autoclavable , metal loop holder , soap , sterile disposable/hypodermic syringe for single use(5ml ) , sterile disposable/hypodermic syringe with needle for single use(2ml ) , sterile disposable/hypodermic syringe with needle for single use(10ml ) , test tube stand, polypropylene, 3 tier(for keeping 10 ml vtm vials/ tier) , utility gloves(medium) , atcc strain & antisera , acinetobacter baumannii nctc 13304 , enterococcus faecalis atcc 29212 , klebsiella pneumoniae atcc 700603 , pseudomonas aeruginosa atcc 27853 , staphylococcus aureus 25923 , escheriachia coli 25922 , staphylococcus aureus atcc43300 (mrsa) , shigella boydii polyvalent c antisera , shigella dysentriae polyvalent a antisera , shigella flexneri polyvalent b antisera , shigella sonnei polyvalent d antisera , vibrio cholera o1(ogawa)antisera , vibrio cholera o1( inaba)antisera , vibrio cholera (o139 )antisera , salmonella typhi poly o antisera , salmonella typhi o 2 antisera , salmonella typhi o 7 antisera , salmonella typhi o 9 antisera , rt pcr kits, chemical & consumable , 0.2 ml pcr tube (sterile, flat cap shaped) dnase/rnase free , 15 ml polypropylene centrifuge tubes, sterile, {certified nonpyrogenic and dnase /rnase free, disposable conical bottom with seal caps(the tubes should have printed graduations and a large white marking spots)} , alcohol 70% (laboratory grade) , bio medical waste bins red (15 ltr) , bio medical waste bins red (25 ltr) , bio medical waste bins red (40 ltr) , bio medical waste bins yellow (15 ltr) , bio medical waste bins yellow (25 ltr) , bio medical waste bins yellow (40 ltr) , bmw polybags red colour (18 kg capacity) , bmw polybags red colour (28 kg capacity) , bmw polybags red colour(45 kg capacity) , bmw polybags red colour (05 kg capacity) , bmw polybags yellow colour (18 kg capacity) , bmw polybags yellow colour (28 kg capacity) , bmw polybags yellow colour (45 kg capacity) , cryotags / freezer labels, for 1.5 2.0 ml cryovials {ability to withstand cryogenic temperatures upto minus 80 degree c for a wide variety of plastic and glass vials, test tubes, cryogenic boxes and plates} , diluent for dna extraction/ ethanol, molecular(biology grade) , filter barrier tips 20 ul (in box packing, sterile dnase rnase pyrogenfree compatible with nichipet ex2 pipette (make nichiriyo)) , filter barriertips 10 ul (sterile dnase rnase pyrogenfree compatible with nichipet ex2 pipette (make nichiriyo)) , filter barriertips 1000 ul (sterile dnase rnase pyrogenfree compatible with nichipet ex2 pipette (make nichiriyo)) , filter barriertips 200 ul (sterile dnase rnase pyrogenfree compatible with nichipet ex2 pipette (make nichiriyo)) , micro centrifuge tube 0.5 ml (polypropylene tubes, resistance to chemicals, mechanical stress and temperature extremes,(autoclavable, dnase, rnase/endotoxin free)) , micro centrifuge tube 1.5 ml(polypropylene tubes, resistance to chemicals, mechanical stress and temperature extremes,(autoclavable, dnase, rnase/endotoxin free)) , micro centrifuge tube 2 ml(polypropylene tubes, resistance to chemicals, mechanical stress and temperature extremes,(autoclavable, dnase, rnase/endotoxin free)) , micro pipette tips 5 300ul , microcentrifuge tube rack (20 tube/24 tube capacity)(for 1.5/2ml tube) , microcentrifuge tube rack (80 tube/96 tube capacity) reversible one side for 1.5ml tube and other( side with 0.2 ml pcr tubes) , non latex purple nitrile gloves (large) (sterile dnase rnase pyrogenfree ) , non latex purple nitrile gloves (medium) (sterile dnase rnase pyrogenfree ) , optical adhesive covers for pcr 96 well rxn plates 0.2ml (compatible with biorad cfx 97 dx opm) , optical adhesive covers for pcr 96 well rxn plates 0.2ml (compatible with thermo fisher a28574 quant studiort pcr machine) , parafilm roll (size approx 2 inch width and 250 inch length) , pcr 96 well rxn plates 0.2ml (compatible with biorad cfx 97 dx opm) , pcr 96 well rxn plates 0.2ml (compatible with thermo fisher a28574 quant studiort pcr machine) , pcr strips 0.1 ml (strip of 4) (compatible with qiagen 5plex rotorgene rt pcr machine) , pcr strips 0.2 ml with attached cap (strip of 8) (compatible with thermo fisher a28574 quant studiort pcr machine) , pcr strips 0.2 ml with attached cap (strip of 8) (compatible with biorad cfx 97 dx opm) , rnase/ dnase away solution (for complete removal of rnase/ dnase contamination from work surfaces, pipettes and equipments(should be stable at room temperature)) , sterile pasteurppipettes 3ml , viral transport media with swabs (3ml vial with 2 regular swabs i.e. one nasal swab and one throat swab (1.viral transport medium (vtm) with swab with complete directions for collection, storage, transport and carrying. 2.sterile dacron, polyester or rayon sterile swabs with plastic shafts)) , aluminium foil (9 meters length) thickness 11 microns, width 30 cm , compertable with transasia xl 1000fully automated biochemistry analyser , erba gamma gt kit (5x44ml/5x11 ml ) , compertable with transasia semi auto analyzer erbachem 5x , ldh kit , ck mb kit , hdl kit , micropippte((0.5 50 ul)) , external quality control vial for routine biochemistry (erba chem 5x) , protein csf kit , lamp. (erba chem 5x) , calcium (50x1 ml) , ada , compertable with gelmatrix system model : tulip , ahg (coombs) test card , complete grouping card , diluent 2 liss , ngl xcf 3000 blood component separator machine , platelet apheresis bag...

Kendriya Vidyalaya Sangathan - Madhya Pradesh

36473488 bids are invited for physics and chem lab equipment volumetric flask 100ml , watch glass , wash bottle , 24dnp , agaragar , ammonium chloride , ammonium phosphate , benzene , benzoic acid , chloroform , copper sulphate , distilled water , magnessium ribbon , manganese dioxide , phenophthalein , potassium chromate , potassium hydroxide , potassium sulphate , strontium chloride , sulphuric acid , zinc sulphate , zinc rod , benzaldehyde , volumetric flask 500ml , volumetric flask 250ml , ammonium hydroxide , sodium metal , parafin liquid , sodium thiosulthate , hydrogen peroxide , sodium sulphite , stopwatch , polythene bottle 250ml , alumium metal chip , sulphar powder , carbon di sulphide , lead nitrate , plain slides , cover slips , droppers , acetocarmine stain , glacial acetic acid , sucrose , potassium nitrate , neutral litmus solution , universal indicator , ethanol , calcium carbonate , sodium bicarbonate , phenolphthalein , bacteria , paramecium , euglena , chlamydomonas , volvox , entamoeba , budding of yeast , rhizopus , spirogyra , epidermal peel with stomatas , parenchyma collenchymas scelerenchyma , pollen germination on stigma , t.s. testis of any mammal , t.s.ovary f any mammal , t.s.blastula of any mammal , t.s.morula gastrula of any mammal , cardiac muscles striated muscles smooth muscles , w.m. of nerve cell , glass rod , test tube brushes , wash bottle total quantity : 623...

Directorate Of Medical Education - Madhya Pradesh

36434740 kits chemical and comsumable, reagents tender regarding kits chemical and comsumable, reagents , name of department : pathology , diluent ( m 53 ) , lyse ( lh ) ( m 53 ) , leo ( ii ) ( m 53 ) , leo ( i ) ( m 53 ) , cleanser ( m 53 ) , probe cleanser ( m 53 ) , quality control ( m 53 ) , calibrator ( m 53 ) , bendedicts qualitative reagent , reticulocyte kit , leishmann stain sol. with buffer tablet ph , methanol ( acetone free ) , occult blood test kit ( haem test kit ) , drabkins solution , vaccutainer edta ( k3 vial with needles ) , immersion oil ( merck / span ) , test tube glass ( 12 x75 ) borosil / pyrex , tips ( micropipette ) ( 5 200?l ) , glass capillary tube , lancet , ( 10 ml syring ( piston with rubber bang ) , disodium hydrogen phosphate ( anhydrous ) , sodium di hydrogen phosphate , protein for csf ( calorimeter ) , albumin for csf ( albumin ) , rubber gloves 6.5, 7.0, 75 size , strips for urine albumin and sugar , hypochlorite so. ( conc. ) , ehrilichs aldehyde reagent , semen diluting fluid , wbc diluting fluid , sulphur powder , test tube holder , manual cellcounter , neubaerscounting chamber new improved , urinometer for specific gravity , h2o2 ( conc. ) , leishman staining powder , esr wintrobe tube ( glass ) , ammonia sol. , tissue paper roll , fouchets reagent , esbachsreagent , ehrlichs reagent , litmus paper , total protein reagent , filter paper , forceps 6 & 4 , tissue roll , vaccutainer needles holder , tourniquet , sodium citrate vail , cell pack , stromatolyzer 4 dl , stromatolyzer 4 ds , sulfolyzer , cell clean , g6pd kits , coombs , leishmann stain sol. with buffer tablet ph leishmans , waxparaffin ( 60 62 digree ) high grade, , formaline , microtome blade ( thermo ) m x 35 ultra 34 / 80 mm , nitric acid , filter paper sheet size 460mm x 570mm , popy lysine coated slide , poly lysine solusion , citric acid , tri sodium , sodium di hydrogen phosphate , disodium hydrogen phosphate , sodium chloride , tris ( hydroxy methyl ) amino methane , pas staining kit , microtome blades ( spencer’s rottary ) high profile , ptah staining kit , microtome blades ( thermo ) hp35 ultra 34 / 75 mm , cryomatrix gel ( thrmo ) , crytome ( fe ) cryocassette ( block hider ) , reticuline stain , messon tricrome , l mold ( brass metal ) size 6x03x02cm , cassette ( for tissue processing ) metal , dimond pencil , formic acid , runing water tray ( for histology ) , grossing nife ( ss ) , forcep 6’’ , scissors 6’’ , slide tray aluminium , coplinjar , tissue paper , cover slipe ( 22x50mm ) histology+ cytology , glycerol , con. hcl , muccuric oxide , iron alum amunium potesium sulphate , fericammonium sulphate , mucicarmine stain , alcian blue stain , congo red stain , staining rack , gold chloride , sliver nitrate , liquer ammonia , ph paper , slide filing cabinets , alcohol ( isopropyle alcohol ) histology + cytology , glass slide histology, cytology, cpl , xylene sulpher free histology + cytology , cover slips22x22 mm histology + cytology+cpl , d.p.x. 250 ml histology + cytology , haematoxyline powder 5 gm histology + cytology , glacial acetic acid histology + cytology+cpl , cover slips22x50 mm histology + cytology , cover slips22x40 mm histology + cytology , ea 50 , og 06 , eosin , carbal fuchsin , acid fast , methylene blue , cytospin filter card , cytospin filter cup with clips , plain plastic tube , glass test tube , filter paper sheet , diamond pencil , sta neoptimal cl 10 ( 00667 ) , sta ptt automate 5 ( 00595 ) , sta c.k. prest 5 ( 00597 ) , sta thrombin 2 ( 0611 ) , sta lia testd di plus ( 00662 ) , sta coag control ( n+p ) ( 00679 ) , sta lia test control n+p ( 00526 ) , sta lia test vwf:ag ( 00518 ) , sta immnodef def f viii ( 00728 ) , sta immnodef def f ix ( 00734 ) , sta pool norm ( 00539 ) , sta desorb u ( 00975 ) , sta cacl2 0.025 m ( 00367 ) , sta cleanersolution ( 00973 ) , sta cuvettes ( 38669 ) , sta cuvettes satellite ( 39430 ) , sta liquid cooling glycol ( 38640 ) , sta ptt la ( 00599 ) , sta liquid fib ( 00673 ) , sta pm kits ( 89567 ) , sta system control ( 00678 ) , sta uni calibrator ( 00675 ) , water bath measures ( with thermostate ) , aggregometer , digital stop watchs , incubator ( variable tempresure medium size ) , micro ppt ( finn pipette ) variable , ( a ) 20 200 ? l , ( b ) 05 100 ? l , ( b ) 1000 5000 ? l , ( d ) 50 500 ? l , centrifuge digital without carbon bush ( remi r 8c bc ) , thermametre ( mercury ) centrigrate , diamond pencil , semi automatic coagulometer ( 04 tube ) , cell pack , stromato lyser 4 dl , stromato lyser 4 ds , sulfo lyser , cell clean , e check trilevel , scs 1000 calibrator , g6pd kits ( qualitative ) , coombs sera , tri sodium citrate , amonium sulphate ( erba pure ( nh4 ) so4 , lieshman stain with buffer , mpo stain , iron stain ( perls ) , liquar amonia solution , sodium hypo cloride , distilled water , normal saline ( ns ) , immersion oil , methanol ( acetone free ) , chloroform ( chcl3 ) , potassium ferocyanide , sodium meta bisulfite ( ar ) , h2o2 ( hydrogen peroxide ) , dpx mountant , sodium dihydrogen phosphate , di sodium hydrogen phosphate , bovine albumin ( 22 % ) , acetone solution , syringe plastice 02 ml , piston with rubber bag 5 ml ( syringe ) , piston with rubber bag 10 ml ( syringe ) , hand gloves ( ruber ) , gauze , cotton roll , tissue paper , filter paper roundshape , hand wash shop / solution , citrate test tube ( 3.2% ) 2 ml mark , edta vial 2ml mark ( vacutainer ) , plain plastice 5 ml test tube with stopper , microtips ( unirersal type ) , micro centrifuge tubes ( 1.5ml size ) , glass slides ( blue star ) , cover slips ( blue star ) , glass test tubes ( borsil ) , glass test tubes ( borsil ) , glass ppt. ( mark up to tip ) , glass ppt. ( mark up to brosil ) , rubber bulb for ppt , glass fimmd ( borosil ) , bio rad d 10 tm dual program , lyphochek a2 control ( 553 ) l1+l2 , plastic aliquos polypropylane vials with pierceable caps ( sample vials 1.5 ml ) , micropipettes ( 100 1000 micro lt. ) , micropipettes ( 05 50 micro lt. ) , microtips+macrolips ( large ) , microtips+macrolips ( small ) , thermal printer paper ( 4 ) , rb a hu3c comlenent / fitc , rb a hu igg / fitc , rb a hu igm / fitc , rb a hu iga / fitc , miscellaneous item , igg , iga , igm , c3 , cig , c4d ( tansplant ) , fibrinogen , kappa ( kidnev only ) , lambds ( kidnev only ) , fitc ( florescent isothiayank , rhodaminc , feulgen stain , michelsmidium ( transport midium ) , er immuneo , pr immune , her 2 / neu , hpv 16 & hsv immuno stains , proliferative marker p 53 , proliferative marker kit 67 , pancytokeratin , ck 7 , ck 20 , ema , cea , hmwck , apf , vimentin , s 100 , desmin , nse , chromogranin , synaptophysin , msa , c kit / cd 117 , cd 34 , cd 31 , lca , bcl 2 , bck 6 , cd 3 , cd 5 , cd 10 , cd 20 , cd 15 , cd 1a , cd 30 , cd 68 , cd 99 , alk 1 , ca 125 , hmb 45 , gfap , myoglobin , cd 19 , plap , cd 33 , mpo , leucognost alpa , leucognost est , leucognost pas , leucognost pox , leucognost basic set , hematognost fe , basic set / reduction set , ttf 1 , p16 , mannual kits for liquid based cytology , cd 34 , cd 31 , lca , andriogenreceptro , myogenin , pten , cyclin d1 , lbc manual kits for cervical cancer screening , ihc basic kit , pap pen , humod chamber , name of department :pediatric medicine , crp ( turbidometry quantitative ) , crp slide ( latex / slide ) , urea ( modified berthelot ) , creatinine ( alkaline picrate kinetic ) , bilirubin t+d ( dmso ) , protein ( total ) { biuret } , printer paper ( thermal ) , sodium hypochlorite , tips – small ( 5 100 ul ) , tips – 1 ml ( big ) , micropipette – 1 ml , micropippete 50 ul , micropippete 10 ul , micropippete 5 50ul , dengue card , caliberator 1 and 2 , na electrode , k electrode , ca electrode , reference electrode , complete tubing set , paper roll , electrolyte filling solution , reference electrode filling solution , albumin ( bcg method ) , name of department :medicine , sterilant hot disinfectent for dialysis containing 21% ( approx ) ( citrostrile disinfectent ) for dialysis machine , sodium hypochlorite solution 5% for dialysis machine , dialyzer / a.v line reprocessing sterilant cold disinfectent for dialysiscontaining pracetic acid hydrogen peroxide acetic acid , equipment disinfecten gluteraldehyde solution 2% , bi_ carb h.d. fluid , bi_ carb potassium free h.d fluid , 1. wash cartridge 2. measurement cartridge for siemens abg machine , serum glucose kit method – god pod , blood urea kits modified birthlot method , serum creatinine method – jaffe’s kinetic method , eeg paste , eeg electrode , ncv electrode , emg needle , diluents ( abx minidil lmg ) method horiba abx micros es 60 , abx miniclean cleanser method horiba abx micros es 60 , abx mini lysevio method horiba abx micros es 60 , abx mono clair method horiba abx micros es 60 , urine strip method deka phan laura 10p make transasia , methanol , field stain a , field stain b , drabkin’s reagent method – cyanmethemoglobin , name of department : biochemistry department , murcuric sulphate , barium chloride , cupric acetate , creatinine powder , casine powder , formaldehyde , fructose powder , glucose powder , gelatin powder , lactose powder , mercuric chloride , maltose powder , phenyl hydrazine hydro chloride , resorcinol , sodium nitro prosside , sodium hydroxide , sodium tarcholate , sodium meta bisulphate , sucrose powder , starch , sodium chloride , sodium nitrite , sulphuric acid , hydro chloric acid , glacial acitic acid , nitric acid , ? napthol , phloroglucinol powder , ninhydrine powder , hydrogen peroxide , liquor ammonia , chloroform , albumin powder , ethanol ( abs.alcohol ) , amyl alcohal , ammonium molebdate , bromine ampule , burning spirit , sodium tungstate , lead oxid ( yellow ) , silver nitrate , urea powder , megnsium sulphate , uric acid , trichlora acitic acid , frerric chloride , cupper sulphate , ammonium oxalate , sulpher powder , bromocresal green ( liquid ) , picric acid , phenopthline indicator , lead acetate , orthophosphoric acid , sodium carbonate , lactic acid , barium nitrate , barium hydroxide , potassium chloride , sodium phosphatase ( hydrated ) , sodium pyrophosphate , n butanol , ether , phenol ( carbolic acid ) , phaspho molybdic acid , phasphotungstate , potassium hydroxide , sodium acetate , sodium carbonate , sodium hypo chloride , sodium tungstate , acetone , calcium chloride , ferrous sulphate , bilirubin powder , sodium benzoate , sodium dihydrogen phosphate monohydrate , thioberbituric acid , sodium citrate , sodium meta bisulphate , methanol , tannic acid , acitic anhydride , sodium diethyle dithio carbamate , sodium sulphate , ferric ammonium sulphate , perchloric acid , adrenaline bi tartrate , l tyrophan , l alanine , l arginine , l aspartic acid , l cysteine , l glycine , l tyrisine , l serine , l histidine , l methionine , l phenyl alanine , pera nitrophynele phosphate , sodium citrate dihydrate , filter paper 1, 2, 3 , filter paper circular 1, 2 ( circular ) , filter paper plane , cellulose strip ( for electrophoresis ) , beaker , beaker , beaker , beaker , beaker , beaker , volumetric flask , volumetric flask , volumetric flask , funnel ( plastic ) , flat bottom flask , flat bottom flask , merking acid bottles ( hcl ) , merking acid bottles ( h2so4 ) , merking acid bottles ( hno3 ) , dropping bottles brown , dropping bottles plane , reagent bottle , test tube , test tube , spirit lamp , test tubes holder , fallin uw tube , slide glass , cover slip , doramess urea meter , measuring clyinder , measuring clyinder , measuring clyinder , measuring clyinder , test tube stand ( bigsize hole 12 test tubes ) , drapper ( big size ) , glucose god pod , urea birth lot , uric acidpap method , cholesterolchod pap method , total protein biurate , albuminbcg colorimetric test , csf protein ( end point ) , sgotifcc / uv kinetic method , sgptifcc / uv kinetic method , alkaline phosphatase pnpp amp kinetic assay , triglyceride , hdl cholestrol , serum bilirubinjendrassik & grof method , serum creatinine jeff s reaction ( alkaline picric method ) , serum calcium , serum phophorus , calibrator solution 1& 2 ( carelyte electrolyte analyzer ) ( electrode method ) , enzyme cleaning solution , sodium conditioner , reagent pack ( careline electrolyte analyzer ) ( electrode method ) , control level 1 , control level 2 , d proteinization solution , sodium conditioner , cleaning solution , glucose god pod ( ba 400 ) , urea urease / glumate dehydrogenase , serum creatinine jaffe compensated , sgotifcc , sgpt ifcc , alkaline phosphate amp2 amino 2 methly 1 propanal , total bilirubindicholophenyl dizo buffer ( ifcc ) , serum direct bilirubindicholophenyl dizonium , serum protein biuret , serum albumin bromocresol green , cholesterol cholesterol peroxidase method , triglyceride glycerol phaphate oxidase / peroxidase , hdl cholesteroldirect , hdl / ldl standard , ldl cholesterol direct , serum uric acid uricase peroxidase , serum calcium arsenazo iii , serum phosphorus , serum amylase direct substract , serum lipase colour method , cpk ( ck ) ifcc , ck mb ifcc , serum ferritinlatex , serum ferritin standard , hba1c direct , hba1c standard , crp , crp standard , ldh kit , magnesium kit , biochemistry calibrator , biochemistry control , wash solution concentrate , reaction rotor , pd cups , extran ma 02 , protein electrophoresis in blood ( serum kit ) code no.7004058 , normal control serumcode no.58305 , wash solution code no. 58595 , destaining solution code no.58694 , hb electrophoresis , d 10 hemoglobin a1c program recorder pack ( code no 220 0101 ) , d 10printer paper ( code no 220 0375 ) , liquichek diabetes control level 1 ( code no 171 ) , liquichek diabetes control level 2 ( code no 172 ) , tips ( 10 200 ul ) , tips ( 10 1000 ul ) , allicates , clot vaccutainer , distill water ( ltr ) , tissue paper roll , t3 elisa , t4 elisa , tsh elisa...

Directorate Of Medical Education - Madhya Pradesh

36184405 tender for supply of chemical and reagents for mdru dep , item name , mdru kits and reagents , ammonium chloride 500gm , potassium bi carbonate 500gm , sodium chloride 500gm , tris hcl 500gm , sds 500gm , saturated phenol 500ml , chloroform 500ml , sodium acetate 250gm , isoamyl alcohol 500ml / 1ltr , glacial acetic acid 500ml / 1ltr , molecular biology grade agarose powder 250gm , bromophenol blue dye 2ml*5=1pack , ethidium bromide 10ml , molecular weight ( dna ladder ) 100bp & 1kb 1 vial , molecular weight ( dna ladder ) 50bp 1 vial , molecular weight ( dna ladder ) 25bp 1 vial , taq polymerase 500units / vial , amplitaq gold dna polymerase master mix 500units / vial , mgcl2 5ml , dntp mix 1ml , dnase 1000 unit , rnase 1000 unit , proteinase k 1000 unit , tris edta 500 gm , edta 250gm / 500gm , boric acid 250gm / 500gm , teepol5 liter , xylene cynol 10 gm , dmso 50 ml , tips i. 0.2 20 ?l tips , superscript ii rnase reverse transcriptase / episcript™ rnase h reverse transcriptase ( episcript rt ) 400 / 500 reaction pack. , power sybrgreen pcr master mix 5 ml , power sybrgreen rt pcr reagent kit 5 ml , oligo ( dt ) 12 18 primer25ug ( 0.5ug / ul ) , absolute ethanol 500ml , pcr plates ( light cycler 480 compatible ) pack of 50 / pack of 100 , sealing foil ( rt pcr / qpcr grade ) ( light cycler 480 compatible ) pack of 50 / pack of 100 , filter tips each pack contains 1000 psc. , mct variable tubes each pack contains 1000 psc. , i. 20 200?l tubes , ii. 200 600 ?l tubes , iii. 500 2000 ?l tubes , nitrile autodextorous gloves each pack contains 1000 psc. , mctstands for variable tubes sizes each pack contains 10 psc. , i. 20 200?l tubes stand , ii. 200 600 ?l tubes stand , iii. 500 2000 ?l tubes stand , filter tip boxes each pack contains 10 psc. , i. 0.2 20 ?l filter barrier tip box , ii. 20 200 ?l filter barrier tip box , iii. 200 1000 ?l filter barrier tip box , rt pcr grade water pack size of 20ml ( 20 ml * 5 ) , tip discard box ( 1 2 liter capacity ) each , graduated measuring cylinders 50, 100, 500, 1000 ml each , graduated beakers 50, 100, 500, 1000 ml each , flat bottom tube 5ml ( with screw cap ) pack size of 500 psc. , tube stand ( 15ml falcon, 5ml, 2ml, 0.5ml, 0.2ml mct ) pack size of 10 psc. , graduated conical flask 50, 100, 500, 1000ml pack size of 5 psc. , test tube 5, 10 ml each pack contains 100 psc. , slide+cover slips ( 25mm*75mm ) each pack contains 100 psc. , tissue paper roll pack size of 12 psc. , fine tissue cloth roll pack size of 12 psc. , cotton pack size of 10 psc. , wash bottle / dropping bottle, 200ml, 500ml, 1ltr each , funnels variable range each , plastic bottle, 200, 500, 1000ml each , syringe + needle 2 ml, 5 ml pack size of 100 psc. each , nitrile gloves; medium and large size box pack size of 1000 psc. , dna isolation kit { blood } per kit , rna isolation kit per kit , phenol 500 ml , hno3 ( nitric acid ) 500 ml , propionaldehyde pure ( 97% ) 500 ml , phthalic anhydride 500 ml , glacialacetic acid ar 500 ml , hydrochloric acid ar 500 ml , sulfuric acid ar 500 ml , 2 amino ethanol 500 ml , pyridine ar 500 ml , ammonia solution ar 500 ml , ammonia chloride ar 500 ml , acetyl salicylic acid 500 ml , acetone ar 500 ml , anthranilic acid ar 500 ml , activated charcoal 500 ml , silica gel g 500 ml , benzoicacid ar 500 ml , sds 500 gm , colin ( cleaning detergent solution ) 500 ml , sterilium ( hand sanitizer ) 100 ml * 5 , dettol / lifeboy alcohol based hand sanitizer 100 ml * 5 , floor cleaner phenyl 1 l * 5 , cleaning mop per psc , broom per psc , microwave gloves per pair , brown paper for autoclaving per roll , liquid nitrogen 10 / 25 ltr. , phosphate buffer saline ( 10x; ph 7.4; rnase free ) 500 ml , formalin ( formaldehyde aqueous solution; lab grade ) 500 ml , paraffin wax ( 58 600c for histology ) 500 gm , xylene ( molecular lab grade ) 500 ml , glycerol500 ml , ammonia ( nh4oh; extra pure ) 250 ml / 500 ml , methanol ( methyl alcohol, ch3oh ) 500 ml , acrylamide / bis ar 500 ml , 10x tbe buffer 500 ml , urea ( ultra pure; mol bio grade ) 500 gm / 1kg , ammonium persulfate 100 gm , temed ( ultra pure; mol bio grade ) 100 ml / 250 ml , 4’, 6 diamidino 2 phenylindole 50 ml , diethyl pyrocarbonate 5 gm / 25 gm , tae buffer , sybr gold 100ul , restriction enzyme – mnl i250 / 300 / 500 units , restriction enzyme – bcli1000 / 1500 / 2500 / 3000 units , restriction enzyme – hpych4v100 / 500 units , restriction enzyme – hpych4iii200 / 250 / 1000 / 1250 units , restriction enzyme – sau96i 1000 units , restriction enzyme – sfci200 / 1000 units , restriction enzyme – bcci1000 units , restriction enzyme – scrfi500 / 1000 / 2500 units , restriction enzyme – afliii250 / 1250 units , restriction enzyme – scai500 / 1000 / 1250 units , restriction enzyme – avai1000 / 2000 units , restriction enzyme – bsmi200 / 500 / 1000 / 2500 units , restriction enzyme – tspri ( also share cleavage site withtscai ) 1000 units , restriction enzyme – mboii250 / 300 / 1250 / 1500 units , restriction enzyme – bsh1236i500 / 1000 / 2500 units , restriction enzyme – banii1000 / 1500 / 2000 units , restriction enzyme – mph1103i1000 / 5000 units , restriction enzyme – dde i200 / 500 / 1000 / 2500 units , restriction enzyme – bsmb i ( also share cleavage site withesp3i ) 200 / 400 / 1000 units , restriction enzyme – afa i ( also share cleavage site withrsa i ) 1000 / 5000 units , restriction enzyme – bal i ( also share cleavage site withmlu ni ) 50 / 100 / 200 / 250 units , restriction enzyme – fspi ( also share cleavage site withnsbi ) 400 / 500 / 1000 / 2500 units , restriction enzyme – hpa ii ( also share cleavage site withmspi ) 1000 / 2000 / 4000 / 5000 / 10000 units , restriction enzyme hinf i , restriction enzyme hpych4 , restriction enzyme mboii , restriction enzyme bstui , restriction enzyme mvai , primers , fmr1 set 1 –f5 tcaggcgctcagctccgtttcggtttca 3 r5 5 aagcgccattggagccccgcacttcc 3 , mecp2 exon 1 set 1 f5 gttatgtctttagtctttgg–3´ r5 tgtgtttatcttcaaaatgt–3´ , exon 2set 1 f5 cctgcctctgctcacttgtt–3´ r5 ggggtcatcatacatgggtc–3´ , exon 2set 2 f5 agcccgtgcagccatcagcc–3´ r5 gttccccccgaccccaccct–3´ , exon 3 set 1 –f5 tttgtcagagcgttgtcacc–3´ r5 cttcccaggacttttctcca–3´ , exon 3 set 2 f5 aaccacctaagaagcccaaa–3´ r5 ctgcacagatcggatagaagac–3´ , exon 3 set 3 f5 ggcaggaagcgaaaagctgag–3´, r5 tgagtggtggtgatggtggtgg–3´ , exon 3 set 4 – f5 5´–tggtgaagcccctgctggt–3´ r5 ctccctcccctcggtgtttg–3´ , exon 3 set 5 f5ggagaagatgcccagaggag–3´ r5 cggtaagaaaaacatccccaa–3´ , exon3 ( l100v ) f5 aaccacctaagaagcccaaa 3 r5 gcttaagcttccgtgtccagccttcaggta 3 , putative promoter and exon 1. f5 gggtgcaatgaaacgctta 3 r5 tttaccacagccctctctcc 3 , mc4r rs17782313 f 5 aagttctacctaccatgttcttgg 3 r 5 ttccccctgaagcttttcttgtcattttgat 3 fto rs9939609 f 5 aactggctcttgaatgaaataggattcaga 3 r5 agagtaacagagactatccaagtgcagtac 3 , adipoqrs2241766 – f5 tgtgtgtgtggggtctgtct 3 r 5 tgtgatgaaagaggccagaa 3 , rs1501299 f5 ctacactgatataaactatatggag 3 r5 ccccaaatcacttcaggttg 3 , pcsk1 rs155971 – f5’tatatgcagccaccaatcca 3’ r5’aaaatgaagggagaagcacaaa3’ , pomcrs6232 f5 ttgtgcccttcatctgaaca 3 r5 tgtagcaactttggcatgga 3 , rs155971 f5tatatgcagccaccaatcca 3 r5 aaaatgaagggagaagcacaaa 3 , ppar g ( pro12ala ) f5gcc aat tcaagc cca gtc 3r5gat atgttt gca gac agt gta tca gtg aaggaa tcg ctttcc g 3 , kcnj11 ( rs5219 ) f5 gactctgcagtgaggcccta 3’ r5 acgttgcagttgcctttctt 3’ , capn10 ( rs3792267 ) f5 cacgcttgctgtgaagtaatgc 3’r5 tgattcc catggtctgtagcac 3’pik3ca set 1 forward 5’ ggagtatttcatgaaacaaatgaatgatgcg 3’ reverse 5’ gagctttcattttctcagttatctt 3’ , bat 25 set 1 f 5’ tcgcctccaagaatgtaagt 3’r 5’ tctgcattttaactatggctc 3’bat 26 set 1 f5’ tgactacttttgacttcagcc 3’r5’ aaccattcaacatttttaaccc 3’ , d2s123 set 1 f5’ aaacaggatgcctgccttta 3’ r5’ ggactttccacctatgggac 3’ , d5s346 set 1 f 5’ actcactctagtgataaatcggg 3’ r5 agcagataagacagtattactagtt 3 , d17s250 – set 1 f5’ ggaagaatcaaatagacaat 3’ r5’ gctggccatatatatatttaaacc 3’ , impdh2 set 1 f5 gtttctgcggtatcccaatc 3 r5 cgagcaagtccagcctat 3 bmp6 rs73719353 f5’ gctcctttgcacttcgctgt 3’ , r5’ aggctctgctg agctcctac 3’ , bmp6 rs73719341 f 5’tgaacttcccattcccctct 3’ r5’ataaaattagcattgatcca 3’ , bmp6 rs73719318 f5’caggtgctgtgcaacttctt 3’ r 5’agagggcaccatggttgcct 3’ , bmp6 rs73381662 f 5’ ctgagattcaattaggccca 3’ r 5’taaagaacagcaaaagtctg 3’ , bmp6 rs73381650 f 5’cacataaagattgctgcatt 3’ r 5’tagtaatcctaaaaatggga 3’ , anxa2 rs7170178 f 5’ ttcacagcagttcaaaatac 3’ r 5’ ctgggtttccagagatggaa 3’ , anxa2 rs73435133 f 5’ gagtgcaaggtgctgaggat 3’ r 5’ gatttcagacagcccttgca 3’ , anxa2 rs73418020 f 5’ tctgagagtgaaaggtgcac 3’ r 5’ tcccatcccctgaatccctg 3’ , anxa2 rs72746635 f 5’ cctgactcattgtcacatca 3’ r 5’ aagtggctttccactgccc 3’ , anxa2 rs73418025 f 5’ cttctcatcttactttt 3’ r 5’ agggaaggatacagaggaga 3’ , hsp 70 primer sequence5 agcgt aacac cacca ttcc 3 ( forward ) 5 tggct cccac cctat ctc 3 ( reverse ) , the gapdh sequence forward primer 5 agc cac atc gct gag aca c 3, reverse primer 5 gcc caa tac gaccaa atcc 3. , mthfr f:5 tgtggtctcttcatccctcgc 3;r: 5 ccttttggtgatgcttgttggc 3. , dpyd f:5 actcaatatctttactctttcatcaggac 3. r: 5 acattcaccaacttatgccaattct 3. , tyms f:5’ ggtacaatccgcatccaactatta 3’ r:5’ ctgataggtcacggacagattt 3’ , imp3 forward:5’atgactcctccctacccg3’ reverse:5’gaaagctgcttgatgtgc3’ , cxcl1forward: 5’ccagacccgcctgctg 3’and reverse:5’cctcctcccttctggtcagtt 3’ , cox 2 forward: 5 cagccatacagcaaatcc 3; reverse: 5 tcgcacttatactggtcaa 3 , hmlh1f 5 ttt tga tgt aga tgt ttt att agg gtt gt 3r 5 acc acc tcatcataa cta ccc aca 3 , ppar g ( pro12ala ) , f5gcc aat tcaagc cca gtc 3 , r5gat atgttt gca gac agt gta tca gtg aaggaa tcg ctt tcc g 3 , methylated ( hmlh1 ) f 5 acg tagacg ttt tat tag ggt cgc 3 r 5 cct catcgtaac tac ccg cg 3 , hmsh2 f 5 ggt tgt tgt ggt tgg atg ttg ttt 3 r 5 caa cta caa cat ctc ctt caa cta cac ca 3 , methylated ( hmsh2 ) f 5 tcg tgg tcg gac gtc gtt c 3 r 5 caa cgt ctc ctt cga cta cac cg 3 , ? actin: forward: 5’ ctacgtcgccctggacttcgagc 3’ ß actin: reverse: 5’ gatggagccgccgatccacacgg 3’ , kras forward: 5 gactgaatataaacttgtggtagttggacct 3.reverse: 5 ctattgttggatcatattcgtcc 3. , braf forward: 5 tcataatgcttgctgatagga 3. reverse: 5 ggccaaaaatttaatcagtgga 3. , mthfr ( c677t ) ‘‘5 gcacttgaaggagaaggtgtc 3” and reverse primer ‘‘5 aggacggtgcggtgagagtg 3” , mthfr ( a1298c ) forward ‘‘5 ctt tgg gga gct gaa gga cta cta c 3” and reverse ‘‘5 cac ttt gtg acc att ccg gtt tg 3” primers. , total rna isolation mini kit ( from human skin tissue ) / rneasy fibrous tissue mini kit ( for rna extraction from human skin tissue ) ( qiagen ) per kit ( each kit pack is for 50 reactions ) , purospin™ fibrous tissue rna purification kit ( luna nanotech ) ( for rna extraction from human skin tissue ) per kit ( each kit pack is for 250 reactions ) , aurum™ total rna fatty and fibrous tissue kit ( biorad ) / mp biomedicals fastrna pro green kitper kit ( each kit pack is for 50 reactions ) , human leptin elisa kit per kit ( each kit pack is for 96 reactions ) , human adiponectin elisa kit per kit ( each kit pack is for 96 reactions ) , human adipsin elisa kit per kit ( each kit pack is for 96 reactions ) , human resistin elisa kit per kit ( each kit pack is for 96 reactions ) , human iron elisa kit ( serum iron ) per kit ( each kit pack is for 96 reactions ) , human ferritin elisa kit ( serum / ferritin ) per kit ( each kit pack is for 96 reactions ) , gdf15 human elisa kit per kit ( each kit pack is for 96 reactions ) , spexin human elisa kit per kit ( each kit pack is for 96 reactions ) , human pai 1 elisa kit per kit ( each kit pack is for 96 reactions ) , thyroid estimation kit per kit ( each kit pack is for 96 reactions ) , ice maker machine for laboratory purpose 1 unit , microwave gloves each packet contains one pair of gloves. , pcr mini cooler / coolcube microplate and pcr tube cooler each , horizontal gel apparatus: 18 – 20 cm ( length ) x 25 – 30 ( breadth ) x 5 7.5 cm ( height ) , 40 60 samples, multichannel pipette compatible combs and gel caste each , mini horizontal gel apparatus: 9 cm w x 11 cm l with grooves ( 8.7 cm l x 1.2 cm h ) on the side for gripping the gel tray. it should have two comb slots on the same tray area. buffer capacity should be 600 ml for the buffer tanks and optimum gel runs with a fill line indicator for buffer levels along the unit side each , multi size forceps lab set each packet containsmulti size forceps lab set , liquid nitrogen sample storage tanks each , liquid nitrogen sample handling gloves each packet contains one pair of gloves. , l mold each , tissue cassette steel each , electric tissue float bath ( thermostate ) each , coupling jar each pack contains 2 psc. , staining rack each , whatman filter paper grade 1 & 2 each packet contains 50 psc.. , harri’s hematoxylin powder 25 / 50 / 100 / 250 / 500 gm , yellow eosin powder 25 / 50 / 100 / 250 / 500 gm , coverslip 18x18 ( microscopic ) each packet contains 100 psc.. , dpx mount 100 ml / 250 ml , hot plate each , mx35 premier microtome blade ( 34 / 80mm ) 50 blades each box contains 50 psc.. , diamond point marker pen ( histopathology use ) each , embedding mold and embedding ring each , qiamp dna ffpe tissue kit ( 50 rxns ) , genomic dna purification kit ( promega ) , rna extraction kit from tissue , cdna synthesis kit , superscript ii rnase reverse transcriptase , sybr green pcr master mix , sodium bisulphite , page loading dye , formamide , n’n’ methylene bisacrylamide , ammonium persulfate , temed , polyacrylamide , wizard dna clean up system ( promega ) , 2 mercaptoethanol , silver stain , hydroquinone , urea , blotting paper , dna ladder 10 bp , pas stain , histopathology plastic cassettes , poly – l – lysine coated slides , deep well mortar and pestle homogenizers ( medium size ) , deep well mortar and pestle ( small size ) , rneasy minielute cleanup kit , phase – lock gel heavy5 prime phase – lock gel heavy5 prime , qiazol lysis reagent , rneasy minielute cleanup kit , cryo vial 1 pkt contains 50 psc. , deep well mortar and pestle ( small size ) ...

Government Medical College - Madhya Pradesh

35627530 supply for central lab and cssd consumables and other item supply for central lab and cssd consumables and other items in gmc raltam , three part automated cell counter model : swelab alfa plus basic , swelab alfa plus diluents , swelab alfa plus lyser , boule control normal , boule control low , boule control high , five part fully automated cell counter model : bc 6800 , m 68lh lyse , m 68 lb lyse , m 68 dr diluent , m68 ld lyse , m 68 ln lyse , m 68 ds diluent , 68 fd dys , 68 fr dys , 68 fn dys , probe cleanser , controls and calibrators , aspen bc – 6d control set (6x4.5ml (2l, 2n, 2h)) , aspen bc – ret control set (6x4.5ml (2l, 2n, 2h)) , aspen sc – cal plus calibrator , automatic coagulation analyzer model : sta compact max 3 , stac cacl20, 0025m (00367) , sta cephascreen 10(00310) , sta cleanser solution 6x2500ml(00973) , sta coag control n+p(00679) , sta desorb u24x15ml (00975) , sta liatest control n+p (00526) , sta liatest d di (00662) , sta @ neoptimal 5. (01163) , sta owren koller 24x15ml(00360) , chemicals , ethanol (99.9%) , xylene (sulphar free) , paraffin wax (58 60 temperature) , acetone , hematoxyline , eosin (2%) , distyrene plasticizer xylene (dpx mountant) , glacial acetic acid , formic acid (100%) , nitric acid (100%) , propanol (45%) , oil immersion , n/10 hcl , sodium metabisulphate , urine strip 10 para , sodium nitroprusside , liquor ammonia , ammonium sulphate , sulphosalicilic acid solution , sulphur powder , leishmen stain , wbc diluting fluid , rbc diluting fluid , og 6 , ea 50 , semen analysis diluting fluid , formaline , spirit alcohol , sulphuric acid , reticulocyte count fluid , distilled water , barium chloride , sodium hypochloride , methanol , glucose pouch , perls stain (long expiray) , pas stain (long expiray) , mpo sstain (long expiray) , benzidine solution (long expiray) , kits , reticulocyte count kit , pt kit , aptt kit , field stain kit , rapid pap stain kit , giemsa stain kit , g6pd kit , antisera a , antisera b , antisera d , sickle cell test kit , pt/inr kit , reagent , benedict reagent (long expiray) , ehrlich’s reagent (long expiray) , esbech’s reagent (long expiray) , fouchet reagent (long expiray) , other consumable items , microscopic glass slide (75x25) , jam microscopic cover glass (22x50) , casset , microtome blade , slide box , tissue paper roll , plastic dropper (small) , plastic dropper (big) , test tube 5ml , coupling jar , test tube 10ml , slide carrying tray , aluminium slide tray , slide staining stand , glass dish staining jar , test tube stand , measuring cylinder (10 ml borosilicate) , glass tube brush , hand wash , beaker glass (100 ml borosilicate) , beaker glass (500 ml borosilicate) , conical flask (100 ml borosilicate) , conical flask (500 ml borosilicate) , bubbler (plastic screw) , graduate pipette (borosilicate ) 10ml , volumetric flask 100ml , filter paper 12.5dm , diamond pencil , capillary tube for bt ct (glass) , k3 edta vial , urine container , knife (grossing) , speciman jar with lid (glass) (200x200x70 mm) , speciman jar with lid (glass) (150x150x60mm) , museum jar with lid (glass) (220x150x100mm) , museum jar with lid (glass) (220x195x80mm) , museum jar with lid (glass) (250x165x140mm) , museum jar with lid (glass) (360x150x100mm) , museum jar with lid (glass) (150x150x80mm) , museum jar with lid (glass) (250x250x120mm) , museum jar (10x10x15 inches) , museum jar (18x12x12 inches) , museum jar (25x15x10 inches) , pippette 1 ml (borosilicate) , pippette 5 ml (borosilicate) , glass rod (solid ) , slide holder (steel) , slide staining rack , urinestripe 4 parameter (1.ph 2.specific gravity3. sugar 4.albumin(protein)) , sodium citrate vial , esr tube (wintrobe) , esr western green tube , cover slip10 gm , application plastic stick , sprit lamp glass , tube holder , rbc pipette , wbc pipette , wester green stand , wintrobe stand , pasture pipette , disposable pap smear kit , torniqute , tissue embedding mold , embedding o ring , test tube 15 ml , test tube 20 ml , centrifuge tube 15ml , centrifugr graduated tube 15 ml , reagent bottle 100 ml , reagent bottle 250ml , reagent bottle 500 ml , measuring cylinder 100 ml , measuring cylinder 5 ml , dropping bottle 250 ml , detergent powder , culture media , agar powder , alkaline peptone water , anhydrous barium chloride , arabinose , arginine dihydrolase powder , automated blood culture bottle (adult) compatible withbact/alert 3d 480, bio merieux , automated blood culture bottle (paediatrics) compatible withbact/alert 3d 480, bio merieux , bile esculin agar , blood agar powder , brain heart infusion broth , candida crome agar , cary blair medium base , christensens urea agar base , cled agar , corn meal agar , decarboxylase broth moeller , dermatophyte test medium , glucose , glucose phosphate broth , hugh leifson medium , lowenstein jansens medium(ready prepared) , lactose , lysine decarboxylase , macconkey agar without crystal violet , macconckeys agar with crystal violet , macconkey broth double strength (for water testing) , macconkey broth single strength (for water testing) , maltose , manitolmotility test medium , mannitol , mannitol salt agar , manual blood culture bottle with sds (adult) 70ml , manual blood culture bottle with sds (paediatrics) 20ml , muller hinton agar , nutrient agar , nutrient broth , peptone powder , phenyl alanine agar , pyr agar , robertson cooked meat medium base , sabouraud dextrose agar with chloramphenicol with cycloheximide , sabourauds dextrose agar powder , sabroud dextrose agar with chlorophenicol , selenite f broth , simmons citrate agar , sodium deoxycholate , sucrose , tcbs agar , triple sugar iron agar , xld agar , antibiotic disc , amikacin 30 mcg , amoxicillin , amoxycillin clav 20/10ug , ampicillin 10 mcg , ampicillin sulbactam(10/10 ?g) , azithromycin 15 mcg , aztreonam(30 ?g) , cefazoline 30 mcg , cefepime 50ug , cefoperazone / sulbactum , cefoperazone 75 mcg , cefotaxime(30 ?g) , cefotaxime+clavulanate , cefoxitin 30ug , cefpodoxime , ceftazidime 30 mcg , ceftazidime+clavulanate , ceftriaxone 30 mcg , ceftriaxone sulbactum 30/15ug , cefuroxime 30 mcg , chloramphenicol 30 mcg , ciprofloxacin 5mcg , clarithromycin(15 ?g) , clindamycin 2 mcg , co trimoxazole(sulpha/trimethoprim) 25 mcg (23.75/1.25) , colistin (0.016 256 mcg/ml) , colistin 10 mcg , cotrimoxazole(25 ?g) , doripenem(10 ?g) , doxycycline hydrochloride 30 mcg , ertapenem(10 ?g) , erythromycin 15 mcg , gatifloxacin(5?g) , gemifloxacin(5 ?g) , gentamicin 10 mcg , imipenem 10 mcg , linezolid(30 ?g) , lomefloxacin(10 ?g) , meropenam 10ug , minocycline(30 ?g) , moxifloxacin(5 ?g) , nitrofurantion 300 mcg , norfloxacin 10 mcg , novobiocin(5 ?g) , ofloxacin(5 ?g) , oxacillin(1 ?g) , penicillin 10 units , piperacillin 100 mcg , piperacillin/tazobactam 100/10 mcg , polymyxin b , quinopristin dalfopristin(15 ?g) , teicoplanin , teicoplanin 30 mcg , tetracycline 30 mcg , ticarcillin clavulanate(75/10 ?g) , tobramycin 10 mcg , trimenthoprim(5 ?g) , vancomycin (0.016 256 mcg/ml) , vancomycin 30 mcg , bacitracin(0.4 u) , sterile disc , v factor , x factor , x+v factor , optochin(5 ?g) , kits & chemical , acetone solution , acid fast staining kit , albert’s metachromatic stain kit , andrade’s indicator , anti hav igm (elisa kit) , anti hav igm (rapid test) , anti hcv antibody kits (elisa kit) , aso kit(25 test/packet),consumable , basic carbol fuchsin for afb staining(powder) , conc hcl , crp test kit , crystal violet powder , dengue ns 1 elisa , formaldehyde solution , field stain a , field stain b , filarial antigen card test , ferric chloride (500 gm) , formaldehyde 40% (conc. formaline) , giemsa stain (merck / span) , glycerol , gram iodine , gram staining kit , h2so4 (sulphuric acid) 25% , hbv elisa test kit , hepatitis e virus anti hev igm antibody (elisa) , hiv (rapid)(whole blood finger prick test kit) , hiv elisa test kit , hydrogen peroxide 6% solution , india ink , kovac’s reagent (indole) , lacto phenol cottons blue stain , lead acetate strip , leishman stain , liquid paraffin , malaria bivalent antigen detecting rapid diagonstic tests(rdts) , methyl blue for (z n) , methyl alcohol , methyl red indicator , methylene blue powder , nitrate reagent a , nitrate reagent b , occult blood test kit (haem test kit) , oxidase disc , oxidase reagent (tetra methyl para phenylene di amine di hydro chloride) , phenol crystals , pyr reagent , ra factor rapid kit , rpr test kit , safranine (gram stain) , urea 40% supplement (for urea agar base) , voges proskauer reagent a , voges proskauer reagent b , widal slide test(4x5ml with control) , xylene , zinc dust , chemical indicator for autoclave (indicator tape) , biological indicator for autoclave (indicator vial) , glassware, plasticware& other item , autoclavable aluminium foil , autoclavable glass bottle with screw cap for culture media (1000ml (borosilicate glass autoclavable)) , autoclavable glass bottle with screw cap for culture media (500ml (borosilicate glass autoclavable)) , autoclavable glass bottle with screw cap for culture media (50ml (borosilicate glass autoclavable)) , autoclavable petri plate (100mm) plastic , autoclavable petri plate (150mm) plastic , autoclavable petri plate (90mm) plastic , autoclavable reusable transparent bags , bcg(1 ml each) , beaker 1000ml (borosilicate glass autoclavable) , bloting paper (paper) , burning sprit , cedar wood oil , concavity slide , conical flask (glass) 1000ml , conical flask (glass) 100ml , conical flask (glass) 2000ml , conical flask (glass) 500ml , conical flask (glass) 50ml , cover slip , cryogenic vial , disposable plastic loop 2mm , disposable plastic loop 4mm , disposable sharp collection containers(5 ltr) , dropping bottle plastic 100 120 ml capacity , durham’s tube , falcon tube sterile, (conical bottom)(50ml each plastic containers with air tight screw cap printed graduation) , filter paper sheet((whatmann no 01) , filter paper(12.5 cm, 0.1 micron) , forceps small , gaspak (3.5 liter) , glass marking pen (diamond ) , glass reagent bottle (5 litre) , glass test tube 12 x 100 (medium size) heavy quality 100/pkt(no.) , glass test tube 12 x 50 borocilicate glass autoclavable , glass test tube 15 x 125 borocilicate glass autoclavable , measuring cylinder plastic (100 ml) , measuring cylinder plastic (1000 ml) , measuring cylinder plastic (50 ml) , measuring cylinder plastic (500 ml) , metal loop holder , micropipette tips (10 ul )(for serology) , micropipette tips (100 ul )(for serology) , micropipette tips (1000 ul )(for serology) , micropipette tips (20 ul ) , micropipette tips (200 ul ) , microscope lens cleaner kit , para film sealing film , ph paper strip range (1 10) , soap , sterile cotton swab wooden stick(individually packed) , sterile disposable/hypodermic syringe for single use(5ml ) , sterile disposable/hypodermic syringe with needle for single use(2ml ) , sterile disposable/hypodermic syringe with needle for single use(10ml ) , sterile urine collection container 50ml disposable , individually packed , swab stick with tube sterile , test tube holder , test tube stand (aluminum) 10x10 holes for 12mm diameter test tube , test tube stand 10x10 holesfor 18mm diameter test tube , test tube stand 10x10 holes for 12mm diameter test tube , test tube stand, polypropylene, 3 tier(for keeping 10 ml vtm vials/ tier) , urine container size of the container shall be 30ml disposable , utility gloves(medium) , atcc strain & antisera , acinetobacter baumannii nctc 13304 , enterococcus faecalis atcc 29212 , klebsiella pneumoniae atcc 700603 , pseudomonas aeruginosa atcc 27853 , staphylococcus aureus 25923 , escheriachia coli 25922 , staphylococcus aureus atcc43300 (mrsa) , shigella boydii polyvalent c antisera , shigella dysentriae polyvalent a antisera , shigella flexneri polyvalent b antisera , shigella sonnei polyvalent d antisera , vibrio cholera o1(ogawa)antisera , vibrio cholera o1( inaba)antisera , vibrio cholera (o139 )antisera , salmonella typhi poly o antisera , salmonella typhi o 2 antisera , salmonella typhi o 7 antisera , salmonella typhi o 9 antisera , rt pcr kits, chemical & consumable , 0.2 ml pcr tube (sterile, flat cap shaped) dnase/rnase free , 15 ml polypropylene centrifuge tubes, sterile, {certified nonpyrogenic and dnase /rnase free, disposable conical bottom with seal caps(the tubes should have printed graduations and a large white marking spots)} , alcohol 70% (laboratory grade) , bio medical waste bins red (15 ltr) , bio medical waste bins red (25 ltr) , bio medical waste bins red (40 ltr) , bio medical waste bins yellow (15 ltr) , bio medical waste bins yellow (25 ltr) , bio medical waste bins yellow (40 ltr) , bmw polybags red colour (18 kg capacity) , bmw polybags red colour (28 kg capacity) , bmw polybags red colour(45 kg capacity) , bmw polybags red colour (05 kg capacity) , bmw polybags yellow colour (18 kg capacity) , bmw polybags yellow colour (28 kg capacity) , bmw polybags yellow colour (45 kg capacity) , cryotags / freezer labels, for 1.5 2.0 ml cryovials {ability to withstand cryogenic temperatures upto minus 80 degree c for a wide variety of plastic and glass vials, test tubes, cryogenic boxes and plates} , diluent for dna extraction/ ethanol, molecular(biology grade) , filter barrier tips 20 ul (in box packing, sterile dnase rnase pyrogenfree compatible with nichipet ex2 pipette (make nichiriyo)) , filter barriertips 10 ul (sterile dnase rnase pyrogenfree compatible with nichipet ex2 pipette (make nichiriyo)) , filter barriertips 1000 ul (sterile dnase rnase pyrogenfree compatible with nichipet ex2 pipette (make nichiriyo)) , filter barriertips 200 ul (sterile dnase rnase pyrogenfree compatible with nichipet ex2 pipette (make nichiriyo)) , micro centrifuge tube 0.5 ml (polypropylene tubes, resistance to chemicals, mechanical stress and temperature extremes,(autoclavable, dnase, rnase/endotoxin free)) , micro centrifuge tube 1.5 ml(polypropylene tubes, resistance to chemicals, mechanical stress and temperature extremes,(autoclavable, dnase, rnase/endotoxin free)) , micro centrifuge tube 2 ml(polypropylene tubes, resistance to chemicals, mechanical stress and temperature extremes,(autoclavable, dnase, rnase/endotoxin free)) , micro pipette tips 5 300ul , microcentrifuge tube rack (20 tube/24 tube capacity)(for 1.5/2ml tube) , microcentrifuge tube rack (80 tube/96 tube capacity) reversible one side for 1.5ml tube and other( side with 0.2 ml pcr tubes) , non latex purple nitrile gloves (large) (sterile dnase rnase pyrogenfree ) , non latex purple nitrile gloves (medium) (sterile dnase rnase pyrogenfree ) , optical adhesive covers for pcr 96 well rxn plates 0.2ml (compatible with biorad cfx 97 dx opm) , optical adhesive covers for pcr 96 well rxn plates 0.2ml (compatible with thermo fisher a28574 quant studiort pcr machine) , parafilm roll (size approx 2 inch width and 250 inch length) , pcr 96 well rxn plates 0.2ml (compatible with biorad cfx 97 dx opm) , pcr 96 well rxn plates 0.2ml (compatible with thermo fisher a28574 quant studiort pcr machine) , pcr strips 0.1 ml (strip of 4) (compatible with qiagen 5plex rotorgene rt pcr machine) , pcr strips 0.2 ml with attached cap (strip of 8) (compatible with thermo fisher a28574 quant studiort pcr machine) , pcr strips 0.2 ml with attached cap (strip of 8) (compatible with biorad cfx 97 dx opm) , rnase/ dnase away solution (for complete removal of rnase/ dnase contamination from work surfaces, pipettes and equipments(should be stable at room temperature)) , sterile pasteurppipettes 3ml , viral transport media with swabs (3ml vial with 2 regular swabs i.e. one nasal swab and one throat swab (1.viral transport medium (vtm) with swab with complete directions for collection, storage, transport and carrying. 2.sterile dacron, polyester or rayon sterile swabs with plastic shafts)) , aluminium foil (9 meters length) thickness 11 microns, width 30 cm , compertable with transasia xl 1000fully automated biochemistry analyser , erba ada kit (1x20 ml/1x10 ml) , erbaalbumin kit (10x44 ml) , erba alakaline phosphatase kit (2x44 ml /2x11 ml) , erba amylase kit (3x22 ml) , erba autowash kit (10x100 ml) , erba bilirubin total (btdca) kit (6x44 ml /3x22 ml) , erba bilirubin direct (btdca) kit (6x44 ml /3x22 ml) , erba calcium (arsenazo) kit (10x12 ml) , erba cholestrol kit (10x44 ml) , erba ck nac kit (2x44 ml /2x11 ml) , erba ck mb kit (2x44 ml /2x11 ml) , erba direct hdl cholestrol with calibrator kit (4x30ml/4x10ml) , erba direct ldl cholestrol with calibrator kit (2x30//2x10 ml) , erbacreatinine (enzymetic) kit (5x30 ml/5x10 ml) , erba gamma gt kit (5x44ml/5x11 ml ) , erba glucose kit (10x44 ml) , erba fe 125 kit (r1 4x25 ml/r2 2x12.5 ml/calibrator/2x2ml) , erba hba1c kit (r1.2x15 ml/r2 2x5 ml/5x0.5 ml) , erba ldh p kit (2x44 ml /2x11 ml) , erba lipase xl kit (1x44 ml/1x11 ml) , erba magnesium kit (2x44 ml) , erba mal kit (1x10/5x25 ml) , erba microprotein kit (10x12 ml) , erba phosphorus kit (10x12 ml) , erba total protein kit (10x44 ml) , erba sgot el kit (6x44/3x22 ml) , erba sgpt el kit (6x44/3x22 ml) , erba triglycerides kit (5x44 ml/5x11ml) , erba urea kit (5x44 ml/5x11ml) , erba uibc125 kit (r1 4x25ml, r2 2x12.5ml, calibrator 2x12.5ml ) , erba uric acid kit (5x44 ml/5x11ml) , xl turbi crp kit (2x22 ml/1x11 ml) , xl turbi rf kit (1x22/1x5.5 ml) , erba ada cail kit (1x1ml) , erba ada control kit (1x1ml) , erba hba1c con h kit (1x.0.5ml) , erbahba1c con l kit (1x.0.5ml) , erba xl multical kit (4x3 ml) , erba norm kit (1x5ml) , erbapath kit (1x5ml) , apo a1 kit , apo b kit , hs crp kit , lp(a) kit , xl auto wash ac/al kit (5x44 ml /5x44 ml) , sample cups kit , sample cup vol: 1.0 ml unique type kit , thermal paper roll (108 mm x 3 m)kit , ise module reagent pack na+/k+/cl./li+(4 channel pack) kit , ise cleaning solution kit , compertable with transasia semi auto analyzer erba chem 5x , glucose kit , urea kit , creatinine kit , total bilirubin kit , total protein kit , albumin kit , total cholesterol kit , sgpt/alt kit , sgot/ast kit , ldh kit , ck mb kit , trop i kit (qualitative) , alp kit , triglycerides tg kit , hdl kit , disposable plastic test tube , clot activater tube (plan tube) , fluoride tube , micropipette tip1000ul , micropipette tip100ul , micropippte((0.5 50 ul)) , micropippte (100 1000ml) , external quality control vial for routine biochemistry (erba chem 5x) , protein csf kit , lamp. (erba chem 5x) , calcium (50x1 ml) , uric acid , ada , ark diagnosis electrolyte analyzer , electrolyte analyzer reagent , electrolyte daily cleaner , electrolyte quality control 1,2,3 (1 box ( serum: l1 3, l2 4, l3 3,urin: l1 1, l2 1)) , pm kit , reference housing , electrode (na,k,cl) , compertable with elisa reader (tecan infinite f50 & hydroflex) , t3 , t4 , tsh , sterilizer item compertable with cisa 8 stu model no. 6412 , printer paper , door gasket , heating element , microbiological filter , print ink ribbon for washer , sterilizer item compertable withcisa 4 stu model no. 4212 , printer paper , door gasket , heating element , microbiological filter , print ink ribbon for washer , table topitem compertable with table top sterilizer 23 ltr , door gasket , microbiological filter , heating element , printer paper , washer kf 155item compertable with cisa washer 12 din , liquid alkaline detergent , liquid neutralising agent , lubrication spray , enzamatic detergent , cleaning indicator (level 1) , cleaning indicator (level 2) , cleaning indicator (level 3) , cleaning indicator (level 4) , print ink ribbon for washer , air filter (hepa) , heater element , gasket , ultrasonic washeritem compertable with cisa ultrasonic washer 30 ltr , cleaning agent for ultrasonic cleaner , heat sealeritem compertable with cisa heat sealer , print ink ribbon for heat sealer ( pack of 10 ) , consumables for operation for cssd equipmentitem compatible with cisa cssd machines , 3 line label steam , bowie dick strip , batch monitoring strip , chemical indicator class 4 , chemical indicator class 5 , biological indication steam , wrapping paper 40x40 cm , wrapping paper 50x50 cm , wrapping paper 60x60 cm , wrapping paper 75x75 cm , wrapping paper 90x90 cm , wrapping paper 100x100 cm , wrapping paper 120x120 cm , sterilization reel 50x200m , sterilization reel 75x200m , sterilization reel 100x200m , sterilization reel 120x200m , sterilization reel 150x200m , sterilization reel 200x200m , sterilization reel 250x200m , sterilization reel 300x300m , sterilization reel 350x200m , sterilization reel 400x200m , sterilization reel 500x200m , autoclave tape ( 18x50 meter ) , autoclave tape ( 24x50 meter ) , packing tape (18x50 meter) , packing tape (24x50 meter) , packing tape (36x50 meter) , packing tape (48x50 meter) , process indicator ( external labeling ) for every pack , sms paper non woven material(90 x90 mm) , sms paper non woven material (100 x100 mm) , sms paper non woven material (100 x120 mm) , sms paper non woven material (120 x 120 mm) , labelling ink role , ro plant consumables for cssd , anti scaling chemical , cip chemical , chemical for flushing , jumbo catridge filter , r.o. membrane 8040 , water softener consumables for cssd , resin , air compressor consumables for cssd , check valve kit , intake filter element , crankase filter element with felet , grease kit , piston ring set , filter , operational consumables for cssd compertable , apron heavy duty water proof , brushes for instrument cleaner , devices for cssd , pcd device for bms test , pcd device for bds test , gun for labeling , aqua zero vacuum pump (devices for cssd 8 stu) , aqua zero vacuum pump (devices for cssd 6 stu) , aqua zero vacuum pump (devices for cssd 4 stu)...

Directorate Of Health Services - Madhya Pradesh

35141987 supply of medicines and consumables the year 2022 23 1.01 5 fluorouracil ( 5 fu ) ( 250mg ) , injection 1.02 acenocoumarol / nicoumalone ( 2 mg ) , tablet [ 120003 ] 1.03 adrenochrome monosemicarbazone ( 0.75mg / ml ( ml amp ) ) , injection 1.04 aggs ( anti gas gangrene serum ) 10, 000 iu / ml 40000 iu / ml / 30000 ou / ml inj. 1.05 alpha beta arteether ( 150mg / 2ml ) , injection 1.06 alprazolam ( 0.5mg ) , tablet 1.07 amikacin ( 250mg / 2ml ) , injection 1.08 amino acid glass bottle contain amino acid 6 gm, nitrogen 0.929, essential amino acid 51%, non essential amino acid 49%, bcca 22.6%, carbohydrate 5% inj ( 6 gm ) , injection solution for 1.09 aminoacid 10% ( essential ) ivf ( 10 % ) , injection solution 1.1 aminoacid 5% ivf ( 100ml bottle ) , infusion 1.11 amiodarone tab ( 200mg ) , tablet 1.12 amlodipin ( 10mg ) , tablet ] 1.13 amoxicillin 250mg + clavulanic acid 50mg inj vial 1.14 amoxycillin dispersible tablets ip amoxicillin trihydrate ip equivalent to amoxicillin ( 250mg ) , tablet 1.15 amoxycilline and clavulanic acid inj 1.16 ampicillin ( 1 gm vial ) , injection 1.17 ampicillin inj ( 250 mg / vial ) , vial 1.18 antacid chewable tablet containing aluminum hydroxide equivalent to dried gel 250mg+ magnesium hydroxide 250mg+ simethicone 50mg usp 1.19 anti rabies immunoglobulin inj 300 iu per 2ml ( 2ml vial ) ( 300 iu per 2ml ) , injection solution for 1.2 artemether inj 80mg / ml ( 1 ml amp ) , injection 1.21 artesunate + sulphadoxine + pyrimethamine ip ( 100 mg ( 3tab ) + 750mg + 37.5mg ( 1tab ) ( age group between 5 to 8 years ) ) , combi blister pack 1.22 artesunate tablets 150mg ( 3tab ) + sulphadoxine ( 500mg+500mg ) pyrimethamine 25mg +25mg tab ip ( 2tab ) ( age group 9 to 14 years ) , combi blister pack 1.23 artesunate tablets 25mg ( 3tab ) + sulphadoxine 125mg pyrimethamine 6.25mg tablets ip ( 1tab ) ( age group of less than 1year ) , combi blister pack 1.24 artesunate + sulphadoxine + pyrimethamine ( 50 mg + 500 mg + 25 mg tablet ) , combi blister pack 1.25 aspirin low dose tab 150mg 1.26 atorvastatin ip ( 20 mg ) , tablet 1.27 azathioprine 50mg tab 1.28 azithromycin inj 100mg / 5ml 1.29 basal insulin glargine injection 300iu disposable pen 300iu with 4 needles per pen 31g needle ( ) , pen 1.3 basal insulin glargine penfill 300iu with free permanent pens one pen for each five cartridge and 10 needles per pen 1.31 beclomethasone inhalation i.p 200 mcg per dose ( 200 metered dose container ) , inhaler 1.32 benedicts solution ( qualitative ) , bottle 1.33 benzyl benzoate emulsion ( ) , emulsion 1.34 benzyl penicillin 10lac / vial ( penicillin g ) , injection 1.35 betahistine ( 16 mg ) , tablet 1.36 betamethasone valerate cream 0.05% ( 15gm tube ) , ointment 1.37 betamethasone valerate oint 0.1% ( 15 gm tube ) , ointment 1.38 betamethasone valerate oint / cream ip ( 0.12% ) , tube 1.39 bevacizumab100 mg ( 4 ml vial ) , injection 1.4 black disinfectant fluid ( phenyl ) as per schedule o grade iii 1.41 black disinfectant fluid ( phenyl ) strength : specification as per schedule o grade i 1.42 bortezomib ( 2mg ) , injection 1.43 bortezomib ( 3.5mg vial ) , injection 1.44 bromhexine hcl 4 mg+ guaiphensin 50 mg + terbutaline sulphate 1.25 mg / 5ml syp ( 100 ml bottle ) , syrup 1.45 budesonide nebulising suspension containing budesonide 0.25mg / ml ( 2ml amp ) , suspension 1.46 budesonide respules 0.25mg / 2ml inhalation ( 2ml amp / respule ) , inhaler 1.47 bupivacaine hydrochloride inj. 0.25mg ( 20 ml vial ) , injection solution for 1.48 bupivacaine hydrochloride inj. 0.5% 20ml vial ( not for spinal use ) ( ) , vial 1.49 bupivacaine hydrochloride ( not for spinal use ) ( 0.5% ) ( 4ml amp / vial ) , vial 1.5 calcium carbonate derived from oyester shell equivalent to elemental calcium 500mg and vitamin d3 250 iu ( ) , tablet 1.51 calcium chloride 0.1 ( 10 ml ) , injection 1.52 calcium citrate 1000mg ( elemental ca equivalent to 250 mg and vitamin d3 400 iu ) ( ) , tablet 1.53 calcium with vitamin d tablets calcium carbonate 650mg eq. to elemental calcium 250mg and cholecalciferol 125 iu 1.54 carbamazepine tab ( 400mg ) , tablet 1.55 carboplatin ( 150mg 15 ml vial ) , injection 1.56 carboprost trome thamine inj usp 0.25mg / ml vial ( ) , injection solution for 1.57 carboprost tromethamine injection i.p ( 15 methyl pgf2a ) inj 250mcg / 1ml ) , ampule 1.58 carboxymethylcellulose eye drop ip 1% w / v 10ml vial ( sodium cmc also accepted ) , eye drop 1.59 carvedilol ( 3.125 mg ) , tablet 1.6 carvedilol ( 6.25 mg ) , tablet 1.61 cefazolin ( 1gm ) , injection 1.62 cefazolin inj ( 500mg vial ) , injection 1.63 cefepime 1gm and tazobactam 125 mg inj ( vial ) , injection solution for 1.64 cefepime ( 500mg injection ) , injection 1.65 cefixime 50 mg dt tab ( ) , tablet 1.66 cefixime tab ip ( 100mg ) , tablet 1.67 cefoperazone 1000mg + sulbactam 1000mg inj ( vial ) , injection 1.68 cefoperazone 500mg + sulbactam 500mg ( vial ) , injection 1.69 ceftazidime ( 250mg / vial ) , injection 1.7 ceftriaxone+tazobactum ( 1gm+125mg, vial ) , injection 1.71 ceftriaxone+tazobactum 250mg+31.25mg ( vial ) , injection 1.72 ceftriaxone+tazobactum ( 500mg+62.5mg vial ) , injection 1.73 cephalexine ( 500mg ) , capsule 1.74 cetrimide + chlorhexidine ( conc. ) ( 15%+7.5% ) ( 1 liter bottle ) ( 15%+7.5% ) , liquid [ 1.75 cetrimide + choline salicylate gel for oral ulcer 15ml tube 1.76 cetrimide cream bp ( 0.1% w / w ) , tube 1.77 chloramphenicol ear drop 5% ( 5 ml vial ) , eye drop 1.78 chloramphenicol eye applicaps 1% ( 100 applicaps per bottle ) , eye drops / ointment 1.79 chloramphenicol ( 1% ( 5 ml vial ) ) , eye drop 1.8 chlorhexidine 0.2% mouth gargle ( 100 ml ) , solution 1.81 chlorhexidine gluconate solution [ 1.82 chlorhexidine gluconate solution 4% i.p. ( antiseptic ) ( 500 ml bottle ) , liquid 1.83 chlorine based compound ( sodium dicholoroiso cyanurate ) nadcc tablets 75 mg with available chloroine 45 mg bis ( 45 mg ) , tablet 1.84 chloroquine phosphate inj. 64.5mg / ml 30ml vial ( ) , injection solution for 1.85 chloroquine ( phosphate ) , syrup 1.86 chlorpheniramine maleate ( 4mg ) , tablet 1.87 chlorpromazine hydrochloride sugar coated tab ( 100 mg ) , tablet 1.88 chlorpromazine hydrochloride ( 25 mg ) , tablet 1.89 chlorpromazine hydrochloride ( 50 mg tab ) , tablet 1.9 chlorpromazine inj ip ( 25mg / ml ( 2ml amp ) ) , injection solution for 1.91 cholecalciferol concentrate ( powder form ) ph.eur. 60000iu / gm ( 60000iu / gm ) , powder 1.92 ciprofloxacin + dexamethosone ( 0.3%+0.1% ) ( 5ml ) , eye drop 1.93 ciprofloxacin + tinidazole ( 500mg+600mg ) , tablet 1.94 ciprofloxacin 0.3% ( 5ml vial ) , eye drop 1.95 ciprofloxacin inj 2 mg / ml inj 100ml glass bottle ( ) , injection solution for 1.96 ciprofloxacin inj 100 mg / 50ml ( 100ml ffs bfs bottle ) , injection solution for 1.97 cisplatin ( 10 mg vial ) , injection 1.98 cisplatin 50 mg inj ( 50 ml vial ) , injection solution for 1.99 clindamycin ( 150mg / ml ( 2 ml vial / amp ) ) , injection 2 clobetasol 0.05% + gentamicin 0.1% cream 10 gm ( 10 gm tube ) , cream 2.01 clomiphene citrate ( 25 mg tab ) , tablet 2.02 clonazepam ( 2mg ) , tablet 2.03 clopidogrel + aspirin ( 150mg ) , capsule 2.04 clopidogrel 75mg + aspirin 75mg tab ( 10x10 ) , tablet 2.05 clotrimazole 1%w / v +lignocaine 2%w / v ear drop 10ml vial bfs / ffs squeeze ( 10ml vial ) , vial 2.06 clotrimazole cream 1% ( 15 gm tube ) , cream 2.07 clotrimazole vaginal pessary tab 100mg 14 x 10 tab 2.08 clotrimazole vaginal tablet i.p. 100mg ( without applicator ) , tablet 2.09 cloxacillin sodium inj. ( 500mg ) , vial 2.1 compound benzoic acid ointment 2.11 compound tincture benzoin ip ( solution ) , bottle 2.12 cough syrup ( each 5ml contains ammonium chloride 138mg, diphenhydramine hcl 14.08mg, sodium citrate 57.03mg, menthol 2.5mg ) ( 5 ml ) , syrup 2.13 cyclophosphamide ( 1000mg vial ) , injectio 2.14 cyclophosphamide inj 500mg / vial ( each ) , injection solution for 2.15 cyclophosphamide inj ( 200 mg / vial ) , injection 2.16 dacarbazine ( 200 mg per vial ) , injection 2.17 deferasirox dispersible ( 100mg ) , tablet 2.18 deferasirox dispersible tab. 400mg 2.19 desferioxamine inj ( 0.5g / vial ) , injection solution 2.2 dextromethorphan syrup ( each 5ml contains 30 mg dextromethorphan ) ( ) , syrup 2.21 dextromethorphan syrup ( ) , syrup 2.22 dextrose 10% 500ml bfs bottle ( ) , injection solution 2.23 dextrose 10% ( ffs / bfs 500ml bottle ) , infusion 2.24 dextrose 25% inj ( 100ml ffs / bfs bottle ) , injection solution 2.25 dextrose 25% inj 500ml bfs bottle ( ) , injection solution for 2.26 dextrose 25% inj 500ml ffs / bfs bottle ( ) , injection solution 2.27 dextrose 5% 500ml bfs bottle ( ) , injection 2.28 dextrose 50% inj 100ml ffs / bfs bottle ( dextrose 50% inj 100ml ffs / bfs bottle ) , injection solution 2.29 dextrose 50% inj. bottle ( 500ml ffs / bfs ) , injection solution 2.3 dextrose with saline 5% + 0.9% inj 500ml bfs bottle 2.31 dextrose with saline 5% + 0.9% inj 500ml ffs / bfs bottle 2.32 diclofenac sodium 50mg + paracetamol ( 325mg ) , tablet 2.33 dicyclomine 10mg / ml ( 10ml with dropper ) , drop 2.34 digoxin 250mcg / ml ( 2ml amp ) , injection 2.35 dilitiazem tab 60mg 2.36 dispersible zinc tab ( 10mg ) , tablet 2.37 dobutamine ( 50 mg / 5 ml ) , injection 2.38 docetaxel 20mg inj 2.39 docetaxel 80mg inj 2.4 domperidone suspension ( 5mg / 5ml ) , suspension 2.41 doxorubicin inj 10mg ( 10mg ) , injection solution 2.42 doxycycline tab. 100mg ( ) , tablet 2.43 doxylamine succinate + pyridoxine ( 10mg+10mg ) , tablet 2.44 electrolyte e inj 500ml ffs / bfs bottle ( electrolyte e inj 500ml ffs / bfs bottle ) , injection solution 2.45 electrolyte g inj 500ml bfs bottle ( ) , injection solution 2.46 electrolyte m inj 500ml bfs bottle ( ) , injection solution for 2.47 electrolyte m inj ( 500ml ffs bottle ) , injection solution for 2.48 electrolyte m inj 500ml ffs / bfs bottle ( ) , injection solution 2.49 electrolyte p inj 500ml bfs bottle ( 500ml bfs bottle ) , injection solution 2.5 electrolyte p inj ( 500ml ffs bottle ) , injection solution 2.51 electrolyte p inj 500ml ffs / bfs bottle ( ) , injection solution 2.52 enalapril maleate tab ( 2.5mg ) , tablet 2.53 enalapril maleate tab ( 5mg ) , tablet 2.54 enoxaparin ( 60mg equivalant to 6000 iu vial / pfs ) , injection 2.55 enoxaparin ( 20mg / 0.2ml ) ( 0.2 ml prefilled syringe ) , injection 2.56 epinephrine hydrochloride inj. 1 mg / ml ( ) , injection solution for 2.57 epirubicin ( 10mg vial ) , injection 2.58 epirubicin ( 50mg vial ) , injection 2.59 equine anti rabies immunoglobulin, ( not less than 300iu / ml ) , injection 2.6 erythromycin stearate tab 250 mg 2.61 erythromycin stearate ( 500 mg ) , tablet 2.62 erythropoietin ( 4000 iu inj vial ) , injection 2.63 ethinyl estriadiol+norethisterone tab ( 35 mcg +1mg ) , tablet 2.64 etiophylline and theophylline ( paediatric ) , syrup 2.65 etiophylline theophylline sr tab. 300mg ( ) , tablet 2.66 etoposide ( 100mg vial ) , injection 2.67 filgrastim 300mcg inj 2.68 formaldehyde ( formalin ) ( 37% acq ) , bottle 2.69 formoterol + budesonide ( 6 mcg + 100 mcg / puff ( 120 mdi ) ) , inhaler 2.7 furazolidone ( 25mg / 5ml ( 60 ml bottle ) ) , suspension 2.71 gatifloxacin ( 0.3% ) , eye drop 2.72 gemcitabine ( 1000mg vial ) , injection 2.73 gemcitabine ( 200mg / vial ) , injection 2.74 gentian violet crys sol 1% 2.75 glibenclamide tab 2.5 mg 2.76 gluteraldehyde solution b.p. ( b.p. ) , solution 2.77 glycerine ip solution ( who gmp certification exempted for this item ) ( 100 ml ) , bottle 2.78 glyceryl trinitrate 5mg / ml inj 10ml vial ( nitroglycerine ) ( 5mg / ml ) , injection solution for 2.79 griseofulvin tab. ip 125 mg 2.8 haloperidol inj ( 50mg / ml ) , injection [ 2.81 haloperidol ( 10mg ) , tablet 2.82 heparin inj ( 5000iu / ml 5ml vial ) , injection 2.83 hepatitis b immunoglobulin im inj 200 iu / vial 2.84 human albumin 20% ( 50 ml vial ) 2.85 human albumin solution i.p. 20%w / v ( 100 ml vial ) ( ) , injection solution 2.86 human anti d. immunoglobulin ( polyclonal ) bp / ep / usp / ip ( 300mcg / vial ( vial / pfs ) ) , injection 2.87 human chorionic gonadotropin inj ( 5000 iu 1ml ) , ampule 2.88 hydroethylstarch 6% solution with sodium chloride 0.9% iv infusion ( hydroxy ethylstarch solution ffs / bfs ) ( 0.9% iv ) , bottle 2.89 hydroxyprogesterone caproate inj i.p. 250mg / ml 2.9 hyoscine butylbromide ( 10mg ) , tablet 2.91 ibuprofen 400mg+ paracetamol 325mg tablet ( ) , tablet 2.92 ifosphamide 1gm lyophilised each vial + 3amp of mesna 100mg / 2ml inj ( 100mg / 2ml inj ) , injection solution for 2.93 insulin aspart in disposable pen 300iu with minimum 4 needles per pen 31g needle 2.94 insulin aspart penfill 300 iu with free permanent pen ( one pen per five cartridges and ten needles per pen ) 2.95 insulin human mixtard inj. 30:70 ( ) , injection solution for 2.96 insulin lispro in disposable pen 300iu with minimum 4 needles per pen 31g needle 300iu ( prefilled syringe ) , pens 2.97 ipratropium bromide + levosalbutamol ( 20mcg+50mcg, 200 mdi ) , inhaler 2.98 ipratropium bromide powder for inhalation 250mcg / ml [ 4330004 ] 2.99 irinotecan ( 40mg / vial ) , injection 3 iron and folic acid enteric coated tab dried ferrous sulphate ip eq. to 45 mg elemental iron and 400 mcg folic acid ip ( pink color ) wifs junior ( iron and folic acid enteric coated tab dried ferrous sulphate ip eq. to 45 mg elemental iron and 400 mcg folic acid ip ( pink color ) wifs junior ) , tablet 3.01 iron and folic acid entric coated tab dessicated ip 67mg equivalent to 20mg of elmental iron 3.02 iron and folic acid entric coated tab. ferrous suplhate ip 333.335mg equivalent to 100mg of elemental ( red tablet ) , tablet 3.03 isoflurane solution ( liquid for inhalation ) 100ml ( amber color bottle ) , bottle 3.04 isosorbide mononitrate ( 20mg ) , tablet 3.05 isoxsuprine hydrochloride inj. 5mg / ml ( 2 ml amp ) ( 2 ml ) , injection solution for 3.06 ivermectin usp ( 6mg ) , tablet 3.07 ketoconazole ointment 2% 15gm tube ( 15 gm ) , ointment 3.08 ketoconazole tab 3.09 lactobacillus ( ( lactobacillus 60 million spores ) ) , tablet [ 3.1 lactulose solution ( 3.35gm / 5 ml ) , solution 3.11 l asparaginase 5000 iu lyophilized ( vial ) , injection 3.12 levocetirizine tab 5mg ( ) , tablet 3.13 levodopa +carbidopa tab 250mg + 25m 3.14 levofloxacin 500mg inj 100ml ffs / bfs bottle ( ) , injection solution 3.15 levonorgestrel emergency contraceptive ( 0.75mg ) , tablet 3.16 lidocaine 2% inj. 30 ml vial ( 30 ml ) , injection solution 3.17 lignocaine hydrochloride ( 4% ( 5 ml vial ) ) , eye drops / ointment 3.18 lignocaine hydrochloride topical solution usp ( 2% ) , vial 3.19 linezolid 200mg / 100ml ( 100ml ffs bottle ) , injection 3.2 liquid paraffin ( 500 ml, bottle ) , solution 3.21 lmwh low molecular weight heparin inj 4000iu / ml. ( ) , injection solution for 3.22 lmwh low molecular weight heparin inj. 6000_x000d_iu / ml ( ) , injection solution for 3.23 lorazepam ( 2 mg ) , tablet 3.24 losartan ( 50 mg ) , tablet 3.25 lysol ( 5ltr jar ) , solution 3.26 magnesium hydroxide and aluminium hydroxide simethecon ( 500mg + 250 mg ) , tablet 3.27 magnesium suplhate ( 50 % w / v ( 2ml amp ) ) , injection 3.28 magnesium suplhate injection i.p.50 % w / v ( 1 ml amp ) ( 1 ml amp ) , ampule 3.29 mannitol inj, 10% 100 ml bottle ( ) , injection solution 3.3 mannitol inj, 20% 350ml bfs / ffs bottle ( ) , injection solution 3.31 mannitol inj. 10% 350ml bottle ( ) , injection solution for 3.32 mannitol injection i.p. 20% 100ml bottle ( ) , injection solution 3.33 mebendazole ( 100 mg tab ) , tablet 3.34 mefloquine tab ( 250mg ) , tablet 3.35 menadione usp ( vitamin k3 ) ( 10 mg / ml ( 1 ml amp ) ) , injection 3.36 mephentermine inj 15mg / ml 10ml vial 3.37 methotrexate ( 10 mg ) , tablet 3.38 methotrexate 2.5 mg tab 3.39 methotrexate inj 15mg / ml ( vial ) 3.4 methotrexate inj 500mg vial 3.41 methotrexate inj ( 2ml ) ( 50mg ) , injection solution for 3.42 methyl prednisolone sodium succinate inj. usp 125mg ( 10ml ) , vail 3.43 methyl prednisolone sodium succinate inj.usp ( 40mg / ml vial ) , injection 3.44 methyl prednisolone sodium succinate inj. usp 500mg 3.45 methyl prednisolone sodium succinate tablet 8 mg 3.46 metoprolol inj 1 mg / ml ( 5ml vial ) , injection 3.47 metronidazole benzoate oral suspension ( 100mg of base / 5 ml ( 60ml bottle ) ) , suspension 3.48 metronidazole 500mg ( 100 ml ffs bfs bottle ) , injection 3.49 metronidazole tab ( 200 mg ) , tablet 3.5 micronised progestron inj. 200mg / m 3.51 milk of magnesia 11.25 ml, liquid paraffin 3.75ml phenolphthalein 50mg / 15ml ( cremaffin pink formula ) 170ml syr 3.52 milk of magnesia 11.25ml+liquid paraffin 1.25ml / 5ml 170ml bottle 3.53 morphine sulphate inj. ip 15mg / ml ( 15mg / ml ) , injection solution 3.54 moxifloxacine eye drop 0.5%w / v 3.55 multivitamin drops ( approx 22 drops ) ( ) , drop 3.56 multivitamin sugar coated tab. ( nfi formula ) , tablet 3.57 n acetyl cysteine inj ( 200mg / ml in 1ml amp ) , injection 3.58 nitrofruantoin tablet ip 100m 3.59 noraderanaline inj. ( 2 mg base / 2 ml amp ) , injection solution 3.6 norethisterone ( 5mg ) , tablet 3.61 ofloxacin + ornidazole ( 200mg and 500mg ) , tablet 3.62 ofloxacin 0.3% w / v of ofloxacin ph.eur. ( 5 ml vial ) , eye drop [ 110332 ] 3.63 ofloxacin suspension [ 4670003 ] 3.64 ofloxacin suspension 50mg / 5 ml ( 30 ml bottle ) , suspension [ 120224 ] 3.65 olanzapine 20mg tab [ 4710506 ] 3.66 olopotadine antiallergic ( 0.1% w / v ( 5 ml vial ) ) , eye drop [ 110337 ] 3.67 omeprazole 40mg ( vial ) , injection [ 120231 ] 3.68 omeprazole ( 20mg ) , capsule [ 120230 ] 3.69 ondansetron 8mg inj [ 4340019 ] 3.7 ors packet who formula sodium chloride 2.5g, potessium chloride 1.5g, sodium citrete 2.09g dextrose 13.6g, 20.5gm pouch ( ) , powder [ 4550004 ] 3.71 oxaliplatin ( 50mg inj 25 ml vial ) , injection [ 120239 ] 3.72 oxytocin ( 5 iu / ml ( 2ml amp ) ) , injection [ 4350048 ] 3.73 paclitaxel 260mg inj 43.4ml vial [ 4340016 ] 3.74 paclitaxel 300mg inj [ 4350372 ] 3.75 paclitaxel 30mg inj ( 30mg ) , injection solution for [ 4350305 ] 3.76 paclitaxel inj ( 100mg ) , injection 3.77 pantoprazole tab ( 40 mg ) , tablet 3.78 paraffin liquid ( liquid paraffin 1.25ml + milk of magnesia 3.75ml + sodium picosulphate 3.33mg ) , syrup 3.79 pentaprazole inj. 40mg 10ml vial ( ) , injection solution for [ 4350418 ] 3.8 pantaprazole ( 40mg tab ) , tablet 3.81 phenytoin sodium inj. ( 100 mg ) , vial 3.82 phenytoin sodium oral suspension 25 mg / ml ( 100 ml bottle suspension ( loan licencing will be accepted for this item. ) ) , suspension 3.83 pilocarpine eye drops ( 4% ) , eye drop 3.84 pilocarpine hydrochloride eye drops bp 2% 3.85 pioglitazone ( 30 mg ) , tablet 3.86 piroxicam ( 20mg ) , tablet or capsule 3.87 pneumococcal ( polysaccharide ) vaccine 23 valent / 0.5ml inj 3.88 potassium chloride inj. ( 150 mg / 10ml ) , injection solution for 3.89 potassium chloride inj. 150mg / ml 3.9 povidone iodine ointment 5% 250gm jar ( ) , each 3.91 povidone iodine surgical scrub solution. 7.5% ( 500 ml bottle ) , solution 3.92 pralidoxime chloride injection i.p. 1gm ( 20 ml ) , injection 3.93 prazosin tab ( 5 mg ) , tablet 3.94 prednisolone ( 10 mg ( dt also acceptable ) ) , tablet 3.95 prednisolone ( 10 mg / ml ) , eye drop 3.96 premixed insulin biphasic analogue 25 / 75 in penfill 300iu permanent pen one pen per five cartidges and ten needles per pen 3.97 premixed insulin biphasic analogue 30 / 70 in penfill 300iu permanent pens one pen per five cartridges and ten needles per pen 3.98 promethazine inj 25 mg / ml ( 10 ml vail ) ( 10 ml vail ) , injection solution 3.99 promethazine tab ( 25 mg ) , tablet 4 propofol sodium 1%w / v ( 10mg / ml ( 20ml vial ) ) , injection 4.01 propranolol tab ( 40 mg ) , tablet [ 4.02 protamine sulphate inj 10mg / ml 4.03 quinine sulphate 150mg / 5ml syrup 60 ml 4.04 quinine sulphate inj. ( 300mg / ml ) , injection solution for 4.05 rabies vaccine inj ( vero cell culture ) inj. intra dermal ( ) , vial 4.06 rabies vaccine ip human ( ( cell culture ) ) , injection solution 4.07 rabies vaccine ip human cell culture 2.5 iu / dose ( intra muscular use ) , vial 4.08 rabies vaccine ip human ( purified chick embryo cell culture ) ( ) , vaccine 4.09 rabies vaccine ip inj human ( chick embryo / vero cell culture ) intra muscular ( ) , injection solution 4.1 ramipril ( 5 mg ) , tablet 4.11 rectified spirit ( 90% ) solution 4.12 ringer lactate inj iv 500ml bfs bottle ( ) , injection solution 4.13 ringer lactate inj iv 500ml ffs / bfs bottle ( ) , injection solution f 4.14 rituximab ( 100mg ) , injection [ 120268 ] 4.15 salbutamol nebuliser solution bp sabutamol sulphate eq. to salbutamol 1mg per ml ( 2.5 ml amp ) , ampule 4.16 snake venom anti serum ip liquid form ( ) , injection 4.17 snake venom anti serum inj. ( ) , injection solution for 4.18 sodium chloride 0.9% injection ip 100ml bottle ( ) , injection powder for 4.19 sodium chloride 1 / 2 normal, hyper tonic and dextrose 5% inj 4.2 sodium chloride inj iv 0.9% 500ml ( glass bottle ) ( ) , injection solution 4.21 sodium chloride inj iv 500ml bfs bottle ( ) , injection solution 4.22 sodium chloride inj iv 500ml bottle ( ) , injection solution 4.23 sodium chloride n / 2 injection ip 500ml bfs bottle ( ) , bottle 4.24 sodium chloride n / 2 injection ip 500ml ffs / bfs bottle ( ) , injection solution 4.25 sodium hypochlorite 5% solution ( 5 ltr ) , solution 4.26 sodium valproate enteric coated tab. bp ( 200 mg ) , table 4.27 sodium valproate ( 200mg ) , tablet 4.28 soluble insulin 30% isophane insulin 70% 100 iu inj 4.29 spironolactone tab 100mg ( 10x10 ) , tablet 4.3 streptokinase inj ( ) , injection solution 4.31 streptomycin inj ( 0.75g ) , injection solution for 4.32 succinyl choline inj. 50mg / ml 1ml amp 4.33 sulfacetamide eye drops ( 20% ) , eye drops / ointment 4.34 sulfamethoxazole and trimethoprim ( 100 mg and 20mg ) , tablet 4.35 sulfamethoxazole 200mg and trimethoprim 40mg per 5ml suspension ( 50ml bottle ) , suspensio 4.36 sulphadoxine 500mg and pyrimethamine 25mg tab. 4.37 surfactant suspension ( for intratrcaheal ) natural surfactant inj ( 25 mg / ml ) , injection solution for 4.38 surfactant suspension ( intratrcaheal ) bovine 4ml amp natural inj ( ) , ampoule 4.39 surgical spirit bp 500 ml ( ) , bottle 4.4 syrup 100ml bottle. ( 5ml 100mg elemental fe iron & folic acid syrup ( as per the standards provided ) ( ) , syrup 4.41 tamoxifen ( 20mg ) , tablet 4.42 telmisatran ( 20 mg ) , tablet 4.43 temozolomide ( 100mg ) , capsule 4.44 temozolomide 20mg cap 4.45 temozolomide 250mg cap 4.46 terbutaline suplhate inj 4.47 terbutaline suplhate tab ( 2.5mg ) , tablet 4.48 tetanous vaccine adsorbed ip 5ml ( tetanus toxide inj ) 4.49 tetanus immunoglobulin usp / ip ( 500 iu / vial ) , vial 4.5 tetanus toxide inj 5ml ( ) , injection solution for 4.51 tetanus toxiod ( inj. ) , injection 4.52 tetracycline eye oint 1% 4.53 thyroxine sodium tab 100 mcg ( 100 tab bottle ) ( 100 tab ) , tablet 4.54 thyroxine sodium tab ( 50mcg ( 100 tab bottle ) ) , tablet 4.55 tinidazole ( 500mg ) , tablet 4.56 tobramycin ( 0.3% 5ml ) , eye drop 4.57 torsemide ( 10mg ) , tablet [ 4.58 torasemide tab ( 20mg ) , tablet 4.59 tpn ( total parenteral nutrition ) including carbohydrate + proteins + fats solution ( brand: oliclinomel n7 2000 ml ) 4.6 tramadol ( 100mg / ml ( 2 ml amp ) ) , injection 4.61 tramadol cap ip ( 50mg ) , capsule 4.62 tramadol ( 100mg ) , tablet 4.63 tranexamic acid inj. 125mg / ml amp 4.64 trastuzumab ( 440mg vial ) , injection 4.65 triamcinolone acetate 40mg / ml ( 1ml amp ) , injection 4.66 urograffin 76% solution for injection 20ml vial ( 20ml ) , injection solution for 4.67 urograffin 76% solution for injection 50ml vial bottle 4.68 urokinase ( 5 lac iu / vial inj ) , injection powder for 4.69 valethamate bromide 8mg / ml ( 1ml ) , injection 4.7 vancomycin hydrochloride ( 250mg vial ) , injection 4.71 verapamil sugar coated tab ip ( 40mg ) , tablet 4.72 vildagliptin tab ( 50 mg ) , tablet 4.73 vinblastine 10mg inj. 4.74 vincristine inj 1mg / ml 4.75 vitamin a cap usp soft gelatin capsule ( 1 lakh iu ) , capsule ] 4.76 vitamin a cap usp soft gelatin capsule ( 2 lakh iu ) , capsule 4.77 vitamin b1 10mg, b2 10mg, b6 3mg, b12 15mcg, niacinamide 100mg, calcium panthenol 50mg, folic acid 1.5mg, vitamin c 150mg, biotin 100mcg or more tab ( ) , tablet 4.78 vitamin k inj ( phytonadione inj ) 1mg / 0.5ml ( ) , injection solution for 4.79 vitamin k inj. 10 mg / ml ( 10 mg / ml ) , injection solution for 4.8 vitamin. b complex ( nfi ( prophylactic ) ) , tablet 4.81 vitamin b12 inj 500 mcg / ml ( 30 ml amp / vial ) , injection 4.82 voglibose dispersible 0.3mg tab 4.83 water for injection inj 10 ml amp 4.84 zinc sulphate syrup 20mg / 5ml ( 50 ml bottle ) , syrup ] 4.85 bcg diluent ( normal saline ) 1ml 4.86 bcg with vvm 10 doses 4.87 measles diluent ( sterile water ) 4.88 ad syringe ( 0.1 ml ) , vaccine 4.89 ad syringe ( 0.5 ml ) , vaccine 4.9 disposable syringe ( 5 ml ) , syrings 4.91 tt with vvm 10 doses [ 3790004 ] 4.92 absorbable gelatine sponge ( ip 80mm x 50mm x 10mm ) , consumable 4.93 absorbent cotton wool ip 500 grms ( each ) roll ( iso:13485:2016 ) , consumable 4.94 adhesive plasters usp 7.5 cm x 10 mts / roll 4.95 adhesive plasters usp ( 7.5 cm x 5 mts / roll ) , consumable 4.96 ascorbic acid ( vitamin c ) tab i.p. ( 500mg ) , tablet 4.97 b.b silk with 1 / 2 cir rb needle ( size:3 / 0 20 mm length 75 cm ) , consumable 4.98 b.b silk ( 12 foils / pkt ) ( 3 / 8 rcut needle 45 mm length 76 cm, size 2 / 0 ) ) , consumable 4.99 b.b. silk 6 reels x 25 mts ( size:3 / 0 length 25 mts ) , consumable 5 benzyl benzoate application i.p 25%w / w ( 100ml bottle ) , radiology 5.01 blood administrations set 5.02 ceftazidime injection i.p. ( 0.5gm / vial ) , injection 5.03 cholesterol kit end point enzymatic kit 50 test / kit 5.04 coated polyster braided with cd white d ( needle 25 mm ( curved reverse cutting or curved round body or taper cut ) size:2 / 0 ) , consumable 5.05 coated polyster with cd green needle 17 mm ( curved reverse cutting or curved round body or taper cut ) size:2 / 0 length 90cm 5.06 cpk mb kit ( kinetic ) ( 25 test / kit ) , consumable 5.07 disposable dust mask jl246c equivalent to n 95 mask 5.08 disposable examination gloves made of natural rubber latex, pre powdered, non streile, conforming to is 15354:2003 and amendment thereof. size: large 5.09 disposable needles ( is 10654:2002 22g ) , surgical material 5.1 disposable needles ( is 10654:2002 24g ) , surgical material 5.11 disposable needles ( is 10654:2002 26g x 1 / 2 ) , surgical material 5.12 disposable syringes is 10258:2002 ( with needle is 10654:2002 cgs 10cc ( in ribbon pack ) ) , surgical material 5.13 disposable syringes is 10258:2002 with needle is 10654:2002 ( cgs 2cc ( in ribbon pack ) ) , surgical material 5.14 disposable syringes is 10258 2002 with needle is 10654 2002 ( cgs 5cc in ribbon pack ) , surgical material 5.15 field stain a ( 500ml ) , digonstic 5.16 field stain b ( 500ml ) , consumable 5.17 fixer: it shall be powder fixer to produce clean radiographs available in pack size size: 13.5 ltr 5.18 fixer: it shall be powder fixer to produce clean radiographs available in pack size size: 9 ltr 5.19 foleys urinary catheter ( 3 way size 12 ) , surgical material 5.2 g6pd deficiency ( test kit 10 test ) , consumable 5.21 glass slide 75mm x 25mm 1.1 mm 5.22 hbs antigeng kit card ( pack of 10 card test with 10 dropper, 1 buffer solution, 10 pricking lancet and 10 alcohol swab ) , digonstic 5.23 hemoglobin color scale ( starter kit ) components ( 1 ) color scale 01 / kit ( 2 ) test strip 1000 / kit ( 3 ) printed literature for method of use / kit ( 4 ) lancet 1000 / kit [ 6120003 ] 5.24 infant feeding tube ( ( catheter ) size: 5g ) , consumable [ 6760003 ] 5.25 infant mucus extractor sterile pvc ( each ) , surgical material [ 6550018 ] 5.26 intravenous set with airway and needle ( ( adult ) ) , surgical material [ 6450089 ] 5.27 intravenous set with airway and needle ( children ) , surgical material [ 645090 ] 5.28 iv cannula ( two way ) ( size 20 ) , surgical material 5.29 iv cannula ( two way ) ( size 22 ) , surgical material 5.3 iv cannula size 24g with inj.valve ( port ) , surgical material 5.31 k wire length 375mm ( size:1.6mm roll ) , surgical material [ mis70 ] 5.32 k wire size:1mm 5.33 malaria antigen, p vivax, p falciparum rapid diagnostics bivalentt test card ( as per gio nvbdcp specification ) pack of 10 card test with 10 dropper, 1 buffer solution, 10 pricking lancet, and 10 alcohol swab [ 6120089 ] 5.34 micro volume ( drip set ) , digonstic 5.35 poly propylene mono filament sterile precut with 1 / 2 cir rb heavy needle 30mm length 70 cm non absorbable ( surgical sutures usp size 1 ) , digonstic [ 6450117 ] 5.36 poly propylene mono filament sterile precut with 1 / 2 cir rb ( needle 30 mm length 70 cm non absorbable surgical sutures usp size 1 / 0 ) , surgical material 5.37 poly propylene mono filament sterile precut with 1 / 2 cir rb needle 30 mm length 70 cm non absorbable surgical sutures usp size 2 / 0 ( 12 foils / pkt ) , surgical material 5.38 powder developer suitable for processing medical xray films. one developer box shall contain part a and part b which are mixed at the time of preparation of solution of specific capacity size: 13.5 ltr 5.39 pregnancy detection kit ce marked / isi marked 5.4 pregnancy detection kit ce marked / isi marked 30 test / kit ] 5.41 pyrethrum extract 2% ( 25 litre drum ) ( as per specification attached in tender ) , chemical 5.42 reuse prevention syringe sterile single use reuse prevention syringewith detachable needles complaint to iso 7886:4 type i and type b, flow wrap / blister package using medical grade breathable paper, eto sterilized, non latex stopper ( 2ml ) , surgical material 5.43 reuse prevention syringe sterile with detachable needles complaint to iso 7886:4 type i and type b, flow wrap / blister package using medical grade breathable paper, eto sterilized, non latex stopper ( preferred material thermoplastic elastomer ) ( 5ml ) , surgical material 5.44 disposable spinal ( l.p. ) needle ( 25g ) , surgical material 5.45 stainless steel wire 28g 5.46 stainless steel wire 30g 5.47 surgical blade, size 11 5.48 synthetic absorbable suture 1 with 1 / 2 circle taper cut needle ( h ) size :1 40mm length 90cm polyglycolic acid ( pga ) ( 12 foils per pkt ) ( 12 foils per pkt ) , surgical material 5.49 synthetic absorbable suture 2 / 0 with 1 / 2 cir rb needle size:2 / 0 40mm length 90cm polyglycolic acid ( pga ) [ 6450024 ] synthetic absorbable suture 3 / 0 with 1 / 2 cir rb needle size:3 / 0 20mm length 70cm polyglycolic acid ( pga ) [ 6450017 ] 5.51 synthetic absorbable suture 3 / 0 with 1 / 2 cir rb needle size:3 / 0, 40mm length 90cm polyglycolic acid ( pga ) 5.52 synthetic absorbable suture 4 / 0 with 3 / 8 cir cutting needle size:4 / 0 16mm length 45 cm polyglycolic acid ( pga ) 5.53 three layer surgical mask 5.54 urinary drainage bag 2 litre cap with non return valve ( eo sterile ) 5.55 wbc diluting fluid ( 500 ml bottle ) , consumable [ mis144 ] 5.56 x ray film 10 x 12 50 sheets / pack 5.57 x ray film 12 x 12 50 sheets / pack 5.58 x ray film 14 x 14 50 sheets / pack 5.59 x ray film 14 x 17 50 sheets / pack x ray film 6.5 x 8.5 50 sheets / pack 5.61 x ray film 8 x 10 50 sheets / pack 5.62 ceftazidime inj ( 500mg / vial ) , injection 5.63 disposable sterile gloves isi marked surgical rubber hypoallergenic latex 100% powder free 7 1 / 2 inc 5.64 disposable sterile gloves bis specification gloves, surgical rubber, made of hypoallergic latex 100%, electronically tested sterilized by gamma irradiatio eto is no:13422:1992 as amended upto , 7inch / pair ( pair ) , consumable 5.65 ventilator adult model new port e 360 [ 360 ] 5.66 k wire length 375mm ( size:1.8mm roll ) , surgical material [ mis71 ] 5.67 poly propylene mono filament sterile precut with 1 / 2 cir rb needle 25 mm length 70 cm non absorbable surgical sutures usp size 3 / 0 5.68 poly propylene mono filament sterile precut with 1 / 2 cir rb ( needle 40 mm length 70 cm non absorbable surgical sutures usp size 1 / 0 ) , surgical material 5.69 powder developer suitable for processing medical xray films. one developer box shall contain part a and part b which are mixed at the time of preparation of solution of specific capacity size: 9.0 ltr [ 6521029 ] 5.7 tetanus toxoid ( adsorbed ) ip ( 5ml vial ) , injection 5.71 disposable sterile gloves isi marked surgical rubber made of hypoallergenic latex 100% powder free 7 inches 5.72 x ray film 12 x 15 50 sheets / pack 5.73 foldable iol sterile lens + 18d ( usfda approved, as per specification ) ( each ) , consumable 5.74 foleys urinary catheter 3 way size 18 5.75 foleys urinary catheter 3 way size 20 5.76 foldable iol sterile lens + 18.5 d ( usfda approved, as per specification ) ( each ) , consumable 5.77 disposable examination gloves made of natural rubber latex, pre powdered, non streile medium 5.78 disposable examination gloves made of natural rubber latex, pre powdered, non streile small 5.79 synthetic absorbable suture 4 / 0 with 1 / 2 cir rb needle size:4 / 0 20mm length 70cm poly glycolic acid ( pga ) 5.8 reuse prevention syringe sterile with detachable needles complaint to iso ( 7886:4 typei and typeb 3ml ) , consumable 5.81 foldable iol sterile lens + 19d ( usfda approved, as per specification ) ( each ) , consumable 5.82 foldable iol sterile lens + 19.5d ( usfda approved, as per specification ) ( each ) , consumable 5.83 foldable iol sterile lens + 20d ( usfda approved, as per specification ) ( each ) , consumable 5.84 foldable iol sterile lens + 20.5d ( usfda approved, as per specification ) ( each ) , consumable 5.85 foldable iol sterile lens + 21d ( usfda approved, as per specification ) ( each ) , consumable 5.86 foldable iol sterile lens + 21.5d ( usfda approved, as per specification ) ( each ) , consumable 5.87 foldable iol sterile lens + 22d ( usfda approved, as per specification ) ( each ) , consumable 5.88 foldable iol sterile lens + 22.5d ( usfda approved, as per specification ) ( each ) , consumable 5.89 micro pipet 1000 fix and variable each 5.9 baby oxygen mask set of all sizes 5.91 catgut chromic size:2 / 0 length 150 cm 5.92 disposable syringes is 10258:2002 with ( needle is 10654:2002 20ml ) , consumable 5.93 endotracheal tube internal dia 5.5mm to 9.5mm 5.94 foleys urinary catheter silkolatex 2 way sterile, non toxic size 10 5.95 hub cutter non electric lockable safety portable box for disposal of hypodemic needles. cuts the needle from the hub of machine 5.96 sgot kit ( kinetic ) 5x20ml 200 test / kit 5.97 aciclovir 3% ( 5gm tube ) , ointment 5.98 acyclovir suspension 400mg / 5ml ( 100 ml bottle ) , suspension 5.99 aciclovir tab 400 mg ( 400 mg dt tablet also acceptable ) , tablet 6 amino infusions ( 200ml bottle ) , infusion 6.01 amitriptyline tab. ip ( 25 mg ) , tablet 6.02 ampicilline + cloxacilline injection ( 250 mg + 250 mg ) vial injection 5ml vial ( ) , injection 6.03 anti rabies immunoglobulin ( inj.150 iu per 2 ml vial ) , injection 6.04 ascorbic acid ( vitamin c ) tab. 500 mg. 6.05 atracurium besylate ( 10mg / ml inj amp ) , injection 6.06 botropase injection ( ( haemocoagulase 1cu ) 1ml ) , injection 6.07 oseltamivir h1 n1 antiviral cap 75 mg 6.08 clonidine injection, 10ml vial ( 1mg ) ( 10ml vial ) , injection 6.09 cyclophosphamide 50 mg tab 6.1 diphenhydramine syrup 12.5mg / ml 6.11 disposable cap 6.12 disposable ( needles 23g ) , consumable 6.13 disposable pricking lancet ( pkt of 200 units ) ( packet ) , consumable 6.14 enalapril maleate inj. ( 1.25 mg per ml ) , injection 6.15 ethamsylate inj ( 250mg ( 2ml amp ) ) , injection 6.16 ethamsylate tab ( 500mg ) , tablet 6.17 fluconazole iv ( 2mg / ml ( 100ml bottle ) ) , infusion 6.18 foleys urinary catheter size 16 2 way 6.19 foleys catheter size 18 2 way 6.2 glucose kit ( god / pod ) ( 350ml, digonstic ) , consumable [ mis60 ] 6.21 hcv kit card test ( 25 test / kit ) , digonstic 6.22 hydrocortisone sodium succinate inj. 200mg vial ( ) , injection 6.23 iv cannula size with inj.valve ( port ) ( 18g ) , consumable 6.24 ketamine hydrochloride inj. 50mg / ml ( 2 ml amp ) 6.25 meropenem inj 125mg / vial ( each ) , injection [ 6.26 inj.iv dns ( ) , injection 6.27 multivitamine 200ml syrup ( 200ml ) , syrup 6.28 n acetyl cysteine inj 200mg / ml in 10ml amp 6.29 nimesulide ( 100 mg ( dispersiable tablet also accepted ) ) , tablet 6.3 norfloxacine 400mg and tinidazole 600mg ( tab ) , tablet 6.31 oxygen inhelation mddial oxygen steel aluminium cylinder 10 ltr ( ) , consumable 6.32 oxygen nasal cannula ( neonatal ) , consumable 6.33 paracetamol drop ( 100 mg / ml ) , drop 6.34 paracetamol drop 10mg / ml 6.35 phenobarbitone syp 200mg / 5ml ( ) , syrup 6.36 povidone iodine cream 250 gm 6.37 salbutamol ( 2mg / 5ml ( 100ml bottle ) ) , syrup 6.38 salicylic acid ointment ( 6% ) , ointment 6.39 salt testing kit ( as per attached specification , kit ) , consumable 6.4 mesalamine ( 5 aminosalicylic acid 400 mg ) tab 6.41 thiopentone injection 1gm 6.42 tobramycin + dexamethasone ( 0.3%w / v + 0.1%w / v ( 5ml vial ) ) , eye drop 6.43 torasemide inj 100mg ( 2ml vial / amp ) , injection 6.44 umblical cotton tape length 75cm. 6.45 verapamil 80mg ( tablet ) , tablet 6.46 foldable iol sterile lens +18d ( each ) , lens 6.47 microsurgery speciality gloves ( size 6.5 ) , lens 6.48 alchohol repellent and anti static sms fabric csection drape with 16in x 14in adhesive full incise, 270 degrees pe film fluid collection pouch with malleable band and suction port and sms arm board covers and tube holders 120in x 100in 50gsm 6.49 alchohol repellent and anti static sms fabric drape with absorbent material. fluid collection pouch with malleable band and suction port, having filter screen for sample collection and graduated markings on pouch 40 in x 44 in 50gsm 6.5 silver impregnated peripherally inserted central catheter 4 fr with integrated hub 6.51 non foldable iol sterile lens pc + 18.5 ( each ) , lens 6.52 non foldable iol sterile lens pc + 19 ( each ) , lens 6.53 non foldable iol sterile lens ( pc + 20.5 ) , lens 6.54 non foldable iol sterile lens pc + 20 6.55 non foldable iol sterile lens pc + 21.5 6.56 non foldable iol sterile lens pc + 21 ( each ) , lens 6.57 non foldable iol sterile lens pc + 22 ( each ) , lens 6.58 non foldable iol sterile lens pc + 23 6.59 non foldable iol sterile lens pc + 24 6.6 non foldable iol sterile lens ac + 20 6.61 non foldable iol sterile lens ac + 18 6.62 gefitinib tab 250mg 6.63 pancreatin 170 mg+oxbile extract 50 mg+ginger oleoresin 2 mg+activated charcoal 50 mg ( tab ) , tablet 6.64 paclitaxel 260mg inj ( 260mg ) , injection 6.65 filgrastim 300 mcg ( prefilled syrings ) , vial 6.66 dacarbazine inj. ( dtic ) ( 500 mg vial ) , injection 6.67 5 fluorouracil ( 5 fu ) ( 500mg inj ) , injection 6.68 paclitaxel protein bound particles inj 6.69 tamsulosin 4mg tab 6.7 nilotinib ( 200mg ) , tablet or capsule 6.71 nilotinib ( 150mg ) , tablet or capsule 6.72 oxytocin 10 iu / ml ( 1ml ampoule ) , injection 6.73 foleys urinary catheter 3 way size 16 6.74 chymotrypsin and trypsin 100000 iu tab 6.75 l ornithine +l aspartate 5mg inj ( 5mg ) , injection 6.76 quinine sulphate ( ip 600mg ) , tablet 6.77 personal protection kit ( kit ) , consumable 6.78 oseltamivir ( 45mg ) , capsule 6.79 oseltamivir h1 n1 antiviral cap 30 mg 6.8 chromic with st rb needle ( 12 foils / pkt ) ( 60 mm length 76 cm size:2 / 0 ) , consumable 6.81 dextrose 5% inj 500ml ffs / bfs bottle ( 500ml ) , bottle 6.82 acyclovir intervenous infusion i.p ( 500mg / vial ) , injection 6.83 propofol sodium ( 1% w / v 10mg / ml, 10ml vial ) , injection 6.84 digital x ray film 8x10 ( 150 films / pkt ) 6.85 digital x ray film 10x12 ( 150 films / pkt ) 6.86 digital x ray film 11x14 ( 150 films / pkt ) ( 11x14 ( 150 films / pkt ) ) , film 6.87 ecg paper ( chemical coated ) 50mm x 30 mtr. roll 6.88 plaster of paris bandage 15cm x 2.7mtr / roll ( roll ) , bandage ] 6.89 plaster of paris bandage bp 10 cm x 2.7 mtr / roll 6.9 reuse prevention syringe sterile single use reuse prevention syringe with detachable needles compliance to iso 7886:4 type i, b, flow wrap / blister pack using medical grade breathable paper, eto sterilized ( 5ml ) , syrings 6.91 ecg jelly 250 gms ( bottle ) , jelly 6.92 ecg paper ( wax coated ) 50mm x 30 mtr, roll 6.93 nebulization mask kit ( adult ) , mask 6.94 oxygen mask adult ( standard size ) , mask 6.95 oxygen mask paediatric ( standard size ) , mask 6.96 ecg paper ( wax coated ) heavy quality 50mm x 30 mtr / roll 6.97 mackintosh double colour water proof rubber marked isi hospital rubber sheeting is:4135 1974 packing and making : as per clause no 4.1 and 4.3 / mtr 6.98 instrument sterilant 10 minute sporicidal sterilant aldehyde free containing sodium perborate ( ( 810 grm packet ) ) , powder 6.99 surface disinfectant 10 minute aldehyde free disinfectant containing potassium mono per sulphate powder ( ( 5kg packet ) ) , powder 7 b.b silk with 1 / 2 cir rb needle 20 mm length at least 75 cm non absorbable surgical suture usp size 3 0, ( 12foils / pkt ) , needle 7.01 black braided silk with 1 / 2 cir rb needle 30 mm length 75 cm 2 / 0 12 foils / pkt 7.02 black braided silk with 1 / 2 cir rb needle 20 mm length 75 cm 1 / 0 13 foils / pkt 7.03 black braided silk with 1 / 2 cir cd cutting needle 16 mm length 75 cm 3 / 0 ( 14 foils / pkt ) 7.04 disposable needles ( 26g x 1 / 2 ) , consumable 7.05 halothane ( 200ml ) , bottle 7.06 erythromycin ( as estolate ) powder for susp ( 125 mg / 5ml 40ml bottle ) , consumable 7.07 potassium chloride oral solution 500mg / 10ml 7.08 cefixime syrup 50mg / 5ml ( 30 ml bottle ) , syrup 7.09 ferric ammonium citrate 200mg, folic acid 0.5mg ( bottle ) , syrup 7.1 multivitamin 10ml ( amp inj ) , injection 7.11 vecuronium bromide inj 4mg / ml amp ( 4mg / ml amp ) , solution [ 987609 ] 7.12 iron sucrose ( 20 mg ) , injection 7.13 clofazimine ( 50 mg ) , capsule 7.14 b complex minerals with zinc ( capsule ) , capsule 7.15 antioxident ( cap ) , capsule 7.16 vaseline white / yellow ( 1 / 2 kg ) , consumable 7.17 silver sulphadiazine cream 500gm 7.18 hydroxypropyl methylcellulose ophthalmic solution 2% ( 5ml vial ) , consumable 7.19 atracurium besylate usp inj injection 7.2 diphenhydramine inj 50mg / ml ( 50mg / ml ) , injection 7.21 dextran 70 injectable sol inj 500ml ( solution ) 7.22 hydrocortisone sodium succinate inj. 200 mg / vial ( 200 mg / via ) , injection 7.23 ofloxacin inj 2mg / 1ml ( 100ml ) , injection 7.24 meropenam 500mg inj 7.25 inj. meropenam 125mg ( 125mg ) , injection 7.26 meropenem ( 1gm ) , injection 7.27 phenobarbitone inj. 100 mg / ml 7.28 inj. heamocoagulase 1cu 1ml 7.29 diclofenac sodium injection, 3ml ( ) , injection 7.3 inj. b complex 30ml 7.31 inj. l ornithine l aspartate ( 10ml ) , injection 7.32 inj. diclofenac 30ml 7.33 drop iron ( 15ml ) , consumable 7.34 neomycin sulphate+bacitracin zinc ( 5mg+500 iu / gm ointment ( 15gm tube ) ) , tube 7.35 beclomethasone dipropionate, clotrimazole, neomycine sulphate, chlorocresol ( 0.025% + 1% + 0.5% + 0.1% w / w ( 5gm tube ) ) , ointment or cream 7.36 diclofenac + menthol ( 30gm ) , tube 7.37 oint. gentamycin sulphate ( 15gm ) , ointment 7.38 nimesulide oint gel 20gm 7.39 heparin and benzyl nicotinate 20mg oint. 7.4 oxygen inhelation ( oxygen ip medical oxygen in steel or aluminium, cylinder ( 10 litres water cap ) ( 10 liters ) , consumable 7.41 powder protien +vitamins +corbohydrates & minerals 200gm ( 200gm ) , consumable 7.42 calcium syp 100ml syrup ( 240mg / 5 ml ) 7.43 multivitamin 200ml syrup 7.44 cetirizine ( 5mg / 5ml ( 60 ml bottle ) ) , syrup 7.45 magnesium hdroxide+aluminium hydroxide ( 625mg+312mg / 5ml ) [ 987646 ] 7.46 dicyclomine syrup [ 987647 ] 7.47 vitamin b complex nfi formula ( 100ml bottle ) , syrup 7.48 syp. ferric ammonium citrate 200mg +folic acid 0.5mg+vitamin b 125mcg+zinc 5ml syrup 7.49 antacid mint flavour ( 170ml ) , syrup 7.5 drop paracetamol 100mg / 15ml 7.51 norfloxacin + tinidazole ( ( 100 mg + 100 mg ) / 5 ml 30ml syrup ) , syrup 7.52 norfloxacin +metronidazole 30ml syrup 7.53 ibuprofen 10mg+paracetamol 125mg syrup 7.54 ampicilline 125mg / 30ml syrup 7.55 ibuprofen 100mg + paracetamol 125mg per 5 ml syrup ( 60 ml bottle ) , syrup 7.56 syp. cefodroxil 125mg / 30ml syrup 7.57 vitamin b complex nfi formula ( 200ml bottle ) , syrup 7.58 cyproheptadine hcl + tricholine citrate ( 2mg + 275 mg / 5 ml ( 200ml bottle ) ) , syrup 7.59 syp. cetirizine 5mg / 5ml 30ml syrup ( syp. cetirizine 5mg / 5ml 30ml syrup ) , syrup 7.6 calcium gluconate syrup ( 200ml ) , syrup 7.61 amoxicillin dispersible ( 125 mg ) , tablet 7.62 dicyclomine 20mg tab 7.63 clonidine tablet ( 100 mcg ) , tablet 7.64 diphenhydramine ( 25mg ) , capsule 7.65 dexamethasone ( 4 mg ) , tablet 7.66 vitamin c tab 500 mg tablet 7.67 mesalamine ( 5 aminosalicylic acid ) ( usp 400mg ) , tablet 7.68 isoxsuprine tablets i.p. 20 mg tablet 7.69 anticold ( paracetamol 300mg+cetirizine hcl 5mg tablet 7.7 pentoprazole 40mg, domperidone 10mg tab tablet 7.71 pentoprozole 40mg +domperidone 10mg tab 7.72 calcium citrate 500mg with vitamin d3 200mcg tablet 7.73 norfloxacine 400mg and tinidazole 600mg tab 7.74 losartan 50mg +hydroclorothiazide 12.5mg tablet 7.75 ethamsylate tablet ( 250mg ) , tablet 7.76 diclofenac 50mg +paracetamol 325mg+chlorzoxazone 500mg ( tab ) , tablet 7.77 ofloxacin 200mg +tinidazole 600mg ( tab ) , tablet 7.78 azythromycin 1 gm + fluconazole 150 mg, + secnidazole 2 g, tablet c tablet 7.79 amlodipine 5mg+atenolol ( 50mg ) , tablet 7.8 iron & folic acid entric coated 100mg, of elemental iron ( adult ) +fa 1.5mg tab. 7.81 aceclofenac 100mg+paracetamol 500mg tab 7.82 dicyclomine 20mg+paracetamol 325mg tab 7.83 norfloxacin + tinidazole 400mg tab 7.84 norfloxacin +tinidazole 400mg tab 7.85 roxithromycin 150mg tablet 7.86 domperidone +ranitidine 150mg tab 7.87 povidone iodine cream 250gm 7.88 amoxycillin and potassium clavulanate i.p. ( 1 gm + 0.2 gm / 10 ml vial ) , injection 7.89 dexamethasone + gentamycin eye drop 0.1%+0.3% 7.9 prostaglandin e2 gel 0.5mg ( 3gm tube ) , tube 7.91 who hemoglobin color scale ( starter kit ) components ( 1 ) colour scale 01 / kit ( 2 ) test strip 1000 / kit ( 3 ) printed literature for method of use / kit ( 4 ) lancet 1000 / kit 10x100 ( nabl / cap accrediated lab test certificate for the batch no. must be enclosed with each supply delivered ) , consumable [ mis145 ] 7.92 strip for albumin urine and suger 7.93 glass slide 75mm x 25mm 1.35 mm 7.94 cover slip 18 x 18 mm 10gm 7.95 variable auto pippets 10 to 100 micro litres ( 10, 25, 50, 100 ) each 7.96 tips for auto pippetes 10 to 100 micro litres 7.97 glucometer strip ( 1x50 ) , consumable 7.98 urea kit berthelot ( 100 test / kit ) , consumable 7.99 acetone detection kit ( 100 gm ) , powder 8 crp test kit ( latex / card ) ( 25 test / kit ) 8.01 cyanemeth solution for hb ( 5 litre ) , consumable 8.02 leishman stain ( 500 ml bottle ) , consumable 8.03 hcl n / 10 ( 500 ml bottle ) 8.04 semen dilution fluid ( 100 ml bottle ) , consumable 8.05 gram iodine ( gram stain ) 125 ml 8.06 sodium citrate 3.8% ( 500 ml bottle ) , consumable 8.07 edta solutions k3 ( 500 ml ) 8.08 disposable cup for urine sputum 30ml 80 to 90 mm diameter 100 / pkt 8.09 disposable pricking lancet 100 units consumable 8.1 paper adhesive plaster 1 x 9.0mts 8.11 barium chloride 10% ( 500 ml bottle ) , consumable 8.12 sulfur powder 8.13 alkaline citrate with k oral solution each 10 ml contains sodium citric 1 gram potassium citrate 0.65 gram citric acid 1 gram syrup ( 10 ml ) , syrup 8.14 alkaline citrate with k oral solution ( 100ml ) , syrup 8.15 total protein lysozyme 1x50 ml 8.16 b.b. silk 6 reels x 25 mts length 25 mts.black braided silk without needle in reels non absorbable surgical sutures usp , 2 0 ( 6 reels is per box rate should be quoted for 6 reels ) , surgical 8.17 b.b. silk 6 reels x 25 mts size:1 / 0 ( 6 reels is per box rate should be quoted for 6 reels ) , surgical material 8.18 bandage than ( 1mtrx20mtr ) , consumable 8.19 rolled bandage 15cm � 5 m 8.2 rolled bandage 10cm � 5m 8.21 rolled bandage 7.5cm � 5m 8.22 bandage clothes 01m � 20m consumable 8.23 cotton crape bandage 15cm x 4m ( box of 10 bandages ) ( no. ) , consumable 8.24 cotton crape bandage 10cm x 4m ( box of 10 bandages ) ( no. ) , consumable 8.25 rolled bandage 5cm � 5m 8.26 iv cannula ( two way ) ( size 24 ) , consumable 8.27 keratome 3.2 keratome round stock 3.2mm full handle knives e.t.o. sterile angled bevel up 45 deg ( ) , consumable 8.28 hub cutter non electric lockable safety portable box for disposal of hypodemic needles. consumable 8.29 hiv 1&2 test cards 8.3 urine albumin & suger 8.31 dengue card test 100 test kit 8.32 typhoid test card ( an immunochromatography assay for the rapid visual detection of typhoid antibody igg / igm in human serum / plasma ) ( 50 test per pack ) , consumable 8.33 hiv kit 100 test / kit 8.34 sodium hypo chloride 5 lit jar 8.35 disposable paper gloves size 7 inches consumable 8.36 disposable paper gloves size 7, 1 / 2 inches consumable 8.37 usg thermal paper 8.38 orthopaedic speciality gloves ( size 7 ) , consumable 8.39 disposable appron consumable 8.4 cannula fixer ( set ) , consumable [ 987748 ] 8.41 cotton delivery belt 8.42 gauze swab / pad 6 layer 20 � 20 8.43 disposable sterile gloves size 6 inches consumable 8.44 disposable sterile gloves size 61 / 2 inches consumable 8.45 disposable sterile gloves size 7, 1 / 2 inches consumable 8.46 c.p.d.blood bag 350 ml consumable 8.47 fixer powder ( bromex acid fixer with hardner ) ( 22.5 ltr / pkt ) 8.48 bilirubin kit ( colorimeter semi auto ) ( 4x60 ml 480 test / kit ) , consumable 8.49 cholesterol kit end point enzymatic kit ( 5x20ml 200 test / kit ) , consumable 8.5 hdl kit ppt ( 2x50ml 200 test / kit ) , consumable 8.51 triglyceride kit enzymetic ( 5x20ml 200test / kit ) , consumable 8.52 creatinine calorimeter for semi auto kinetic 4x60ml 480test / kit 8.53 alkaline phosphatase kit ( kinetic ) 10x2.2ml 44 test / kit consumable 8.54 ra factor 50 test kit qualicative 8.55 chromic with cd.rb needle absorbable surgical suture ( 12 foils / pkt ) ( 40 mm length 76 cm size:1 / 0 ) , surgical material 8.56 chromic with 1 / 2 cir rb needle 30 mm length 76cm, 2 0 usp, absorbable surgical suture surgical material ( 12 foils / box ) , surgical material 8.57 chromic with 1 / 2 cir rb needle 20 mm length 76 cm, 3 0 usp, absorbable surgical suture surgical material 12foils / box 8.58 chromic with 1 / 2 cir rb needle size:1 / 0, 30 mm length 76cm absorbable surgical suture surgical material 8.59 chromic with 1 / 2 cir rb needle 40 mm length 76 cm ( with needle ) ) absorbable surgical sutures usp, ( size 1, 12 foils / pkt ) , surgical material 8.6 chromic with cd rb needle 30 mm length 76 cm size:2 / 0 ( absorbable surgical suture surgical usp, 12 foils / boxmaterial ) , surgical material 8.61 chromic with cd cutting needle 12 mm length 70cm size:3 / 0 8.62 chromic catgut ( 12 foils / pkt ) ( size:1 / 0 length at least 150 cm ) , consumable 8.63 synthetic absorbable suture 3 / 0 with 1 / 2 cir cutting needle size:3 / 0 36mm length 70cm polyglycolic acid ( pga ) 8.64 b.b silk with 1 / 2 cir rb needle size:2 / 0 30 mm length 75 cm surgical material 8.65 poly propylene with 1 / 2 cir rb needle 16 mm length 70 cm size:4 / 0 ( 12 foils / pkt ) , consumable 8.66 poly propylene monofilament sterile precut with 1 / 2 cir rb needle 30mm length 70cm non absorbable surgical sutures usp size 2 / 0 ( size:2 / 0 ( 12 foils / pkt ) ) , consumable 8.67 disposable needles ( 22g consumable ) , consumable 8.68 polyamide with cd r cut extra penetrating needle ( 12 foils / pkt ) ( size 4 / 0 ) , consumable 8.69 needle hypodermic0insulin ( metallic non0sterile ) 8.7 suture needles curved 1 / 2 circle round bodyassorted size 1 5 8.71 suture needles curved 1 / 2 circle round bodyassorted size 11 15 8.72 suture needles curved 1 / 2 circle round bodyassorted size 16 20 8.73 spinal ( l.p. ) needle disposable ( 24g ) , consumable 8.74 spinal ( l.p. ) needle disposable 26g consumable 8.75 chromic catgut , round body needle no. 1.0 8.76 needle hypodermic size is ( 10654:2002 24g ) , consumable 8.77 catgut chromic with 1 / 2 cir rb needle 40 mm length 75cm no. 1 consumable 8.78 bleaching power gr ii ( 25kg ) bags consumable 8.79 bleaching powder gr ii is 1065 / 1989 with upto date amendment packed in 25 kg hdpe bags isi marked stable consumable 8.8 disposable suction catheter assorted covering ( all sizes 10, 12, 14, 16, 18 ) , consumable 8.81 foleys urinary catheter silkolatex 2 way sterile, non toxic size 10 8.82 ecg paper computerizesd triple channel 20m 8.83 infant feeding tube size: 6g 8.84 b.b silk with 1 / 2 cir rb needle size:1 / 0 20 mm length 75 cm non absorbable surgical sutures usp surgical material [ 987794 ] 8.85 gauze swab / pad 6 layer 10 � 10 8.86 endotracheal tube internal dia 2.5 mm to 5 mm 8.87 complete delivery kit 1plastic desposable gown ( non woven plastic laminated, leak proof ) 2 ( 4*4 ) , ( 2 ) .disposable goggles for protection of eyes 2 ( free size ) , ( 3 ) .face mask 2 free size, ( 4 ) .plastic disposable cap ( non woven plastic laminated, leak proof ) ( 1pair, ( 5 ) .long gloves elbow length 2pairs ( 6 1 / 2 and 7 ) , ( 6 ) disposable shoe covers, till calf ( plastic ) 2pair ( free size ) as per attached specification ) , consumable 8.88 malaria card ( antigen ) atleast 100 microbes / desi ltr. for both species 8.89 seman diluting fluid 100 ml. 8.9 n / 10 hcl 500ml 8.91 widal 2x2 sera slide kit 8.92 syphalis card igg+igm s / s above 99.5 % syrup 8.93 edta k3 vial each 8.94 crp latex slide per test 8.95 urine culture pot 30 ml. 8.96 rapid ra 25 test 8.97 cell pack, reagent pack for cell counter ( ( erma and mindrug ) complete set ) , consumable 8.98 capillary tube ( 100 pieces ) , consumable 8.99 crp kit 1x100 biolab qualitative ) 9 vdrl ( rpr ) 1x100 strip 9.01 widal 4x5 ml 9.02 anti abd grouping serum 3x10ml consumable 9.03 sgpt kit lyphozyme 5x20 ml 9.04 urea uv gloh 5x20ml 9.05 urea ( brethelot ) 3x100ml lyphozyme 2x10ml 9.06 creatinin kit 9.07 uric acid biosystem 9.08 sugar albumin strip 9.09 test tube 15x125 9.1 disposable syringes ( with needle cgs 2cc ) , consumable 9.11 disposable syringes ( with needle cgs 5cc ) , consumable 9.12 disposable syringes with needle ( cgs 10cc ) , consumable 9.13 insulin syringe ( 40 units / ml iso 8537:2007 ) , consumable 9.14 reuse prevention syringe sterile single use reuse prevention syringe with detachable needles compliance to iso 7886:4 type i and b, flow wrap / blister pkg using medical grade breathable paper, eto sterilized ( 3ml ) , consumable 9.15 disposable syringe with needle cgs 1cc with mark 0 1ml consumable ( ) , consumable 9.16 malaria pf / pv rapid test 9.17 malaria pf / pv antigen card 9.18 ryles tube ( pvc ) size ( children: 10 ) , consumable 9.19 ryles tube ( pvc ) size : adult: 16 ( each ) , consumable 9.2 infant feeding tube ( catheter ) size: 8g ( each ) , consumable 9.21 edta vail 9.22 edta vial with safty cap ( 2ml. ) capsule 9.23 plain vial with screw cap ( 12 x 75 ) , consumable 9.24 bed sheet white 60 x 90 consumable 9.25 basta cloth 44 x 44 ( 44x44 ) , consumable 9.26 draw sheet bleach 45 x 45 9.27 instrument wash 500ml with spray pump 9.28 liquid hand wash solution with dispenser consumable ( 500 ml ) , consumable 9.29 surgical blade isi marked, size 15 ( 100 per packet ) , surgical material 9.3 surgical blade isi marked, size 23 ( 100 / pkt ) , surgical material 9.31 suture mersilk 8 0 ( 12 foil ) [ 987841 ] 9.32 paper adhesive plaster 1 / 2 x 9.0mts 9.33 inj. primacort hydrocotisone ( 200 mg ) , injection 9.34 iv dextrose 40% 9.35 absorbent cotton roll 100 gm each consumable 9.36 acetic acid solution ( 3% 100 ml bottle ) , consumable 9.37 acetone solution ( 100 ml ) , bottle 9.38 antacid syrup , 170 ml ( dried alluminium hydroxide gel 200 mg, simethicon ( 25 mg / 5 ml ) , syrup 9.39 azithromycin + fluconazole +secnidazole ( 1 gm+150 mg+ 1 gm, tablet combipack ) , tablet 9.4 bandage cloth bleach consumable 9.41 beclomethasone dipropionate, neomycin sulphate, miconazole nitrate ( 0.025 % + 0.5 % + 2 % ( 5 gm tube ) ) , ointment 9.42 buppivacaine 5 mg, dextrose80 mg / ml ( 4 ml inj injection ) , injection 9.43 calcium carbonate 625 mg, vitamin d3 125 iu / 5 ml ( 100 ml syrup ) , syrup 9.44 cefixime 50 mg / 5ml, 30 ml, drop ( 30 ml ) , drop ] 9.45 chair cushion box type 18x18 9.46 neonatal hyperthermia prevention double layer pe bag with hood and velcro protection 9.47 chloramphenicol 0.5% ( 5ml ) , eye drop 9.48 chlorhexidine 0.5 % propanol 70 %, 100 ml hand rub ( 100 ml ) , consumable 9.49 chlorhexidine acetate 0.5 %, medicated gauze 9.5 chlorquine phosphate 64.5 mg / ml, 5 ml inj ( 5 ml ) , injection 9.51 cold cough drop , 15 ml ( phenyl ephrine 5 mg, chlorphenaramine 0.5 mg, paracetamol 125 mg / 5 ml ) , consumable 9.52 creatine calorimeter for semi auto kinetica 4x60ml 480 test kit 9.53 dengue duo serum plasma 10 test / kit ( sd ) 9.54 dexamethasone sodium ( 0.5 mg ) , tablet 9.55 dextrose 25 %, 25 ml inj 9.56 dextrose 50 %, ( 25 ml ) inj ( 50 % ) , injection 9.57 digestive drop ( digestive enzyme and multivitamin with l lysine ) ( 15 ml ) , drop 9.58 digital x ray film size 14 x 17 ( ( 100 sheet per packet ) ) , film 9.59 kellys pad disposable 9.6 dusting powder, 10 gm ( neomycin sulphate 5 mg, baccitracin 250 unit, sulphacetamide sodium 60 mg ) 9.61 enema 100 ml ( sodium acid phosphate 10 gm, sodium phosphate 8 gm / 100 ml ) 9.62 foleys urinary catheter 3 way size 22 9.63 frusemide 20mg + spironolactone 50mg ( tablet ) , tablet 9.64 g 6pd kinetic per ml 9.65 gauze clothes 90cmx20m 9.66 gauze swab / pad ( 4 layer 20x40 ) , consumable 9.67 gentian violet ( gram stain ) 100ml bottle 9.68 glass test tube 5 without edge 9.69 haemoccel ( electrolight na, k, ca, cl ) ( 500 ml inj ) , injection ] 9.7 haemocoagulase 1 nih unit / ml, 1 ml inj 9.71 hdl kit 50 test 9.72 hematology cell counter reagents as per requirement of cell counter cleaning solution 100 ml 9.73 hematology cell counter reagents dilutent ( 20 ltr ) 9.74 hematology cell counter reagents rinse solution ( 20 ltr ) 9.75 heparin sodium benzyl nicotinate oint 9.76 hiv 1+2 ( rapid ) per card j mitra 9.77 inj. sigmacrome ( obrochrome ) 10ml 9.78 iron syrup 200 ml ( elemental iron 40 mg, ammonium citrate 200 mg, cyanocobalamin 7.5 mg, folic acid 0.5 mg, zinc sulphate 7 mg / 5 ml ) , consumable 9.79 iv cannula size 26g ( ) , consumabl 9.8 labetalol 5 mg / ml, 2 ml inj ( 2 ml ) , injection 9.81 losartan potassium, hydrochlorthiazide ( 50 mg + 12.5 mg ) , tablet 9.82 medigard hand scrub 9.83 mehylcobalamine 1500 mcg, alpha lipoic acid 100 mg, folic acid 1.5 mcg, thiamine mononitrate 10 mg ( pyridoxine hcl 3 mg ) , capsule 9.84 metresses 3x6 with raxine cover 4 density 9.85 miconazole nitrate 2 % w / w 15 gm, oint 9.86 micropiptte 100 1000 9.87 ofloxacin + dexamethasone 10 ml eye drop ( 10 ml ) , drop 9.88 pantoprazole 40 mg, domperidone 10 mg ( tab ) , tablet 9.89 paracetamol 100 mg / ml, 150 ml drop ( 150 ml ) , consumable 9.9 paracetamol 75 mg / ml ( 10 ml inj ) , injection 9.91 phenobarbitine ( 20 mg / ml, 60 ml syrup ) , syrup 9.92 poly propylene mesh ( 7.5cmx15cm ) , consumable 9.93 sgpt test kit reagent 9.94 strip for malaria antigen, p vivex, p falciparum ( 50 tests ) 9.95 synethetic absorbable suture 1 / 0 with 1 / 2 cir rb needle size: 1 / 0 length 90cm 9.96 telmisartan, hydrochlorthiazide ( 40 mg + 12.5 mg ) , tablet 9.97 tuberculin diluted ppd 5 tu / 0.1 ml ( 5 ml ) , solution 9.98 uri stix 100 test 9.99 vitamin b complex syp 200 ml 10 white petrollium jelly 500 gm 10.01 widal 2x2 tube test kit 10.02 b.b silk with 1 / 2 cir rb / cutting needle 30 mm length 75 cm non absorbable ( size 2 0, 12 foils / pkt ) , consumable 10.03 collagen sheets 10 x 10 cm sheet 10.04 foleys catheter size 14 3 way 10.05 foleys catheter size 14 2 way 10.06 ryles tube ( pvc ) size : adult ( 18, each ) , tube 10.07 ryles tube ( pvc ) size ( children : 12 ) , tube 10.08 disposable suction catheter ( size 14 ) , consumable 10.09 disposable suction catheter ( size 12 ) , consumable 10.1 disposable scalp vein set ( size 20 no ) , consumable 10.11 disposable scalp vein set size 22 no ( each ) , consumable 10.12 paediatric drip set ( set ) , digonstic 10.13 measure volume ( drip set ) , each 10.14 cvp line complete set 10.15 triple lumen jugular catheter 12 x 16 10.16 oseltamivir h1 n1 antiviral syp 75 mg 10.17 swine flu vaccine ( vaccine ) , vaccine 10.18 paper adhesive plaster microporous surgical tape 1 inch x 9 m / roll ( 1 inch * 9 m / roll ( iso 13485:2016 ) ) , consumable 10.19 paper adhesive plaster microporous surgical tape ( 4 inch x 9 m / roll ( iso 13485:2016 ) ) , consumable 10.2 paper adhesive plaster microporous surgical tape ( 2 inch x 5m / roll ) , consumable 10.21 paper adhesive plaster microporous surgical tape ( 6 inch x 5m / roll ) , consumable 10.22 plaster of paris bandage 10 cm x 2.7 mtr / roll ( roll ) , bandage 10.23 vdrl kit ( strip ) ( 50 test / kit ) , consumable 10.24 disposable spinal needle ( 23 no ) , each 10.25 disposable spinal needle 18 no 10.26 disposable spinal needle ( 22 no ) , each 10.27 dj stent for ureter ( 8 fr ) , each 10.28 dj stent for ureter ( 6 fr ) , each 10.29 double lumen hoemodialysis catheter with pur ext ( tube ) , each 10.3 trucut biopsy needle ( 18 g length 15 cm ) , each 10.31 disposable ( 20 g no isi marked ) , needle 10.32 disposable syringe ( 50 ml ) , syrings 10.33 reuse prevention syringe ( 10 ml ) , syrings 10.34 glass test tube 12 x 100 ( medium size ) heavy quality 100 / pkt ( no. ) , tube 10.35 test tube 12 x 100 ( medicm size ) 100 / pkt 10.36 test tube 12 x 75 ( small size ) 100 / pkt ( 12 x 75 ( small size ) 100 / pkt ) , tube 10.37 tips for auto pipettes 2 to 100 micro litres 1000 / pkt ( 2 to 100 micro litres 1000 / pkt ) , each 10.38 tips for auto pipettes 200 to 1000 micro litres 500 / pkt ( 200 to 1000 micro litres 500 / pkt ) , each 10.39 abdominal drain ( set 32 no ) , each 10.4 abdominal drain set ( 28 no ) , each 10.41 icd bag 1000 ml 10.42 foleys urinary catheter 2 way size 8 10.43 endotracheal tubes size 9.5 cuffed should have low pressure high volume cuff and radio opaque blue line 10.44 wound suction catheter ( no 18 ) , each 10.45 foleys urinary catheter pediatrics ( size 10 ) , each 10.46 blood grouping anti sera a monoclonal : antisera should be transparent with more than one year shelf life at 2 6 c , it should give +++ agglutination at 1.256 dilution in 3 4 sec with a positive cells 10 ml 10.47 blood grouping anti sera b monoclonal : antisera should be transparent with more than one year shelf life at 2 6 c , it should give +++ agglutination at 1.256 dilution in 3 4 sec with b positive cells 10 ml 10.48 chikungunya card test 1 gg + 1 gm ( 25 test / kit ) 10.49 alpha beta arteether inj 75 mg / 2 ml 10.5 cefadroxil ( 500 mg ) , tablet 10.51 clotrimazole suspension i.p 50mg / 5ml ( 50mg / 5ml ) , suspension 10.52 olopatadine hydrochloride ophthalmic solution usp 01% w / v 5ml ( ) , eye drop [ 10.53 atorvastatin ( 20mg ) , tablet 10.54 soframycin ointment 30 mg tube ( ) , ointment 10.55 atorvastatin ( 10 mg ) , tablet 10.56 glass test tube 12 x 75 ( small size ) ( heavy quality 100 / pkt ) , tube 10.57 b.b. silk 6 reels x 25 mts length 25 mts. black braided silk without needle in reels non absorbable surgical sutures usp 3 0 ( 6 reels is per box rate should be quoted for 6 reels ) , consumable 10.58 chromic catgut no 1.0 round dody, 40 mm 12 foils / pkt 10.59 disposable sterile gloves b.i.s specification gloves, surgical rubber, made of hypoallergic latex 100%, electronically tested sterilized by gamma irradiation / eto is no : 13422 92, 6 inch / pair 10.6 disposable sterile gloves b.i.s specification gloves, surgical rubber, made of hypoallergic latex 100%, electronically tested sterilized by gamma irradiation / eto is no : 13422:1992 as amended upto, 6.5 inch / pair ( pair ) , consumable 10.61 disposable sterile gloves b.i.s specification gloves, surgical rubber, made of hypoallergic latex 100%, electronically tested sterilized by gamma irradiation / eto is no : 13422:1992 ( 7 inch / pair ) , consumable 10.62 disposable sterile gloves b.i.s specification gloves, surgical rubber, made of hypoallergic latex 100%, electronically tested sterilized by gamma irradiation / eto is no : 13422:1992, as amended upto, 7.5 inch / pair ( pair ) , consumable 10.63 disposable sterile gloves isi marked surgical rubber made of hypoallergic latex 100%, electronically tested sterilized by gamma irradiation / eto is no : 13422 92, powder free 6 inch / pair 10.64 disposable sterile gloves isi marked surgical rubber made of hypoallergic latex 100%, electronically tested sterilized by gamma irradiation / eto is no : 13422 92, powder free 6.5 inch / pair 10.65 disposable sterile gloves isi marked surgical rubber made of hypoallergic latex 100%, electronically tested sterilized by gamma irradiation / eto is no : 13422 92, powder free 7 inch / pair 10.66 disposable sterile gloves isi marked surgical rubber made of hypoallergic latex 100%, electronically tested sterilized by gamma irradiation / eto is no : 13422 92, powder free ( 7.5 inch / pair ) , consumable 10.67 diagnostic strips for urine sugar / albmin packing: 100 strip / pkt 10.68 disposable syringes is 10258:2002 with needle is 10654:2002 ( 10ml ) , syrings 10.69 i.v. cannula with injection valve ( 20g ) , consumable 10.7 needle hypodermic size is ( 10654:2002 23g ) , needle 10.71 sterile hypodermic syring with needle ( 5 ml ) , syrings [ 10.72 sterile hypodermic syring with needle 10 ml [ 10.73 sterile hypodermic syring with needle 20 ml 10.74 disposable needles ( 23 no ) , needle 10.75 i.v. cannula with injection valve ( size 24 g ) , consumable 10.76 triway cannula ( 3 way stop cock ) , consumable 10.77 three way stop ( cock ) , consumable 10.78 syrup 50ml bottle ( each 1 ml contains 20 mg elemental iron and 100 mcg folic acid syrup as per the standards provided with dropper ) , syrup 10.79 formaldehyde ( formalin ) 37% acq dilute 34 ml formaledehyde solution with water to produce 100ml ( 450 ml bottle ) ( 34 ml ) , bottle 10.8 irinotecan 100 mg inj ( 1 ml amp ) [ 10.81 azithromycin ( 100mg / 5ml ( 15 ml bottle ) ) , suspension 10.82 compound sodium lactate injection ip ( ringers lactate ) 0.24 % w / v of lactic acid ( eq. to 0.32% w / v of sodium lactate ) , 0.6 % w / v sodium chloride, 0.04 % w / v potassium chloride and 0.027 % w / v calcium chloride ( 500 ml bottle ) ( ) , solution 10.83 gram iodine ( gram stain ) ( 100ml bottle ) ( bottle ) , consumable 10.84 trisodium citrate 3.8% ( 500 ml bottle ) 10.85 basic carbol fuchsin for afb staining 25 gm / pkt 10.86 carbol fuchsin for zn stain ( 500ml bottle ) 10.87 fouchets reagent ( 100 ml bottle ) , consumable [ mis56 ] 10.88 kit for total protein ( including albumin and total protein ) 100ml bottle 10.89 methyl blue for ( z n ) ( 125 ml bottle ) , consumable 10.9 platelet dilution fluid ( 100 ml ) , consumable 10.91 safranine ( gram stain ) ( 500 ml bottle ) , consumable 10.92 papaniculau stain kit ( 125ml bottle ) 10.93 developer single bath liquid concentrated of consistent quality. it sould have favoutable contrast / fog ratio and good shelf life 2 lit can ( to make 9 liters working solution ) ( bromodex mp developer concentrate ) 9ltr packing 10.94 developer single bath liquid concentrated of consistent quality. it sould have favoutable contrast / fog ratio and good shelf life 3 lit can ( to make 13.5 liters working solution ) ( bromodex mp developer concentrate ) 13.5 ltr packing 10.95 developer single bath liquid concentrated of consistent quality. it sould have favoutable contrast / fog ratio and good shelf life ( 5 ltr can to make 22.5 liters working solution ) 10.96 echo jelly 250ml bottle ( bottle ) , jelly 10.97 surgical blade isi marked, size 22 ( 100 / pkt ) , surgical material 10.98 surgical blade isi marked, size 24 ( 100 / pkt ) , surgical material 10.99 developer powder ( 22.5 ltr ) 11 brain thromboplastin for prothrombin time ( pt reagent ) 5ml ( liquiplastin ) 11.01 blood grouping anti sera d monoclonal : antisera should be transparent with more than one year shelf life at 2 6 c, it should give +++ agglutination at 1.256 dilution in 3 4 sec with d antigen positive cells. 10ml vail ( eryclone anti d igm ) 11.02 hiv kit card ( 25 test / kit ) , kit 11.03 ra factor rapid kit ( 25 test / kit ) 1: ) should be based on latex agglutination slide test. 2: ) qualitative and semiquantitative testing facility possible. 3: ) test speed must be less than 2 minutes 11.04 typhoid card test kit ( for igg and igm antibody detection ) ( 25 test kit ) 11.05 auto pippets fixed volume ( 10 micro liters each ) , consumable [ mis11 ] 11.06 auto pippets fixed volume ( 20 micro liters each ) , consumable [ mis13 ] 11.07 auto pippets fixed volume ( 1000 micro liters each ) , consumable [ mis12 ] 11.08 central venous catheter kit ( single lumen ) , kit 11.09 desferioxamine injection 500mg ( 500mg ) , injection 11.1 octreotide lar ( 30mg ) , injection 11.11 vildagliptin + metformin ( 50mg + 500mg ) , tablet 11.12 levofloxacin 500 mg ( 100 ml ffs bottle ) , injection 11.13 imatinib ( 400 mg ) , tablet 11.14 imatinib 100 mg cap 11.15 calcium leucovorin ( 50 mg / vial inj ) , injection 11.16 tamoxifen ( 10 mg ) , tablet 11.17 paclitaxel nanoparticle / protein bound particles inj. ( 100mg vial ) , vial 11.18 amlodipine ( 2.5mg ) , tab 11.19 oseltamivir 12 mg / ml syrup ( 75ml bottle ) , syrup 11.2 sitagliptin ( 100 mg ) , tablet 11.21 methyl prednisolone sod. succinate ( 500 mg vial ) ( inj 40mg / ml , 12.5 ml vial ) , injection 11.22 hydrocortisone inj 100 mg / vial ( ) , injection 11.23 oseltamivir 30mg ( capsule ) , capsule 11.24 iron and folic acid enteric coated tab. dried ferrous sulphate ip equ. to ferrous iron 100 mg and folic acid ip 0.5 mg granules ( red tablet ) ( ) , tablet 11.25 a v blood lines with av pressure transducer protector for all machines types and dialysers ( acceptable for fitting to all standard dialysers ) , set 11.26 femoral catheters single lumen size adult ( set of 12 different sizes set ) , consumable 11.27 femoral catheters single lumen size size pediatrics ( ( set of 12 different sizes ) , set ) , consumable 11.28 femoral catheters double lumen kit curved double lumen catheter set ( 12 f ( curved ) adult ) , consumable 11.29 adult double lumen catheter ( set 11.5 f 12 fr, 13cm ( curved ) , kit ) , consumable 11.3 adult double lumen catheter set ( 11.5 f 12 fr, 13cm ( straight ) , set ) , consumable 11.31 paediatric double lumen catheter set 6.5 f 8.5 fr, 13cm ( curved ) , kit 11.32 paediatric double lumen catheter set 6.5 f 8.5 fr, 13cm ( straight ) , set 11.33 jugular catheters : double lumen kit ( curved ) , set [ 700233 ] 11.34 femoral guide wires : straight ( 0.325 mm size ) should meet the following standards : european ce, iso13485, sterile, fda, set 11.35 blood vessel introducers needles 16g, sterilized, set 11.36 dialysis starting kit disposable:a ) sterile tray with top ( disposable ) , size not less than 30x30cm b ) sterile drape size not less than 45x45 cm 1no c ) cotton ball 6 no d ) cotton gauze pieces 1 11.37 tourniquet with belt ( good quality pairs ) ( each ) , consumable 11.38 kores indelible ink marker pen 11.39 ecg paper ( chemical coated ) ( 50mm*20 mm roll ) , each 11.4 tmt graph paper a4 size, 100 piece / pkt 11.41 ecg roll three channel 20m 11.42 iv cannula size with inj.valve ( port ) ( 22g ) , consumable 11.43 1.3 / 1.4 adult dialyzer ( dialyzer multiple use hollow fiber size as given polysulphone or polyethersulfone ) ( 200ml bottle ) , consumable 11.44 1.5 / 1.6 adult dialyzer ( dialyzer multiple use hollow fiber size as given polysulphone or polyethersulfone ) 11.45 rpr rapid card test kit ( 50 test / pkt ) 11.46 disposable sharp collection containers ( 1.5 l ) , consumable 11.47 polybutylate coated with polyester braided ( green ) with 1 / 2 cir tap cut v 5 da needle 17mm, non abs surg suture usp 2 0 length 90cm ( 12 foils / pkt ) 11.48 mva kit ( mannual vaccum aspiration kit 11.49 fistula 16g, single sterilized eto single needle packing fistula 17g, single sterilized eto single needle packing 11.51 disinfectant renaclean cold sterilant ( 5 ltr can ) 11.52 disinfectant renasteril hot disinfectant ( 5 ltr can ) 11.53 hemodialysis fluid for bicarb made ( part a 10 ltr +part b 500gm 2 / pkt ) , consumable 11.54 intracath cannula for single use ( intravascular catheters ) bis ( gauze 22, length 25 ) , consumable 11.55 quincke bevel pediatric spinal needle, g 25, length 1.2 inch 11.56 exchange transfusion catheter with four way adaptor ( size 4 cm, l 40 cm ) , consumable [ mis52 ] 11.57 single umbilical catheter with luer lock stopcock fr 2, l 40 cm 11.58 single umbilical catheter with luer lock stopcock fr 3, l 40 cm ] 11.59 single umbilical catheter with luer lock stopcock ( fr 4, l 40 cm ) , consumable [ mis113 ] single umbilical catheter with luer lock stopcock ( fr 5, l 40 cm ) , consumable [ 11.61 short iv catheter with straight / j tip guidewire ( l 20, fr 2, g 22 ) , consumable [ mis108 ] 11.62 long line silicon catheter ( g 24, fr 2, l 30cm ) , consumable [ mis76 ] 11.63 short iv catheter with straight guidewire. l 20, fr 2, g 22 11.64 poly propylene monofilament sterile precut with 1 / 2 cir rb needle 30mm length 70cm size : 1 / 0 ( 12 foils / pkt ) , consumable [ 11.65 skin closure stapler ( 35 pins high quality medical grade plastic, cartridge with ss rectangular design pins with wire diameter 0.60 mm and size after closure ( 7.2 x 4.3 mm ) , consumable 11.66 triple lumen polyurethane cvp catheter, 7.5 fr, g 14x18x18, length 15cm 11.67 triple lumen polyurethane cvp catheter, 7.5 fr, g 14x18x18, length 20cm 11.68 double lumen polyurethane cvp catheter, 5 fr, g 17 x 20 ( length 8cm ) , consumable 11.69 double lumen polyurethane cvp catheter, 5 fr, g 17 x 20, ( length 15cm ) , consumable 11.7 spinal needle g 23 with metal stylet. 11.71 low profile titenium chemo port with cilicon catheter ( 9.6 fr, 6.6fr, 3.9fr, ) length 60cm, guide wire, peel away desilet, hubsite needle ( 22g*20mm ) ( 22g*20mm ) , needle 11.72 i.v cannula size with injection valve ( port ) ( 18g ) , consumable 11.73 xro catheter with ptfe material, i.v. safety cannula, with luer lock ( g 22 ) , consumable 11.74 xro catheter with ptfe material, i.v. safety cannula, with luer lock ( g 20 ) , consumable 11.75 xro catheter with ptfe material, i.v. safety cannula, with luer lock ( g 18 ) , consumable ] 11.76 ptfe material, i.v. safety cannula, with luer lock, g 16 ] 11.77 quincke pediatric spinal needles g 25, length 2.0 inch 11.78 central venous catheter kit single lumen ( 18 g ) , consumable 11.79 amoxicillin cloxacillin and lactic acid bacillus capsules 250mg ( 250mg ) , capsule 11.8 polyethylene high pressure extension tube, length 100cm 11.81 polyethylene high pressure extension tube ( length 150cm ) , consumable [ mis94 ] 11.82 polyethylene high pressure extension tube, length 200cm 11.83 a.v fistula needle 17 g 11.84 a.v fistula needle 16 no 11.85 guide wire 3mm 11.86 urosticks ( 50 / pkt ) , consumable 11.87 paper adhesive plaster microporous surgical tape 6 inch x 10 m / roll 11.88 adhesive roll 1 inch x 5 m / roll 11.89 light weight composite mesh : polypropylene and polyglycolic acid partially absorbable composite mesh with large pore size 6 x 11 cm 11.9 chromic catgut monofilament with 1 / 4 circle reverse cutting needle 6 0 ( 12 / pkt ) 11.91 a.v. blood line ( post haemodialysis tubing ) high quality 11.92 endotreheal tube size 3 cuffed piece, should have silicon tube with radio opaque blue line 11.93 endotreheal tube size 4 cuffed piece, should have silicon tube with radio opaque blue line 11.94 disposable sharp collection containers ( 5 ltr ) , consumable 11.95 ondansetron syrup 2mg / ml 11.96 insulin intermediate inj 11.97 doxorubicin ( lypholozed ) 10 mg / vial 11.98 doxorubicin ( lypholozed ) 50 mg / vial ( 50 mg / vial ) , injection 11.99 pemetrexed ( 100 mg vial ) , injection 12 bleomycin 15 units / vial 12.01 daunorubicin ( 20 mg / vial ) , injection 12.02 egc roll ( 66 mm x 15 mm ) , consumable 12.03 umbical cord clamps ( plastic material ) , consumable 12.04 nebulization mask kit ( pediatrics ) , consumable 12.05 1 / 2 ccs cut needle 48 mm stainless steel ( length 45 cm size 4 ) , needle [ mis03 ] 12.06 1 / 2 ccs cut needle 48 mm stainless steel length ( 45 cm size 5 ) , needle [ mis01 ] 12.07 1 / 2 ccs cut needle 48 mm stainless steel length ( 45 cm size 6 ) , needle 12.08 poly propylene monofilament sterile precut with 1 / 2 cir rb needle 40 mm length 70 cm size 1 ( 12 foils / pkt ) , needle 12.09 poly propylene mesh ( 15 x 15 cm ) , consumable [ 12.1 polymaide mono filament ( nylon ) with cd cut needle 20 mm length 70 cm size 2 / 0 ( 12 foils / pkt ) 1 ] 12.11 polyglactin 30 mm 1 / 2 circle round body 90 cm size 1 / 0 ( 12 foils / pkt ) , consumable [ 12.12 polyglactin 40 mm 1 / 2 circle round body 90 cm size 1 ( 12 foils / pkt ) , consumable 12.13 polyglecaprone with 1 / 2 cir oval / rb needle 26 mm length 70 cm size 3 / 0 ( 12 foils / pkt ) , consumable [ mis95 ] 12.14 poly propylene mono filament sterile precut with 1 / 2 cir rb d needle 16mm length 70 cm non absorbable surgical sutures usp size 5 / 0 ( 12foils / pkt ) , consumable 12.15 poly propylene mono filament sterile precut with 1 / 2 cir rb heavy needle 16 mm length 70 cm non absorbable surgical sutures usp 5 / 0 ( 12 foils / pkt ) 12.16 polyester braided coated with cd white dn 25mm ( curved rb ) 2 0 length 90cm ( 12 foils / pkt ) 12.17 polyester braided coated with 1 / 2 cir cd white dn 17 mm taped cut 90 cm 2 / 0 size ( 12 foils / pkt ) , consumable [ mis93 ] 12.18 polyester braided coated with cd white dn 17 mm ( curved rev cut ) cut 90 cm 2 / 0 ( 12 foils / pkt ) 12.19 polyester braided coated with cd white dn 17 mm curved rb 90cm 2 / 0 ( 12 foils / pkt ) 12.2 5 0 da polyglactin 910 coated with polyglactin 910 and calcium state mono with 1 / 4 circle spatulated needle ( 12 foils / pkt ) , consumable 12.21 whitacre pencil point spinal needle 25 g with introducer [ 12.22 lead letter 0 9 sets ( 100 clips / pkt ) 12.23 lead letter a to z set [ 12.24 cassette ( 12 x 15 ) , consumable 12.25 cassette ( 10 x 12 ) , consumable 12.26 gloves latex autoclavable ( 8 no ( pair ) made of natural latex micro rough finish for better grip ) , consumable [ mis59 ] 12.27 sulfamethoxazole and trimethoprim suspension 50ml ( ) , suspension [ 12.28 sargramostim ( recombinant human granulocyte macrophage colony stimulating factor ) ( 500 mcg / ml ) , injection 12.29 magnesium suplhate injection i.p.50 % w / v 10ml amp 12.3 gentamicin inj. 40 mg / ml, 2ml amp 12.31 white petrollium jelly 1kg 12.32 white petrollium jelly 20 kg 12.33 hypodermic syringe for single use ( 10ml bp / bis ( without needle ) ) , syrings 12.34 hypodermic syringe for single use 2ml bp / bis ( without needle ) , syrings 12.35 hypodermic syringe for single use 5ml bp / bis ( without needle ) , syrings [ 700356 ] 12.36 ptfe material, iv cannula ( with luer lock, g 18 ) , consumable [ 700357 ] 12.37 diclofenac gel 1% 10gm tube 12.38 schirmer strip for ophthalmic use 12.39 actinomycin d ( 0.5mg vial ) , injection [ 12.4 cytra.bine 100 mg vial 12.41 ifosphamide + mesna ( 1gm ) , injection [ 12.42 vincristin sulphate 1 mg vial ( ) , vial [ 12.43 azithromycin ( 500 mg / 5ml inj ) , vial 12.44 carboprost promithamin ( 1ml amp ) ( 250mcg / ml ) , injection 12.45 metformine 500mg + glibenclamide 5mg ( tab ) , tablet 12.46 ampicillin ( 250 mg ) , capsule [ 12.47 metronidazole 100mg / 5ml ( 30ml ) , syrup 12.48 prednisolone ( dt tablets also accepted ) ( 5mg ) , tablet 12.49 salmeterol 25 mcg + fluticasone 125 mcg ( 120mdi ) , inhaler 12.5 salmeterol 25 mcg + fluticasone 250 mcg inhaler ( 120mdi ) ( 250 mcg ) , inhaler 12.51 enoxaparin sodium 40mg ( 20mg / 0.2ml ) prefilled syringe inj ( syringe inj ) , syrings [ 12.52 meropenem ( 1000 mg ( vial ) ) , injection 12.53 ceftriaxone 1000mg + sulbactam 500mg ( vial ) , injection 12.54 paracetamol 1000mg i v infusion ( 100 ml ffs bottle ) , injection 12.55 vitamin d3 granules ( 60000 iu sachet ) , powder 12.56 risperidone ( 1mg ) , tablet 12.57 hcg ( human chorionic gonadotropin ) inj 5000 iu vial 12.58 azithromycin 1gm + cefixime 400mg ( ( 1 + 1 tab ) ) , tablet 12.59 vitamin a ( soft gelatin cap ) 50000 i.u 12.6 chlorpromazine ( 50 mg ) , tablet 12.61 surfactant bovine ( 135 mg phopholipid per 5 ml / 5ml vial ) , vial 12.62 sterlium 500 ml 12.63 glucometer strip ( 1x100 ) 12.64 aceborophylline ( 100 mg ) , capsule 12.65 sildenafil ( 50 mg ) , tablet 12.66 ursodeoxycholic acid ( 150 mg tab ) , tablet 12.67 ursodeoxy cholic acid 300 mg tab 12.68 vitamin e usp ( 400 mg ) , capsule 12.69 benzyl benzoate lotion 25% ( 100ml bottle ) , bottle 12.7 disposable needles is ( 10654:2002 26 g ) , needle 12.71 hypodermic syringe for single use 1ml, is : 10258 ( 10 ml vial ) , syrings 12.72 spinal needle g 22 l 120 mm*0.71 / piece 12.73 spinal needle g 27 l 120 mm*0.40 / piece 12.74 hypodermic needles for single use gauze 22 bis length, 25 +1 / 2 12.75 hypodermic needles for single use gauze 23 bis length, 25 +1 / 2 12.76 feeding tube ( catheter ) ( 10 g, each ) , consumable ] 12.77 amoxicillin trihydrate dispersible 125 mg tab ( 125 mg ) , tablet ] 12.78 iron and folic acid sugar coated tab dried ferrous sulphate ip eq. to 45 mg ferrous iron and 400 mcg folic acid ip ( pink colored tab ) wifs junior ifa tablets ( detail specification as per tender ) ( 400 mcg ) , tablet 12.79 phenytoin sodium 250 mg / 5 ml ( 5ml vial ) , injection 12.8 dextromethorphan hydrobromide syrup 13.5 mg / 5ml ( 30 ml bottle ) , syrup 12.81 diphtheria antitoxin 10000 iu ( 10ml vial ) , injection 12.82 glass slide with isi mark at least 75mm x 25 mm thickness at least 1.1mm, detail specifications i with smooth edges, without any scrathtches. ii glazed glass.iii no visual or chromatic abbretions ( 50 slides / packet ) , consumable 12.83 cover slip with isi marked size:18x18mm ( + / 1.00mm ) , thikness 0.13.. to 0.17mm ( pkt of 50 pieces ) , consumable 12.84 spinal needle ( 24 g ) , consumable 12.85 absorable surgical suture rb needle size no 1 0, 30 mm length 70 cm , 12 foils per packet , polyglycolic acid ( pga ) [ 12.86 catgut chromic with 1 / 2 cir rb needle 30 mm length 70cm no. 1 0, 12 foils per packet ( needle 30 mm length 70cm no. 1 0, 12 foils per packet ) , consumable [ 12.87 kellys pad ( rubber / each ) , consumable 12.88 disposable syringe with needle ( 3ml each ) , syrings 12.89 disposable syringe with needle ( 2ml each ) , syring ] 12.9 medical x ray film polyester based imaging film 30.5 cm x 30.5cm ( 12x12 ) size: 50 sheets in one packet 12.91 medical x ray film polyester based imaging film 35.6cm x 35.6cm ( 14x14 ) size: 50 sheets in one packet 12.92 medical x ray film polyester based imaging film 35.6 cm x 43.2cm ( 14x17 ) size: 50 sheets in one packet 12.93 syrup cefpodoxime ( 50 mg ) , syrup 12.94 a.v. blood line ( post haemodialysis tubing ) 12.95 non foldable iol sterile lens pc+14d ( 2 ) , pc+16d ( 3 ) , pc+18d ( 5 ) , pc+19d ( 5 ) , pc+19.5d ( 5 ) , pc+20d ( 15 ) , pc+20.5d ( 15 ) , pc+21d ( 13 ) , pc+21.5d ( 10 ) , pc+22d ( 10 ) , pc+22.5d ( 5 ) , pc+23d ( 5 ) , pc+24d ( 3 ) , pc+26d ( 2 ) , ac+19d ( 2 ) ( box ) , lens 12.96 total protein test kit ( 100 ml bottle ) , consumable 12.97 cervical collar / each soft, ( medium sized ) , consumable 12.98 baby diapers small ( 10 diaper per pkt ) , consumable 12.99 gauze sponge / each ( size 3 x 3 ) , consumable 13 chadar medical bleach ( name print ) ( 54 inch x 90 inch tana x bana ( 2 / 40 s x 20 s ) reed x pik ( 52 x 54 / inch ) ) 13.01 chadar medical bleach ( 60 inch x 90 inch tana x bana ( 2 / 40 s x 20 s ) reed x pik ( 52 x 54 / inch ) ) , 13.02 chadar medical bleach ( ( name print ) 60 inch x 90 inch tana x bana ( 2 / 40 s x 20 s ) reed x pik ( 52 x 54 / inch ) ) , 13.03 dr sheet bleach ( 45 inch x 54 inch tana x bana ( 2 / 40 s x 20 s ) reed x pik ( 52 x 54 / inch ) ) , 13.04 sheeting cloth bleach ( 1 m x 54 inch tana x bana ( 2 / 40 s x 20 s ) reed x pik ( 52 x 54 / inch ) ) , 13.05 pillow cover cloth bleach ( 1 m x 40 inch tana x bana ( 2 / 40 s x 20 s ) reed x pik ( 52 x 54 / inch ) ) , 13.06 chadar rangeen check ( 54 inch x 90 inch tana x bana ( 2 / 40 s x 20 s ) reed x pik ( 52 x 54 / inch ) ) , 13.07 chadar rangeen ( ( name print ) 54 inch x 90 inch tana x bana ( 2 / 40 s x 20 s ) reed x pik ( 52 x 54 / inch ) ) , 13.08 chadar rangeen ( 60 inch x 90 inch tana x bana ( 2 / 40 s x 20 s ) reed x pik ( 52 x 54 / inch ) ) , 13.09 chadar rangeen ( ( name print ) 60 inch x 90 inch tana x bana ( 2 / 40 s x 20 s ) reed x pik ( 52 x 54 / inch ) ) , 13.1 table cloth rangeen ( 54 inch x 48 inch tana x bana ( 2 / 40 s x 20 s ) reed x pik ( 52 x 54 / inch ) ) , 13.11 table cloth rangeen ( 72 inch x 48 inch tana x bana ( 2 / 40 s x 20 s ) reed x pik ( 52 x 54 / inch ) 13.12 curton cloth rangeen ( 1 m x 48 inch tana x bana ( 2 / 20 s x 10 s ) reed x pik ( 36 x 34 / inch ) ) 13.13 curton cloth rangeen design ( 1 m x 48 inch tana x bana ( 2 / 20 s x 10 s ) reed x pik ( 36 x 36 / inch ) ) , 13.14 honeycomb towel bleach ( 54 inch x 27 inch tana x bana ( 2 / 20 s x 10 s ) reed x pik ( 40 x 40 / inch ) ) , 13.15 napkin bleach ( 27 inch x 17 inch tana x bana ( 2 / 20 x 10 s ) reed x pik ( 40 x 40 / inch ) ) , 13.16 do suti bleach ( 1 m x 50 inch tana x bana ( 20 s x 14 s ) reed x pik ( 32 x 32 / inch ) ) 13.17 gaadi pot patta ( 1 m x 45 inch tana x bana ( 2 / 20 s 10 s ) reed x pik ( 36 x 32 / inch ) ) 13.18 basta cloth ( 36 inch x 36 inch tana x bana ( 10 s x 10 s ) reed x pik ( 28 x 26 / inch ) ) , 13.19 basta cloth ( 44 inch x 44 inch tana x bana ( 10 s x 10 s ) reed x pik ( 28 x 26 / inch ) ) , 13.2 patient cloth ( 1 m x 54 inch tana x bana ( 2 / 40 s x 20 s ) reed x pik ( 48 x 52 / inch ) ) 13.21 astar cloth ( 1 m x 54 inch tana x bana ( 2 / 40 s x 20 reed x pik ( 48 x 52 / inch ) ) 13.22 peticote / blauge cloth shuti bleach ( 1 m x 40 inch tana x bana ( 2 / 60 s x 2 / 60 s ) reed x pik ( 60 x 60 / inch ) ) , 13.23 peticote blauge cloth shuti rangeen ( 1 m x 40 inch tana x bana ( 2 / 60 s x 2 / 60 s ) reed x pik ( 60 x 60 / inch ) ) , 13.24 gray duster cloth ( 24 inch x 24 inch tana x bana ( 10 s x 10 s ) reed x pik ( 20 x 24 / inch ) ) , 13.25 gray duster cloth ( 28 inch x 28 inch tana x bana ( 10 s x 10 s ) reed x pik ( 20 x 24 / inch ) ) , 13.26 macchardaani kapda cotten ( 1 m x 53 inch tana x bana ( 2 / 40 s x 20 s ) reed x pik ( 40 x 40 / inch ) 13.27 chadar check rangeen ( 84 inch x 48 inch tana x bana ( 2 / 40 s x 20 s ) reed x pik ( 52 x 54 / inch ) ) , 13.28 chadar check rangeen naam print ( 84 inch x 48 inch tana x bana ( 2 / 40 s x 20 s ) reed x pik ( 52 x 54 / inch ) ) , 13.29 blauze cloth tericat rangeen ( 1 m x 40 inch tana x bana ( 83 / 34d x40 cott. ) reed x pik ( 72 x 72 / inch ) ) , 13.3 tericat shirting cloth ( 1 m x 36 inch tana x bana ( 2 / 60s x 60 p.v. ) reed x pik ( 68 x 64 / inch ) ) , 13.31 tericat shuting ( 1 m x 56 inch tana x bana ( 2 / 30p : vx2 / 30 p:v ) / 65:35 reed x pik ( 60 x 48 / inch ) ) , 13.32 gauze cloth bleach 91cm x 20m tana x bana ( 26 s 26 s ) reed x pik ( 17 x 14 / inch ) , 13.33 bandage cloth bleach 1 m x 20 m tana x bana ( 26 x 26 s ) reed x pik ( 34 x 24 / inch ) , 6 ] 13.34 blazer cloth ( woolen 1 m x 54 inch tana x bana ( 8 n.m. x 8 n.m. ) reed x pik ( 28 x 24 / inch ) ) , 13.35 cotten sharee safed / rangeen ( 46 inch x 5.50m tana x bana 2 / 120sx80s reed pik 80 x 70 72 / inch ) ) , 13.36 tericot sharee rangin ( 46 x 5.50m tana x bana ( 2 / 120sx83 / 34 poly reed x pik ( 72 x80 / inch ) ) , 13.37 razai cloth ( 1 mts x 54 inch tana x bana ( 2 / 40s x 20s ) reed x pik ( 44 x44 / inch ) ) , 13.38 tericot astar cloth ( 1 mts x 54 inch tana x bana ( 2 / 60pv x 155d. ) reed x pik ( 68 x64 / inch ) ) , 13.39 tericat macchardani gray cloth ( 1 mts x 53 inch tana x bana ( 2 / 60pv x 30 p.v. ) reed x pik ( 48 x46 / inch ) 13.4 roll bandage 15 cm x 05 m tana x bana ( 26s x 26s ) reed x pik ( 34x 24 ) , 13.41 roll bandage 10 cm x 05 m tana x bana ( 26s x 26s ) reed x pik ( 34x 24 ) , 13.42 roll bandage 7.5 cm x 05 m tana x bana ( 26s x 26s ) reed x pik ( 34x 24 ) , 13.43 roll bandage 05 cm x 05 m tana x bana ( 26s x 26s ) reed x pik ( 34x 24 ) , ] 13.44 chadar medical bleach ( 54 inch x 90 inch tana x bana ( 2 / 40 s x 20 s ) reed x pik ( 52 x 54 / inch ) ) , 13.45 sodium hypochlorite solution 100 ml bottle 13.46 lignocaine hydrochloride for spinal anaesthesia ( heavy ) ( 0.05 2 ml amp ) , injection 13.47 bupivacaine hcl for spinal anaesthesia ( 0.5% ( heavy ) ) , injection 13.48 medical oxygen steel / aluminium cylinder ( 10 water cap ) with gas specific pin system ( 10 liters ) , inhalation 13.49 flumazenil 0.1 mg / ml 5 ml multiple dose vial 13.5 carbamazepine ( 100 mg / 5 ml 100 ml bottle ) , 13.51 amoxicillin ( 250 mg / vial ) , injection 13.52 amoxicillin + clavulanic acid ( 125 mg + 25 mg ) , injection 13.53 cefixime 10 ml bottle ( 100 mg / 5 ml ) , suspension 13.54 cefpodoxime ( 50 mg ( dt tablet also acceptable ) ) , tablet 13.55 cephalexin dispersible ( 125 mg ) , tablet 13.56 chloramphenicol ( 500 mg ) , capsule 13.57 penicillin v 125 mg 13.58 penicillin v ( phenoxymethyl penicillin potassium ) ( 250 mg ) , tablet 13.59 tinidazole 150 mg / 5 ml ( 60 ml bottle ) , suspension 13.6 diethylcarbamazine ( 50 mg ) , tablet 13.61 epirubicin inj 100mg / vial vial ( each ) , injection 13.62 methotrexate tab ( 5 mg ) , tablet 13.63 levodopa + carbidopa 200 mg + 50 mg 13.64 dobutamine ( 12.5 mg / ml 20 ml vial ) , injection 13.65 fusidic acid 0.02 ( 15 gm ) , cream 13.66 metronidazole 1% ( 15 gm tube ) , ointment 13.67 salicylic acid ( 0.02 30 gm ) , ointment [ 13.68 chlorthalidone ( 50 mg ) , tablet 13.69 torasemide ( 20 mg / 2 ml vial ) , injection 13.7 dicyclomine hydrochloride oral solution 10 mg 30 ml bottle ( 10 mg ) , solution 13.71 doxylamine succinate ( 10 mg ) , tablet 13.72 ondansetron ( 2 mg ) , tablet 13.73 dydrogesterone ( 10 mg ) , tablet 13.74 micronised progestrone ( 200 mg ) , tablet 13.75 cabergoline ( 0.5 mg 4 tablets / strip ) , tablet 13.76 fluconazole eye drop 3 mg / ml ( 10 ml vial ) , eye [ 13.77 gentamycin + hydrocortisone 0.3% + 1% ( 5 ml vial ) , ear drops 13.78 fluconazole 0.3% eye / ear ( 5 ml ) , drop 13.79 cerumenolytic ( for ear wax ) each 10 ml contains paradichlorobenzene 2%benzocaine 2.7%chlorbutol 5%turpentine oil 15% ( 10 ml vial ) , ear drops 13.8 fluphenazine ( 2.5 mg ) , tablet 13.81 fluoxetine ( 10 mg ) , tablet or capsule 13.82 sertraline ( 50 mg ) , tablet 13.83 venlafaxine ( 75 mg ) , capsule 13.84 salbutamol sulphate ( 2 mg ) , tablet 13.85 formaldehyde ( formalin ) 34% acq 450 ml bottle 13.86 sodium hypochlorite ( 0.03 5 ltr ) , solution 13.87 albendazole 100 mg ( tab ) , tablet 13.88 albendazole tab ( 200 mg ) , tablet 13.89 alfacalcidiol capsule ( 0.25 mcg ( soft gelatin capsule also acceptable ) ) , capsule 13.9 amitryptiline tab ( 50 mg ) , tablet 13.91 amitryptiline ( 75 mg ) , tablet 13.92 atorvastatin ( 5 mg ) , tablet 13.93 benzoic acid + salicylic acid ( 6% + 3% ( 15 gm tube ) ) , ointment 13.94 benzoyl peroxide 2.5% 20 gm ( ointment / gel ) , tube 13.95 busulphan ( 2 mg ) , tablet 13.96 capreomycin 1000 mg / vial injection ( 10 ml ) , vial 13.97 chlorambucil ( 2 mg ) , tablet 13.98 ciprofloxacin 125 mg / 5 ml 60 ml bottle ( 125 mg / 5 ml 60 ml bottle ) , suspension 13.99 ciprofloxacin + tinidazole ( 250 mg + 300 mg ) , tablet 14 clindamycin ( 1% w / w 10 gm ) , gel 14.01 clobazam ( 5 mg ) , tablet [ 14.02 clobazam ( 10 mg ) , tablet 14.03 clonazepam 0.25 mg ( tablet ) , tablet 14.04 clonazepam ( 1 mg ) , tablet 14.05 cloxacillin cap ( 250 mg ) , capsule 14.06 cloxacillin ( 250 mg / vial ) , injection 14.07 cloxacillin ( 125 mg / 5 ml 40 ml bottle ) , syrup 14.08 colistin sulphate ( 12.5 mg / 5 ml 30 ml bottle ) , suspension 14.09 crystalline penicillin 5 lakh iu / vial ( vial ) , injection 14.1 cycloserine 250mg ( capsule ) , capsule 14.11 daunorubicin 50 mg / vial vial 14.12 didanosine 250 mg 14.13 didanosine ( 400 mg ) , capsule 14.14 dimercaprol 50 mg / ml ( 2 ml amp ) , injection 14.15 ephedrine 30 mg / ml ( 1 ml amp ) , injection 14.16 estradiol cypionate + medroxy progesterone acetate 5 mg + 25 mg / 0.5 ml 0.5 ml ( ) , injection 14.17 ethacridine lactate 1 mg / ml ( 50 ml ) , infusion 14.18 ethinyl estradiol 0.01 mg 10 tablets 14.19 ethinyl estradiol 0.05 mg 10 tablets 14.2 etoposide ( 50 mg ) , capsule 14.21 fluconazole ( 50 mg ) , tablet 14.22 fluconazole 100 mg [ 14.23 fluconazole ( 200 mg ) , tablet [ 14.24 flunarizine ( 10 mg tab ) , tablet 14.25 human chorionic gonadotropin 2000 iu / ml 1 ml amp 14.26 hydrochlorthiazide ( 12.5 mg ) , tablet 14.27 iron dextran 50 mg / ml ( 2 ml amp ) , injection ] 14.28 levamisole ( 50 mg ) , tablet 14.29 levocetirizine + monteleukast ( ( 2.5 mg + 4 mg ) / 5 ml, 30 ml bottle ) , syrup [ 14.3 lithium carbonate ( sr ) ( 450 mg ) , tablet 14.31 medroxy progesterone acetate ( 150mg / ml 1 ml amp ) , injection 14.32 mesalamine ( 5 aminosalicylic acid ) usp ( 800 mg ) , tablet 14.33 methotrexate ( 7.5 mg ) , tablet 14.34 methylcobalamin inj ( 500 mcg / ml ( 10 ml vial ) ) , injection 14.35 methylcobalamin / mecobalamin ( 500 mcg ) , tablet 14.36 metoclopramide syrup ( 5mg / 5ml ( 30 ml bottle ) ) , syrup 14.37 mirtazapine ( 7.5 mg ) , tablet 14.38 misoprostol 400 mcg ( 4 tablets / strip ) , tablet 14.39 ofloxacin + ornidazole ( 50 mg + 125 mg ) / 5ml 30 ml bottle ( 30 ml ) , suspension 14.4 olanzapine ( 2.5 mg ) , tablet [ 14.41 olanzapine ( 7.5 mg ) , tablet 14.42 omeprazole ( 10 mg ) , capsule 14.43 omeprazole capsule ( 40 mg ) , capsule 14.44 ornidazole tab ( 500 mg ) , tablet 14.45 oxcarbazepine 150 mg 14.46 oxcarbazepine ( 300 mg ) , tablet 14.47 oxcarbazepine ( 600 mg ) , tablet 14.48 pancuronium 2 mg / ml ( 2 ml amp ) , injection 14.49 procaine penicillin 4 lac iu / vial vial ( ) , injection 14.5 ribavirin ( 200 mg ) , tablet capsule 14.51 roxithromycin ( 50 mg / 5 ml 30 ml bottle ) , syrup 14.52 roxithromycin ( 300 mg ) , tablet [ 14.53 secnidazole ( 500 mg tab ) , tablet 14.54 sodium valproate + valproate ( 333 mg + 145 mg ) , tablet 14.55 venlafaxine er / pr ( 37.5 mg ) , tablet or capsule 14.56 venlafaxine ( 150 mg ) , tablet or capsule 14.57 acarbose ( 25 mg ) , tablet 14.58 atenolol ( 25 mg ) , tablet 14.59 cefadroxil 250 mg ( tab ) , tablet 14.6 cefepime ( 250 mg / vial ) , injection 14.61 cefpodoxime tablet 100 mg ( dt tablet also acceptable ) , tablet 14.62 dextrose, d 50 0.5 25 ml ( 25 ml ) , injection [ 14.63 dextrose, d 25 0.25 25 ml ( 25 ml ) , injection 14.64 aceclofenac + paracetamol + chlorzoxazone ( 100 mg + 500 mg + 500 mg ) , tablet 14.65 amisulpride ( 100 mg ) , tablet 14.66 amisulpride ( 50 mg ) , tablet 14.67 amisulpride ( 200 mg ) , tablet 14.68 amitriptyline ( 10 mg ) , tablet 14.69 amoxicillin 100 mg / ml ( 10 ml with dropper ) , drop 14.7 amoxicillin + clavulanic acid ( 200 mg + 28.5 mg ) , tablet 14.71 aripiprazole ( 10 mg ) , tablet 14.72 aripiprazole 15 mg ( tablet ) , tablet 14.73 aripiprazole ( 20 mg tab ) , tablet 14.74 aripiprazole ( 5 mg tab ) , tablet 14.75 atropine + dexamethasone + chloramphenicol 1% + 0.1% + 0.5% ( 5 ml ) , eye drop 14.76 benzathine penicillin ( 24 lac iu / vial vial ) , injection 14.77 bismuth iodoform paraffin paste ( 200 gm jar ) , ointment 14.78 butorphanol tartrate 1mg / ml ( 1 ml ) , injection 14.79 calcitriol cap ( 0.25 mcg ) , tablet 14.8 calcium acetate ( 667 mg ) , tablet 14.81 cefixime + azithromycin 200 mg + 250 mg ( tab ) , tablet 14.82 cefoperazone 1gm / vial vial 14.83 cefotaxime + sulbactam 1000 mg + 500 mg vial ( 1000 mg + 500 mg ) , injection 14.84 ceftriaxone tab ( 250 mg ) , tablet 14.85 cefuroxime 500 mg 10 x 10 ( 500 mg ) , tablet 14.86 cefuroxime 250 mg 10 x 10 ( 250 mg ) , tablet 14.87 cephalexin 100 mg / ml ( 10 ml with dropper ) , drop 14.88 cetrimide + choline salicylate 0.01% + 8% all w / v ( 10 gm tube ) , gel 14.89 chloramphenicol 1% w / w ( 50 / pack ) , eye applicap 14.9 chloraxozone + paracetamol ( 250 mg + 500 mg ) , tablet 14.91 chlordiazepoxide ( 20 mg ) , tablet 14.92 chlordiazepoxide ( 25 mg ) , tablet [ 14.93 chlordiazepoxide ( 10 mg ) , tablet 14.94 cholecalciferol ( 60000 iu ) , tablet 14.95 gel containing choline salicylate + benzalkonium chloride 9% + 0.02% ( 10 gm ) , gel [ 20200913 ] 14.96 clobetasol propionate 0.05% ( 15 gm tube ) , cream [ 14.97 clomiphene citrate ( 100 mg tab ) , tablet 14.98 clomipramine ( 75 mg ) , tablet 14.99 clomipramine 25 mg ( tablet ) , tablet 15 clomipramine ( 50 mg ) , tablet 15.01 clotrimazole ( 1% 100 gm ) , powder [ 15.02 clotrimazole 1% w / v ( 15ml ) , mouth paint 15.03 clotrimazole ( 1% 15 ml ) , lotion 15.04 clotrimazole ( 1% w / w 30 gm ) , powder 15.05 clozapine ( 100 mg ) , tablet 15.06 cyclobenzaprine ( 5 mg ) , tablet [ 15.07 cyclopentolate 1% w / v ( 5 ml ) , eye drop 15.08 cyclosporine 50 mg 15.09 cyclosporine 25 mg 15.1 des venlafaxine ( 50 mg ) , tablet 15.11 des venlafaxine ( 100 mg ) , tablet 15.12 diacerein + glucosamine ( 50 mg + 750 mg ) , capsule 15.13 diazepam ( 10 mg ) , tablet 15.14 diclofenac sodium + paracetamol +serratiopeptidase ( 50 mg +325 mg + 10 mg ) , tablet 15.15 diclofenac+paracetamol+chlorzoxazoe ( 50 mg + 325 mg + 250 mg ) , tablet 15.16 dicyclomine 20mg+paracetamol 325mg ( tab ) , tablet 15.17 disodium acid phosphate + sodium phosphate 10 gm + 8 gm / 100 ml 100 ml ( ) , enema 15.18 divalproex sodium ( 500 mg tab ) , tablet 15.19 divalproex sodium ( 750 mg ) , tablet 15.2 divalproex sodium ( 250 mg ) , tablet 15.21 domperidone ( 1 mg / ml 10 ml with dropper ) , drop 15.22 doxophylline ( 400 mg ) , tablet 15.23 duloxetine ( 40 mg ) , tablet 15.24 duloxetine ( 20 mg ) , tablet 15.25 elemental iron 50 mg / ml 15 ml with dropper ( 15 ml with dropper ) , drop 15.26 elemental iron ( 50 mg / 5 ml ) , syrup 15.27 eltrombopag ( 25 mg ) , tablet 15.28 eplerenone ( 25 mg ) , tablet 15.29 escitalopram ( 5 mg ) , tablet 15.3 escitalopram ( 20 mg ) , tablet 15.31 escitalopram + clonazepam ( 10 mg + 0.5 mg ) , tablet 15.32 esmolol 100 mg / vial ( vial ) , injection 15.33 estradiol 1 mg / gm ( 15 gm tube ) , cream 15.34 estradiol 10 mg / vial ( vial ) , injection 15.35 fluvoxamine ( 50 mg ) , tablet 15.36 fluvoxamine ( 100 mg ) , tablet 15.37 flurbiprofen sodium 0.03% ( 5 ml ) , eye drop 15.38 gabapentine ( 100 mg ) , tablet 15.39 gentamicin + betamethasone 0.3% w / v + 0.1% w / v 5 ml ( ) , eye drop 15.4 gentamycin 40 mg / ml 10 ml vial ( 10 ml vial ) , injection 15.41 glimepiride + metformin hydrocloride sr ( 1 mg + mg ) , tablet 15.42 glycerine + sodium chloride enema ( 15% + 15% 20 30 ml / pack ) , enema 15.43 glycerine suppository usp ( 3 gm bottle / 10 ) , suppository 15.44 glycerine + mag sulphate crystal 250 ml jar 15.45 granisetron 1 mg / ml ( 1 ml amp ) , injection 15.46 haemocoagulase 1 iu / ml 10 ml 15.47 heparin 25000 iu ( 5 ml ) , injection 15.48 homatropine 2% ( 1 ml vial ) , eye drop 15.49 hyaluronidase 1500 iu / 2 ml ( 2 ml amp / vial ) , injection 15.5 ibuprofen ( 200 mg ) , tablet 15.51 icthyol glycerine 1% 30 ml 15.52 intraocular irrigating solution sodium chloride 0.49 % w / v, potassium chloride 0.075 % w / v, calcium chloride 0.048 %, magnesium chloride 0.03 % w / v, sodium acetate 0.39 % w / v, sodium citrate 0.17 % w / v. 500 ml ffs ( ) , infusion 15.53 isoprenaline 2 mg / ml ( 1 ml ) , injection 15.54 lactobacillus 150 million spores ( 1 sachet ) , powder 15.55 lamotrigine dt tab ( 100 mg ) , tablet [ 15.56 lamotrigine dt ( 50 mg ) , tablet 15.57 levetiracetam 500 mg 15.58 levocetirizine + monteleukast ( 5 mg + 10 mg ) , tablet 15.59 magnesium hydroxide + aluminium hydroxide simethecon 250 mg + 250 mg + 50 mg / 5 ml 170 ml bottle ( syrup ) , syrup 15.6 mefenamic acid + dicyclomine tab ( 250 mg + 10 mg ) , tablet 15.61 mefenamic acid + drotaverine hcl ( 250 mg + 80 mg ) , tablet 15.62 metformin + glimepiride ( 500 mg + 2 mg tablet ( sr form also acceptable ) ) , tablet 15.63 methocarbamol 100 mg / ml ( 10ml ) , injection 15.64 methylcobalamin + alpha lipoic acid ( 1500 mcg + 100 mg ) , capsule 15.65 methylcobalamine ( vitamin b12 ) 500 mcg / ml 3 ml 15.66 metoprolol + amlodipin ( 25 mg + 2.5 mg ) , tablet ] 15.67 metoprolol + ramipril ( 25 mg + 2.5 mg ) , tablet 15.68 micronised progesterone ( 400 mg ) , capsule 15.69 micronised progestrone ( 50 mg / ml 4 ml amp ) , injection 15.7 mirtazapine 15 mg ( tablet ) , tablet 15.71 mometasone 0.10% ointment / cream ( mometasone furoate also acceptable ) , ointment [ 15.72 moxifloxacin 0.5% w / v ( 5 ml ) , eye drop 15.73 moxifloxacin + prednisolone 5 mg + 3 mg / 5 ml 5 ml ( ) , eye drop 15.74 moxifloxacine + dexamethasone 0.5% + 0.1% w / v 5 ml ( ) , eye drop 15.75 netilmycin 25 mg / ml 1 ml ( vial ) , injection 15.76 nicorandil ( 5 mg 10 x 10 ) , tablet 15.77 nicotine 2 mg ( 2 mg ) , gum 15.78 nicotine 4 mg ( 4 mg ) , gum 15.79 nicotine 14 mg ( 14 mg ) , transdermal patch 15.8 nicotine ( 2 mg ) , lozenges 15.81 nicotine transdermal patch ( 21 mg ) , transdermal patch 15.82 nicotine transdermal patch ( 7 mg ) , transdermal patch 15.83 nifedipine ( sublingual ) ( 10 mg ) , capsule 15.84 nimesulide +paracetamol ( 100 + 325 mg ) , tablet 15.85 nimesulide +paracetamol+serratiopetidase ( 100 + 325 + 10 mg ) , tablet 15.86 nitrazepam ( 5 mg ) , tablet 15.87 norethisterone enanthate 200 mg / ml ( 1 ml ) , injection 15.88 norfloxacin ( 200 mg ) , tablet [ 15.89 nortriptyline ( 10 mg ) , tablet 15.9 omeprazole + domperidone 20 mg + 10 mg ( capsule ) , capsule 15.91 paracetamol + chlorphenaramine+ phenylephrine ( 250 mg + 2.5 mg + 10 mg ) , tablet 15.92 paracetamol + phenylephrine + chlorpheniramine maleate ( 125mg+2.5 mg+1mg ) / ml ( 15 ml bottle with dropper ) , drop 15.93 paroxetine cr ( 25 mg ) , tablet 15.94 paroxetine cr ( 12.5 mg ) , tablet [ 15.95 petrollium jelly ip ( 500 gm ) , gel 15.96 phenylepherine hcl & tropicamide 5% + 1% 5 ml [ 120566 ] 15.97 piperacillin + tazobactam 2000 mg + 250 mg 20ml vial ( 2000 mg + 250 mg 20ml vial ) , injection 15.98 piperacillin + tazobactam 1000 mg + 125 mg vial 10 ml vial ( ) , injection 15.99 piracetam 200 mg / 15 ml ( 15 ml ) , injection [ 16 pregabalin + methylcobalamin ( 75 mg + 750 mcg ) , tablet or capsule [ 16.01 promethazine ( 50 mg ) , tablet 16.02 proparacaine 0.50% 5 ml / vial 16.03 propranolol ( tab 20 mg ) , tablet 16.04 povidone iodine + metronidazole ( 5 % + 1 % ) , ointment 16.05 providone iodine 1% ( 5 ml ) , eye drop 16.06 pyridostigmine ( 60 mg ) , tablet 16.07 quetiapine ( 200 mg ) , tablet 16.08 quetiapine ( 100 mg ) , tablet 16.09 quetiapine ( 50 mg ) , tablet 16.1 quinine dihydrochloride 150 mg / ml 2 ml ( amp ) , injection 16.11 rabeprazole ( 10 mg ) , capsule 16.12 ranitidine 15 mg / ml ( 100 ml bottle ) , syrup 16.13 risperidone + trihexiphenidyle ( 3 mg + 2 mg ) , tablet 16.14 risperidone + trihexiphenidyle ( 2 mg + 2 mg ) , tablet 16.15 risperidone + trihexiphenidyle ( 4 mg + 2 mg ) , tablet 16.16 rosuvastatin ( 10 mg ) , tablet 16.17 s adenosyl l methionine ( 400 mg ) , tablet 16.18 salbutamol 2.5 mg / 3 ml ( 3ml ) , injection 16.19 serratiopeptidase ( 10 mg ) , tablet 16.2 sertraline ( 100 mg ) , tablet 16.21 silver nitrate ( 500 ml each ) , liquid 16.22 sodium chloride ( ophthalmic ) 5% ( 10 ml ) , eye drop 16.23 sodium hyaluronate ( intraocular ) ( 10 mg / ml 2ml ) , injection 16.24 sodium valporate ( 300 mg ) , tablet 16.25 tamsulosin + dutasteride 0.4 mg + 0.5 mg ( tab ) , tablet 16.26 tannic acid with glycerine ( gum paint ) 80% + 20% 10 ml vial ( 10 ml ) , lotion 16.27 teicoplanin ( 200 mg / vial ) , injection 16.28 tetracycline eye ointment 1% 5 gm 16.29 thalidomide 100 mg 16.3 thiocholchecocide ( 8 mg ) , tablet 16.31 thiocholchecocide ( 4 mg ) , tablet 16.32 thyroxine sodium 25 mcg ( 100 per bottle ) , tablet 16.33 thyroxine sodium ( 75 mcg ) , tablet 16.34 tricholine citrate + sorbitol ( 550 mg + 7.15 g / 10 ml ) , syrup 16.35 trifluoperazine + trihexyphenidyle 5 mg + 2 mg ( tab ) , tablet 16.36 vitamin b12 500 mcg / ml 10 ml vial ( 10 ml vial ) , injection 16.37 vitamin d3 ( cholecalciferol ) ( 400 iu / ml ( 100 ml bottle ) ) , syrup 16.38 vitamin e 200 mg ( capsule 10 x 10 ) , capsule 16.39 vitamin e 50 iu / ml 10 ml ( bottle with dropper ) , drop 16.4 zinc sulphate / gluconate 10 mg elemental zinc / 5 ml ( 10 mg / 5 ml ) , syrup 16.41 zinc sulphate 10 mg elemental zinc / 5 ml ( 200 ml bottle ) , syrup 16.42 bleomycin ( 15 mg / vial vial ) , injection 16.43 hydroxypropyle methyle cellulose opthalmic solution ( 2% 2ml pfs ) , eye drop 16.44 diltiazem 5mg / 1ml ( 5 ml ) , injection 16.45 acamprosate ( 333 mg ) , tablet 16.46 agomelatine ( 25 mg ) , tablet 16.47 aripiprazole ( 30 mg ) , tablet 16.48 atomoxetine ( 10 mg ) , tablet 16.49 atomoxetine ( 25 mg ) , tablet 16.5 baclofen ( 20 mg ) , tablet 16.51 baclofen ( 30 mg tab ) , tablet 16.52 baclofen ( 40 mg tab ) , tablet 16.53 blonanserin ( 2 mg ) , tablet 16.54 blonanserin ( 4 mg ) , tablet 16.55 bupropion ( 150 mg ) , tablet 16.56 buspirone ( 10 mg ) , tablet 16.57 buspirone ( 5 mg ) , tablet 16.58 carbamazepine ( sr ) ( 100 mg ) , tablet 16.59 donepezil ( 10 mg ) , tablet 16.6 duloxetine ( 30 mg ) , tablet 16.61 fluoxetine ( 40 mg ) , capsule 16.62 flupenthixol ( 20 mg / ml 1 ml ) , injection 16.63 haloperidol ( 1.5 mg ) , tablet 16.64 imipramine ( 75 mg ) , tablet 16.65 lithium carbonate ( 400 mg ) , tablet 16.66 memantine ( 10 mg ) , tablet 16.67 methyl phenidate 10 mg ( tab ) , tablet 16.68 methyl phenidate ( 20 mg ) , tablet 16.69 mirtazapine ( 30 mg ) , tablet 16.7 modafinil ( 100 mg ) , tablet 16.71 naltrexone ( 50 mg ) , tablet 16.72 olanzapine ( 10 mg / vial vial ) , injection 16.73 paliperidone 1.5 mg ( tab ) , tablet 16.74 paliperidone ( 3 mg ) , tablet 16.75 procyclidine ( 5 mg ) , tablet 16.76 risperidone ( 4 mg ) , tablet 16.77 sodium valproate ( 100 mg / ml 5 ml ) , injection 16.78 tadalafil 10 mg 16.79 tianeptin 12.5 mg ( tab ) , tablet 16.8 topiramate 25 mg ( tab ) , tablet 16.81 topiramate 50 mg ( tab ) , tablet 16.82 topiramate 100 mg ( tab ) , tablet 16.83 trifluoperazine 5 mg 16.84 vitamin b1 ( thiamine ) 75 mg ( tab ) , tablet 16.85 zonisamide ( 50 mg ) , capsule 16.86 zonisamide 100 mg ( capsule ) , capsule 16.87 urine container 5ml disposable ( 50 per pkt ) 16.88 disposable syringe with needle ( 5ml each ) , needle 16.89 infant feeding tube ( catheter ) size: 3g ( no. ) , consumable 16.9 infant feeding tube ( catheter ) size: 4g 16.91 suction catheter assorted 9 no / each ( each ) , consumable 16.92 suction catheter assorted 10 no / each 16.93 dental x ray film size 31 x 41 mm ( 150 films / pkt ) ( size 31 x 41 mm ) , film 16.94 disposable syringe with needle ( 20ml each ) , needle 16.95 synthetic absorbable suture 3 / 0 with cd cutting needle size : 3 / 0 22mm length 45cm polyglycolic acid ( pga ) ( 12 foils per pkt ) ( needle circle size is 1 / circle ) , needle 16.96 infant feeding tube size: 5g 16.97 adhesive tape 7.5cm x10 ( mtr / roll ) , consumable 16.98 disposable plastic appron ( full size ) , consumable 16.99 hydralazine hydrochloride 20mg / ml injection ( 1 ml amp / vial ) [ 700449 ] 17 glycerine ip solution ( 100ml bottle ) , bottle 17.01 etiophylline +theophylline ( ( 46.5+14 ) mg / 5ml ( 100 ml bottle ) ) , syrup 17.02 disposable surgeon cap ( box of 100 caps ) , consumable 17.03 paediatric epidural set ( 19g needle, metal stylet, 22g catheter, 0.22micron epidural catheter lor syringe ) ( ) , consumable 17.04 oxygen nasal canula ( neonatal ) 7 white colour tubing and threaded nut ( 25 pcs / pkt ) , consumable 17.05 catgut chromic with 1 / 2 cir cutting needle 12mm ( length 70cm no.3 0, 12 foils per pakt ) , consumable 17.06 electrolyte e ( multiple electrolytes and dextrose inj type v ip ) i / v fluid ( each 100ml contains inj dextrose 5g, sod.acetate 0.64g, sod.chloride 0.50g, sodium citrate 0.075g, kcl 0.075g, ccl 0.035g, magnesium chloride 0.031g ) , infusion 17.07 electrolyte g ( multi electrolyte with 5% dextrose iv injection type iv ip ) intravenous fluid ( each 100ml contains: anhydrous dextrose 5 gm, sod.chloride 0.37g, potassium chloride 0.13g, ammonium chloride 0.37g ) , infusion 17.08 cetrimide 15% w / v + chlorhexidine 1.5% w / v ( 1 liter bottle ) , bottle 17.09 human albumin solution i.p. 20%w / v ( 100 ml ffs bottle / glass bottle ) , bottle 17.1 k3 blood vaccutainer ( edta 100 tubes / pkt ) , consumable 17.11 synthetic absorbable suture 2 / 0 with 1 / 2 cir rb needle size:2 / 0 30mm length 90cm polyglycolic acid ( pga ) 12 foils / pkt ( 12 foils per pkt ) , needle 17.12 synthetic absorbable suture 4 / 0 with 1 / 2 cir rb needle size:4 / 0 20mm length 70cm poly glycolic acid ( pga ) ( 12 foils / pkt ) ( size:4 / 0 20mm length 70cm poly glycolic acid ( pga ) ( 12 foils / pkt ) ) , needle 17.13 synthetic absorbable suture 3 / 0 with 1 / 2 cir cutting needle ( size:3 / 0 36mm length 70cm polyglycolic acid ( pga ) 12 foils / pkt ) , needle 17.14 b.b silk with 1 / 2 cir rb needle size:4 / 0 20 mm ( length at least 75 cm, 12 foils per packet ) , needle 17.15 prolene 1 0 rb 1 / 2 circle 30 mm, l 70 cm ( 12 foils / pkt ) , needle 17.16 prolene mesh ( 7.5 x 15 cm ) , needle 17.17 dengue ns 1 elisa ( antigen ) kit ( pack of 96 / as per attached specification in tender ) , consumable 17.18 blood bag 100ml 17.19 blood bag 350ml 17.2 insulin syringe / each ( graduation upto 100 units ) 30 g needle, 40 units / ml ( 30 g needle, 40 units / ml ) , syrings 17.21 silk no 1 cutting needle 1x12 ( 1x12 ) , consumable 17.22 neomycin and sulfacetamide sprinkling powder 5 gm ( each ) , consumable 17.23 distilled water 5 litre ( each ) , consumable 17.24 meropenem 250 mg / vial ( 250mg / vial ) , injection 17.25 ambu bag adult ( silicon ) ( each ) , consumable 17.26 ambu bag child ( silicon ) ( each ) , consumable 17.27 multivitamin with protein 200 ml ( 200 ml ) , syrup 17.28 aprin polyster ( std size ) , consumable 17.29 bed sheet white ( 60 inch x 90 inch ) , consumable 17.3 bed sheet cloured 50 inch x 80 inch 17.31 basta cloth ( 36 inch x 36 inch ) , consumable 17.32 compounder coat / lab tec / xry tec ( std size ) , consumable 17.33 curtain green redymade ( 45 inch x 60 inch ) , consumable 17.34 chair cushion box type ( 18 inch x 18 inch ) , consumable 17.35 chair cushion cover ( 19 inch x 19 inch ) , consumable 17.36 front aprin ( std size ) , consumable 17.37 livirise set female saree white polyster green / blue border [ saree + peticot + blouse ] 5 meter 17.38 livirise set male [ pent and shirt ] std size 17.39 mattress 5kg cotton ( 3 ft x 6 ft ) , consumable 17.4 napkin sup. quality std size 17.41 new born baby kit ( [ 4 piece set ] ) , consumable 17.42 whole sheet 35 inch x 35 inch 17.43 patient suit for male / female ( std size ) , consumable 17.44 pillow cover sup. quality ( 17 inch x 27 inch ) , consumable 17.45 pillow with 2kg cotton ( 16 inch x 26 inch ) , consumable 17.46 turkish towel sup. 25 inch x 50 inch 17.47 wollen saluka / coat for 4th class std size 17.48 chloramphenicol eye ointment 1% ( 4 gram ) , tube 17.49 ketoconazole tab 200mg ( ) , tablet 17.5 bupivacaine hydrochloride 0.25% ( 20 ml vial ) , injection 17.51 ondansetron inj ( 2 mg / ml ) , injection 17.52 vitamin b complex injection ( nfi formula 30ml / vial ) , injection 17.53 norfloxacin + metronidazole suspension 100mg+100mg / 5ml ( 30 ml bottle ) , bottle 17.54 temephos ( 50 % ec 5 litre pack ) , consumable 17.55 paper adhesive microporous surgical tape 3 inch m / roll ( 10 roll / pkt ) ( 3 inch x 5 m / roll ( 10 roll / pkt ) ) , consumable 17.56 hydroxypropyl methylcellulose eye drops ( 2% 5 ml vial ) , eye drop 17.57 alpha beta arteether inj 75 mg / ml 1ml 1ml amp ( ) , injection 17.58 metformin 500mg + gliclazide 80mg tablet ( 10x10 ) , tablet 17.59 aceclofenac 100mg+paracetamol 325mg + serratiopeptidase 10mg tab ( 10x10 ) , tablet 17.6 micronised progesterone ( 100 mg ) , tablet 17.61 disodium hydrogen citrate 1.25gm / 5ml 100 ml ( 100 ml ) , syrup 17.62 cefuroxime 750mg powder for solution for injection ( 750mg ) , injection powder for 17.63 gluteraldehyde solution 2% ( 5 litre can ) , solution 17.64 chlorhexidine gluconate mouthwash 0.2% w / v solution ( 50ml bottle ) , solution 17.65 milk of magnesia + liquid paraffin ( 11.25ml+3.75ml ) / 15ml ( 200 ml bottle ) , syrup 17.66 catgut chromic with 1 / 2 cir rb needle 40 mm length 75cm no. 2 consumable ( each ) , consumable 17.67 multivitamine 100ml syrup ( 100 ml ) , syrup 17.68 multivitamin with zinc drop 15ml ( 15 ml ) , drop 17.69 drotaverine ( 80 mg ) , tablet 17.7 isotonic 18 ltr ( each ) , consumable 17.71 hemolynac 3n 2340 500ml ( each ) , consumable 17.72 split septum transparent closed needles connector with two 10 cm pur extension and one non return valve, consumable 17.73 pe arterial catheter with visualization chamber and anti kinking color 20 g, 8 cm length, consumable 17.74 electrolyte solution a 250ml ( 250ml ) , consumable 17.75 tiotropium 9 mcg + formoterol 6 mcg + ciclesonide 200 mcg pack of 200mdi, inhaler ( 200mdi ) , inhaler 17.76 spinal needle 26 g ( each ) , needle 17.77 cotton khadi dari 3x6 feet 1.4kg per piece 17.78 cotton khadi dari, 4x7 feet, 2.0 kg, per piece 17.79 cotton khadi dari, 4x7 feet, 4.0kg, per piece 17.8 cotton khadi dari, 9x10 feet, 5.0kg, per piece 17.81 cotton khadi dari, 9x12 feet, 6.0kg, per piece 17.82 cotton khadi dari, 10x1.5 feet, 1.2kg, per piece 17.83 cotton khadi dari floor mota per sq. ft 17.84 cotton khadi yoga dari , 2x6 feet, 800gm, per piece 17.85 cotton khadi asana dari, 24x24 inch, per piece 17.86 cotton khadi white bedsheet, 54x90 inch, 500gm, per piece [ kha010 ] 17.87 cotton khadi printed bedsheet, 54x90 inch, 500gm, per piece 17.88 cotton khadi printed bedsheet tiger print, 54x90 inch, 500gm, per piece 17.89 cotton khadi pillow cover, 16x26 inch, per piece 17.9 cotton khadi blanket cover, 54x90 inch, per piece 17.91 cotton khadi pillow, 15x24 inch, 1.0kg, per piece 17.92 cotton khadi matress, 3x6 feet, 5.0kg, per piece 17.93 cotton khadi matress, 3x6 feet, 10.0kg, per piece 17.94 cotton khadi curtain, 2.30mt, per piece 17.95 cotton khadi curtain, 1.75mt, per piece 17.96 cotton khadi bag, 36x36 inch, per piece 17.97 cotton khadi bag, 48x48 inch, per piece 17.98 polyvastra kapda coating, 28 inch, 2 suti, per meter 17.99 polyvastra kapda shirting, 36 inch, 1.5 suti, per meter 18 polyvastra uniform ( pent / shirt / topi ) , 2 suti, per set 18.01 polyvastra uniform ( kurta / payjama / topi ) , 1.5 suti, per set 18.02 polyvastra white sari, 5.50mtr, 1 suti, per piece [ kha026 ] 18.03 polyvastra plane sari colored , 5.50mtr, 1 suti, per piece 18.04 polyvastra blouse, 1.00mtr, 1.5 suti, per piece 18.05 polyvastra peticote, 2.00mtr, 1.5 suti, per piece 18.06 blanket jammu woolen plane, 54x90 inch, 2.200 kg, per piece 18.07 woolen shawl meriono ladies, 40x80 inch, per piece 18.08 woolen coating, 28 inch, per meter 18.09 woolen coating, 54 inch, per meter 18.1 woolen coat, per piece as per measurment 18.11 shoes uniform , per pair as per measurment 18.12 amunation boot, per pair as per measurment 18.13 ankle boot, per pair as per measurment 18.14 ladies sleeper, per pair as per measurment 18.15 leather belt without backaal, per piece as per measurment 18.16 leather belt with backaal , per piece as per measurment 18.17 cream sumag ( ) , cream 18.18 aceclofenac 100mg+paracetamol 325mg tab ( ) , tablet 18.19 h2so4 ( sulphuric acid ) ( 25% 500 ml bottle ) , consumable 18.2 plain vial ( 12 x 75 with screw cap each ) , consumable 18.21 abdominal belt ( 32 inch each ) , consumable 18.22 ecg paper ( chemical coated ) ( 80mmx 20 mtr each ) , consumable 18.23 x ray film fixer ( powder to make 13.5 liters pkt ) , consumable 18.24 x ray film fixer ( powder to make 9 liters pkt ) , consumable 18.25 potassium chloride syrup 200ml ( each ) , syrup 18.26 hematology cell counter reagents lysis solution 500ml ( each ) , solution 18.27 e z cleaner 100ml ( each ) , solution 18.28 rifampicin cap ( 300 mg ) , capsule 18.29 rifampicin cap ( 450 mg ) , capsule 18.3 rifampicin cap ( 600 mg ) , capsule 18.31 diproex er tablet 500mg ( 500mg ) , tablet 18.32 hyoscine butyl bromind 1 mg ( amp ) , injection 18.33 bone wax sterilised ( 2 gm / packet ) , consumable 18.34 i v cannula with inj.valve ( port ) ( size 26g each ) , consumable 18.35 surface and fogging disinfectant stabilised h202, 10 11%w / v with diluted silver nitrate sol. 0.01%w / v ( 5 litre can ) , each 18.36 liquid paraffin 50ml ( bottle ) , consumable 18.37 troponin 1 kit ( 10 test per pack ) , consumable 18.38 serum t3 kit, elisa ( 96 test kit each ) , consumable 18.39 serum t4 kit, elisa ( 96 test kit each ) , consumable 18.4 serum tsh kit, elisa ( 96 / pkt ) , consumable 18.41 silver sulphadiazine cream usp 1% ( 500 gm jar ) , cream 18.42 cannula fixer set ( piece ) , each 18.43 latex examination gloves ( large ) ( 100 / pkt ) ( packet ) , consumable 18.44 latex examination gloves ( medium ) ( 100 / pkt ) ( packet ) , consumable 18.45 latex examination gloves ( small ) ( 100 / pkt ) ( packet ) , consumable 18.46 chromic size 1, 12 foils / pkt ( 1 / 2 cir rb needle 45 mm, length 100 cm ) , needle 18.47 polyamide size 2 / 0, 12 foils / pkt ( 3 / 8 r cutting needle 45 mm, length 70 cm ) , needle 18.48 polyamide size 8 / 0, 12 foils / pkt ( 3 / 8 cir micro point spatulated 6 mm, length 38 cm ) , consumable 18.49 chromic ( 12 foils / pkt ) ( 3 / 8 rb needle 30 mm, length 76 cm, size 2 / 0 ) , needle 18.5 polyglycolic acid absorbable surgical suture ( 12 foils / pkt ) ( 1 / 2 cir rb needle 40 mm, length 90 cm size 2 / 0 ) , needle 18.51 polyglycolic acid absorbable surgical suture ( 12 foils / pkt ) ( 1 / 2 cir rb needle 20 mm, length 70 cm size 3 / 0 ) , needle 18.52 tracheostomy tube ( pvc ) sterile single use ( adult ) ( size 7 each piece soft flexible flange at for each fixation 15 mm connector at terminal end which can be rotated in 360 degree direction nonirritant, each ) , tube 18.53 tracheostomy tube ( pvc ) sterile single use ( adult ) ( size 8 each piece soft flexible flange at for each fixation 15 mm connector at terminal end which can be rotated in 360 degree direction nonirritant, each ) , tube 18.54 tracheostomy tube ( pvc ) sterile single use ( adult ) ( size 4 each piece soft flexible flange at for each fixation 15 mm connector at terminal end which can be rotated in 360 degree direction nonirritant ) , tube 18.55 tracheostomy tube ( pvc ) sterile single use ( adult ) ( size 5 each piece soft flexible flange at for each fixation 15 mm connector at terminal end which can be rotated in 360 degree direction nonirritant ) , tube 18.56 urinary drainage bag ( paediatric ) ( 100 ml / pc, each ) , consumable 18.57 close wound drainage device under negative pressure ( closed wound suction unit ) size 200 ml ( catheter size 16, each ) , consumable 18.58 close wound drainage device under negative pressure ( closed wound suction unit ) size 200 ml ( catheter size 18, each ) , consumable18.59 polyamide size 1 / 0, 12 foils / pkt ( 3 / 8 r cutting needle 45 mm, length 70 cm ) , needle 18.6 polypropylene size 1, ( 12 foils / pkt ) ( 1 / 2 cir rb needle 45 mm, length 90 cm ) , needle 18.61 chromic size 1 / 0 ( 12 foils / pkt ) ( 3 / 8 cir rb needle 40 mm, suture length 76 cm ) , needle 18.62 chromic size 1, ( 12 foils / pkt ) ( 1 / 2 cir rb needle 40 mm, length 76 cm ) , needle 18.63 human albumin 20% ( 50 ml vial ffs glass bottle ) , bottle 18.64 temozolomide ( 20 mg ) , capsule 18.65 ambu bag / resuscitator silicon 200 250 ml infant size each, with oxygen connecting tube , should be supplied with a carry pouch , ambu bag should be complete with required autoclavable valves and other accessories, ( should have silicon rubber bellow to withstand autoclave at 134 deg.c ) should be multiple times autoclavable ) , consumable 18.66 ldh kit pack ( 50 ml bottle ) , consumable 18.67 neubauers chamber ( each ) , consumable 18.68 biomedical waste collection plastic bag ( yellow ) ( as per attached detail specifications ) ( 450x450 mm 55 micron 100 / pkt ) , consumable 18.69 aso kit ( 25 test / packet ) , consumable 18.7 ambu bag ( silicon type ) paediatrics each 1400 1700 ml with oxygen connecting tube , should be supplied with a carry pouch , ambu bag should be complete with required autoclavable valves and other accessories, ( should have silicon rubber bellow to withstand autoclave at 134 deg.c ) , consumable 18.71 ambu bag / adult each 1700ml, with oxygen connecting tube , should be supplied with a carry pouch , ambu bag should be complete with required autoclavable valves and other accessories, ( should have silicon rubber bellow to withstand autoclave at 134 deg.c ) , consumable 18.72 draw sheet ( each ) , consumable 18.73 urine ( multi stripe ) , consumable 18.74 voglibose ( 0.3mg ( mouth dissolving tablet also acceptable ) ) , tablet 18.75 clotrimazole + lignocaine ear drop 1% ( 5ml vial ) , drop 18.76 diphenhydramine syrup ( 12.5mg / 5ml ( 100 ml bottle ) ) , syrup 18.77 ondansetron ( drops ) syrup ( 2mg / 5ml ( 10 ml bottle ) ) , syrup 18.78 paracetamol oral drops ( 100 mg / ml ( 15 ml bottle with dropper ) ) , drop 18.79 gentamicin inj ( 80 mg / ml ( 2 ml amp ) ) , injection 18.8 multivitamin syrup 60 ml ( each 5ml contains vitamin a ( palmitate ) ip 1600 iu+vitamin d3 ip 200 iu ( +vitamin b2 ip 1.00mg+vitamin b6 ip 0.50mg+niacinamide ip 15.00mg+d panthenol ip 1.00mg ( 20% variability in strength or with additional contents acceptable ) ) , syrup 18.81 diclofenac + seratopeptidase ( 50mg + 10mg ) , tablet 18.82 vitamin d3 drop 10ml ( cholecalciferol 400 iu ) ( 10 ml drop ) , drop 18.83 aceclofenac 100mg+paracetamol 325mg+chlorzoxazone 250mg tab ( 250mg ) , tablet 18.84 glutaraldehyde solution 2% in 5 litre can ( 2 strips / vials per each can ) ( 5 litre can ) , consumable 18.85 acyclovir 5% ( 5gm ) , ointment or cream 18.86 biomedical waste collection plstic bag ( black 750 x 900 mm 55 micron 100 / pkt ) , bag 18.87 biomedical waste collection plstic bag ( black 900 x 900 mm 55 micron 100 / pkt ) , bag 18.88 biomedical waste collection plstic bag ( blue 750 x 900 mm 55 micron 100 / pkt ) , bag 18.89 biomedical waste collection plstic bag ( blue 900 x 900 mm 55 micron 100 / pkt ) , bag 18.9 biomedical waste collection plstic bag ( red 750 x 900 mm 55 micron 100 / pkt ) , bag 18.91 biomedical waste collection plstic bag ( red 900 x 900 mm 55 micron 100 / pkt ) , bag 18.92 biomedical waste collection plstic bag ( yellow 750 x 900 mm 55 micron 100 / pkt ) , bag 18.93 biomedical waste collection plstic bag ( yellow 900 x 900 mm 55 micron 100 / pkt ) , bag 18.94 glucometer strips 1 should be able to use capillary blood samples 2 should have expiry as printed on the label of the supplied box ( 3 all strips should have at least one year expiry date from the date of supply 1 glucometer free with each 1 thousand strips rate should be quoted for 50 strip / packet ) , consumable 18.95 endotracheal tubes size 5 cuffed should have low pressure high volume cuff and radio opaque blue ( 25 each ) , consumable 18.96 endotracheal tubes size 5.5 cuffed should have low pressure high volume cuff and radio opaque blue ( 25 each ) , combi blister pack 18.97 endotracheal tubes size 6 cuffed should have low pressure high volume cuff and radio opaque blue ( 25 each ) , consumable 18.98 endotracheal tubes size 6.5 cuffed should have low pressure high volume cuff and radio opaque blue ( 25 each ) , consumable 18.99 endotracheal tubes size 7 cuffed should have low pressure high volume cuff and radio opaque blue ( 25 each ) , consumable 19 endotracheal tubes size 7.5 cuffed should have low pressure high volume cuff and radio opaque blue ( 25 each ) , consumable 19.01 endotracheal tubes size 8 cuffed should have low pressure high volume cuff and radio opaque blue ( 25 each ) , consumable 19.02 endotracheal tubes size 8.5 cuffed should have low pressure high volume cuff and radio opaque blue ( 25 each ) , consumable [ 700627 ] 19.03 endotracheal tubes size 9 cuffed should have low pressure high volume cuff and radio opaque blue ( 25 each ) , consumable 19.04 foleys catheter size 12 2 way ( 10 each ) , consumable 19.05 foleys catheter size 16 2 way ( 11 each ) , consumable 19.06 foleys catheter size 20 2 way ( 12 each ) , consumable 19.07 foleys catheter size 22 2 way ( 13 each ) , consumable 19.08 foleys catheter size 24 2 way ( 14 each ) , consumable [ 700633 ] 19.09 post operative bag with window size 70 mm ( 1 each ) , consumable [ 700634 ] 19.1 post operative bag with window size 100 mm ( 1 each ) , consumable 19.11 cresent knife ( 1 each ) , consumable 19.12 lenstip ( 1 each ) , consumable 19.13 sodium chloride 0.3% iv 100ml ( 1 each ) , injection 19.14 imipenem 250mg+cilastatin 250mg powder for solution ( 1 each ) , injection powder for 19.15 terlipressine inj. 1mg / 10ml vial ( 1 each ) , injection 19.16 clindamycin 300 mg / ml inj ( 1 each ) , injection 19.17 anti h sera 10 ml vial ( each ) , consumable 19.18 anti d sera igg+igm 10ml vial ( each ) , consumable 19.19 anti ab sera igm 5 ml vial ( each ) , consumable 19.2 anti a1 lection sera5 ml vial ( each ) , consumable 19.21 albumin 100 ml bottle ( each ) , consumable 19.22 coombs reagent 5 ml bottle ( each ) , consumable 19.23 hba ag elisa 96 kit 1x96 ( each ) , consumable 19.24 hba ag rapid card test ( each ) , consumable 19.25 microtips ( 2 200 ul ) 1x1000 ( each ) , consumable 19.26 test tube medium ( 12x100 ) 100eack / pkt ( each ) , consumable 19.27 dionised water 5 ltr cane ( each ) , consumable19.28 double blood bag 450 ml cpda ( each ) , consumable 19.29 quadraple blood bag 450 ml sagm ( each ) , consumable 19.3 triple blood bag 450 ml ( cpda ) ( each ) , consumable 19.31 transfer bag ( each ) , consumable 19.32 tissue paper roll ( each ) , consumable 19.33 plain disposable vial 3ml ( each ) , consumable 19.34 edta vaccutainer 3 ml + needle ( each ) , consumable 19.35 v.p shunt high pressure ( venticular peritonial shunt, ( venticular catheter 15cm length, 1 distilled catheter 75 l, struit stylet ) ( each ) , consumable 19.36 v.p shunt medium pressure ( venticular peritonial shunt, ( venticular catheter 15cm length, 1 distilled catheter 75 l, struit stylet ) ( each ) , consumable 19.37 balanced salt solution 500 ml bottle ( each ) , consumable 19.38 hydroethyl starch 6% solution with sodium chloride 0.9% 500 ml bottle ( each ) , consumable 19.39 pyrazinamide 750mg tablet ( 10x10 ) , tablet 19.4 folic acid tab ( 400 mcg ) , tablet 19.41 ofloxacin infusion ( 2mg / 1ml ( 100ml ffs bottle ) ) , bottle 19.42 ketamine hydrochloride ( 50mg / ml ( 10 ml vial ) ) , injection 19.43 chromic catgut suture ( 12 foils / pkt ) ( 3 / 8 cir r cutting needle 19 mm needle, suture length 76 cm size 4 / 0 ) , needle 19.44 endotracheal tube, soft cuff towards the distal end kink resistant inflation tube murphy eye at distal end with polished smoothness standard 15 mm connector sterile, single use curved shaped blister pack suiting the shape of product ( size 4 , each ) , tube 19.45 endotracheal tube, soft cuff towards the distal end kink resistant inflation tube murphy eye at distal end with polished smoothness standard 15 mm connector sterile, single use curved shaped blister pack suiting the shape of product ( size 3 ) , tube 19.46 b.b silk size 3 / 0 ( 12 foils / pkt ) ( 3 / 8cir rcut needle 26mm length 76 cm ) , needle 19.47 polypropylene size 2 / 0 ( 12 foils / pkt ) ( 1 / 2 cir rb needle 25mm, length 45 cm ) , needle 19.48 ampicillin syrup ( 125 mg / 5 ml 30 ml bottle ) , syrup 19.49 cefadroxil syrup ( 125 mg / 5 ml 30 ml bottle ) , syrup 19.5 methyline blue ( 100 ml ) , solution 19.51 pop bandage ( 6 inch ) , consumable 19.52 pop bandage ( 4 inch ) , consumable 19.53 x ray cassets ( 6.5x8.5 ) , consumable 19.54 x ray cassets ( 8x10 ) , consumable 19.55 x ray hangers ( 6.5x8.5 ) , consumable 19.56 x ray hangers ( 8x10 ) , consumable 19.57 x ray hangers ( 10x12 ) , consumable 19.58 x ray hangers ( 12x15 ) , consumable 19.59 blood bag with acd / cpd solution ( disposable sterilised ) with needle ( 100 ml ) , bag 19.6 blood bag with acd / cpd solution ( disposable sterilised ) with needle ( 350 ml ) , bag 19.61 foldable iol sterile lens pc+14d ( lens 2 ) , pc+16d ( lens 3 ) , pc+18d ( lens 5 ) , pc+19d ( lens 5 ) , pc+19.5d ( lens 5 ) , pc+20d ( lens 15 ) , pc+20.5 ( lens 15 ) , pc+21d ( lens 13 ) , pc+21.5d ( lens 10 ) , pc+22d ( lens 10 ) , pc+22.5d ( lens 5 ) , pc+23d ( lens 5 ) , pc+24d ( lens 3 ) , pc+26d ( lens 2 ) ( ( one box should contain 100 pieces as per specification of power given ) , lens ( attached specification ( 100 lens per box ) ) , consumable 19.62 erythromycin ( as estolate ) ( 125mg / 5ml, 60ml bottle ) , suspension 19.63 abdominal belt ( 36 inch each ) , consumable 19.64 abdominal belt ( 38 inch each ) , consumable 19.65 abdominal belt ( 34 inch each ) , consumable 19.66 dengu card antigen ( 25 card / pkt ) , consumable 19.67 povidone iodine solution 5% ( 500 ml ) , bottle 19.68 total parenteral nutrition ( including carbohydrate + proteins + fats solution 2000 ml ) , infusion 19.69 pregnancy test card ( 10 card pack ) , consumable 19.7 glucose pouch ( 100 gram pack ( mfg bhandari products ) ) , consumable 19.71 brain thromboplastin ( 5ml bottle ) , consumable 19.72 swab stick with tube sterile ( 70 80 mm length 10 15 mm diameter ) , unit 1 ( 100 / pkt , packet ) , consumable 19.73 blood grouping anti sera a monoclonal ( 10 ml vial ) , consumable 19.74 blood grouping anti sera b monoclonal ( 10 ml vial ) , consumable 19.75 blood grouping anti sera d monoclonal ( 10 ml vial ( mfg tulip diagnostics ) ) , consumable 19.76 safranine ( gram stain ) ( 500 ml bottle ( mfgsunlabs ) ) , consumable 19.77 anti a sera igm ( 10 vial ) , consumable 19.78 anti b sera igm ( 10 vial ) , consumable 19.79 bovine albumin ( each ) , consumable 19.8 coombs ahg sera 5ml ( each ) , consumable 19.81 flow regulator ( dial flow ) ( each ) , consumable 19.82 l alanyl l glutamine solution for infusion ( 20%w / v ) ( each ) , consumable 19.83 disinfectant with stabilizer by 0.01%w / v agn03 and h2p04 ( each ) , consumable 19.84 insulin syringe ( each ) , consumable 19.85 disposable sterile hypodermic syringe 10ml ( each ) , consumable 19.86 iv mannitol ( 100 ml ) , injection 19.87 human normal immunoglobin ( 5gm / 100ml ) , injection 19.88 iv cannula with inj valve ( 20g ) , consumable 19.89 iv cannula with inj valve ( 18g ) , consumable 19.9 sevoflurane 20cc ( each ) , consumable 19.91 patch buprenorphine ( 10mcg ) , consumable 19.92 patch buprenorphine ( 20mcg ) , consumable 19.93 propofol 1% ( 10ml / 5ml 20ml ) , injection 19.94 intravenous immuglobin ( ivig ) ( each ) , injection 19.95 sodium thiopentone ( 500mg ) , injection powder for 19.96 ranibizumab inj ( 10ml / mg ) , injection 19.97 trastuzumav inj ( 440mg ) , injection 19.98 ibandronic acid inj ( 6mg ) , injection 19.99 everolimus tab 10mg ( 4x7 ) , tablet 20 cell pack for 5 part hematology analyser ( model : sysmex xs 800i ( japan ) ) ( pack size 20000 ml ) , consumable 20.01 stromatolyser 4dl for 5 part hematology analyser ( model : sysmex xs 800i ( japan ) ) ( pack size 5000 ml ) , consumable 20.02 sstromatolyser 4ds for 5 part hematology analyser ( model : sysmex xs 800i ( japan ) ) ( pack size 126 ml ) , consumable 20.03 sulfolyser for 5 part hematology analyser ( model : sysmex xs 800i ( japan ) ) ( pack size 5000 ml ) , consumable 20.04 cell clean for 5 part hematology analyser ( model : sysmex xs 800i ( japan ) ) ( pack size 50 ml ) , consumable 20.05 isotonac 3000 pack size 18 l ( cell counter ( model no mek 6420p japan ) ) , consumable 20.06 hemolynac 3n 2340 pack size 500 ml ( cell counter ( model no mek 6420p japan ) ) , consumable 20.07 cleanac 4000 pack size 5l ( cell counter ( model no mek 6420p japan ) ) , consumable 20.08 cleanac 3 4000 pack size 5l ( cell counter ( model no mek 6420p japan ) ) , consumable 20.09 albumin ( mfg pathogyme diagnostics ) ( 200 ml ( 4 x 50 ml ) ) , consumable 20.1 barium chloride 10% ( mfg precious life care pvt ltd ) ( 500 ml bottle ) , consumable 20.11 basic carbol fuchsin for afb staining ( mfg precious life care pvt ltd ) ( 25 gram / packet ) , consumable 20.12 crp test kit ( latex / card ) , kit of 25 tests ( 25 test / kit ) , consumable 20.13 field stain a ( mfg precious life care pvt ltd ) ( 500 ml bottle ) , consumable 20.14 field stain b ( mfg precious life care pvt ltd ) ( 500 ml bottle ) , consumable 20.15 fouchets reagent ( mfg precious life care pvt ltd ) ( 100 ml bottle ) , consumable 20.16 g6pd deficiency test kit ( mfg pathogyme diagnostics ) ( 10 test / kit ) , consumable 20.17 gram iodine ( gram stain ) ( mfg precious life care pvt ltd ) ( 100 ml bottle ) , consumable 20.18 leishman stain ( mfg precious life care pvt ltd ) ( 500 ml bottle ) , consumable [ 700732 ] 20.19 methyl blue for ( z n ) ( mfg precious life care pvt ltd ) ( 125 ml bottle ) , consumable 20.2 platelet dilution fluid ( mfg precious life care pvt ltd ) ( 100 ml ) , consumable 20.21 rbc dialuation fluid ( 500 ml bottle ) , consumable [ mis98 ] 20.22 serum creatinine ( 100 ml bottle ( 2 x 50 ml ) ) ( consumable ) , consumable 20.23 sgot ( 25 ml ) , consumable 20.24 sodium citrate 3.8% ( mfg precious life care pvt ltd ) ( 500 ml bottle ) , consumable 20.25 trisodium citrate 3.8% ( mfg precious life care pvt ltd ) ( 500 ml bottle ) , consumable 20.26 uric acid ( mfg pathogyme diagnostics ) ( 50 ml ( 2 x 25 ml ) ) , consumable [ 700739 ] 20.27 usg gel ( 250 ml bottle ) , consumable 20.28 wbc dialuation fluid ( mfg precious life care pvt ltd ) ( 500 ml bottle ) , consumable 20.29 foleys urinary catheter 2 way ( size 22 each ) , consumable 20.3 suction catheter, sterile ( size fg 20 ( disposable, sterile each ) ) , consumable 20.31 suction catheter, sterile ( size fg 22 ( disposable, sterile each ) ) , consumable 20.32 suction catheter, sterile ( size fg 6 ( disposable, sterile each ) ) , consumable 20.33 corrugated drainage sheet, sterile, multichannel, single use ( 2 inch x 6 inch ( pvc ) piece ) , consumable 20.34 infant feeding tube ( 10 g each piece, each ) , consumable 20.35 infant feeding tube ( 7g each piece, each ) , consumable 20.36 ryles tube ( size 14 each piece ) , consumable 20.37 cyanemeth solution for hb ( mfg by beacon diagnostic ) ( 5 lit can ) , consumable 20.38 edta solutions k3 ( 500 ml bottle ) ( bottle ) , consumable 20.39 total protein ( mfg by beacon diagnostic ) ( 100 ml ) , consumable 20.4 vdrl kit ( strip ) ( mfg by alere ) ( 50 test / kit ) , consumable 20.41 serum amylase ( 100 ml ) , consumable 20.42 ra factor rapid kit 1 ) should be based on latex agglutination slide test 2 ) qualitative and semi quantative testing facility possible 3 ) test speed must be less than 2 minutes ( 25 test / kit ) , consumable 20.43 leuprolide depot inj ( 3.75mg ) , injection 20.44 linazolid ( 300ml ) , injection 20.45 moxifloxacin ( 100ml ) , injection 20.46 ofloxacin+ metronidazole ( 30ml ) , syrup 20.47 amphotericin b inj ip ( 50 mg ) , injection 20.48 colistinethate sodium inj bp ( 1 million iu ) , injection 20.49 permethrin 5% ( 30 gm ) , cream 20.5 n s 3% hypotonic ( 100ml ) , injection 20.51 pilocarpine nitrate inj. ip 0.5 % w / v ( 1 ml ) , injection 20.52 carboxymethyl cellulose 0.5% eye drop ( 5 ml ) , eye drop 20.53 hydroxyethylstarch 3% ( 500 ml ) , injection 20.54 dialysis starting kit disposable:a ) sterile tray with top ( disposable ) , size not less than 30x30cm b ) sterile drape size not less than 45x45 cm 1no c ) cotton ball 6 no d ) ( d ) cotton gauze pieces 1, e ) artery forceps 1 no ( disposable ) ) , consumable 20.55 tourniquet with belt ( mfg by precious life care pvt ltd ) ( good quality pairs ) , consumable 20.56 medical nitrous oxide gas in jambo size cylinder ( d type ) , miscellaneous 20.57 medical nitrous oxide gas in medium size cylinder ( b type ) , miscellaneous 20.58 medical nitrous oxide gas in small size cylinder ( a type ) , miscellaneous 20.59 medical oxygen gas ip in jambo size cylinder ( d type ) , consumable 20.6 medical oxygen gas ip in medium size cylinder ( b type ) , miscellaneous 20.61 medical oxygen gas ip in small size cylinder ( a type ) , miscellaneous 20.62 carbondioxide gas in medium size cylinder ( b type ) , miscellaneous 20.63 carbondioxide gas in small size cylinder ( a type ) , miscellaneous 20.64 amlodipine ( 10mg ) , tablet 20.65 erythomycin stearate ( 250mg ) , tablet 20.66 intravenous fat emulsion 20% w / v ( 20% w / v ) , bottle 20.67 sevoflurane usp inhalation anesthetic 250 ml ( 250 ml ) , bottle 20.68 dexmedetomidine hydrochloride injection 1ml amp ( 1 ml amp ) , ampule 20.69 co trimoxazole oral suspension ip ( 5 ml each trimethoprim 40 mg sulphamethoxazole 200 mg ) , bottle 20.7 fistula sterilized twin needle ( 16 g ( two needle pack ) ) , consumable 20.71 a v fistula sterilized twin needle ( 17 g ( two needle pack ) ) , consumable 20.72 a v blood lines with av pressure transducer ( acceptable for fitting to all standard dialyzers ) with side tubing ( for heparinization and av pressure monitoring ) ce and iso certificate essential with protector for all machines types and dialysers ( post pump tubing sets options medical grade clear tubing guarded access ports for reduced infection risks parts of superior quality, each ) , consumable 20.73 protien ( total ) mfg by ba 400 biosystems diagnostics pvt ltd ( 600 ml ) , consumable 20.74 protien ( urine ) ba 400 biosystems diagnostics pvt ltd ( 240 ml ) , consumable 20.75 creatinine mfg by ba 400 biosystems diagnostics pvt ltd ( 600 ml ) , consumable 20.76 protein ( total ) 600 ml ( model ba 400 system ( mfg bybio system ) ) , consumable 20.77 creatinine 600 ml ( model ba 400 system ( mfg bybio system ) ) , consumable 20.78 glucose 600 ml ( model ba 400 system ( mfg bybio system ) ) , consumable 20.79 cholesterol 600 ml ( model ba 400 system ( mfg bybio system ) ) , consumable 20.8 bilirubin ( total ) 600 ml ( model ba 400 system ( mfg bybio system ) ) , consumable 20.81 urea / bun � uv 600 ml ( model ba 400 system ( mfg bybio system ) ) , consumable 20.82 uric acid 600 ml ( model ba 400 system ( mfg bybio system ) ) , consumable 20.83 triglyceride 600 ml ( model ba 400 system ( mfg bybio system ) ) , consumable 20.84 ast / got 600 ml ( model ba 400 system ( mfg bybio system ) ) , consumable 20.85 alt / gpt 600 ml ( model ba 400 system ( mfg bybio system ) ) , consumable 20.86 albumin 600 ml ( model ba 400 system ( mfg bybio system ) ) , consumable 20.87 calcium arsenazo 600 ml ( model ba 400 system ( mfg bybio system ) ) , consumable 20.88 cholesterol hdl direct 160 ml ( model ba 400 system ( mfg bybio system ) ) , consumable 20.89 alkaline phosphatase ( alp ) dea 300 ml ( model ba 400 system ( mfg bybio system ) ) , consumable 20.9 bilirubin ( direct ) as 300 ml ( model ba 400 system ( mfg bybio system ) ) , consumable 20.91 conc washing solution 500 ml ( model ba 400 system ( mfg bybio system ) ) , consumable 20.92 reaction rotor 10 pc ( model ba 400 system ( mfg bybio system ) ) , consumable 20.93 bilirubin standard 1x5 ml ( model ba 400 system ( mfg bybio system ) ) , consumable 20.94 biochemistry calibrator 5x5 ml ( model ba 400 system ( mfg bybio system ) ) , consumable 20.95 hdl / ldl standard 1x1 ml ( model ba 400 system ( mfg bybio system ) ) , consumable 20.96 biochemistry control serum l1 5x5 ml ( model ba 400 system ( mfg bybio system ) ) , consumable 20.97 biochemistry control serum l2 5x5 ml ( model ba 400 system ( mfg bybio system ) ) , consumable 20.98 sodium chloride 0.45% + dextrose 5% ( 500 ml ffs bottle ) , injection 20.99 femoral catheters single lumen set adult ( size 6f to 8f, length 13 cm to 15 cm, each ) , consumable 21 femoral catheters single lumen set pediatric ( size 3f to 4f, length 13 cm to 15 cm or less ) , consumable 21.01 calcium phosphate ( 2 : 1 ratio ( 100 ml bottle ) ) , syrup ( each 5 ml contains : calcium 82 mg + vitamin d3 ( cholecalciferol ) 200 iu + vitamin b12 ( cynocobalamin ) 2.5 mcg ) , syrup 21.02 imatinib cap / tab ( 100 mg ) , tablet or capsule 21.03 tamsulosin ( 0.4mg ) , tablet 21.04 sterilant cold disinfectant for dialysis containing peracetic acid hydrogen peroxide acetic acid ( 5 ltr can ) , consumable 21.05 sterilant hot disinfectant for dialysis containing 21% ( approx ) citric acid, malic acid, lactic acid ( 5 ltr can ) , consumable 21.06 hemodialysis powder for bicarb made ( part a powder to make 10 ltr + part b 500gm 2 / pkt ) , consumable 21.07 adult double lumen catheter set ( size: 11.5 fr 12 fr, 13cm to 15cm ( straight ) ) , consumable 21.08 adult double lumen catheter set ( size: 11.5 fr 12 fr, 13cm to 15cm ( curved ) ) , consumable 21.09 femoral guide wires : straight / j tip ( ( 0.325 mm size ) sterile: ce / iso13485 marked ) , consumable 21.1 electrolyte m ( multi electrolyte with 5% dextrose injection type iii ip ) i / v fluid each 100ml contains: ( anhydrous dextrose 5g; sodium acetate trihydrate ) ( 500 ml ffs bottle ) , injection 21.11 disposable pricking lancet ( mfg by precious life care ) ( pkt of 200 units ) , consumable 21.12 echo jelly 250 ml ( mfg by precious life care ) , bottle 21.13 hub cutter non electric lockable safety portable box for disposal of hypodermic needles ( cuts the needle from the hub of machine ) , each 21.14 disposable sharp collection containers ( 1.5 l mfg by precious life care ) , each 21.15 disposable sharp collection containers ( 5 l ( mfg by precious life care ) ) , each 21.16 ecg jelly 250 gms bottle ( mfg by precious life care ) , bottle 21.17 umbical cord clamps plastic material ( box of 100 clamps ) ( mfg by precious life care ) , consumable 21.18 rib belt large ( each ) , each 21.19 rib belt medium ( each ) , each 21.2 rib belt small ( each ) , each 21.21 diagnostic strips for urine sugar / albmin packing: amber colored, 100 strips / pkt ( packet ) , consumable 21.22 nitrofruantoin ( 100mg ) , tablet capsule 21.23 biphasic isophane insulin ( 30 / 70 100iu / ml ( 10 ml vial ) ) , injection 21.24 surface disinfectant 10 minute aldehyde free disinfectant containing potassium mono per sulphate powder ( 5 kg packet ( mfg by zenith chemicals allied industries ) ) , consumable 21.25 iron ferrous sulphate folic acid 100ml ( each 5ml contains ferrous sulphate i.p equivalent to elementary iron 100mg folic acid i.p 0.5mg ) , syrup 21.26 hypodermic needles for single use bis gauze ( 23 length, 25 mm + 1 ) , needle 21.27 bcg ( 1 ml each ) , syrings 21.28 disposable ( 24 g each ) , needle 21.29 reuse prevention syringe sterile single use reuse prevention syringe with fixed / detachable needles complaint to iso 7886:4 type i and b, flow wrap / blister pkg using medical grade breathable paper, eto sterilized. ( 10 ml ) , syrings 21.3 disposable needles is 10654:2002 ( 23g ) , needle 21.31 short iv catheter with straight / j tip guidewire ( l 4, fr 2, g 22 ) , consumable [ mis109 ] 21.32 disposable syringe ( for vitamin k inj ) ( 1ml with needle 26g ) , consumable 21.33 reuse prevention syringe sterile single use reuse prevention syringe with fixed / detachable needles complaint to iso 7886:4 type i, b, flow wrap / blister pack using medical grade breathable paper, eto sterilized ( 5ml ) , syrings [ 700846 ] 21.34 reuse prevention syringe sterile single use reuse prevention syringe with fixed / detachable needles complaint to iso 7886:4 type i, b, flow wrap / blister pack using medical grade breathable paper, eto sterilized ( 3ml ) , syrings 21.35 reuse prevention syringe sterile single use reuse prevention syringe with fixed / detachable needles complaint to iso 7886:4 type i, b, flow wrap / blister pack using medical grade breathable paper, eto sterilized ( 2ml ) , syrings 21.36 latex based baloon capacity ( 30 50ml ) foleys catheter ( size 14 2 way each ) , consumable 21.37 latex based baloon capacity ( 30 50ml ) foleys catheter ( size 18 2 way, each ) , consumable 21.38 latex based baloon capacity ( 30 50ml ) foleys catheter ( size 16 2 way each ) , consumable 21.39 latex based baloon capacity ( 3ml ) foleys urinary catheter peadiatrics ( 2 way size 8, each ) , consumable 21.4 latex based baloon capacity ( 3ml ) foleys urinary catheter peadiatrics ( size 10 , each ) , consumable 21.41 sgpt100 ml ( 4 x 25 ) , consumable 21.42 alkaline phosphate ( 100 ml ( 5 x 20 ) ) , consumable 21.43 reagent for hdl cholestrol test ( 100 ml ( 4 x 25 ) ) , consumable 21.44 1.5 / 1.6 dialyzers multiple use made of polysulphone or polyethersulfone low / middle flux, hi performance dialyser performance enhanced technology with hi biocompatibility housed in medical grade polycarbonate openable ends for easy cleaning caps ( for dialysate inlet utlet for safer storage openable caps ( red and blue ) hi quality sterilisation procedure using gamma radiation and should meetings standards of european ce / iso13485:2003sterlised ) , consumable 21.45 clopidogrel + aspirin ( 75 mg + 150 mg ) , capsule 21.46 alphacypermetherin 5% wdp ( as per attached specifications in rc ( confirming to is 15603 standards to be supplied in in 25kg or 20kg pack . 1 metric ton ) ) , consumable 21.47 chromic catgut suture ( 3 / 8 cir rcutting needle 16 mm, suture length 76 cm ( 5 / 0 12 foils / pkt ) ) , sutures 21.48 testcha ( 23 ) , ampoule 21.49 black braided silk with 1 / 2 cir cutting needle 30mm length 75 cm ( 1 / 0 12 foils / pkt ) , consumable [ mis18 ] disposable syringes is 10258:2002 with needle is 10654:2002, mfg by ph health care pvt ltd ( 10ml ) , consumable 21.51 sterile hypodermic syring with needle, mfg by ph health care pvt ltd ( 10ml ) , consumable 21.52 sterile hypodermic syringe with needle, mfg by ph health care pvt ltd ( 20 ml ) , consumable [ 700863 ] 21.53 double lumen polyurethane cvp catheter 5 fr ( length 13 to 15 cm ) , consumable [ 700864 ] 21.54 double lumen polyurethane cvp catheter 4 to 5 fr ( length 8 to 13 cm, sample to be submitted by firm latest by 10 days from the date of bid opening , each ) , consumable [ 700865 ] 21.55 triple lumen polyurethane cvp catheter 7 to 7.5 fr ( g 14 16x18x18x18, length 15 16cm, each ) , consumable 21.56 triple lumen polyurethane cvp catheter 7 to 7.5fr ( g 14 16x18x18, length 16 20 cm, each ) , consumable 21.57 spinal needle ( g 22 l 120 mm ) , consumable 21.58 triple lumen jugular catheter kit, ( size 12f, 16+ / 1cm, kit ) , consumable 21.59 nylon suture spatulated micropoint reverse cutting needle, double armed suture size 9 0 ( 12 foils / pkt ) , sutures nylon suture, macrofilment spatulated, micropoint double armed size 10 0 ( 12 foils / pkt ) , sutures 21.61 endotracheal tube internal with radioopaque line ( dia 2.5 mm to 5 mm, each ) , consumable 21.62 endotracheal tubes size 9.5 cuffed should have low pressure high volume cuff and radio opaque line ( size 9.5 , each ) , consumable 21.63 latex based baloon ( capacity 30 50 ml ) foleys urinary catheter ( 3 way size 20 ) , consumable 21.64 spinal needle with metal stylet, ( g 23 ) , needle [ 700875 ] 21.65 urinary drainage bag cap with non return valve ( eo sterile ) ( 2 litre, each ) , consumable 21.66 disposable spinal needle, mfg by alpha medicare & devices pvt. ltd. ( 18 no ) , needle 21.67 disposable spinal needle, mfg by alpha medicare and devices pvt. ltd. ( 22 no ) , needle 21.68 disposable spinal needle, mfg by alpha medicare and devices pvt. ltd. ( 23 no ) , needle 21.69 ecg paper ( chemical coated ) , mfg by life o line technologist ( 50mm x 20 mtr roll ) , consumable 21.7 ecg paper ( chemical coated ) , mfg by life o line technologist ( 50mm x 30 mtr. roll ) , consumable 21.71 ecg paper ( wax coated ) ( 50mm x 30 mtr, roll ) , consumable 21.72 ecg roll three channel mfg by life o line technologist ( 50 mm x 20 mtr ) , consumable 21.73 egc roll, mfg by life o line technologist ( 66 mm x 15 mm roll ) , consumable 21.74 icd bag, mfg by life o line technologist ( 1000 ml ) , bag 21.75 nebulization mask kit, mfg by life o line technologist ( pediatrics ) , consumable 21.76 cloth based surgical adhesive tape roll ( 1 inch x 5 mtr / roll ) , consumable 21.77 mva kit ( mannual vaccum aspiration kit ) ( as per attached specification ) , consumable 21.78 latex based baloon capacity ( 30 50ml ) foleys catheter ( size 14 3 way ) , consumable 21.79 latex based baloon capacity ( 3 ml ) foleys catheter ( way, size 12 ) , consumable 21.8 scalp vein set ( size 24g, disposable , each ) , consumable 21.81 paracetamol + chlorpheniramine ( 100 ml syrup ) , syrup 21.82 calcium carbonate + vitamin d3 + zinc ( 200 ml syrup ) , syrup 21.83 size of film 14 inch x 17 inch ( dihl ) , consumable 21.84 size of film 10 inch x 12 inch ( dihl ) , consumable 21.85 size of film 8 inch x 10 inch ( dihl ) , consumable 21.86 size of cassette ( 14 inch x 17 inch ) , consumable 21.87 size of cassette ( 10 inch x 12 inch ) , consumable 21.88 size of cassette ( 8 inch x 10 inch ) , consumable 21.89 hiv elisa kit ( hiv micro elisa ag+ab 4th generation ) ( 96 test kit ) , consumable 21.9 hcv elisatest kit pack size: 96 well per kit ( rate should be quoted for 1 kit containing 96 wells ) , consumable 21.91 triple blood bag ( sagm ) ( 450 ml ) , consumable 21.92 size of film 10 inch x 12 inch digital x ray film ( dihl ( pack of 150 ) ) , film 21.93 size of film 14 inch x 17 inch digital x ray film ( dihl ( pack of 100 ) ) , film 21.94 size of film 8 inch x 10 inch digital x ray film ( dihl ( pack of 150 ) ) , film 21.95 mindray bc 5300, auto hematology analyzer part 5 ( m 53 diluent ) , consumable 21.96 mindray bc 5300, auto hematology analyzer part 5 ( m 53 lh lyes ) , consumable 21.97 mindray bc 5300, auto hematology analyzer part 5 ( m 53 leo ( i ) lyes ) , consumable 21.98 mindray bc 5300, auto hematology analyzer part 5 ( m 53 leo ( ii ) lyes ) , consumable 21.99 mindray bc 5300, auto hematology analyzer part 5 ( m 53 cleaner ) , consumable 22 mindray bc 5300, auto hematology analyzer part 5 ( m 53 probe cleaner ) , consumable 22.01 mindray bc 5300, auto hematology analyzer part 5 ( quality control ) , consumable 22.02 mindray bc 2800, auto hematology analyzer ( m 18 diluent ) , consumable 22.03 mindray bc 2800, auto hematology analyzer ( m 18 cfl lyes ) , consumable 22.04 mindray bc 2800, auto hematology analyzer ( m 18 rinse ) , consumable 22.05 mindray bc 2800, auto hematology analyzer ( m 18 cleanzer ) , consumable 22.06 mindray bc 2800, auto hematology analyzer ( m 18 probe cleanzer ) , consumable 22.07 mindray bc 2800, auto hematology analyzer ( paper roll ) , consumable 22.08 mindray bc 2800, auto hematology analyzer ( quality control ) , consumable 22.09 stago diagnostica stago s.g.s, model sta satellite fully automated coagulation machine ( pt � sta neoplastin cl + 5 ) , consumable 22.1 stago diagnostica stago s.g.s, model sta satellite fully automated coagulation machine ( aptt sta cepha screen 4 ) , consumable 22.11 stago diagnostica stago s.g.s, model sta satellite fully automated coagulation machine ( aptt sta cepha screen 4 ) , consumable [ 700045 ] 22.12 stago diagnostica stago s.g.s, model sta satellite fully automated coagulation machine ( sta cacl2 ) , consumable 22.13 stago diagnostica stago s.g.s, model sta satellite fully automated coagulation machine ( stadesorb u ) , consumable 22.14 stago diagnostica stago s.g.s, model sta satellite fully automated coagulation machine ( stacoagcontrol n+p ) , consumable 22.15 stago diagnostica stago s.g.s, model sta satellite fully automated coagulation machine ( stasatellite cuvette ) , consumable 22.16 stago diagnostica stago s.g.s, model sta satellite fully automated coagulation machine ( stacleaner solution ) , consumable 22.17 stago diagnostica stago s.g.s, model sta satellite fully automated coagulation machine ( white stirrer for pt test ) , consumable 22.18 carelyte 503 ( calibrator 1&2 ) , consumable 22.19 carelyte 503 ( enzyme cleaning solution ) , consumable 22.2 carelyte 503 ( thermal printer roll ) , consumable 22.21 carelyte 503 ( sodium electrode ) , consumable 22.22 carelyte 503 ( pottasium electrode ) , consumable 22.23 carelyte 503 ( refernce electrode ) , consumable 22.24 carelyte 503 ( pump tubing ) , consumable 22.25 carelyte 503 ( complete tubing set ) , consumable 22.26 blood gluose ( god / pod ) semi auto end point ( 1000 ml ) , consumable 22.27 blood urea ( bun ) uv ( 1000 ml ) , consumable 22.28 s direct billirubin ( 1000 ml ) , consumable 22.29 hba 1 c ( glycosylated hb ) ( 100 tests ) , consumable 22.3 microalbumin urine ( 100 tests ) , consumable 22.31 apo a ( 100 tests ) , consumable 22.32 apo b ( 100 tests ) , consumable 22.33 crp ( hs ) ( 100 tests ) , consumable 22.34 s. transferin ( 100 tests ) , consumable 22.35 s. tibc kit ( 100 tests ) , consumable 22.36 s. b12 ( 100 tests ) , consumable 22.37 s. folate ( 100 tests ) , consumable 22.38 s.vitamin d3 ( 100 tests ) , consumable 22.39 s. iron ( ferrozine ) ( 100 tests ) , consumable 22.4 hdl ( each ) , consumable 22.41 s. ferritin ( each ) , consumable 22.42 s.calcium ( each ) , consumable 22.43 s. phosphorus ( each ) , consumable 22.44 s. total protein ( each ) , consumable 22.45 s.albumin ( each ) , consumable 22.46 s.lipase ( each ) , consumable 22.47 pt kit ( time ) ( ist 1.00 1.20 ) ( 2x4 ml ) , consumable 22.48 apit ( 2x4 ml ) , consumable 22.49 fdp kit ( 4 ml ) , consumable 22.5 d dimer ( 10x3 ml ) , consumable 22.51 thrombin time kit ( 10x3 ml ) , consumable 22.52 factor vii deficient plasma ( less than 1% ) ( 10x30 ml ) , consumable 22.53 factor ix deficient plasma ( less than 1% ) ( 10x1 ml ) , consumable 22.54 staining kit reticulin ( 100 test ) , consumable 22.55 staining kits ( 100 test ) , consumable 22.56 ptah staining kits ( 100 test ) , consumable 22.57 masson trichrome staining kits ( 100 test ) , consumable 22.58 quick diff staining kits for pap smear ( 100 test ) , consumable 22.59 troponin t ( ctn t ) card test ( 50 test ) , consumable 22.6 coombs serum ( anti human globulin ) ( polyvalent ) ( 1x5=5 ml ) , consumable 22.61 bovine albumin ( 22% w / v ) ( 1x5=5 ml ) , consumable 22.62 anti d ( polyvalent ) ( 1x10 ml ) , consumable 22.63 benedicts qualitative reagent ( 1x5 lit ) , consumable 22.64 absolute alcohol ( ethanol ) ( 1x500 ml = 500 ml ) , consumable 22.65 isopropyl alcohol ( propanol ) ( 1 x 2.5 lit ) , consumable 22.66 xylene ( sulphur free ) ( 1 x 2.5 lit ) , consumable 22.67 clotrimazole 1%w / v +lignocaine 2%w / v ( 10ml ) , eye drop 22.68 aztreonam inj ( 500 mg ) , injection 22.69 glycopyrolate 0.5 mg + neostigmine 2.5 mg ( 5ml ) , injection 22.7 dexmedetomidine hydrochloride injection ( 100mg ) , injection 22.71 dextran iv 40% ( 500ml ) , injection 22.72 ampicilline + cloxacilline ( 250 mg + 250 mg ) , injection per vial 22.73 losartan ( 25 mg ) , tablet 22.74 hydroxyethyl starch 6% ( each ) , suspension 22.75 antacid ( 250mg ) , syrup 22.76 dinoprostone gel ( 0.5 mg ) , gel 22.77 insulin biphasic / premix 50:50 ( 40 iu / ml ( 10 ml vial ) ) , injection 22.78 insulin biphasic lispro 25:75 100 iu / ml ( 3 ml cartridge ) ( firm has to supply compatible pen along with cartridges as and when required without any extra cost ) , cartridges [ 120713 ] 22.79 dpx ( 1 x 250 lit ) , consumable 22.8 ea 50 ( modified ) ( for cytology ) ( 1x125 ml ) , consumable 22.81 og6 ( for cytology ) ( 1x125 ml ) , consumable 22.82 paraffin wax histology ( 58 60 ) ( 1x1 kg = 1 kg ) , consumable 22.83 polytaxine powder ( 1x5 gm ) , consumable 22.84 haematoxyline solution ( harris ) ( 1x125 ml ) , consumable 22.85 formaldehyde 40% ( conc. formaline ) ( 1 x 30 lit ) , consumable [ 710021 ] 22.86 filter paper sheet ( ( whatmann no 01 ) sheets ) , consumable 22.87 ( ss ) powder ( 1x25 gm = 25 gm ) , consumable 22.88 eosin 2% solution ( 1x250 ml ) , consumable 22.89 reticulocyte kit ( 100 tests ) , consumable 22.9 leishmann stain sol with buffer tablet ph ( 1x5 lit ) , consumable 22.91 giemsa stain ( merck / span ) ( 125 ml ) , consumable 22.92 stain ( 1x25 gm = 25 gm ) , consumable 22.93 cytochrome stain with buffer ( 500 ml ) , consumable 22.94 methanol ( acetone free ) for leishman staining ( 1x2.5 lit ) , consumable 22.95 fauchets reagents ( 125 ml ) , consumable 22.96 esbachs reagent ( 125 ml ) , consumable 22.97 sodium nitroprusside ( 100 gm ) , consumable 22.98 occult blood test kit ( haem test kit ) ( 1 x 100 strips ) , consumable 22.99 hydrogen peroxide ( conc. ) h2o2 ( 500 ml ) , consumable 23 ehrilichs aidehyde reagen ( 2x250 ml ) , consumable 23.01 conc hcl ( 1x500 ml = 500 ml ) , consumable 23.02 con. ( hno3 ) nitric acid ( 2.5 liter ) , consumable 23.03 glacial acetic acid ( 2.5 liter ) , consumable 23.04 liquor ammonia ( 500 ml ) , consumable 23.05 pandys reagent csf ( 125 ml ) , consumable 23.06 ammonium sulphate ( analar ( gr / ar ) ( 1x500 gm = 500gm ) , consumable 23.07 sodium metabisuiphite ( na2s2o3 ) ( analar ( gr / ar ) ( 1x500 gm = 500gm ) , consumable 23.08 sodium hydroxide ( naoh ) ( analar / gr / ar ) ( 1x500 gm = 500gm ) , consumable 23.09 citric acid analar / gr / ar ( 1x500 gm = 500gm ) , consumable 23.1 trisodium citrate analar / gr / ar ( 1x500 gm = 500gm ) , consumable 23.11 nah2 po4 ( anhydrous ) analar / gr / ar ( 1x500 gm = 500gm ) , consumable 23.12 poly l lysine sol ( for immunochisto chemistry ) ( 1x100 ml ) , consumable 23.13 poly l lysine coated slides ( 50 lidess x 1 ) , consumable 23.14 indicator sol, for ph ( litmus sol ) ( 1x500 ml = 500 ml ) , consumable 23.15 sodium chloride nacl analar / gr / ar ( 1x500 gm = 500gm ) , consumable 23.16 iron alum a ) ferric amino sulphate ( 1x500 ml = 500 ml ) , consumable 23.17 aluminium potassim sulphate ( each ) , consumable 23.18 mercuric oxide ( 25 gm ) , consumable 23.19 gold chloride ( 1x1 gm ) , consumable 23.2 sliver nitrate ( 1x25 gm = 25 gm ) , consumable 23.21 drabkin solution for hb ( 1x5 lit ) , consumable 23.22 distilled water ( 1x5 lit ) , consumable 23.23 centchroman ip ( 30 mg ) , tablet 23.24 non ionic contrast media ( 350 mg , 100ml ) , consumable 23.25 protein ( total ) ( 600 ml ) , consumable 23.26 hdl / ldl standard ( 1x1 ml ) , consumable 23.27 biochemistry control serum l1 ( 5x5 ml ) , consumable 23.28 biochemistry control serum l2 ( 5x5 ml ) , consumable 23.29 dexamethasone sodium inj 4mg / 2ml ( 2ml vial ) , injection 23.3 tablet domeperidone ( 10mg ) , tablet 23.31 pantaprazole ( 40mg ) , injection 23.32 ceftriaxone ( 1g ) , injection 23.33 human insulin regular / soluble ( 40iu / ml ( 10ml vial ) ) , injection 23.34 human insulin regular / soluble ( 100iu / ml ( 10ml vial ) ) , injection 23.35 basal insulin glargin ( 100iu / ml ( 10ml vial ) ) , injection 23.36 ultravist 300mg ( 50 ml / vial ) , injection 23.37 tab amitryptyline ( 25 mg ) , tablet 23.38 tab citalopram ( 20 mg ) , tablet 23.39 sics blade cresent ( 15 degree ) , consumable 23.4 sics blade sideport ( sideport entry knife ) , consumable 23.41 eye drape disposable towel ( size 70*70cm area 08*08 ) , consumable 23.42 id wrist band ( identification for mother / child specific colour ) ( wrist band / no ) , consumable 23.43 balance salt solution for irrigation 500 ml ffs bottle ( 500ml bottle ) , eye applicap 23.44 trypan blue dye ( 1ml ) , consumable 23.45 x ray developer powder ( 13.5 liter ) , consumable 23.46 surgical spirit ( 100ml ) , bottle 23.47 hemotocyto meter ( meter ) , consumable 23.48 haemoglobin tube ( tube ) , consumable 23.49 multivitamin without iron syrup ( 100ml ) , syrup 23.5 haemoglobi pippate ( pippate ) , consumable 23.51 bloting paper ( paper ) , consumable 23.52 blood cell counter key ( key ) , consumable 23.53 barium chloride powder ( powder ) , consumable ] 23.54 edta powder ( 250 gm ) , consumable [ ] 23.55 insulin biphasic / premix 50:50 ( 100 iu / ml ( 10 ml vial ) ) , injection 23.56 montex test 2tu ( 1 vial ) , consumable 23.57 stainic rack ( each ) , consumable 23.58 intra camral saline ( r.l ) sep ( eto sterelied, specialy ( manufactured for intra camral ) , consumable [ 23.59 plastic bottle ( 300ml ) , consumable 23.6 plastic bottle ( 500 ml ) , consumable 23.61 sics blade ( disposable ) cresent nife 2.8 ( specialy long matel handle, micro sharp edge, isi / iso ( manufaturer, eto stereliged ) , consumable 23.62 suter ( 8 / 0 ( 01 box ) ) , consumable 23.63 pistol grip curvedcoagulating shears ergonomic handle with att shaft lenght 36cm can seal blood vessel upto and inclding ( 5mm in diameter ) , consumable [ 23.64 advanced rfenergy hand instrument of 5mm shaft diameter for open procedure with shaft length 14cm and should be both hand and ( foot activated ) , consumable ] 23.65 scissor grip curved coagulating shears with curved tapered tip for precise dissection and with 240 degree activation triggers that support multiple hand positions in the following shaft ( lengths 9cm can seal blood vessels upto and including 5 mm in diameter ) , each [ 710092 ] 23.66 advanced rfenergy hand instrument of 5mm shaft diameter for open procedure with shaft length 25cm and should be both hand and ( foot activated ) , consumable [ 710095 ] 23.67 scissor grip curved coagulating shears with curved tapered tip for precise dissection and with 240 degree activation triggers that support multiple hand positions in the following shaft ( lengths 17 cm can seal blood vessels upto and including 5 mm in 23.68 advanced rfenergy hand instrument of 5mm shaft diameter for laparoscopic procedure with shaft length 35cm with 55degree articulation and should be both hand ( foot activated ) , consumable 23.69 advanced rfenergy hand instrument of 5mm shaft diameter for open procedure with shaft length 35cm and should be both hand and ( foot activated ) , consumable [ 710096 ] 23.7 pistol grip curved coagulating shears with ergonomic handle in the ( folloeing shaft lengths 36 cm can seal blood vessels upto and including 5 mm in diameter ) , consumable [ 710099 ] 23.71 advanced rfenergy hand instrument of 5mm shaft diameter for laparoscopic procedure with shaft length 35cm with 55degree articulation and should be both hand ( foot activated with curved tip ) , consumable 23.72 advanced rfenergy hand instrument of 5mm shaft diameter for laparoscopic procedure with shaft length 45cm and should be both hand ( foot activated with curved tip ) , consumable 23.73 pistol grip curved coagulating shears with ergonomic handle shaft ( langths 36 cm can seal blood vessels upto and including 5 mm in diameter att ) , each 23.74 complete absorbable mesh fixation device with minimum strap length 7mm2point fixation to hold the mesh and device should be of ( 25 absorbable straps ) , consumable 23.75 handpiece ( transducer ) , each 23.76 handpiece ( blue ) , consumable 23.77 fistula and wound management system ( size 104 159 mm ) , consumable 23.78 fistula and wound management system ( size 156 228 mm ) , consumable 23.79 fistula and wound management system ( size 208 297 mm ) , consumable 23.8 oxidized regenerated cellulose based topical absorbable hemostat, structured non woven material, with bactericidal property. ease of use in both open and minimally invasive procedures ( size 1x2 approved by us fda ) , consumable 23.81 oxidized regenerated cellulose based topical absorbable hemostat, structured non woven material, with bactericidal property. ease of use in both open and minimally invasive procedures ( size 2 x 4 approved by us fda ) , consumable 23.82 oxidized regenerated cellulose based topical absorbable hemostat, structured non woven material, with bactericidal property. ease of use in both open and minimally invasive procedures ( size 4 ) , consumable 23.83 v.p.shunt ( medium pressur ) , consumable 23.84 v.p.shunt ( low pressur ) , consumable 23.85 pistol grip curved coagulating shears with ergonomic handle in the following shaft lengths 23 cm. can seal blood vessels upto and including ( 5mm in diameter ) , consumable 23.86 pistol grip curved coagulating shears with ergonomic handle shaft lengths 45 cm. can seal blood vessels upto and including ( 5mm in diameter ) , consumable [ 720016 ] 23.87 dissecting hook having telescoping shaft ( 10cm 14cm with integrated hand activation control buttons ) , consumable 23.88 curved blade having telescoping shaft ( 10cm 14cm with integrated hand activation control buttons ) , consumable 23.89 5mm lap dissecting hook ( 32 cm long ) , consumable 23.9 blood culture media aerobic for adult ( bact / alert fa plus ) , each 23.91 blood culture media aerobic for pediatric ( bact / alert pf plus ) , each 23.92 advanced rf energy hand instruments of 5mm shaft diameter for open procedures with shaft ( lengths 14cm and should be both hand & foot activated with curved tip ) , consumable 23.93 blood culture media anaerobic for pediatric ( bact / alert pf plus ) , each 23.94 blood culture media anaerobic for adult ( bact / alert fa plus ) , each 23.95 blood culture media fungus bottles per year, fungus can be tested by all quoted bottles. in the same bottle bacteria and fungus can be tested.; fungus can be tested by all quoted bottles. in the same bottle bacteria and fungus can be tested. ( ) , consumable 23.96 blood culture media mycobacterium spp ( bact / alert mp ( plastic ) ) , each 23.97 individual identification panel for aerobic gram positive organism ( gpid ) , each 23.98 individual identification panel for aerobic gram negative organism ( gnid ) , each 23.99 individual ast panel for gram positive organism ( gp p628 ) , each 24 advanced rf energy hand instruments of ( 5mm shaft diameter for open procedures with shaft lengths 25cm and should be both hand & foot activated with curved tip ) , consumable 24.01 individual ast panel for gram negative organism ( gn n280 ) , each 24.02 advanced rf energy hand instruments of 5mm shaft diameter for laparoscopic procedures with shaft lengths ( 35cm and should be both hand & foot activated with curved tip ) , consumable 24.03 individual identification panel for anaerobic gram negative organism ( anc ) , each 24.04 individual identification panel for anaerobic gram positive organism ( anc ) , each 24.05 individual identification panel for fungus ( yst ) , each 24.06 individual ast panel for fungus ( ast ys07 ) , each 24.07 advanced rf energy hand instruments of 5mm shaft diameter for laparoscopic procedures with shaft lengths ( 45cm and should be both hand & foot activated ) , consumable 24.08 advanced rf energy hand instruments of 12mm shaft diameter for open procedures with shaft lengths ( 22cm and should be both hand & foot activated ) , consumable [ 720039 ] 24.09 diltiazem tablet ( 60 mg ) , tablet 24.1 altracurium ( 10mg / ml, 2.5ml vial ) , injection 24.11 heamoglobin colour scale book with special strip complete ( 1 x 200 ) , consumable 24.12 paracetamol 150 mg / ml ( 15 ml bottle with dropper ) , drop 24.13 ofloxacin + dexamethosone ( 0.3%+ 0.1% ( 10 ml ) ) , eye drop 24.14 vitamin b1 10mg, b2 10mg, b6 3mg, b12 15mcg, niacinamide 75mg, calcium panthenol 50mg ( folic acid 1.5mg, vitamin c 150mg, biotin 100mcg or more ) , tablet 24.15 spectra optia collection set, model : 10110 / 10120 ( packing size : 6 kits ) , consumable 24.16 spectra optia exchange set, model : 10220 ( packing size : 6 kits ) , consumable 24.17 optia granulocyte depletion set, model : 10300 ( packing size : 6 kits ) , consumable 24.18 spectra optia platelet kit, model : 10400 ( packing size : 6 kits ) , consumable 24.19 acd a solution 500ml, model : pb 1ac500j8b ( packing size : 2 bags / foil or 12 foils / box ) , consumable 24.2 hpmed solution consumable ( pack size: 16 bottles of 50 ml ) , make polti s.p.a. ; model sani system ( country of origin italy; ) , consumable 24.21 laser fiber for dental laser , make faith inovation ; model fd10b ; ( country of origin india ) , consumable 24.22 sterigen c electrolyte solution one pack of 10 ltr. for sterigen 400 daf , make faith inovation; model sterigen sg 400 daf ; ( country of origin india ) , consumable 24.23 tri iodothyronine ( t3 ) , consumable 24.24 thyroxine ( t4 ) , consumable 24.25 rhyroid stimulating hormone ( tsh ) , consumable 24.26 auto lyser solution for cbc machine ( 500ml ) , consumable 24.27 auto cleanser for cbc machine ( 2 liter ) , consumable 24.28 auto dill solution for cbc machine ( 20 liter ) , consumable 24.29 tranexamic acid ( 5ml ) , injection 24.3 tranexamic amp / vial ( 500mg ) , injection 24.31 serum electrolite na+ k+ kit analizer ( 50 test per kit ) , consumable 24.32 milkiwhite gel based sanitizer 1.ethinol ( cas 64 17 5 ) 58 62% 2. benzoil coline chloride 0.52% 1 % 3. ( ph neutral contact time 15 se 4. pack size 100 ml & 100 ml with dispensor ) , consumable 24.33 milkiwhite gel based sanitizer 1.ethinol ( cas 64 17 5 ) 58 62% 2. benzoil coline chloride 0.52% 1 % 3. ph neutral contact time 15 sec 4. ( pack size l& 500 ml with dispensor ) , consumable 24.34 aminoacid ( essential ) infusion ( 10% 100ml glass ffs ) , bottle ] 24.35 curved scissors laparoscopic 5mm size, 360 degree rotating with insulated shaft, non ratchet , plastic grip ( 36 cms length, monopolar pin provision for usage with electro surgical unit, independently moving jaws ) , consumable [ 720066 ] 24.36 maryland dissector laparoscopic 5mm curved maryland dissector with tapering end, 360 degree rotating with insulated shaft, non ratchet , plastic grip ( 36 cms length, monopolar pin provision for usage with electro surgical unit, independently moving ) , consumable 24.37 grasper laparoscopic 5mm straight 360 degree rotating with insulated shaft, toothed a traumatic grasper with ratchet mechanism, plastic grip ( 36 cms length, independently moving jaws ) , consumable [ 24.38 babcock laparoscopic 5mm a traumatic babcock, straight 360 degree rotating with insulated shaft, a traumatic jaws with ratchet mechanism, plastic grip ( 36 cms length, independently moving jaws ) , consumable 24.39 babcock laparoscopic 10mm a traumatic babcock, straight 360 degree rotating with insulated shaft, a traumatic jaws with ratchet mechanism, plastic grip ( 36 cms length, independently moving jaws ) , consumable ] 24.4 sutureless dural graft substitute ( 1x3 ) , cons 24.41 sutureless dural graft substitute ( 2x2 ) , consumable ] 24.42 sutureless dural graft substitute ( 3x3 ) , consumable 24.43 sutureless dural graft substitute ( 4x5 ) , consumable 24.44 1%w / v available iodine in a non oxynol with soluble iodine suractant base with sodium iodide ( less than 1% w / v and surfactant less than 5% w / v 500 ml ) , consumable 24.45 sanitary napkins ( as per attached specification / pack of 6 pads ) , consumable [ mis106 ] 24.46 methyl prednisolone ( 8mg ) , tablet 24.47 gentamycin sulphate 0.1% ( 15gm tube ) , ointment or cream [ 120143 ] 24.48 bss solution for opthalmic use ( 500ml ) , sol 24.49 fat emulsion 20% 0.2 ( 250ml ) , injection 24.5 ivf glutamine dipeptide ( 100ml ) , injection 24.51 rangeen baag print kapda ( 60x115 tanaxbana 2 / 20sx10s reedxpeek 36x36 ) , 24.52 rangeen design weft stripe kapda ( 60x115 tanaxbana 2 / 40x 20s, 2 / 6s reedxpeek 52x52 / inch ) , 24.53 rangeen design towel beev kapda ( 1mtrx56 tanaxbana 2 / 20sx10s reedxpeek 36x40 ) , 24.54 baag print kapda fine ( 94x115 tanaxbana 2 / 40x x 2 / 20s reedxpeek 52x40 ) , 24.55 baag print kapda fine 64x115 tanaxbana 2 / 40x x 2 / 20s reedxpeek 52x40 ( ) , 24.56 rangeen baag print kapda 60x115 tanaxbana 2 / 40x x 2 / 20s reedxpeek 52x52 ( ) , 24.57 tericat shirting cloth ( 1 m x 40 inch tana x bana ( 2 / 60s x 2 / 60 p.v.65:35 ) reed x pik ( 68 x 64 / inch ) ) , 24.58 levosalbutamol ( 1.25mg ) , ipratropium ( 500mcg ) respule ( 2.5ml ) , ampule 24.59 formoterol 6mcg + budesonide 200mcg ( 30 cap x 6 pack with 1 dispensing device ) , rotacaps 24.6 salmeterol 50mcg +fluticasone 250 mcg ( 30 cap x 6 pack with 1 dispensing device ) , rotacaps 24.61 formoterol 6mcg + budesonide 400mcg ( 30 cap x 6 pack with 1 dispensing device ) , rotacaps 24.62 salmeterol 50mcg +fluticasone 500 mcg ( 30 cap x 6 pack with 1 dispensing device ) , rotacaps [ 120781 ] 24.63 blood urea ( arba ) , consumable 24.64 alkaline phosphate kinetic 2*25 ml ( semi auto end point ) , consumable 24.65 bilirubin caoillary heparinised vitrex ( one packet contain 100 capillary ) , consumable 24.66 clarithromycin ( 500mg ) , injection 24.67 i / v polysacchride or conjugate pneumococcal ( 0.5 ml ) , vaccine 24.68 imipenem 500 mg with cilastatin 500mg ( vial / amp ) , injection 24.69 ivf ( l alanine + l glutamine ) ( 50 ml ) , injection 24.7 surgical spirit ( 450 ml ( isopropyl rubbing alcohol ) ) , consumable 24.71 anti oxidant lycopen 200 ml syrup ( vitamins multi minerals ) , syrup 24.72 bupivacaine hcl for spinal ( inj 0.5%+8.25% dextrose ) , ampule 24.73 griseofulvin ( tablet 250 mg ) , tablet 24.74 budesonide ( inhalation 200 mcg per dose ) , inhaler 24.75 salbutamol nebulizing solution ( 5 mg / 2.5 ml ) , ampule 24.76 dextran 40 i / v 10% ( 500 ml ffs bottle ) , bottle 24.77 aluminium hydroxide+magnesium aluminium silicate+magnesium hydroxide+simethecon ( tab 300 mg+50mg + 25 mg+25 mg ) , tablet 24.78 phenylephrin eye drop 2.5 % ( 5 ml vial ) , drop 24.79 calcium with vitamin d3 calcium equivalent to ( 500 mg ) , tablet 24.8 titenium chemo port with silicon catheter ( 8 9.6 fr ) length 60cm 80cm, guide wire, peel away desilet, hubsite needle ( 22 g * 20 25.4mm ) , consumable [ mis137 ] 24.81 single umbilical catheter with leur lock ( fr 3 to fr 3.5 , l 40 cm ) , consumable [ mis112 ] 24.82 alcohal based hand sanitizer ( 500ml bottle with dispenser ) , consumable 24.83 oxidized regenerated cellulose, thicker weave, can be sutured through, with bactericidal property. size 1x1 ( approved by us fda ) , consumable 24.84 oxidized regenerated cellulose, thicker weave, can be sutured through, with bactericidal property. size 1x3.5 ( approved by us fda ) , consumable 24.85 oxidized regenerated cellulose, thicker weave, can be sutured through, with bactericidal property. size 3x 4 ( approved by us fda ) , consumable 24.86 oxidized regenerated cellulose, thicker weave, can be sutured through, with bactericidal property. size 6x 9 ( approved by us fda ) , consumable 24.87 oxidized regenerated cellulose based topical absorbable hemostat, structured non woven material, with bactericidal property. ease of use in both open and minimally invasive procedures size 1x2 ( approved by us fda ) , consumable 24.88 oxidized regenerated cellulose based topical absorbable hemostat, structured non woven material, with bactericidal property. ease of use in both open and minimally invasive procedures size 2x4 ( approved by us fda ) , consumable 24.89 sutureless dural graft substitute ( 2x2 ) , consumable 24.9 sutureless dural graft substitute ( 3x3 ) , consumable 24.91 clip applier laparoscopic 10 mm reusable ligaclip medium / large size applier with clip retention grooves in the jaw with single arm movement ( 36cm metal shaft ) , consumable 24.92 clip applier laparoscopic 10 / 12 mm reusable ligaclip large size applier with clip retention grooves in the jaw with single arm movement ( 36cm metal shaft ) , consumable 24.93 needle holder laparoscopic 5mm straight reusable needle holder with ratchet mechanism with high quality tungsten plated jaws for enhanced needle grip ( 36 cms metal shaft ) , consumable 24.94 all human ( bovine aprotinin free ) fibrin sealant ( 1 ml ) , consumable 24.95 all human ( bovine aprotinin free ) fibrin sealant ( 2 ml ) , consumable 24.96 polyamide with cd cut needle ( 16 mm length 70 cm â� � 3 / 0 ) , consumable 24.97 polyamide with cd cut r cut extra penetrating needle ( 16 mm length 70cm â� � 4 / 0 ) , consumable 24.98 polyamide with cd reverse 5 / 0 cut needle ( 12 mm length 70cm â� � 5 / 0 ) , consumable 24.99 poly propylene with 1 / 2 circle rbd needle ( 13 mm length 60 cm â� � 5 / 0 ) , consumable 25 poly propylene with rbd needle ( 8 mm length 60 cm â� � 7 / 0 ) , consumable 25.01 poly propylene with 1 / 2 cir cc double needle ( 13 mm ( dential guage needle and suture ) length 75 cm 4 / 0 ) , consumable 25.02 poly propylene with 1 / 2 cir cc double needle ( indentical guage needle and suture ) ( 13 mm length 60 cm 5 / 0 ) , consumable 25.03 polybutylate coated with polyster braided ( green ) with 1 / 2 cir taper cut v 5 double armed needle ( 25 mm length 90 cm 2 / 0 ) , consumable 25.04 1 / 2 cir ccs cut needle ( 48 mm stainless steel length 45 cm 4 ) , consumable 25.05 1 / 2 cir ccs cut needle ( 48 mm stainless steel length 45 cm 6 ) , consumable 25.06 1 / 2 cir ccs cut needle ( 48 mm stainless steel length 45 cm 5 ) , consumable 25.07 polyglecaprone with 1 / 2 cir oval rb contrast needle ( 26 mm length 70 cm 3 / 0 ) , consumable 25.08 sterile raney scalp clips ( ) , consumable 25.09 raney scalp clip forceps ( ) , consumable 25.1 polyglecaprone with curved 5 / 0 reverse cutting needle ( 16 mm ) , consumable 25.11 polydioxanone irgacare mp coated ( 122cm , 1 loop sgle armed , 65mm ) , consumable 25.12 patient drapes ( ) , nasal drop 25.13 bio membrane ( ) , consumable 25.14 polydioxanone with 1 / 2 cir reverse cutting orthopaedic surgery ( os ) nededle ( 40 mm length 90 cm 1 ) , consumable 25.15 collagen dry ( 6x6 cm ) , sheet 25.16 collagen dry ( 15 x 30 cm ) , sheet 25.17 polydioxanone with 1 / 2 cir round body heavy needle ( 40 mm length 90 cm 1 ) , consumable 25.18 collagen dry ( 20 x 40 cm ) , sheet 25.19 collagen wet ( 6x6 cm ) , sheet 25.2 collagen wet ( 10 x 10 cm ) , sheet 25.21 collagen wet ( 15 x 30 cm ) , sheet 25.22 collagen wet ( 20 x 40 cm ) , sheet 25.23 collagen granules ( ) , consumable 25.24 coated polyster braided with cd white d needle ( 25 mm ( curved reverse cutting round body or taper cut ) length 90 cm 2 / 0 ) , consumable 25.25 polybutylate coated with polyster braided ( green ) with 1 / 2 cir taper cut v 5 double armed needle ( 17 mm length 90 cm 25.26 polyglecaprone with 1 / 2 cir oval rb jb needle ( 26 mm length 70 cm 2 / 0 ) , consumable 25.27 polydioxanone with 3 / 8 cir round body needle ( 11 mm length 45 cm 6 / 0 ) , consumable 25.28 coated braided fast absorbing polyglactin 910 sut. ) with 3 / 8 cir cutting needle ( 16 mm length 45 cm size 4 / 0 undyed ) , consumable 25.29 coated braided fast absorbing polyglactin 910 sut. ) with 1 / 2 cir round body and 1 / 2 cir reverse cutting double needle ( 36 mm length 140 cm size 2 / 0 undyed ) , consumable 25.3 coated braided fast absorbing polyglactin 910 sut. ) with 1 / 2 cir taper cut needle ( 36 mm length 100 cm size 2 / 0 undyed ) , consumable 25.31 coated braided polyglactin 910 with triclosan coating sut. ) with 1 / 2 cir rb needle ( 20 mm length 75 cm size 3 / 0 ) , consumable 25.32 coated braided polyglactin 910 with triclosan coating sut. ) with 1 / 2 cir rb needle ( 30 mm length 100 cm size 2 / 0 ) , consumable 25.33 coated braided polyglactin 910 with triclosan coating sut. ) with 1 / 2 cir rb needle ( 30 mm length 100 cm size 1 / 0 ) , consumable 25.34 coated braided polyglactin 910 with triclosan coating sut. ) with 1 / 2 cir rb needle ( 40 mm length 100 cm size 1 ) , consumable 25.35 sabourauds dextrose agar powder ( 100gms ) , consumable [ mis104 ] 25.36 nutrient agar ( 500 grm ) , consumable [ mis88 ] 25.37 coated braided polyglactin 910 with triclosan coating sut. ) with 1 / 2 cir rb needle ( 36 mm length 90 cm size 3 / 0 ) , consumable 25.38 coated braided polyglactin 910 with triclosan coating sut. ) with 1 / 2 cir rb needle ( 20 mm length 70 cm size 4 / 0 ) , consumable 25.39 coated braided polyglactin 910 with triclosan coating sut. ) with 1 / 2 cir rb needle ( 40 mm length 90 cm size 2 / 0 ) , consumable 25.4 coated braided polyglactin 910 with triclosan coating sut. ) with 1 / 2 cir rb needle ( 40 mm length 100 cm size 1 / 0 ) , consumable 25.41 coated braided polyglactin 910 with triclosan coating sut. ) with cd cutting needle ( 22 mm length 45 cm size 3 / 0 ) , consumable 25.42 coated braided polyglactin 910 with triclosan coating sut. ) with 1 / 2 circle reverse cutting needle ( 36 mm length 90 cm size 1 / 0 ) , consumable 25.43 coated braided polyglactin 910 with triclosan coating sut. ) with 1 / 2 circle reverse cutting needle ( 40 mm length 100 cm size 1 ) , consumable 25.44 coated braided polyglactin 910 with triclosan coating sut. ) with 1 / 2 circle reverse cutting needle ( 23 mm length 35 cm size 1 ) , consumable 25.45 coated braided polyglactin 910 with triclosan coating sut. ) with 1 / 2 circle round body taper point needle ( 36.4 mm length 90 cm undyed size 2 / 0 ) , consumable 25.46 coated braided polyglactin 910 with triclosan coating sut. ) with 1 / 2 circle round body taper point needle ( 36.4 mm length 90 cm undyed size 1 / 0 ) , consumable 25.47 coated braided polyglactin 910 with triclosan coating sut. ) with 1 / 2 circle round body taper point needle ( 36.4 mm length 90 cm undyed size 1 ) , consumable 25.48 polypropylene and polyglecaprone 25 composite partialy absorbable monofilament mesh of ( size 15 x 15 cm ) , consumable 25.49 polypropylene and polyglecaprone 25 composite partialy absorbable monofilament mesh of ( size 10x 15 cm ) , consumable 25.5 polypropylene and polyglecaprone 25 composite partialy absorbable monofilament mesh of ( size 6 x 11 cm ) , consumable 25.51 polypropylene and polyglecaprone 25 composite partialy absorbable monofilament mesh of ( size 7.6 x 15 cm ) , consumable 25.52 disposable intraluminal stapler curved circular stapler ( 21 mm with controlled tissue compression ) , consumable 25.53 curved circular stapler ( 25 mm with controlled tissue compression ) , cons ] 25.54 curved circular stapler ( 29 mm with controlled tissue compression ) , consumable [ ] 25.55 curved circular stapler ( 33 mm with controlled tissue compression ) , consumable [ 25.56 hemmorhoidal circular stapler 33mm with controlled tissue compression ( leg length of 4mm ) , consumable [ 7 ] 25.57 linear cutter ( of 55 mm with inbuilt selectable staple height ) , consumable 25.58 universal black reload compatible with the ( 55mm linear cutter with inbuilt selectable staple height ) , consumable 25.59 linear cutter of ( 75 mm with inbuilt selectable staple height ) , consumable 25.6 universal black reload compatible with the ( 75mm linear cutter with inbuilt selectable staple height ) , consumable 25.61 5 mm optic view bladeless trocar ( with bilateral tissue separator ) , consumable 25.62 optic view bladeless trocar with bilateral tissue separator ( 11 mm ) , consumable 25.63 optic view bladeless trocar with bilateral tissue separator ( 12 mm ) , consumable 25.64 optic view bladeless trocar with bilateral tissue separator ( 15 mm ) , consumable 25.65 polyglactin 910 with triclosan coating 2 0, 1 / 2 circle round body ( 30 mm, 100 cm ) , consumable 25.66 polyglactin 910 with triclosan coating 1 0, 1 / 2 circle round body ( 40 mm, 100cm ) , consumable 25.67 polyglactin 910 with triclosan coating 1, 1 / 2 circle round body ( 40 mm, 100 cm ) , consumabl 25.68 polyglactin 910 with triclosan coating 1, 1 / 2 circle reverse cutting o.s ( 40 mm, 100cm ) , consumable 25.69 polyglactin 910 with triclosan coating 1 0, 1 / 2 circle reverse cutting o.s ( 40 mm, 100 cm ) , consumable 25.7 polydioxanone irgacare mp coated ( 122cm , 1 loop sgle armed , 65mm ) , consumable 25.71 polydioxanone irgacare mp 90cm m4 usp1 sgle armed ctx, i / 2 circle ( 48 mm ) , consumable 25.72 polydioxanone irgacare mp 70cm m3 usp2 / 0 sgle armed ( sh, 1 / 2 circle , round body, 26mm ) , consumable 25.73 polydioxanoneirgacare mp 70cm m2 usp3 / 0 sgle armed ( rb 1, 1 / 2 circle , round 25.74 polydioxanoneirgacare mp coated ( 150cm usp1 0 rb ctx, i / 2 circle, 48mm ) , consumable 25.75 suture copolymer of glycolide and ecaprolactone ( 3 0, 30cm, 3 / 8 circle rc 24mm needle, 20 anchors / inch unidirectional ) , consumable 25.76 suture dyed polyester poly ( p dioxanone ) ( 2 0, 30cm, 1 / 2 circle 36mm rb, 20 anchors / inch unidirctional ) , consumable [ 7400080 ] 25.77 suture dyed polyester poly ( p dioxanone ) ( 1, 36x36 cm, 1 / 2 circle cutting 40mm, 20 anchors / inch biderctional ) , consumable [ 7400081 ] 25.78 polyglactin 910 with triclosan coating ( 4 0, 1 / 2 circle round body, 20 mm, 70 cm ) , consumable [ 7400082 ] 25.79 polypropylene and polyglecaprone 25 composite partialy absorbable monofilament mesh ( size 15 x 15 cm ) , consumable [ 7400083 ] 25.8 polypropylene and polyglecaprone 25 composite partialy absorbable monofilament mesh of ( size 10 x 15 cm ) , consumable 25.81 polypropylene and polyglecaprone 25 composite partialy absorbable monofilament mesh of ( size 6 x 11 cm ) , consumable 25.82 polypropylene and polyglecaprone 25 composite partialy absorbable monofilament mesh of ( size 7.6 15 cm ) , consumable ] 25.83 2 octyl cynoacrylate propen, topical skin adhesive ( 0.5ml ) , consumable 25.84 non absorbable ( 10 0 ) monofilament polymide black 6mm 3 / 8 circle spatulated micro point doublw arm ( 38 cm ) , consumable 25.85 absorbable ( 6 0 ) braided coated polyglactin aw violet 8mm 1 / 2 circle spatulated micro point doublw arm ( 45 cm ) , consumable 25.86 non absorbable braided silk black 10mm 3 / 8 circle reverse cutting micro point ( 38 cm ) , consumable 25.87 absorbable surgical suture braided polyglycolic acid 3 / 8 circle reverse cuttingg ( 12mm 45 cm spatulated needle ) , consumable 25.88 non absorbable braided silk black ( 12 mm 3 / 8 circle reverse cutting micropoint 38 cm ) , consumable 25.89 suture copolymer of glycolide and ecaprolactone ( 3 0, 30cm, 3 / 8 circle rc 24mm needle, 20 anchors / inch unidirectional ) , consumable 25.9 suture copolymer of glycolide and ecaprolactone ( 2 0, , 20cm, 26mm, 20 anchors / inch unidirectional ) , consumable 25.91 suture dyed polyester poly ( p dioxanone ) ( 2 0, 30cm, 1 / 2 circle 36mm rb, 20 anchors / inch unidirctional ) , consumable [ 7400095 ] 25.92 suture dyed polyester poly ( p dioxanone ) ( 1, 36x36 cm, 1 / 2 circle cutting 40mm, 20 anchors / inch biderctional ) , consumable [ 7400096 ] 25.93 composite mesh polypropylene and polyglactine 910 ( 6x11 cm ) , consumable 25.94 composite mesh polypropylene and polyglactine 910 ( 10x15 cm ) , consumable 25.95 blood agar powder ( 500 grm ) , consumable [ mis19 ] 25.96 composite mesh polypropylene and polyglactine 910 ( 15x15 cm ) , consumable 25.97 suture dyed polyester poly ( p dioxxanone ) ( 1 0, 24x4 cm, 1 / 2 circle 36mm rb, 20 anchors / inch bidirctional ) , consumable 25.98 suture dyed polyester poly ( p dioxxanone ) ( 1 0, 14x4 cm, 1 / 2 circle 36mm rb, 20 anchors / inch bidirctional ) , consumable 25.99 macro porous tissue separating multi layered partially absorbable mesh with oxidized regenerated cellulose, polydioxanone and soft polypropylene mesh ( size 15 cm x 15 cm ) , consumable 26 macro porous tissue separating multi layered partially absorbable mesh with oxidized regenerated cellulose, polydioxanone and soft polypropylene mesh ( size 15 cm x 20 cm ) , consumable [ 26.01 polyglactin 910 with triclosan ( irgacre mp ) coating 2 0, 1 / 2 circle round body ( 30 mm 90 cm ) , consumable 26.02 polyglactin 910 with triclosan ( irgacre mp ) coating 1 0, 1 / 2 circle round body ( 40 mm 90 cm ) , consumable 26.03 polyglactin 910 with triclosan ( irgacre mp ) coating 1, 1 / 2 circle round body ( 40 mm 90 cm ) , consumable 26.04 polyglactin 910 with triclosan ( irgacre mp ) coating 1, 1 / 2 circle reserve cutting o.s ( 40 mm 90 cm ) , consumable 26.05 polyglactin 910 with triclosan ( irgacre mp ) coating 3 0, 1 / 2 circle round body ( 20 mm 90 cm ) , consumable 26.06 polyglactin 910 with triclosan ( irgacre mp ) coating 1 0, 1 / 2 circle reserve cutting o.s ( 40 mm 90 cm ) , consumable 26.07 polyglactin 910 with triclosan ( irgacre mp ) coating 3 0, 3 / 8 circle reserve cutting ( 26 mm 70 cm ) , consumable 26.08 8 0 double arm nylon monofilament with ( 3 / 8circle taper point needle ) , consumable 26.09 polypropylene monofilament sterile precut cd reverse ( cutting needle 6 0 ) , consumable [ 7410013 ] 26.1 polyglactin 8mm 1 / 4 , circle spatulated micro point double needle ( length 45 cm size 6 0 ) , consumable 26.11 10 0 double arm nylon monofilament with ( 3 / 8 circle taper point needle ) , consumable 26.12 opsite dressing ( 15x28 ) , consumable 26.13 collagen dry sheet ( 10x10 cm sheet ) , consumable 26.14 collagen dry sheet ( 15x30 cm sheet ) , consumable 26.15 collagen dry sheet ( 20x40 cm sheet ) , consumable 26.16 oxidised cellulose absorbable hemostate ( 2x3 ) , consumable 26.17 oxidised cellulose absorbable hemostate ( 4x8 ) , consumable 26.18 oxidised cellulose absorbable hemostate ( 2x14 ) , consumable 26.19 oxidised cellulose absorbable hemostate ( 2x14 ) , consumable 26.2 oxidised regenerated cellulose absorbable hemostate ( 1x2 ) , consumable 26.21 oxidised regenerated cellulose absorbable hemostate ( 2x4 ) , consumable 26.22 oxidised regenerated cellulose absorbable hemostate ( 4*4 ) , consumable 26.23 dura patch ( g.patch ) ( 8x10 ) , consumable 26.24 dura patch ( g.patch ) ( 10x12 ) , consumable 26.25 incise drape mini ( 10x10 cm ) , consumable 26.26 opsite dressing ( 30x28 ) , consumable 26.27 tube ex changer and insertion aid in one size ( 2.5, 6.0 ) , consumable 26.28 soft and gentle adhesive for sealing area around stoma ( 60 gm ) , consumable 26.29 absorbent powder for covering excoriated / damaged skin around stoma ( size 25 gm ) , consumable 26.3 1 pc self adhesive drainable stoma bag for colostomy & illeostomy swiss roll self adhesive with flex patern, transparent drainable stoma bag with built in filter and velcro outlet ( size 75mm ) , consumable 26.31 1 pc self adhesive drainable stoma bag for colostomy & illeostomy double layered self adhesive with flex patern, transparent drainable stoma bag with built in filter and velcro outlet ( size 76 mm ) , consumable 26.32 1 pc self adhesive drainable stoma bag for urostomy with no return valve and easy flexible outlet ( 15 45mm ) , consumable 26.33 2 pc base plate / flange for colostomy / illeostomy / urostomy, self adhesive base plate custom cut with belt tabs, double layer of adhesive ( 40 mm ) , consumable 26.34 2 pc base plate / flange for colostomy / illeostomy / urostomy, self adhesive base plate custom cut with belt tabs, double layer of adhesive ( 50 mm ) , consumable 26.35 2 pc base plate / flange for colostomy / illeostomy / urostomy, self adhesive base plate custom cut with belt tabs, double layer of adhesive ( 60 mm ) , consumable [ 7410038 ] 26.36 2 pc base plate / flange for colostomy / illeostomy / urostomy, self adhesive base plate custom cut with belt tabs, double layer of adhesive ( 70 mm ) , consumable 26.37 2 pc pouches with free rotating lockring mechanism with filter and velcro clamp integrated in the bag ( 40 mm ) , consumable 26.38 2 pc pouches with free rotating lockring mechanism with filter and velcro clamp integrated in the bag ( 50 mm ) , consumable 26.39 2 pc pouches with free rotating lockring mechanism with filter and velcro clamp integrated in the bag ( 60 mm ) , consumable 26.4 tooke corneal knife ( num ) , consumable 26.41 2 pc pouches with free rotating lockring mechanism with filter and velcro clamp integrated in the bag ( 70mm ) , consumable 26.42 flexible self adhesive protective sheet to prevent excoriation ( 20x20 cm ) , consumable 26.43 polydioxanone irgacare mp coated ( 122cm , 1 loop sgle armed , 65mm ) , consumable 26.44 e.d.t.a. vacunater with needle ( 3 ml ) , consumable 26.45 plain vial with screw cap ( 12x75 ) , consumable 26.46 barraquer wire speculum, large ( num ) , consumable 26.47 disposable cresent knife ( 2.2mm ) , consumable 26.48 disposable keratom knife ( 2.8mm ) , consumable [ mis40 ] 26.49 disposable keratom knife ( 3.2mm ) , consumable [ mis41 ] 26.5 disposable sideport knife ( num ) , consumable 26.51 k wire ( length 375mm size:1.6mm roll ) , consumable 26.52 k wire ( length 375mm size:1.8mm roll ) , consumable 26.53 simcoe i / a cannula, direct, ( num ) , consumable [ mis110 ] 26.54 blood urea reagent kit ( 200ml ( 2x100ml ) ) , consumable [ mis20 ] 26.55 malaria bivalent antigen detecting rapid diagonstic tests ( rdts ) for p.f and pv ( 10 card, 10 apillary, 1 buffer solution, 10 alcohol swab, 10 sterile lancet for pricking, ( as per attached specification ) ) ( pack of 10 test.total tests:1cr, rate shall be quoted for pack of 10 ) , consumable [ 7004051 ] 26.56 rpr test kit ( 100 test ) , kit [ mis103 ] 26.57 set of phaco tip and test chamber ( phacoemulsification machine ) , consumable 26.58 test chamber sleeves ( 1 set consist of 2 pieces ) ( phacoemulsification machine ) , consumable 26.59 sets of i a system ( phacoemulsification machine ) , consumable 26.6 disposable cassette ( phacoemulsification machine ) , consumable 26.61 hb electrophoresis ( 200 test ) , consumable 26.62 protein electrophorosis in blood ( serum ) , urine , csf ( 200 test ) , consumable 26.63 conventional medical x ray film polyster based imaging film 35.6cmx43.2cm ( 14x17 ) ( size 50 sheet in one packet ) , consumable 26.64 conventional medical x ray film polyster based imaging film 35.6cmx35.6cm ( 14x14 ) ( size 50 sheet in one packet ) , consumable 26.65 conventional medical x ray film polyster based imaging film 30.5cmx30.5cm ( 12x12 ) ( size 50 sheet in one packet ) , consumable [ 7004063 ] 26.66 conventional x ray film 12x15 ( 50 sheet / pack ) , consumable 26.67 conventional x ray film 10x12 ( 50 sheet / pack ) , consumable 26.68 conventional x ray film 8x10 ( 50 sheet / pack ) , consumable [ 7004066 ] 26.69 urine container size of the container shall be 30ml disposable ( 50 per pkt ) , consumable 26.7 anastrozole tablet ( 1 mg ) , tablet 26.71 ppe kit ( as per attached specification ) , consumable 26.72 chewable antacid containing magnesium hydroxide minimum 250mg to 500mg+aluminimum hydroxide minimum 250mg to 500mg +simethecon / dimethicon minimum 25mg to 50mg tab ( additional component will also be accept ) , tablet 26.73 etanercept 25mg / vial ( pack of 2 vials ) , injection 26.74 dextromethorphan 10mg / 5ml ( 100ml bottle ) , syrup 26.75 oxygen cylinder with instrument set for oxygen delivery b type, make everest kanto cylinder limited; ( model everest;country of origin india ) , consumable 26.76 oxygen cylinder with instrument set for oxygen delivery d type, make everest kanto cylinder limited; ( model everest;country of origin india ) , consumable 26.77 m 30 d diluent ( 20ltr ) , consumable 26.78 m 30 r rinse ( 20ltr ) , consumable 26.79 filter for complete pulmonary function testing ( including dlco ) with body box ( 100 filters per pack, make medisoft sa ) , consumable 26.8 needle no 2 ( 1.5 ) , consumable 26.81 ophthalmic needles ( ) , consumable 26.82 silk suture ( 9 0 ( spatulated micropoint reverse cutting needle double armed suture ) ) , consumable 26.83 silk suture ( 10 0 ( spatulated micropoint reverse cutting needle double armed suture ) ) , consumable 26.84 chloranphenicol + dexamethasone ( 5ml ) , ointment 26.85 chloranphenicol 1% + dexamethasone 0.1% ( 5ml vial ) , eye drop 26.86 prednisolone acetate ( 1% 5ml / 10ml ) , eye drop 26.87 nepafenac ( 1mg / ml ) , eye drop 26.88 artificial tear ( 5ml ) , eye drop 26.89 sprit ( 450ml ) , solution 26.9 sensoracaine injection 0.25% ( 30ml ) , injection 26.91 hylase inj ( 1500iu ) , consumable 26.92 hpmc ( hydroxy propylmetty cellulose ) ( 5ml ) , injection 26.93 sinskey ii lens manipulating hook ( angled ) , consumable 26.94 nightingale capsule polisher ( posterior ) , consumable 26.95 castroviejo caliper ( straight ) , consumable 26.96 colibri forceps 1x2 teeth ( 0.12 mm ) , consumable 26.97 mc pherson tying forceps ( long handle ) , consumable 26.98 mc pherson forceps ( 11 mm angled ) , consumable 26.99 vannas capsulotomy scissors ( angled forward 11 mm blade ) , consumable 27 bard parker handle ( handle ) , consumable 27.01 anterior chamber washout cannula ( 16 g ) , consumable 27.02 pearce hydrosdissection cannula ( 35 inc ang 25 g ) , consumable 27.03 kellan hydrodelineation ( curved bevel tip 25g ) , consumable [ 750018 ] 27.04 jensen capsule polisher ( sand blast olive tip 23g ) , consumable 27.05 knolle pearce irrigating vectis ( ) , consumable 27.06 sterlization box with two sillicon mats ( ) , consumable 27.07 kratz barraquer wire speculum ( big ) , consumable 27.08 castoviejo cyclodialysis spatula ( 0.50 mm wide ) , consumable [ 750023 ] 27.09 utrata capsulorhexis forceps ( flat handle ) , consumable 27.1 eye scissors straight ( 4 1 / 2 lenth ) , consumable 27.11 kramer corneal fixation forceps ( ) , consumable 27.12 air injection canula ( 27g ) , consumable 27.13 desmarres lid retractor ( size 0 ) , consumable [ 750028 ] 27.14 ranibizumab 10mg / ml injection ( intenvitral 0.25ml ) , injection 27.15 prochlorperazine tab ( 5mg ) , tablet 27.16 bed sheet colored 60x90 ( 60x90 ) , consumable 27.17 blanket cover 54x90 ( for cover of above size blanket ) , consumable 27.18 blanket cover 60x90 ( for cover of above size blanket ) , consumable 27.19 mattress cover 3x6 ( for cover of above size mattress ) , consumable 27.2 livery set pants and shirt without stitching ( 3 meter cloth ) , consumable 27.21 ladies livery set saree white polyester green / blue border with blouse ( 6.50 mtr ) , consumable 27.22 surgeon gown ( std size ) , consumable 27.23 micro pipette tips 5 300ul ( 100 per pack ) , consumable 27.24 collection tube polystrene ( 100 per pack ) , consumable 27.25 baby suit plain phalalane suit ( 5 peace ) , consumable 27.26 gram staining kit ( crystal ) ( 125ml x 4 ) , consumable 27.27 acid fast staining kit ( carbol ) ( 125ml x 3 ) , consumable 27.28 widal slide test ( 4x5ml with control ) , consumable 27.29 hbv elisa test kit pack size : 96 wells per kit ( rate should be quoted for 1kit containing 96 27.3 hbv rapid test kit quantity is in no. of test card only ( and rate should be quoted for one test card ) , consumable 27.31 torsemide ( 20mg ) , tablet 27.32 temephose 50% ec ( 5 litre ) , chemical 27.33 bti 5% as ( biolarvicide ) , consumable 27.34 diflubenzuron 25% wp ( chemical larvicide ) , consumable 27.35 cyphenothrin 5% ec ( spray ) , consumable 27.36 technical malathion ( spray ) , consumable 27.37 triple sugar iron agar ( 100gm pack ) , consumable 27.38 selenite f broth ( 100gm pack ) , consumable 27.39 nutrient broth ( 500 gm ) , consumable 27.4 muller hinton agar ( 500 gm ) , consumable 27.41 sabroud dextrose agar with chlorophenicol ( 100 gm ) , consumable 27.42 simmons citrate agar ( 100 gm ) , consumable 27.43 brain heart infusion broth ( 500 gm ) , consumable 27.44 columbia blood agar base ( 500 gm ) , consumable 27.45 cled agar ( 500 gm ) , consumable 27.46 glucose phosphate broth ( 100 gm ) , consumable 27.47 cristensens urea agar base ( 100 gm ) , consumable 27.48 salmonella shigella agar ( 100 gm ) , consumable 27.49 cary blair medium base ( 100 gm ) , consumable 27.5 tcbs agar ( 100 gm ) , consumable 27.51 bile salt agar ( 100 gm ) , consumable 27.52 bile esculin agar ( 100 gm ) , consumable 27.53 cetrimide agar ( 100 gm ) , consumable 27.54 cedar wood oil ( 125 ml ) , consumable 27.55 amikacin 30 mcg ( 1 packet of 5 vial ( each vial of 100 disc ) ) , consumable 27.56 imipenem 10 mcg ( 1 packet of 5 vial ( each vial of 100 disc ) ) , consumable 27.57 co trimoxazole ( sulpha / trimethoprim ) 25 mcg ( 23.75 / 1.25 ) ( 1 packet of 5 vial ( each vial of 100 disc ) ) , consumable 27.58 nitrofurantion 300 mcg ( 1 packet of 5 vial ( each vial of 100 disc ) ) , consumable 27.59 nalidixic acid 30 mcg ( 1 packet of 5 vial ( each vial of 100 disc ) ) , consumable 27.6 amoxyclav ( amoxycillin / clavulanic acid ) 20 / 10 mcg ( 1 packet of 5 vial ( each vial of 100 disc ) ) , consumable 27.61 gentamicin 10 mcg ( 1 packet of 5 vial ( each vial of 100 disc ) ) , consumable 27.62 ciprofloxacin 5mcg ( 1 packet of 5 vial ( each vial of 100 disc ) ) , consumable 27.63 ceftriaxone 30 mcg ( 1 packet of 5 vial ( each vial of 100 disc ) ) , consumable 27.64 cefuroxime 30 mcg ( 1 packet of 5 vial ( each vial of 100 disc ) ) , consumable 27.65 teicoplanin 30 mcg ( 1 packet of 5 vial ( each vial of 100 disc ) ) , consumable 27.66 piperacillin 100 mcg ( 1 packet of 5 vial ( each vial of 100 disc ) ) , consumable 27.67 norfloxacin 10 mcg ( 1 packet of 5 vial ( each vial of 100 disc ) ) , consumable 27.68 colistin 10 mcg ( 1 packet of 5 vial ( each vial of 100 disc ) ) , consumable 27.69 cefoperazone 75 mcg ( 1 packet of 5 vial ( each vial of 100 disc ) ) , consumable 27.7 piperacillin / tazobactam 100 / 10 mcg ( 1 packet of 5 vial ( each vial of 100 disc ) ) , consumable 27.71 ceftazidime 30 mcg ( 1 packet of 5 vial ( each vial of 100 disc ) ) , consumable 27.72 cefazoline 30 mcg ( 1 packet of 5 vial ( each vial of 100 disc ) ) , consumable 27.73 ampicillin 10 mcg ( 1 packet of 5 vial ( each vial of 100 disc ) ) , consumable 27.74 tobramycin 10 mcg ( 1 packet of 5 vial ( each vial of 100 disc ) ) , consumable 27.75 polymyxin b ( 1 packet of 5 vial ( each vial of 100 disc ) ) , consumable 27.76 doxycycline hydrochloride 30 mcg ( 1 packet of 5 vial ( each vial of 100 disc ) ) , consumable 27.77 chloramphenicol 30 mcg ( 1 packet of 5 vial ( each vial of 100 disc ) ) , consumable 27.78 tetracycline 30 mcg ( 1 packet of 5 vial ( each vial of 100 disc ) ) , consumable 27.79 azithromycin 15 mcg ( 1 packet of 5 vial ( each vial of 100 disc ) ) , consumable 27.8 levofloxacin 5 mcg ( 1 packet of 5 vial ( each vial of 100 disc ) ) , consumable 27.81 erythromycin 15 mcg ( 1 packet of 5 vial ( each vial of 100 disc ) ) , consumable 27.82 clindamycin 2 mcg ( 1 packet of 5 vial ( each vial of 100 disc ) ) , consumable [ 121051 ] 27.83 penicillin 10 units ( 50 100 disc per pack ) , consumable 27.84 vancomycin 30 mcg ( 50 100 disc per pack ) , consumable 27.85 cisplatin 0.5 mg / ml injection ( 20 ml vial ) , injection 27.86 clonidine 150 mcg / ml ( injection 1 ml amp ) , injection 27.87 clonidine hydrochloride ( 500 mcg injection vial / amp ) , injection 27.88 dextrose d 50 0.5 infusion ( 500 ml ffs bottle ) , infusion 27.89 dicyclomine hydrochloride 10 mg / ml ( injection 2 ml vial ) , injection 27.9 electrolyte e ( multiple electrolytes and dextrose injection type v ip ) type v ip infusion ( 500 ml ffs bottle ) , infusion 27.91 electrolyte g ( multi electrolyte with 5% dextrose iv injection type iv ip ) type iv ip infusion ( 500 ml ffs bottle ) , infusion 27.92 etophylline + theophylline ( 46.5 + 40 ) ( mg / 5 ml syrup 100 ml bottle ) , syrup 27.93 heparin 25000 iu injection ( 5 ml ) , injection 27.94 formoterol + fluticasone 250 mg + 500 mg rotacaps ( 30 capsul pack with rothelar ) , rotahaler 27.95 heparin sodium + benzyl nicotinate 50 iu + 2 mg ( ointment 20 gm ) , ointment 27.96 homatropine 2 % ( eye drops 5 ml ) , eye drop 27.97 hydroxyethylstarch 6% solution with sodium chloride 0.9% iv infusion i / v hydroxyethylstarch 6% solution with sodium chloride 0.9% ( infusion 500 ml ffs bottle ) , infusion 27.98 iron & folic acid 20 mg / ml + 100 mcg / ml syrup ( 50 ml with dropper ) , syrup 27.99 ivf hydroxy ethyl starch 3% injection ( 500 ml ) , injection 28 levobupivacaine 0.01 injection ( vial ) , injection 28.01 levosalbutamol + ipratropium 100 mcg + 40mcg rotacaps ( 30 capsul pack with rothelar ) , rotahaler 28.02 levosalbutamol 1 mg / 5 ml ( syrup 100 ml ) , syrup [ 121081 ] 28.03 levosalbutamol 100 mcg rotacaps ( 30 capsul pack with rothelar ) , rotahaler 28.04 lignocaine spray 0.1 spray ( 100 ml ) , miscellaneous 28.05 lignocaine spray 2 % spray ( 30 ml ) , spray 28.06 linazolid 200 mg / 100 ml infusion ( 300 ml ) , infusion 28.07 liposomal doxorubicin ( 20 mg injection vial ) , injection 28.08 liquid fluoxetine ( 20 mg / 5 ml liquid 30 ml ) , liquid 28.09 liquid risperidone ( 1 mg / ml liquid 60 ml ) , liquid 28.1 morphine sulphate ( 30 mg ) , tablet 28.11 afatinib ( 40 mg ) , tablet 28.12 albendazole + ivermectin ( 400mg + 6mg ) , tablet 28.13 chymotrypsin + trypsin ( 20000 iu + 100000 iu ) , tablet 28.14 artesunate + sulphadoxine + pyrimethamine ( age group 9 to 14 years ) ( 50 mg ( 3 tab ) � � � � � � + 500 mg ( 2 tab ) + 25 mg ( 2 tab ) tablet 1 combi pack ) , tablet 28.15 artesunate + sulphadoxine + pyrimethamine ( age group of less than 1year ) ( 25 mg ( 3 tab ) + 250 mg ( 1 tab ) + 12.5 mg ( 1 tab ) tablet 1 combi pack ) , tablet 28.16 rifampicin + ethambutol + isoniazid pyrazinamide ( 150 mg + 225 mg + 400 mg + 750 mg ) , tablet [ 120801 ] 28.17 lactic acid bacillus ( 5 mg ) , tablet [ 120805 ] 28.18 chloramphenicol + dexamethasne ( 1% + 0.1% ) ( 5 ml ) , eye ointment [ 120682 ] 28.19 chlorpheniramine melate + phenylephrine ( 5 mg + 2 mg each 5ml infusion 100 ml bottle ) , infusion 28.2 isoniazid ( 100mg ( as per attached specification ) ) , tablet 28.21 isoniazid ( 300 mg ( as per attached specification ) ) , tablet 28.22 adenosine ( 2 ml amp ) ( 3 mg / ml ) , injection 28.23 disposable needle 20 g no ( isi marked needle ) , consumable 28.24 polyester braided coated with cd white dn 17 mm taped cut 90 cm 2 / 0 ( 12 foils / pkt ) ( surgical suture ) , consumable 28.25 gauge than ( 91cm x 20 mtr ) , consumable 28.26 chlorhexidine gluconate ( antiseptic ) ( 0.004 solution 500 ml bottle ) , solution 28.27 lmwh low molecular weight heparin inj ( 4000iu / ml. injection 4000iu / ml injection solution for ) , injection solution for 28.28 lmwh low molecular weight heparin inj. 6000 x 000d iu / ml, injection ( injection solution for 6000 x 000d iu / ml ) , injection solution for 28.29 lysol ip ( cresol with soap solution ) 5ltr jar ( medicine 5ltr jar ) , liquid 28.3 lysol ( cresol with soap solution ) 53% + 47% ( solution 5 ltr ) , liquid 28.31 magnesium hydroxide ( syrup 400 ml ) , syrup 28.32 meropenem + sulbactum ( 1 gm + 500 mg ) ( 1.5 gm injection vial ) , injection 28.33 micronised progestrone 50 mg / ml ( injection 2 ml amp ) , injection 28.34 milk of magnesia + liquid paraffin + phenolphthalein ( cremaffin pink formula ) ( ( 11.25 ml + 3.75 ml + 50 mg ) / 15 ml syrup 170 ml bottle ) , syrup 28.35 multi vitamin each ml containvit a 3000 iu vit b1 1mg riboflavin phosphate sodium 2mg, panthenol 2.5mg niacinamide 10mg pyridoxin 1 mg cynacobalamine 1mcg lysine 10 mg ( 15ml oral drop 15ml ( with dropper, which should be able to screw & cap the bottle ) in unit carton ) , drop 28.36 neomycin + bacitracin zinc + sulphacetamide sodium ( 5 mg + 250 unit + 60 mg powder 10 gm ) , powder 28.37 neomycin + polymyxin b sulphate + zinc bacitracin ( neosperine ) ( ( 3400 iu ) + ( 5000 iu ) + ( 400 iu ) powder 10 gm ) , powder 28.38 neomycin + polymyxin b sulphate + zinc bacitracin ( neosperine ) ( ( 3400 iu ) + ( 5000 iu ) + ( 400 iu ) ointment 28.3 gm ) , ointment 28.39 neomycin sulphate + bacitracin zinc ( 5 mg + 500 iu / gm ointment 15 gm ) , ointment 28.4 nicotinamide + folic acid + cyanocobalamin 200 mg + 15 mg + 500 mcg ( injection 10 ml ) , injection 28.41 nicotine 14 mg transdermal patch ( strip ) , transdermal patch 28.42 nicotine 2 mg gum ( strip ) , gum 28.43 nicotine 2 mg lozenges ( strip ) , lozenges 28.44 nicotine 4 mg gum ( strip ) , gum 28.45 nitroglycerine ( glyceryl tri nitrate ) 25 mg / 5 ml injection ( 5 ml amp ) , injection 28.46 paracetamol for iv 10 mg / ml infusion ( 100 ml ffs bottle ) , infusion 28.47 pilocarpine 0.02 eye drops ( 5 ml vial ) , eye drop 28.48 cyproheptadine hcl ( 200ml syrup ) , syrup 28.49 bisacodyl ( 10 mg ) , suppository 28.5 basal insulin glargin ( 40 iu / ml vial / cartridge ) , injection 28.51 basal insulin glargin 300 iu injection penfill 300 iu with free permanent pens one pen for ( each five cartridge and 10 needles per pen ) , injection 28.52 biphasic isophane insulin injection 30 / 70 ( 30% soluble insulin 70% isophane insulin ) ( 40 iu / ml 10ml vial ) , injection 28.53 bethanechol ( 25mg ) , tablet [ 120806 ] 28.54 ciprofloxacin 0.003 ( 3 / 3.5 gm ) , eye ointment 28.55 alkaline citrate with potassium ( sodium citrate 1gm + potassium citrate 0.65gm +citric acid 1gm ) / ) ( 10ml oral solution 100ml bottle ) , solution 28.56 benzyl nicotinate topical + heparin topical ( 2mg + 50iu ( 20gm ) ) , ointment 28.57 calcium dobusulate calcium dobesilate + lignocaine + hydrocortisone + zinc oxide ( 0.25% + 3% + 0.25% + 5% w / w ( 30 gm ) ) , cream 28.58 calcium dobusulate ( 500 mg ) , capsule 28.59 folic acid + l glutamic acid + pyridoxin + thiamine ( 1.5mg + 45mg + 5mg + 5mg ) , tablet 28.6 iron and folic acid sugar coated pink ( as per nipi guidelines ) ( 45mg + 0.4mg ) , tablet 28.61 surgical suture ( ) , consumable 28.62 premixed insulin biphasic analogue 30 / 70 in penfill 300iu permanent pens ( one pen per five cartridges and ten needles per pen 300iu injection vial / amp ) , injection 28.63 povidone iodine vaginal ( 200 mg ) , pessary 28.64 salbutamol nebuliser solution bp sabutamol sulphate eq. to salbutamol 1mg per ml ( 2.5 ml amp ) , suspension 28.65 salmetrol + fluticasone 250 mcg rotacaps ( 30 capsul pack with rothelar ) , rotahaler 28.66 salmetrol + fluticasone 500 mcg rotacaps ( 30 capsul pack with rothelar ) , rotahaler 28.67 terbutaline suplhate 0.5 mg / ml ( injection 1 ml amp ) , injection 28.68 tiotropium 9 mcg rotacaps ( 30 capsul pack with rothelar ) , rotahaler 28.69 torasemide 10 mg / ( vial injection vial ) , injection 28.7 vitamin k 1 mg / 1 ml injection ( 1ml amp ) , injection 28.71 acetaminophen + tramadol hydrocloride 325 mg + 37.5 mg ( tablet 10 x 10 ) , tablet 28.72 frusemide + amiloride 40 mg + 5 mg ( tablet 10 x 10 ) , tablet 28.73 potassium chloride 175 mg tablet ( strip ) , tablet 28.74 prazosin 1 mg ( tablet 10 x 10 ) , tablet 28.75 rifampicin + isoniazid 450 mg + 300 mg capsule ( 750 mg ) , capsule 28.76 theophylline + etophylline ( 35mg ) + ( 115mg ) ( 150mg tablet strip ) , tablet 28.77 dextrose, d 50 0.5 infusion ( 100 ml ffs bottle ) , infusion 28.78 dextrose, d 50 50% injection ( 10 ml amp ) , injection 28.79 isoxsuprine hcl 40 mg injection ( vial / amp ) , injection 28.8 liquid piracetam 500 mg / 5 ml ( liquid 100 ml ) , liquid 28.81 nacl drip 3 % infusion ( 100 ml ffs bottle ) , infusion 28.82 saline ( nacl ) 0.9 % nasal drops ( 10 ml ) , nasal drop 28.83 theophylline + etophylline ( 25.3mg ) + ( 84.7mg ) injection ( 2 ml ) , injection 28.84 synthetic pyrethrum ( 5% ) , solution 28.85 temephos ( 5% ) , solution 28.86 dextran 40 0.4 injection ( 500 ml ) , injection 28.87 dextran 70 0.06 infusion ( 500 ml ffs bottle ) , infusion 28.88 tinidazole i.v. 2 mg / 1ml infusion ( 400 ml ) , infusion 28.89 ambu bag / adult each 1000 1700ml, with oxygen connecting tube , should be supplied with a carry pouch , ambu bag should be complete with required autoclavable valves and other accessories, ( ( should have silicon rubber bellow to withstand autoclave at 134 degree c ) should be multiple times autoclavable ) , consumable 28.9 tranexamic acid 500 mg / 5ml injection ( 5 ml amp ) , injection [ 121094 ] 28.91 blood bag double 350ml ( as per attached specification ) , each [ 121210a ] 28.92 blood bag triple 350ml as per attached specification ( each ) , bag 28.93 blood bag triple sagam 450ml ( as per attached specification ) , each 28.94 blood bag triple sagam 350ml ( each ) , bag [ 121212 ] 28.95 single blood bag ( as per attached specification ) , each 28.96 i.v cannula for single use ( intravascular catheters ) bis ( gauze 22, length 25 ) consumable ( each ) , consumable 28.97 i.v cannula ( two way ) size ( 16 nos ) , consumable 28.98 i.v cannula size with inj. valve ( port ) ( 22g ) , consumable 28.99 quadruple blood bags as per attached specification ( each ) , consumable 29 placenta extracts ( 0.1gm vial / amp ) , injection 29.01 ambu bag ( silicon type ) paediatrics each 300 500 ml with oxygen connecting tube, should be supplied with a carry pouch, ambu bag should be complete with required autoclavable valves and other accessories ( ( should have silicon rubber bellow to withstand autoclave at 134 degree c, should be multiple times autoclavable ) , consumable 29.02 b.b silk ( 12 foils / pkt ) ( 3 / 8rcut needle 45mm length 76cm, size 2 / 0 ) ( consumable ) , consumable 29.03 disposable sterile gloves isi marked surgical rubber made of hypoallergic latex 100% , electronically tested sterilized by gamma irradiation / eto is no:13422:1992 as amended upto, powder free 6 inch / pair ( pair ) , consumable 29.04 disposable sterile gloves isi marked surgical rubber made of hypoallergic latex 100% , electronically tested sterilized by gamma irradiation / eto is no:13422:1992 as amended upto, powder free 6.5 inch / pair ( pair ) , consumable [ 13002 ] 29.05 polyamide mono filament ( nylon ) with cd cut needle 20 / 16 mm length 70 cm size 2 / 0 ( 12 foils / pkt ) , consumable [ 121206 ] 29.06 disposable sterile gloves isi marked surgical rubber made of hypoallergic latex 100% , electronically tested sterilized by gamma irradiation / eto is no:13422:1992 as amended upto, powder free 7 inch / pair ( pair ) , consumable [ 13003 ] 29.07 disposable sterile gloves isi marked surgical rubber made of hypoallergic latex 100% , electronically tested sterilized by gamma irradiation / eto is no:13422:1992 as amended upto, powder free 7.5 inch / pair ( pair ) , consumable [ 13004 ] 29.08 black braided silk with 1 / 2 cir cutting needle 16mm length 75cm size 3 / 0 ( 12 foils / pkt ) , consumable [ 121207 ] 29.09 draw sheet ( each ) one side linen and one side autoclavable water proof sheet size 58x36 ( each ) , consumable [ 13005 ] 29.1 insulin syringe { auto disabled ( ad ) / reuse prevantion ( rup ) syringe } with 31g needle ( single unit pack ) is marked, 40 iu ( each ) , consumable [ 13006 ] 29.11 insulin syringe with 31g needle ( single unit pack ) is marked, 100iu, { auto disabled ( ad ) / re use prevantion ( rup ) syringe ( each ) , consumable 29.12 insulin syringe { auto disabled ( ad ) / reuse prevantion ( rup ) syringe } / each ( graduation upto 100 units ) 30g needle, 40 units / ml ( 30 g needle, 40units / ml ) syringe ( each ) , consumable 29.13 mackintosh ( as per attached specification ) , quantity amended as 300000 meter i.e 15000 roll of 20 meter roll, rate should be quoted for 20 meter, is 8164 1976 or conforming to is 8164 1976 ( roll ) , consumable 29.14 vial 5ml, vial test tube, leak proof, ungraduated, polypropylene / polyethylene capacity 5ml each ( each ) , consumable 29.15 solubility test kit ( for sickle cell ) , 50 test / kit, as per attached specification, control sample is not mandatory acessories required 1. dropper 2.test tube ( standard size ) / vial 3. reading stand 4.micropipette with tip / capillary tube 5.lancet ( 6.alcohol swab , kit ) , kit 29.16 nestroft test kit ( for thalasemia traits ) , 50 test / kit, as per attached specification ( kit ) , kit 29.17 screw cap vial with o ring ( 2ml ) , screw cap, leak proof self standing / flat bottom with o ring, un graduated, polypropylene / polyethylene, 2ml capacity each ( each ) , consumable 29.18 steralised and autoclavable culture tube flat bottom, 5ml ( plastic ) ( each ) , consumable 29.19 recombiant fviii ( 1000 iu / vial ) , vial 29.2 bone wax sterilised ( 2.5 gm / packet ) ( consumable ) , consumable 29.21 formaline 37% ( 500 ml bottle ) , consumable 29.22 iv cannula with inj.valve ( port ) ( size 26g each consumable ) , consumable 29.23 radio opaque catheter with ptfe / polyurethine / fep / volex material ( iv safety cannula with luer lock ( g 18 ) ) , consumable 29.24 radio opaque catheter with ptfe / polyurethine / fep / volex material ( iv safety cannula with luer lock ( g 20 ) ) , consumable 29.25 radio opague catheter with ptfe / polyurethine / fep / volex material ( iv safety cannula with luer lock ( g 22 ) ) , consumable 29.26 safe delivery kit 1 plastic desposable gown ( non woven plastic laminated, leak proof ) 2 ( 4*4 ) , ( 2 ) disposable goggles for protection of eyes 2 ( free size ) , ( 3 ) face mask 2 free size ( 4 ) plastic disposable cap ( non woven plastic laminated, leak proof ) ( ( 1pair, ( 5 ) long gloves elbow length 2pairs ( 6 1 / 2 and 7 ) ( 6 ) disposable shoe covers till calf ( plastic ) 2pair umbical cord clamps plastic material ( 1pair ) ( free size ) ( as per attached specification ) ) ) , consumable 29.27 potassium free, hemodialysis fluid for bicarb made ( ( part a 10 ltr +part b 500gm2 / pkt ) ) , consumable 29.28 potassium free, hemodialysis powder for bicarb made ( ( part a powder to make 10 ltr +part b 500gm 2 / pkt ) ) , consumable 29.29 uric acid ( 50 ml ( 2 x 25 ml ) , consumable 29.3 disposable syringe { auto disabled ( ad ) / re use prevantion ( rup ) syringe } ( ( for vitamin k inj ) ( 1ml with needle 26g ) ) , consumable 29.31 albumin reagent kit, 200ml ( 4*50 ml ) , consumable 29.32 electric cautery lead / each disposable electro surgical pencil 4cm ( each ) , each 29.33 glycrine i.p. ( 400 gm ) , solution 29.34 glycrine i.p. ( 50 gm ) , solution 29.35 polybutester with polytribolate coating 7 0 60 cm, blue 8 mm 3 / 8 circle ( taper point double arm ) , surgical material 29.36 long term absorbable polyglyconate knotless wound closure device with unidirectional & dual angled cut barbs geometry 0, 30 cm ( green 37 mm 1 / 2 circle taper point ) , sutures 29.37 monofilament glycomer 1 , 90 cm ( violet 40mm 1 / 2 circle taper point ) , sutures 29.38 hemorrhoid stapler 33 mm diameter with detachable anvil ( staple height 3.5 mm ) , sutures 29.39 reusable gastro intestinal anastomotic stapler 60 mm with dual firing knob ( inbuilt knife in every cartridge ) , sutures 29.4 reusable gastro intestinal anastomotic stapler 80 mm with dual firing knob ( inbuilt knife in every cartridge ) , sutures 29.41 medium wound protector ( 5 9 cm ) , sutures 29.42 3 dimensional polyester mesh with micro porosity ( x stich macro porosicty and multidirectional elasticity with optimesed atello collagen 1 absorbable anti adhesive barrier 15 cm circular with nylon prefixed sutures ) , consumable 29.43 polyester self gripping mesh with poly lactic acid for open incisional hernia repair ( size 15 x 15 cm ) , consumable 29.44 titanium non absorbable 5 mm ( helical tacker for mesh fixation with 30 tacks ) , consumable 29.45 ag ion impregnated central venous triple lumen polyurethane catheter ( 7.5 fr, g 14x18x18 length 16 cm ) , consumable 29.46 therma coal box ( box ) , consumable 29.47 potassium di chromate ( chornicals formula:k2cr207, formula wt:294.2, minimum assay 99.5% 1kg ) , consumable 29.48 phenolic compounds containing disinfectants ( houschold disinfectant, containing ohcnolic compounds such as monochlorophenol, coal tar acid, oils and mulsifiers etc.the approx content of phenolic compounds should be at least 40% 5 ltrs ) , consumable 29.49 basie fuchsin chemical name:pararosaniline hydrochloride, chemical structure c20h20cin3 mol wt:337.86 dye content: approx 85% 88% dye content must be mentioned color: metalic green ( 25 gms glass bottle ) , consumable 29.5 sulphuric acid ( chemicals name sulphuric acid formula wt:98.08, specific gravity 1.84 minimum assay 98% 500ml ) , consumable 29.51 malachit green ( malachit green hydro chloride, chemical structure:c23h25ctn2 molecular wt 364.9 colour green dye co ) , consumable 29.52 methylene blue ( methylene thionine chloride, chemical structure:c23h25cin3s molecular wt:319.9 dye content:approx 82% ( dye content must be mentioned ) ) , consumable 29.53 hydrochloric acid ( concentrated hydro chloric acid molecular wt;36 46 specific gravity 1.18 1ltr ) , consumable 29.54 porassium permanganate ( kmno4 formula wt;158 500gms ) , consumable 29.55 auramine ( c17h22cin3 mol wt:303.84 25 gms ) , consumable 29.56 liquid paraffin ( heavy grade ) ( refractive index of 1.48 it should be colourless odurless transparent free from fluorescene in day light with relative density of 0.5 50 ml ) , consumable 29.57 sodium citrate ( trisodium citrate dihydrate, ar grade chemical structure na3c6h5o7.2ho molecular wt ( fw ) 294.10purity 500 gms ) , consumable 29.58 potassium phosphate ( potassium di hydrogen ortho phosphate kh2po4 molecular wt:136.1 minimum assay 99% 1kg ) , consumable 29.59 magnesium sulphate ( mgso4 7h2o;mol wt 246.48;purity 99.5% 1kg ) , consumable 29.6 magnesium citrate ( tribasic; c12h10mg3o14.9 h2o mol wt:613.28 500 gms ) , consumable 29.61 l asparagine monohydrate ( c4h8n23.h2o mol wt: 150.14 25 gms ) , consumable 29.62 glycerol ( ch2ohchohch2oh mol wt:92.1 purity 99.5% 1 ltr ) , consumable 29.63 sodium hydroxide pellets ( naoh formula wt:40 minimum assay:98% 500gm ) , consumable 29.64 cetyl pyridinium chloride ( chemical structure: c21h38cin.h2o / 358 500gms ) , consumable 29.65 sodium chloride ( chemical structure: nac1 molecular weight:58.44 minimum assay:99.9% 1 kg ) , consumable 29.66 dihydrostreptomycin sedquisulphate ( sigma d 7253 25 gms ) , consumable 29.67 isonicotinic acid hydarazide ( sigma i 3377 25 gms ) , consumable 29.68 rifampicin ( sigma r 3501 25 gms ) , consumable 29.69 ethambutol dlhydrochloride ( sigma e 4630 25 gms ) , consumable 29.7 pnb ( para nitro benzonic acid formula wt: 167.12 min assay 99% c6h4coohno2 100 gms ) , consumable 29.71 cyanogen bromide ( cnbr cisco research lab:mol wt:105.9 100 gms ) , consumable 29.72 o tolidine a.r ( dimethyl benzidine: c14h16n2 from wt 212.3 ) , consumable 29.73 hydrogen peroxide ( ar or gr grade assay 29 32% solution fw 34.01 1 ltr ) , consumable 29.74 tween 80 ( polyoxyethylenesorbitanmoonooleate ar or gr grade density 1.06 1.09g / ml 500 ml ) , consumable 29.75 oxalic acid ( pure ) ( coohcooh.2h2 mol wt:126.07 purity 99.8% 500gms ) , consumable 29.76 absolute alcohol ( ethanol 1 ltr ) , consumable 29.77 liquor ammonia ( lr / gr grade 1ltr ) , consumable 29.78 sodium carbonate ( na2co3 wt: 106 minimum asay 99% 500 gms ) , consumable 29.79 n n dimethyl formamide ( hcon ( ch3 ) 2 mol wt:73.09 500 ml ) , consumable 29.8 formaldehyde ( hcho mol wt 30.03 wt per ml at 20oc 1.075 1.095g; methanol contant 10 15% assay ( acidimetric ) as hcho 37 11% 1 ltr ) , consumable 29.81 spare caps for universal containers ( spare caps with liner for universal containers 28 ml wide neck pack of 100 nos ) , consumable 29.82 diamond marker pencil ( 6 holder with artificial diamond ( hard stone ) embedded at one end with screw cap to mark on microscope glass slides 6 nos ) , consumable 29.83 grease marking pencil ( mps, blue or red coloured, length to write on glass ware / metal surfaces 8 nos ) , consumable 29.84 cotten ( absorbent, each roll of 0.5 kg 10 rolls ) , consumable 29.85 filter paper ( filter paper no 1, 12.5 cms diameter for filtering carbot fuchsin using a small funnel of 10cm maximum diameter smooth on one 120 packs ) , consumable 29.86 brown paper for packing ( 115 cm.x 75 cm size sheets 75 sheets ) , consumable 29.87 non absorbent cotton ( non absorbent cotten rolls of 1 / 2 kg cach surgical grade 4kg ) , consumable 29.88 lens paper ( soft microsope lens cleaning tissue, 4x6 booklet each booklet containning 100 sheets 50 booklets ) , consumable 29.89 slides ( glass microscope slides 76mm x 26mm x 1.3mm, plain one pack of 50 slides 50 packs ) , consumable [ 121178 ] 29.9 test tubes ( glass autoclavable and heat resistant standerd rimless 150 x 16mm with screw caps 1 ) , consumable 29.91 loop wire ( nichrome wire 24 standard wire gauge ( swg ) or 0.002 inches or 0.559 mm thickness swg 10 metres ) , consumable 29.92 glass beads ( acid washed 3mm diameter round transpatent for dispersing the clumps of microorganisms by vortexing or blending 500 29.93 bijou bottles ( borosilicate or corning glass of 5 ml capacity witj screw caps of aluminium with rubber liners suitable for bijou bottles, leak proof 250 ) , consumable 29.94 spare caps for bijou bottles ( screw caps of aluminium with rubber liners suitable for bijou bottles 500 ) , consumable 29.95 alcohol ( 500ml ) , consumable 29.96 basie fuchsin ( 25 gm glass bottle ) , consumable 29.97 carbolic acid phenol ( 500ml ) , consumable 29.98 falcon tube ( conical bottom ) ( 50ml each plastic containers with air tight screw cap printed graduation ) , consumable 29.99 artificial immersion oil refractive index of 1.48 it should be colorless, odorless, transparent and free from fluorescence in day light eith relative density of 0.827 to 0.890, viscosity of 110 to 230 m pa s; specific gravity of 0.76 0.78 at 15.5 c ( 50 ml bottle ) , consumable 30 methylated spirit ( 500 ml bottle ) , consumable 30.01 phenolic compound / phenol crystal chemical name: phenol, chemical structure: c6h5oh, molecular wt: 94.11, melting point:40 c+2 purity: 99.5% ( 500 gm glass bottle ) , consumable 30.02 sputum container ( 100 per box ) , consumable 30.03 sulphuric acid ( 500ml glass bottle ) , consumable 30.04 ice pack ( pack ) , consumable 30.05 para film sealing film ( film ) , consumable 30.06 therma coal box ( box ) , consumable 30.07 hydroxy propyl methyl cellulose injection 2% ( 3ml prefilled syringe ) , syrings 30.08 diflubenzuron 25% wp ( 1kg ) , consumable 30.09 cepodoxamine 200 mg + clavulanic acid 125mg tab ( 200mg + 125 mg ) , tablet 30.1 hiv ( rapid ) ( whole blood finger prick test kit ) , consumable 30.11 pre & pro biotic sachet each sachet ( 0.5 gm ) contain: streptococcus faecalis t 110 30 million clostridium butyricum toa 2million bacillus mesentericus to a 1 million lactic acid bacillus 50 million ( lactobacillus sporogenes ) ( 0.5 gm sachet ) , sachet 30.12 disposable under pad dimention of sheet 60*90 cm ( inside ) ( weight 80 gm unit ) , consumable 30.13 tetrastarch 6% infusion ( 500 ml bottle ) , infusion 30.14 milk of magnesia+liquid paraffin 11.25ml+3.75ml ) 15ml ) , syrup ( 200ml bottle ) , syrup 30.15 clindamycin 300mg capsule / tab ( 10x10 ) , tablet capsule 30.16 amoxycillin 250 mg + cloxacillin 250 mg cap ( 10x10 ) , capsule 30.17 each uncoated chewable tablet contains dride aluminium hydroxide i.p 240 mg magnesium ( hydroxide i.p 100mg activated dimethicone i.p 25mg light magnesium carbonate ip 60mg ) , tablet 30.18 promethazine 25 mg / ml ( 1ml amp ) , ampule 30.19 heamocoagulase 1 iu / ml ( 1ml amp ) , ampule 30.2 vancomycine eye drop 2.5% , 5ml ( 2.5% , 5ml ) , drop 30.21 chloranphenicol eye ointment 0.5% ( 0.5% ) , ointment 30.22 chloranphenicol + polymycin b eye drop, 4mg / ml, 5ml ( 4mg / ml, 5ml ) , eye drop 30.23 gancyclovir eye ointment 0.15%, 3gm tube ( 0.15%, 3gm tube ) , ointment 30.24 amphotericin b ointment 2.5%, 5gm ( 2.5%, 5gm ) , ointment 30.25 variconazole eye drop ( power form soulation ) 1%, 5gm ( ( power form soulation ) 1%, 5gm ) , eye drop 30.26 fluoro metholone 0.1%, 5ml ( 0.1%, 5ml ) , ampule 30.27 dexamethalone 0.1%, 5ml ( 0.1%, 5ml ) , ampule 30.28 betamethasone 0.1%, 5ml ( 5ml ) , drop 30.29 surgical blade 15 no ( 100 / pkt ) , surgical material 30.3 defluprednate eye drop, 5ml ( 5ml ) , drop 30.31 lotepredrrelol eye drop, 5ml ( 5ml ) , eye drop 30.32 indomethacin eye drop 0.5%& 1% ( 5ml ) , eye drop 30.33 ketorolac eye drop 0.4% ( 5ml ) , eye drop 30.34 diclofenac eye drop 0.1% ( 5ml ) , eye drop 30.35 tropicamide eye drop 0.5% ( 5ml ) , eye drop 30.36 tropicamide + phenylephirne eye drop 1% ( 5ml ) , eye drop 30.37 cmc + sodiumhyaluronate eye drop ( 5ml ) , eye drop 30.38 carboxymethye cellulose 1% eye drop ( 5ml ) , eye drop 30.39 phenylephrine eye drop 5% ( 5ml ) , eye drop 30.4 phenylephrine eye drop 10% ( 5ml ) , eye drop 30.41 timolol eye drop 0.25% ( 5ml ) , eye drop 30.42 betaxolol eye drop 0.25% ( 5ml ) , eye drop 30.43 betaxolol eye drop 0.5% ( 5ml ) , eye drop 30.44 dipverfrine eye drop 0.1% ( 5ml ) , eye drop 30.45 brimonidine eye drop 0.1% and 0.15% ( 5ml ) , eye drop 30.46 lantanoprost eye drop 0.005% ( 2.5ml ) , eye drop 30.47 bimatoprost eye drop 0.1% ( 5ml ) , eye drop 30.48 dorzolamide eye drop 2% ( 5ml ) , eye drop 30.49 bronlolamide eye drop, 0.2% ( 5ml ) , eye drop 30.5 xycocain preservative free 2% injection ( 2% ) , injection 30.51 xylocain injection 2%, 20mg / ml ( 30ml ) , injection 30.52 ophthalmic needles ( round body ) , needle 30.53 ophthalmic needles ( cutting ) , needle 30.54 keratom knife ( 2.8 mm ) , blade 30.55 vicryl 60 suture micropoint sparalated reverse cutting double armed ( reverse cutting double armed ) , blade 30.56 nvr blade ( 20 g ) , blade 30.57 wills hospital utility forceps ( na ) , sutures 30.58 castroviejo suturing forceps 0.12 mm ( 1x2 teeth ) , sutures 30.59 dastoor superior rectus forceps ( 1x2 teeth ) , sutures 30.6 hartman mosquito forceps, straight ( na ) , surgical material 30.61 hartman mosquito forceps, curved ( na ) , surgical material 30.62 baby jones towel clamp ( na ) , consumable 30.63 barraquer iris scissors ( na ) , surgical material 30.64 westcott tenotomy scissors ( na ) , surgical material 30.65 iris scissors, straight ( na ) , surgical material 30.66 kalt needle holder, straight ( na ) , surgical material 30.67 barraquer n holder, shirt model, m. jaws, curved jaws, w / o lock ( na ) , surgical material 30.68 barraquer n holder, standard jaws, curved jaws, w / o lock ( na ) , surgical material 30.69 rycroft air injection cannula, ( 23 g ) , consumable 30.7 lewicky anterior chamber maintainer cannula ( na ) , consumable 30.71 infusion cannula ( size 25.mm ) , consumable 30.72 keener arlt lens loop ( na ) , consumable 30.73 agarwal s phaco chopper ( 1mm fully cutting edge ) , consumable 30.74 beer cilia forceps ( na ) , consumable 30.75 harms traveculotomy probe, right ( na ) , consumable 30.76 harms traveculotomy probe, left ( na ) , consumable 30.77 castroviejo corneal trephine ( size 7.5mm dia ) , consumable 30.78 dastoor corneal graft holding forceps ( na ) , consumable 30.79 osher neumann radial marker ( 8 blades ) , consumable 30.8 tudor thomas corneal graft stand ( na ) , consumable 30.81 lieberman teflon block ( na ) , consumable 30.82 sterilization box ( na ) , consumable 30.83 barraquer solid wire speculum ( large ) , consumable 30.84 hoffer optic zone marker ( 3mm dia ) , consumable 30.85 osher neumann radial marker ( 4 blades ) , consumable 30.86 osher neumann radial marker ( 6 blades ) , blade 30.87 grene visual axis marker ( na ) , consumable 30.88 thornton fixation ring ( na ) , consumable 30.89 bores corneal fixation forceps, ( straight ) , consumable 30.9 bores incision spreading forceps ( na ) , consumable 30.91 lancaster eye speculum ( na ) , consumable 30.92 jaeger lid plate ( na ) , consumable 30.93 graefe muscle hook ( size 3 ) , consumable 30.94 berke ptosis forceps ( 20 mm ) , consumable 30.95 snellen entropium forceps, ( left small ) , consumable 30.96 snellen entropium forceps, ( right small ) , consumable 30.97 ayer chalazion forceps ( na ) , consumable 30.98 lambert chalazion forceps ( na ) , consumable 30.99 stevens tenotomy scissors, curved ( na ) , consumable 31 meyerhoefer chalazion curette ( size 1, 1.75 mm dia ) , consumable 31.01 jameson muscle hook, ( large ) , consumable 31.02 jameson muscle forceps, left, ( child 4 teeth ) , consumable 31.03 jameson muscle forceps, right, ( child 4 teeth ) , consumable [ 201269 ] 31.04 charles flute needle ( na ) , consumable 31.05 infusion cannula, ( size 2.5mm ) , consumable 31.06 schepens forked orbital retractor ( na ) , consumable 31.07 cefixime 200 mg + clavulanic acid 125 mg ( tab ) , tablet 31.08 natamycin eye drop 5%, ( 5ml ) , eye drop 31.09 hpmc ( hydroxy propylmetty cellulose ) eye drop, ( 5ml ) , eye drop 31.1 sodium hyaluronate injection ( pfs ) ( na ) , injection 31.11 45 diaptor irrigating contact lens ( 45 deg ) , consumable 31.12 90 diaptor irrgating contact lens ( 90 deg ) , consumable 31.13 scleral plugs ( sets of 3 ) , consumable 31.14 vitreous forceps, ( 20 g smooth jaws, straight ) , consumable 31.15 buprenorphine 20 mg patch ( each patch ) , each 31.16 vinorelbine ( 50mg inj ) , injection 31.17 linagliptin ( 5mg tab ) , tablet 31.18 tenecteplase ( 40mg ) , injection 31.19 levocetirizine 5mg ( mouth dissolving tablet also acceptable ) , tablet 31.2 cefixime + ofloxacin ( 200 mg + 200 mg ) , tablet 31.21 endotracheal tube no 5.5 ( uncuffed ) , each 31.22 endotracheal tube no 6.0 ( uncuffed ) , each 31.23 pressure monitor ( line ) , each 31.24 follyscathetor 8 no ( pediatrics ) , consumable 31.25 follyscathetor 10 no ( pediatrics ) , consumable 31.26 diclofenec sodium 75mg / ml injection, surfactant & transcutol p free. iv bolus ( 75mg / ml, amp of 1 ml ) , ampule 31.27 disposable eye dressing with adhesive pad ( each unit ) , consumable [ 201391 ] 31.28 vecuronium bromide injection ( 10mg / vial ) , injection 31.29 liposomal doxorubicin 20 mg or pegylated liposomal doxorubicin ( 2 mg / ml 10ml vial ) , injection 31.3 cefpodoxamine ( 200 mg tab ) , tablet 31.31 blood transfusion set ( each ) , consumable 31.32 insulin biphasic aspart 30:70 100 iu / ml ( firm has to supply compatible pen along with cartridges as and when required without any extra cost ) ( 3ml cartridge ) , cartridges 31.33 surgical spirit ip ( 500 ml ) , bottle 31.34 flurbinprofen eye drop 0.03% ( 5 ml vial ) , eye drop 31.35 tropicamide + phenylephime eye drop 0.8% and 5% ( 5 ml vial ) , eye drop 31.36 amoxicillin + cloxacillin ( 250mg + 250mg ) , capsule 31.37 amoxicillin + cloxacilline ( 500 mg+500 mg cap ) , capsule 31.38 carboxymethyl cellulose ( 1% eye drop, 5ml ) , eye drop 31.39 cephalexine cap ( 125mg ) , capsule 31.4 chloramphenicol ( 250mg ) , capsule 31.41 clindamycin ( 150 mg ) , capsule 31.42 clindamycin ( 300 mg ) , capsule 31.43 clomipramine ( 25 mg ) , capsule 31.44 halothane ( ) , inhalation 31.45 medical oxygen ( ) , inhalation 31.46 iron sucrose ( 50mg ) , injection 31.47 alcohol ( absolute ) ( 500 ml ) , consumable 31.48 ulinastatin ( 1 lac iu ) , vial 31.49 cefuroxime ( 1.5 gm ) , injection 31.5 sitagliptin + metformin ( 50mg + 500mg ) , tablet 31.51 teneligliptin ( 20mg ) , tablet 31.52 telmisatran ( 80mg ) , tablet 31.53 ammonium chloride+diphenhydramine+sodium citrate+menthol ( 138mg+14.08mg+57.03mg+2.5mg each 5ml cough syrup ) , syrup 31.54 vildagliptin + metformin ( 50mg + 1000mg ) , tablet 31.55 etoricoxib ( 90mg ) , tablet 31.56 saxagliptin ( 5 mg ) , tablet 31.57 saxagliptin ( 2.5mg ) , tablet 31.58 ticagrelor ( 90mg ) , tablet 31.59 mycophenolate ( 360mg ) , tablet 31.6 sodium valporate + valproic acid cr ( 300mg ) , tablet 31.61 poc kit for syphilis ( as per attached specification ) ( 10 test per pack ) , consumable 31.62 sterlize single use lancing device ( penitration depth 1.5 and 28 guage ) , each 31.63 glargine 100 iu / ml, 3ml cartridge inj. ( firm has to supply one compatible pen with every 20 cartridges as and when required without any extra cost ) ( 100 iu / ml ) , cartridges 31.64 disposable bed sheet ( each ) , consumable [ mis1002 ] 31.65 sterile disposable bed sheet ( each ) , consumable 31.66 viral transport media with swabs ( vtm detail specifications ) : vtm ( 3ml vial with 2 regular swabs i.e. one nasal swab and one throat swab ) 1.viral transport medium ( vtm ) with swab with complete directions for collection, storage, transport and carrying. 2.sterile dacron, polyester or rayon sterile swabs with plastic shafts for sa ) , consumable 31.67 anticold ( drop ) , drop 31.68 sevelamer carbonate ( 800mg ) , tablet 31.69 iron & folic acid with vitamin b12 capsules ( time released ) each timed release capsule contains: ( ferrous fumarate ( in sr form ) ip 200mg eq. to 64mg elemental iron cyanocobalamine ip 15mcg folic acid ip 1.5mg ) , capsule 31.7 degludec 100 iu / ml ( 3ml cartridge with pen inj. ) , injection 31.71 lactobacillus tab ( 60 million spores ) , tablet 31.72 phenytoin sodium ( 250 mg / 5 ml inj ) , injection 31.73 elemental calcium 150mg cap ( ( in the form of calcium hydroxide & calcium oxide pretreated with heated algae ) termed as lonic calcium ) , capsule 31.74 each 5ml contains aluminium hydroxide paste equilvalent to dired alluminium hydroxide i.p. 250mg magnesium hydroxide i.p. 250mg activated dimethicone i.p. 50mg sorbitol solution ( 70% ) ip.. 1.25mg ( non cristallising 170 ml bottle ) , bottle 31.75 sodium dichloroisocynaurate 35 mg tablet ( turnover criteria amended as average annual turnover 2cr. only gmp certified companies also eligible for this consumable item ) , tablet [ 121002a ] 31.76 febuxostat ( 40 mg tab ) , tablet 31.77 glimepride 2 mg + metformin 1000 mg ( tab ) , tablet 31.78 fluocinolone acetonide ip ( 0.1% w / w 30 gm cream ) , tube 31.79 darbepoetin ( 25mcg ) , injection 31.8 darbepoetin ( 40mcg ) , injection 31.81 racecadotril ( 100mg ) , capsule 31.82 methyl prednisolone ( 500mg ) , injection 31.83 reuse prevention syringe sterile single use reuse prevention syringe with detachable needles compliance to iso 7886:4 type i, b, flow wrap / blister pack using medical grade breathable paper, eto sterilized ( 2ml ) , consumable 31.84 reuse prevention syringe sterile single use reuse prevention syringe with detachable needles compliance to iso 7886:4 type i and b, flow wrap / blister pkg using medical grade breathable paper, eto sterilized ( 10ml ) , consumable 31.85 garam coat / woolan saluka sup.quality ( std.size ) , consumable 31.86 duster ( 39x39 ) , consumable 31.87 ladies livirise set redymade saree whote polyster green / blue border ( saree + blouse + peticot ) ( std.size ) , consumable 31.88 pillow 1 kg. cotton ( 14x21 ) , consumable 31.89 mattress 10 kg. cotton ( 3x6 ) , consumable 31.9 dohar redymade ( 54x90 ) , consumable 31.91 table cloth ( 45x60 ) , consumable 31.92 hole sheet ( 39x39 ) , consumable 31.93 gents livirise set redymade ( pent + shirt + topi ) ( std.size ) , consumable 31.94 airway, nasopharyngeal, sterile, single use, set with 6.5mm external diameter ( make medisafe international, model:msi 1220 6.5 ) , consumable [ 20200835 ] 31.95 airway, nasopharyngeal, sterile, single use, set with 7.5 mm external diameter ( make medisafe international, model:msi 1220 7 ) , consumable 31.96 atorvastatin + asprin ( 10mg + 75mg ) , tablet or capsule 31.97 intravenous set with airway and needle ( children ) ( surgical material ) , consumable 31.98 ice pack ( 8 length x 6 widgth ) ( 200gm ) , consumable 31.99 serum electrolyte kit ( 50test per kit ) , consumable 32 filter paper ( 12.5 cm, 0.1 micron, 50 / pkt ) , consumable 32.01 spectacles for school children: durable non allergic plastic ( frame with english lenses in case ) , consumable 32.02 spectacles for old person: durable non allergic plastic ( frame with english lenses in case ( as per tender specification ) ) , consumable 32.03 cotton khadi dari pattil ( 10x1.5 feet, 800gram per piece ) , consumable 32.04 cotton khadi dari pattil ( 10x1.5 feet, 1kg per piece ) , consumable 32.05 cotton khadi white bedsheet ( 54x90 inch per piece ( by weaving the name of the concerned department ) ) , consumable 32.06 cotton khadi white bedsheet ( 54x90 inch per piece ( by printing the short name of the concerned department ) ) , consumable 32.07 polyvastra cloth coating white ( 36 inch per meter ) , consumable 32.08 polyvastra cloth shirting colour ( 36 inch per meter ) , consumable 32.09 polyvastra uniform colour ( pent / shirt / topi ) ( per set ( accourding to measure ) ) , consumable 32.1 polyvastra uniform ( kurta / payjama / topi ) ( per set ( accourding to measure ) ) , consumable 32.11 woolen coatin mix ( 54 inch per meter ) , consumable [ kha058 ] 32.12 woolen shawl mix ladies standard ( per piece ) , consumable [ kha059 ] 32.13 ammunition boot ( according to measure ) , consumable 32.14 ackle boot ( according to measure ) , consumable 32.15 alcohol based hand sanitizer liquid spray ( 500 ml bottle ) , consumable 32.16 alcohol based hand sanitizer ( 50 ml bottle ) , consumable 32.17 plastic gloves ( large size ) , consumable 32.18 alcohol based hand sanitizer ( 1 ltr. bottle ) , consumable 32.19 sodium hypochlorite solution 5% ( 500 ml bottle ) , consumable 32.2 alcohol based hand sanitizer ( 500 ml bottle ) , consumable 32.21 codeine opiod analgesic 15 mg tab ( 15 mg ) , tablet 32.22 pancreatin 170 mg+oxbile extract 50 mg + ginger oleoresin 2 mg+activated charcoal 50 mg ( tab ) ( tablet ( with additional content acceptable ) ) , tablet each 5ml contain potassium citrate i.p. 1100 mgmagnesium citrate u.s.p. 375 mg pyridoxine hydrochloride i.p 20 mg colour caramel ( each contains approx.l meq, magnesium ion, 2meq. potassium ion, 3meq. citrate ion and 4mg of pyridoxine hydrochloride ) , bottle 32.24 afatinib ( 20 mg ) , tablet 32.25 alteplase ( 50 mg ) , injection 32.26 probiotic capsule each capusle contains lactobacillus ( rhamunousus gr 1 & lactobacillus reuteri rc 14 1 billion ) , capsule 32.27 doxketoprofen trometamol ( equivalent to dexketoprofen 25mg + paracitamol 325 mg ) , tablet 32.28 brimonidine eye drop 0.2% ( 5ml ) , vial 32.29 golimumab ( r dna origin ) solution for injection in prefilled syringe for single use 50 mg / 0.5 ml50mg / 0.5ml ( pre filled syringe in autoinjector ) , syrings 32.3 calcitriol 0.25 mcg + calcium 500mg+ mecobalamin 1500mcg+ omega 3 acid ethyl esters 60 bp+ folic acid 400mcg + elemental boron 1.5mg ( capsule / soft gelatin capsule ) , capsule 32.31 pembrolizumab inj ( 100mg / 4ml ( 25mg / mi ) solution in single dose ) , vial 32.32 peptonised iron 176.5 mg ( equivalent to 30 mg of elemental iron, protein ( as peptone ) 100 mg, folic acid 200 mcg, vitamin b12 2.5 mcg 100ml ) , bottle 32.33 feracrylum 1% gel ( 15gm ) , tube 32.34 disodium hydrogen citrate ( 1.4gm / 5ml ) ( 200ml ) , syrup 32.35 cost of reagent per test ( for blood cell counter 3 part ) ( blood cell counter 3 part ) , consumable 32.36 blood cell counter 3 part ( mek6510k ) ( blood cell counter 3 part ) , consumable 32.37 electrolyte solution for disinfectant generation system ( 10 lt. per pack ) , consumable 32.38 canagliflozin ( 100 mg ) , tablet 32.39 gabapantin300 mg + methylcobalamin 500 mcg ( 300 mg + 500 mcg ) , tablet 32.4 minicap ( capd ) with povidon iodine ( each ) , consumable [ 202106004 ] 32.41 serum amylase ( 2x25 ml ) , consumable 32.42 mackintosh ( as per attached specification ) , quantity amended as 136940 meter i.e. 6847 roll of 20 meter roll, rate should be quoted for 20 meter ( is 8164 1976 or conforming to is 8164 1976 ) , consumable 32.43 chromic with 1 / 2 cir rb needle absorbable surgical suture ( 12 foils / pkt ) ( 40 mm length 76 cm size:1 / 0 , surgical material ) , consumable 32.44 aceclofenac +thiocolchicoside ( 100mg+8mg ) , tablet 32.45 beclomethasone 0.025 % + fusidic acid 2.0 % cream ( 10 gm ) , tube 32.46 deflazacort ( 6mg ) , tablet 32.47 etizolam ( 0.25mg ) , tablet 32.48 etizolam ( 0.5mg ) , tablet 32.49 etoricoxib ( 60mg ) , tablet 32.5 febuxostat ( 80mg ) , tablet 32.51 itraconazole ( 200mg ) , capsule 32.52 levocetrizine ( 10mg ) , tablet 32.53 cefopodoxime 50 mg / 5 ml suspension ( 30ml ) , bottle 32.54 chlorpheniramine 2mg+ dextromethorphan 10mg / 5ml ( 100ml ) , syrup 32.55 trypsin chymotrypsin ( 1 lac iu ) , tablet 32.56 cisplatin ( 10 mg ) , injection 32.57 clindamycin 600mg ( 150mg / ml ) , injection 32.58 nebivolol ( 2.5mg ) , tablet 32.59 octriotide ( 50 mcg / ml ) , injection 32.6 rabeprazole + levosulpiride ( 20mg +75mg ) , tablet or capsule 32.61 rifaximin ( 400mg ) , tablet 32.62 rosuvastatin ( 20 mg ) , tablet 32.63 vitamin d3 ( 800iu / ml ) , drop 32.64 diclofenac sodium 75mg intended to use iv aqueous formulation ( 1ml amp ) , injection 32.65 gabapentin ( 300mg ) , tablet 32.66 fexofenadine + montelukast ( 120mg / 10 mg ) , tablet 32.67 fluticasone 50mcg / spray ( 70 120 meter dose nasal ) , spray 32.68 cr system film ( size 8x10 ) , consumable 32.69 cr system film ( size 10x12 ) , consumable 32.7 cr system film ( size 14x17 ) , consumable 32.71 films of size 14x17 inches compatible films to dr system ( 14x17 inches ) , film 32.72 films of size 11x14 inches compatible films to dr system ( 11x14 inches ) , film 32.73 films of size 10x12 inches compatible films to dr system ( 10x12 inches ) , film 32.74 films of size 8x10 inches compatible films to dr system ( 8x10 inches ) , film 32.75 alfacalcidol 0.25mcg, calcium 200mg ( 0.25mcg+200mg ) , capsule levetiracetam 100mg / ml syrup / solution ( 100ml bottle ) , syrup 32.77 paracetamol 500mg + chlorpheniramine 2mg+ phenylephrine 10mg ( 500mg+2mg+10mg ) , tablet 32.78 acenocoumarol ( 1 mg ) , tablet 32.79 alendronate ( 70 mg ) , tablet 32.8 methylcobalamin 1500mcg + pregabalin 75mg ( 1500mcg+75mg ) , tablet 32.81 alfuzosin ( 10mg ) , tablet capsule 32.82 amantadine ( 100mg ) , tablet 32.83 bosentan ( 62.5 mg ) , tablet 32.84 bisoprolol ( 5 mg ) , tablet 32.85 levetiracetam ( 100mg / ml ) , injection 32.86 sucralfate 500mg + oxetacaine 10 mg / 5ml syrup / suspension, 200ml bottle ( 500mg+10 / 5ml ) , bottle 32.87 pregabalin 75 mg + nortriptyline 10 mg ( 75mg+10mg ) , tab 32.88 adapalene ( 0.1%w / w ) , gel 32.89 oxymetazoline hydrochloride 0.05% w / v nasal spray, 10ml bottle ( 0.05% w / v ) , spray 32.9 disposable surgeon cap with cable tie ( each ) , consumable 32.91 weith machine mini ( 1gm to 5kg ) 32.92 heating mantle 32.93 inj multivitamine 32.94 onit eberconazole cream 1% w / w 32.95 cassette ( 10 x 12 ) , consumable fujji 32.96 cassette ( 8 x 10 ) , consumable fujji 32.97 cassette ( 14 x17 ) , consumable fujji 32.98 centrifuse machine 32.99 blood presure machine digital 33 codon set 33.01 acyclovir tab. ip 200mg ( dt tablets also acceptable ) , tablet 33.02 albendazole ip ( 400mg ) , tablet 33.03 alprazolam ( tab 0.25mg ) , tablet 33.04 amiodarone 50mg / ml ( 3ml vial / amp ) , injection 33.05 amiodarone ( 100mg tab ) , tablet 33.06 amlodipin tab ( 5mg ) , tablet 33.07 amoxycillin +clavulanic acid ( ( amoxycillin 500 + clavulanic acid 100 mg ) / vial ) , injection 33.08 amoxicillin ( 125 mg / 5ml ( 30 ml bottle ) ) , suspension [ 110074 ] 33.09 amoxicillin and clavulanic acid i.p. ( 200+28.5mg ( 30 ml bottle ) ) , syrup 33.1 amoxycilline ( 500mg ) , capsule 33.11 ampicillin ( 500 mg / vial ) , injection 33.12 ampicillin trihydrate capsules ( 500mg 33.13 anti d immunoglobulin for iv / im use ( monoclonal ) ( 150mcg ( 1ml vial ) ) , injection 33.14 anti snake venom polyvalent inj 10ml ( lyophilized ) ( 10 ml vial ) , injection 33.15 artemether + lumefantrine ( 20mg+120mg ) , tablet 33.16 artesunate ( 60 mg / vial ) , injection 33.17 artesunate 200 mg ( 3tab ) + sulphadoxine 750 mg + pyrimethamine 37.5 mg ip ( 2 tab ) ( age group 15 or above ) , combi blister pack 33.18 aspirin low dose ( 75mg tab ) , tablet 33.19 atenolol ( 50mg tab ) , tablet 33.2 atenolol ( 100mg ) , tablet 33.21 atorvastatin ( ip 10 mg ) , tablet 33.22 atracurium ( 10mg / ml ( 2.5ml vial / amp ) ) , injection 33.23 atropine sulphate 1% ( 5 ml vial ) , eye drop 33.24 atropine sulphate eye ointment ( 1% ) , ointment 33.25 atropine sulphate 0.6 mg / ml sc / im / iv ( 2ml amp ) , injection 33.26 azithromycin ( 500mg tab ) , tablet 33.27 azithromycin ( 200mg / 5ml ( 15 ml bottle ) ) , syrup 33.28 azithromycin ( 250mg ) , tablet 33.29 betahistine ( 8 mg tab ) , tablet 33.3 betamethasone sodium phosphate ( ml contain betamethasone sodium phosphate equal to 4mg of betamethasone ( 1ml amp ) ) , injection 33.31 biphasic isophane insulin ( 30 / 70 40iu / ml ( 10 ml vial ) ) , injection 33.32 bisacodyl ( 5 mg ) , suppository 33.33 bisacodyl ( 5mg tab ) , tablet 33.34 bromhexine hydrochloride ( 4mg / 5ml syrup ( 50ml bottle ) ) , syrup 33.35 bupivacaine hydrochloride ( 0.5% ( 20 ml vial ) ) , injection 33.36 calcium gluconate ( 10% ( 10 ml vial ) ) , injection 33.37 calcium gluconate 10% ( 10ml amp ) , injection 33.38 calcium with vitamin d tablets usp calcium carbonate 1.25g eq. to elemental ( calcium 500mg and cholecalciferol ip 250 iu ) , tablet 33.39 carbamazepine ( 200 mg ) , tablet 33.4 carboplatin ( 450mg 45ml multidose vial ) , injection 33.41 carboxymethylcellulose sodium eye drop 0.5% ( 10ml ) , eye drop 33.42 cefixime ( 200 mg tab ( dt tablet also acceptable ) ) , tablet 33.43 cefotaxime sodium ( 250 mg vial ) , injection 33.44 cefotaxime sodium ( 1 gm vial ) , injection 33.45 ceftazidime 1gm / vial inj ( 1 gm / vial ) , injection 33.46 ceftrioxone usp ( 1gm / vial ) , injection 33.47 ceftriaxone ( 250mg vial ) , injection 33.48 ceftriaxone ( 500mg vial ) , injection 33.49 cephalexine ( each 5ml contains 125mg ( 30ml bottle ) ) , syrup 33.5 cetirizine ( 10 mg ) , tablet 33.51 chloroquine phosphate suspension equivalent to chloroquine ( 50mg / 5ml ( 60 ml bottle ) ) , suspension 33.52 chloroquine phosphate tab. ( 250mg ) , tablet 33.53 chlorpheniramine maleate ( 10mg / ml inj 10 ml ) , 33.54 ciprofloxacin eye ointment 0.3% ( 3gm tube ) 33.55 ciprofloxacin ( 500mg ) , tablet 33.56 clomiphene citrate ( 50 mg tab ) , tablet 33.57 clonazepam ( 0.5mg ) , tablet 33.58 clopidogrel ( 75 mg ) , tablet 33.59 clotrimazole i.p. 2%w / w ( 15gm tube ) , cream or 33.6 deferasirox dispersible ( 250mg ) , tablet 33.61 deferasirox dispersible ( 500mg ) , tablet 33.62 dexamethasone sodium phosphate ( 8mg / 2ml ( 2ml vial ) ) , injection 33.63 dextromethorphan 10mg / 5ml ( 100ml bottle ) , syrup 33.64 dextrose 25% ( 500ml ffs bottle ) , injection 33.65 dextrose 5% ( 500ml ffs bottle ) , injection 33.66 dextrose with saline ( 5% + 0.9% ( 500ml ffs bottle ) ) ,