Public Health Engineering Department - Madhya Pradesh

35032374 procurement of instrument for district lab mandlasub divisional lab mawai, nainpur, niwas &narayanganj and crm and chemicals for sub divisional lab niwas &narayanganj of mandla 2 analytical balance analytical balance cap. 220gm, readability 0.1 mg, linearity ± 0.2 mg, pen size 90mm x 3.5” ( inch ) , alpha numeric lcd display, automatic calibration with unit of gm, mg, ct, with user administration & password protection, power supply a / c adopter 230 v, with cy series, calibrated with nabl certified lab & certificate, 3 weight boxe 2 , 23 weights including fractional weights200 gm maximum with nabl calibration certificate make: weigh india 4 visi cooler, temp 0 80 o c capacity 320 lit, aesthetic sleek design, withnabl calibrated digital thermometer with rtd probe & nabl certificate, one yearwarranty as per condition of manufacturer. make: voltas. lg. elanpro etc equivalent make. 5 humidity and temperature meter, dual and large display, for humidity and temperature. range 0 100 % rh resolution 0.1%, temperature range 0 60 o c, . with carrying case, manual, temperature probe and with calibration certificate from nabl calibration lab. 6 hydrometer for specific gravity measurement, range 1 2 point gradation interval 0.1 ml with nabl calibration certificate 7 laboratory first aid box completes with 15 items wall mounted 8 fire extinguisher abc, 6 kg 9 eye washer 10 pipette bulb made for natural rubber, make tarson packof 4pc 11 wash bottles ldpe rivira nose type cap. 500 ml 12 tissue paper roll big size 13 micropipette controller for pipette 0.1 200 ml grey and purple with spare membrane filter make – brand gmbh, cat no. 26200, 14 distillation unit : lab q type iii water system 15 bottel top dispensor; bottle top dispenser with recalculating valve cap. 1.0 10.0 ml with recalculating valve, graduation interval 0.1 ml accuracy of ±0.6% or better adjustable delivery, nozzle have rotation knob, piston & valve made of ptfe to ensure high chemical compatibility and jamming free functionary instrument supplied with nabl calibration certificate from nabl accredited lab. instrumenthaving free two year replacement warranty and also provided a two times free nabl recalibration service and service support for trouble shooting, make; tarson , borosil, microlit or equivalent, 16 apron 17 color comparator for color analysis certified with nabl certificate 18 turbidity meter, micro controller based turbidity meter range 0 to 1000 ntu in 4 ranges 0 1 .0 10, 0 100 and 0 1000. one year warranty as per condition of manufacturer.make: thermo scientific ( eutech tn 100 ) , systronics 135, orion, hech, e merck, metler with nabl calibration certificate. 19 auto zero burette with reservoircapacity 2000 ml , burette cap 50ml with rubberair bubbler 3 noclass a, lc 0.1 ml with nabl calibration certificate make: riviera / jsil , 20 auto zero burette with reservoir amber glass capacity 2000 ml , burette cap 50ml with rubberair bubbler 3 noclass a, lc 0.1 ml with nabl calibration certificate make: riviera / jsil , 21 whatman® quantitative filter paper, ash less, grade 42circles, diam. 42.5 mm, pack of 100 22 micro controller based ph meter with electrode and temp probe and with accessories .range 0 14 , resolution 0.001 ph, aquracy ± 0.002 ph on ± 1 digit. calibration 2 / 3 / 5.standard buffer: 1.679, 7.000, 4.004 or 9.183, 12.454. one year warranty as per condition of manufacturer. make: thermo scientific ( eutech ) systronics 362, orion, hech, e merck, metler with nabl calibration certificate. 23 micro controller based conductivity tds meter. conductivity range 0.1 micro mhose to 200 ms.with 6 decadic range.aquarcy± % of fs ± 1 digit, resolution 0.001 micro mhose. tds range 0.1 ppm to 10000 in 6 decade range, auarcy ±15 of fs ± 1digit. one year warranty as per condition of manufacturer. make: thermo scientific ( eutech ) , systronics 308, orion, hech, e merck, metler with nabl calibration certificate 24 volumetric flask with i / c stopper class a 1000 ml cap. with nabl calibration certificate 25 volumetric flask with i / c stopper class a 500 ml cap. with nabl calibration certificate 26 volumetric flask with i / c stopper class a 100 ml cap. with nabl calibration certificate 27 volumetric flask with i / c stopper class a 50 ml cap. with nabl calibration certificate 28 measuring cylinder cap. 50 ml lc 1.0 ml, hexagonal base class a with nabl calibration certificate 29 measuring cylinder cap. 100 ml lc 1.0 ml, hexagonal base class a with nabl calibration certificate 30 measuring pipette class a, mohr type, with nabl calibration certificate, cap. 5.0 ml 31 measuring pipette class a, mohr type, with nabl calibration certificate, cap. 10.0 ml 32 measuring pipette class a, mohr type, with nabl calibration certificate, cap. 25.0 ml 33 measuring pipette class a, mohr type, with nabl calibration certificate, cap. 50.0 ml 34 exhaust fan including component wall mountedproduct dimensions: 20 x 16 x 30 cm , warranty: 2 years on product air delivery: 520 cmh ; speed: 1350 rpm ; number of blades: 5. noise level:42 db, make: havels, bajaj, etc 35 alkalinity standard, ( sodium carbonate ) traceable to nist, srm certipure, cat no. 1.024.05.0080, pk. 80 gm / pkt. 36 calcium standard 1000 mg / lit traceable to srm from nist, 37 chloride standard500 mg / lit traceable to srm from nist nacl in h2o 38 ph4.01 buffersolution traceable to srm from nist. certipur 39 ph6.86 buffersolution traceable to srm from nistcertipur 40 ph9.18 buffersolution traceable to srm from nistcertipur 41 turbidity standard 1000 ntu traceable to srm from nist . certipur 42 color standard 500 hazen pt co unit traceable to srm from nistcertipur 43 conductivity standard crm / eqv, b&d 44 tds standard crm / eqv, b&d...

Department of Higher Education - Madhya Pradesh

34965557 bids are invited for sl. no. item title item description 1 1 containers 2 2 sauce pan with lid 3 3 fry pan 4 4 tava roti/ tava dosa 5 5 parrat 6 6 grater(multipurpose) 7 7 patila with lid 8 8 kadchhi 9 9 knife all types 10 10 peeler/ chamcha/ chimta/jhara/ masala dabba 11 11 cutlery set 12 12 chakla belan 13 13 kadahi with lid 14 14 dinner set (steel) 15 15 bucket/ dustbin/ tub 16 16 pressure cooker 17 17 lighter 18 18 tray 19 19 crockeries (tea set borosil glasses) 20 20 namak daniset 21 21 stiching material—needle box 22 22 gas chula with cylinder/ chimini 23 23 indection 24 24 paper napkins/ cloth napkin/ table mat 25 25 model parts of flower/ kidney/brain/heart/human eye& ear 26 26 weighting machine digital 27 27 sonometer sccale 28 28 scale electronice 29 29 weight sclae 6kg 30 30 calcium oxide 31 31 clycerol 32 32 iodine solution 33 33 phenol 34 34 glacial acetic acid 35 35 safferemine 36 36 potassium mydroxide 37 37 canada balson 38 38 fehling solution 39 39 calcium chloride 40 40 acid accumulator 41 41 cylender noggel/ regulator/rubber set 42 42 bottele opener 43 43 sweing machine 44 44 washing machine 45 45 fabric colour set 46 46 bad sheet 47 47 soffa set cover 48 48 dinning table cover 49 49 vacume cleaner 50 50 hair cap/ aprin 51 51 microwave 52 52 phillips otg 53 53 toster 54 54 grill sandwich maker 55 55 hand grinder 56 56 steel bartan set 57 57 coffe maker 58 58 mixer /grider/ juicer 59 59 all types seaser 60 60 water coler 20 l 61 61 aquagurd 62 62 modular kitchen 63 63 autoclave portable 21l 64 64 autoclave portable50l 65 65 dissecting microscope 66 66 binocular microscope 67 67 deep freezer 68 68 compoundmicroscope 69 69 high defination microscope 70 70 microscopic eye pic 71 71 triangular microscope 72 72 ganong respirometer 73 73 hot air oven 14x14x14 74 74 magnetic stirrer with hot plate 75 75 maximum minimum thermometer 76 76 micro pipette variable 1 5ml 77 77 uv chromatographic chamber 78 78 ph meter ( digital ) with elctrodes 79 79 thin layer chromatography apparatus 80 80 water bath double wall ( 12 holes) ss 81 81 bod incubator 82 82 digital colony counter 83 83 digital tds meter 84 84 flame photometer 85 85 interactive led panel 86 86 digital thermometer 87 87 projection microscope 88 88 betological incubator stainless steel 89 89 laminar air flow horizontal 90 90 hair dryer 91 91 homogenizer 92 92 distillation apparatus doubledistillation 93 93 micro kjeldahl & distillation apparatus 94 94 soxhlet extraction unit 95 95 vortex shaker 96 96 auxanometer 97 97 computer system with licenced operating system internet facility 98 98 farmer potometer / ganog potometer 99 99 water and soil analysis testing kit (digital ) 100 100 tissue culture rack ( caster rack ) 101 101 blackman apparatus 102 102 gel electrophoresis unit with power supply 103 103 heating mantle with regulator cap 1 litre 104 104 occular micrometer/ stage micrometer 105 105 stem borer 106 106 cod analyzer multi parameter beanch 107 107 oxygen electrode 108 108 rotatory microtome 109 109 specimen 20pices 110 110 botany/zoology/physics/chemistry/home science map 111 111 digital spectrophotometer 112 112 blood pressure machine 113 113 plant collection net 114 114 centrifuge machine 115 115 glucometer 116 116 inverter 117 117 laboratory stirrer 118 118 insect collection net 119 119 chemical blance digital 0.01 to 600gm 120 120 chemical cabinet storage 121 121 rotary vane vaccume pump 122 122 oil free vacuum pump 123 123 muffle furnace 124 124 refrigerator 125 125 digital melting pint apparatus 126 126 karl fisher titrator 127 127 student polarimeter 128 128 digital conductivity meter 129 129 digital photo colorimeter 130 130 dissolved oxygen meter 131 131 flask shaker ( wrist action type ) 132 132 screw guage/ vernier calipers 133 133 ammeter dc/ac 134 134 stop watch digital / stop clock 135 135 analog multimeter /digital multi meter 136 136 voltmeter dc/ac / galvanometer 137 137 spectrometer prism ( crown/ flint glass) 138 138 thermometer different range 139 139 analog to digital converter power supply 140 140 rheostat ( various length ) 141 141 battery eliminator 142 142 apparatus to study specific resistance energy gap 143 143 apparatus to study characteristics tunnel 144 144 apparatus to study characteristics of zener diode 145 145 anderson/schering/hay/kelvin/maxwell 146 146 apparatus to study rc coupled amplifier power supply 147 147 audio frequency generator 148 148 laclanche cell 149 149 function generator 1 hz to 10 mhz 150 150 battery charger 2 to 12 volt 151 151 apparatus to study response curve for lcr 152 152 apparatus to draw b h curve of ferromagnetic 153 153 complete apparatus to determine the heating 154 154 potentiometer 155 155 mos fet/ fet characteristics apparatus 156 156 half adder /full adder/half subtractor 157 157 half wave and full wave rectifier apparatus 158 158 zener regulated power supply 159 159 8085/8086 microprocessor kit 160 160 photo diode characteristics apparatus 161 161 digital to analog converter with built in power 162 162 travelling microscope 163 163 series and parallel resonance circuit 164 164 solar cell characteristics apparatus 165 165 encoder and decoder circuit with built in power 166 166 cro dual trace 30/40 mhz 167 167 plancks constant using solar cell apparatus 168 168 function generator 0 3 to 30 mhz 169 169 vibration magnetometer 170 170 single stage and double stage r c couple 171 171 power amplifier ( trainer board) 172 172 variable regulated dc power supply 0 30v range 173 173 scr / ujt characteristics apparatus 174 174 horizontal torsion apparatus 175 175 multiplexers and demultiplexers with built in 176 176 stefan constant apparatus 177 177 regulated power supply trainer board 178 178 dielectric constant apparatus 179 179 thermistor characteristic apparatus 180 180 drill machine with all size bits (hammer) 181 181 bread board (trainer kit) 182 182 study of amplitude modulation and demodulation 183 183 digital ic trainer kit 184 184 study of crystal oscillator 185 185 four probe method 186 186 induction hot plate with induction ports 187 187 op amp as voltage follower trainer board 188 188 youngs modulus apparatus 189 189 frank hartz experiment setup using argon gas 190 190 thyratron characteristics apparatus 191 191 transistorized push pull amplifier 192 192 michelson interferometer apparatus 193 193 study of frequency modulation and demodulation 194 194 op amp as voltage to frequency/frequency to 195 195 study of active and passive filters 196 196 zeeman effect experiment 197 197 fresnel biprism diffraction apparatus 198 198 study of tdm pcm reciever/ transmitter 199 199 study of smps ...

Tribal Welfare Department - Madhya Pradesh

34689093 bids are invited for science material for physics and chemistry and biology lab science lab material 1 iron bob 3 / 4 pcs. 10 2 resistance 2, 4, 6, 10, 15, 1, 3 ohm pcs. 18 3 nichrome wire 100gm pcs. 5 4 stop clock plastic pcs. 2 5 aluminum plate pcs. 5 6 zink plate 6 pcs. 5 7 copper plate 6 pcs. 5 8 aluminum rod pcs. 5 9 zink rod pcs. 5 10 copper rod pcs. 5 11 plane mirror strip holder pcs. 20 12 thread roll 2 13 connecting wire pair pcs. 15 14 battery eleminator pcs. 3 15 jockey pencil pcs. 6 16 resistance wire 100 gm pcs. 3 17 z pullet set pcs. 8 18 ohms law pcs. 8 19 logic gate pcs. 2 20 potentiometer 10 wire pcs. 2 21 sonometer pcs. 2 22 parallelogram kit wall type pcs. 2 23 npn pnp transistor kit pcs. 2 24 zener diode apparatus pcs. 2 25 young modular apparatus iron pcs. 2 26 calorimeter pcs. 2 27 optical bench 1.5 meter pcs. 2 28 meter bridge appartus pcs. 3 29 denial cell complete pcs. 6 30 leclanchi cell pcs. 6 31 hooks law 6 pcs. 2 32 pendulum kit pcs. 4 33 sarl apparatus pcs. 2 34 p n junction pcs. 2 35 optical bench 1 meter complete set pcs. 2 36 inclined plain apparatus pcs. 2 chemistry 37 petri dish 3 pcs. 24 38 l tube 3 pcs. 24 39 u tube 3 pcs. 24 40 glass tube 6 pcs. 20 41 dropper 6 ( g ) pcs. 36 42 boiling tube 25x150 pcs. 100 43 chemical balance pcs. 2 44 ph meter pen type pcs. 2 45 digital weighing machine pcs. 1 46 beaker 100 mi pcs. 12 47 beaker 500 mi pcs. 12 48 beaker 50 mi pcs. 12 49 beaker 250m1 pcs. 12 50 methyl orange 125 ml pcs. 1 51 my. jug 250 ml pcs. 6 52 my. jug 500 ml pcs. 6 53 reagent bottle 125 mi pcs. 12 54 reagent bottle 500 mi pcs. 12 55 reagent bottle 60 ml pcs. 12 56 reagent bottle 1000 ml pcs. 12 57 volumetric flask 1000 ml pcs. 12 58 flask stand pcs. 2 59 dil. nitric acid 1 60 distilled water 5 lit 1 61 rubber gloves 60 62 ferric chloride 1 63 ferric sulphate 1 64 ferrous sulphate 1 65 formaldehyde 500m1 1 66 formic acid 1 67 glycerine 1 68 hydrogen peroxide 1 69 iodine solution 1 70 iron metal 500gm 1 71 lime water 1 72 magnesium nitrate 1 73 magnesium sulphate 1 74 methyl orange 1 75 phenolpthalein 125 mi 1 76 potassium nitrite 1 77 potassium chloride 1 78 potassium hydroxide flakes 1 79 sodium sulphite 1 80 sodium acetate 1 81 sodium bi carbonate 1 82 sodium bi sulphite 1 83 sodium carbonate 1 84 sodium chloride 1 85 sodium hydroxide 1 86 sodium metal 1 87 sodium nitrate 1 88 sodium thiosulphate 1 89 liquor ammonia 250 ml 2 90 sulphur 1 91 iron filling 500 gm 1 92 urea 1 93 zinc sulphate 1 94 zinc chloride 1 95 zinc metal 250 gm 1 96 zinc nitrate 1 97 schiffs reagent 1 98 molischs reagent 1 99 nesslers reagent 125 mi 1 100 litmus solution blue 1 101 litmus solution red 1 102 lucas reagent 1 103 tollens reagent 1 104 universal indicator 1 105 fehlings solution a 1 106 fehlings solution b 1 107 starch 1 108 cotton bundle pcs. 6 109 label book for chemical pcs. 120 110 gas cylinder with stove 5 kg pcs. 6 biology 111 formaline 250 ml 1 112 leishmens stain 250 ml 1 113 haemotaxyain stain solution 250 ml 1 114 iodine stain 250 ml 1 115 boric acid 500 ml 1 116 sodium choride 250 gm 1 117 potassium nitrate 100 ml 1 118 magnesium sulphate 100 ml 1 119 methonol 250 ml 1 120 sodium bi carbonate 250 ml 1 121 chart malaria paraside in blood 1 122 chart develmpment of ovule of angiosperm 1 123 cobart chroide paper 10 maths 124 geometry box pcs. 2 125 greometry 2 d model pcs. 1 126 geometry 3 d model pcs. 1 127 history and photographs of mathematician pcs. 8 128 model of pythgorus theoram pcs. 2 129 chart logiritham pcs. 1 130 chart geometry pcs. 1 131 chart trignometry pcs. 1 132 measurment kit total quantity : 823...

Department of Agricultural Research and Education - Madhya Pradesh

34639495 bids are invited for glassware borosil boq erlenmeyer conical flask , low form beaker with spout , volumetric flasks , c2 single channel variable volume pipette calibration and accuracy as per iso 8655 , mohr pipettes , spatulas chattaway spatula , spatulas chattaway spatula one end flat and one , spatulas chattaway spatula one end flat and one end spoon , spatulas one end flat and one end spoon , reagent bottles narrow mouth with screw cap , round bottom flask narrow mouth with screw cap 3 necks, angular total quantity : 275...

Madhya Pradesh Power Generating Company Limited - Madhya Pradesh

34635029 procurement of laboratory glassware items for chemical laboratory, sgtps, mppgcl, birsinghpur. procurement of laboratory glassware items for chemical laboratory, sgtps, mppgcl, birsinghpur. , autoburette ( with ptfe stopcock ) , class a , autoburette ( with ptfe stopcock ) , class a , burette ( withptfe stopcock ) , class a , beaker with spout , low form , beaker with spout , low form , beaker with spout , low form , beaker with spout , low form , bod bottles , cylinders ( hexagonal base ) , class a.pour out , cylinders ( hexagonal base ) , class a.pour out , cylinders ( hexagonal base ) , class a.pour out , cylinders ( hexagonal base ) , class a.pour out , cylinders ( hexagonal base ) , class a.pour out , cylinders ( hexagonal base ) , class a.pour out , dessicator with cover & porcelain plate, mm , dessicator with cover & porcelain plate, vaccum, mm , dropping bottle ( with glass dropper & rubber teat ) , erlenmeyer ( conical ) flask ( narrow mouth with rim ) , erlenmeyer ( conical ) flask ( narrow mouth with rim ) , erlenmeyer ( conical ) flask ( narrow mouth with rim ) , glass stirrer rod , graduated centrifuge tube , graduated centrifuge tube , mohr pipette , class a , mohr pipette , class a , mohr pipette , class a , mohr pipette , class a , mohr pipette , class a , mohr pipette , class a , narrow mouth volumetric flask, class a , narrow mouth volumetric flask, class a , narrow mouth volumetric flask, class a , narrow mouth volumetric flask, class a , nessler cylinder , nessler cylinder , reagent bottle ( narrow mouth with i / c glass stopper ) , reagent bottle ( narrow mouth with i / c glass stopper ) , reagent bottle ( narrow mouth with i / cglass stopper ) , reagent bottle ( narrow mouth with i / c glass stopper ) , amber , reagent bottle ( narrow mouth with i / c glass stopper ) , amber , reagent bottle ( narrow mouth with screw cap ) , reagent bottle ( narrow mouth with screw cap ) , reagent bottle ( narrow mouth with screw cap ) , test tubes with rim , volumetric pipette, class a , watch glass ( mm ) ...

Nagar Palika Nigam - Madhya Pradesh

34598599 supply of water purification material, lab equipment and chemical for year 2022 23 at seoni malwa. ( m.p. ) , alum , chlorine gas , lime , test tube , erlenmeyer flask , funnel , burett , balance , bunsen burner , mortar & pestle , graduated cylinder , volumetric flask , spatula , test tube holder , beaker , pipett , reagent bottle , wash bottle , florence flask , lab chemical , ammonia buffer solution , potassium chromate ( lab reagent ) , methyal orange indicator solution , erichrome black t ( solo chrome black t ) , universal indicator , hydrarzinc sulphate , sulphuric acid solution n / 50 , hexamine , edta solution n / 50 ( for voumetric analysis ) , silver nitrate solution ( n / 50 ) , o tolidine reagent...

Public Health Engineering Department - Madhya Pradesh

34569334 supply of lab glass ware and allied material in water testing for district lab sehore and sub division lab ashta budni nasrullaganj in district sehore , flask volumetric with interchangeable glass and pp super stopper, class a with nabl certificate, is 915 / iso 1042 capacity – 100 ml make – borosil/j sil / supertech , flask volumetric, with interchangeable glass and pp stoper short neck class a with nabl certificate,is 915 / iso 1042capacity – 250 ml make – borosil/j sil / supertech , flask volumetric, with interchangeable glass and pp stoper short neck class a with nabl certificate, is 915 / iso 1042 capacity – 500 ml make – borosil/j sil / supertech , flask volumetric, with interchangeable glass and pp stoper short neck class a with nabl certificate, capacity – 1000 ml make – borosil/j sil / supertech , nessler cylinder, for colur comparison, with interchangeable stopper, class a with nabl certificate 100ml make borosil/j sil / supertech , plain burettes, automatic zero, mounted on reservoir rubber bellow, accuracy as per class a of is 1997:2008, iso 385 with nabl certificate glass key capacity – 50 ml make borosil/j sil / supertech , pipette, graduated, mohr type, class awith nabl certificate glass key capacity – 1.0 ml make borosil/j sil / supertech , pipette, graduated, mohr type, class awith nabl certificate glass key capacity – 2.0 ml make borosil/j sil / supertech , pipette, graduated, mohr type, class awith nabl certificate glass key capacity – 10.01ml make borosil/j sil / supertech , amber color burettes, automatic zero, mounted on reservair, rubber bellow, accuracy as per class a of is 1997:2008, iso 385, with nabl certificate, capacity 50 ml make borosil/j sil / supertech , measuring cylinder, with pour out, hexagonal base, class a with nabl certificate, capacity 50 ml make borosil/j sil / supertech , measuring cylinder, with pour out, hexagonal base, class a with nabl certificate, capacity 100 ml make borosil/j sil / supertech , laboratory themometer chemical 0 to 100 degree cwith nabl calibration certificate , digital temperature meter (thermometer), with sensor ( 50c to 300c) with nabl calibration certificate , safety shower wall mounted , eye/ face washer , fire extinguisher a,b & c , first aid box wall mounted with first aid kits , digital hygrometer thermometer humidity meter with clock with nabl certificate , hydrometer specific gravity. with nabl certificate , hand pro nitrile powder free disposable hand gloves (medium) , tissue paper roll , pipette stand to hold 24 pipette vertically. plastic polycab , nestler cylinder stand 100ml, make polycab , test tube stand 6 holes 16 mm & 25 mm ø tubes , laboratory tray 350 x 275 x 75 mm white colour , lab safety eye goggles...

Department of Higher Education - Madhya Pradesh

34513828 bids are invited for supply of chemistry material 1 digital tharmameter 2 digital acid base tesr meter 3 computer with couler printer digital model scanner & black printer 4 extension board 5 digital weight machine 6 stathoscope 7 sugar test machine 8 digital signal machine 9 smart hemoglobin meter 10 glucometer 11 digital blood pnessure machine 12 magnitic sterior machine with thermostate 13 fire fighter cylender 14 chemical tharmometer 15 test tube holder 16 mercery lamp 17 thin layer chromatography 18 funnel 19 pippet 20 . buret 21 buret stand 22 beaker 100m1, 250m1, 500m1, 1000m150 23 deluxe ph meter 24 dropper 25 chemistry lab utility ethanol 26 refrazrator 7 star 300 liter 27 . lndection 28 hot ketaly 29 conical flask 200ml 30 tongs and forceps 31 glaves 32 hammer petridish 33 petridis 34 safety goggles 35 magnifier 36 mortar pistle 37 pear shaped flask38 spachula 39 pipet bulb 40 florence flask 41 volumetric pipe 42 condenser 43 graduated cylinder 44 litmus filter paper 45 rubber stopper 46 crucible and cover square 47 ceramic 48 wire gauze 49 acid chart 50 clamps 51 clay triangle 52 boiling flask 53 chemisty functional group chart 54 reagent bottle 55 oven digital 300 lit 56 uv vis silgel beam spectro metter 57 electronic balance 58 micro scope with screen 59 digital tampretur controlled , supply of b.sc. physics items 1 stop watch ( 12set ) 2 clamp stand 06 3 vernier callipers ( 4set ) 4 screw gauge ( 4set ) 5 bar pendulum, 2set 6 metre scale ( 6set ) 7 telescopes ( 2set ) 8 a spiral spring 02 set 9 slotted weights in multiples of 100 gram, 500gram and hungers, ( 2sets ) 10 a laboratory stand and 50 cm scale 02 set 11 torsional pendulum ( inertia table ) 02 set 12 spirit level ( 02set ) 13 physical balance and a weight box ( 3set ) 14 two in one pendulum ( 2 set ) 15 clamps ( 2 set ) 16 steel balls ( 2 set ) 17 sonometer ( 2 set ) 18 rubber pad, ( 2 set ) 19 rectangular steel beam, ( 2 set ) 20 two knife edges, ( 2 set ) 21 microscope ( 1set ) 22 lamp and scale arrangement ( 1 set ) 23 carey fosters bridge ( 1 set ) 24 fractional resistance box ( 2 set ) 25 galvanometers sensitive ( 2set ) 26 physical training instruments ( 2 set ) 27 magnetic field measurement appratus ( 2 set ) 28 biot sanasts law ( 2 set ) 29 young madulus setup ( 2 set ) 30 hookss law set ( 2 set ) 31 two tripod stands, 32 two wire gauges 33 bunsen burner 01 set 34 sand paper 01 35 audio frequency ( af ) oscilliator 01 set 36 opamp ( ic 741 ) 02nos 37 oscillator ( giving sine and square waves of various frequencies ) 02 set 38 strong ( bar ) magnet 02 set 39 plane mirror 04 set 40 student spectrometer 01 set 41 maxwell wheel 07nos 42 e / m thomson ( bar magnet method ) ( 1nos ) 43 zeeman effeot setup ( 1nos ) 44 sodium vapour lamps ( 2set ) 45 travelling microscope ( 2 set ) 46 audio frequency oscillator ( of low power and variable frequency ) 01 set 47 power amplifier ( of the kind used for public address system ) 01 set 48 thermometer ( for room temperature measurment ) 02 set 49 thermistor 02 set 50 physical balance 02 set 51 biprisrn 02 set 52 optical bench with uprights 02 set 53 solenoid 02 set .0_100, 0 1000, 0 1k0, 0 10k0, 0 100k0 ) 02 set 54 ammeters ( ma range ) 02 set 55 capacitors ( electrolytic and boxes ) ( uf and mf range ) 02 set 56 cantilever with fixed strain gauges 02 set 57 diodes ( ge pn junction ) ( 4 ) 58 hall effect apparatus ( electromagnet, electronic millivoltmeter, constant current power supply, hall probe ) ( 2 set ) 59 newtons ring microscope 60 apparatus for resolving power of telescope 61 apparatus for plancks constant by using photoelectric cell 62 he ne laser kit 63 b h curve kit 64 newtons ring microscope 65 fresnels biprism 66 smart board 67 computer with couler printer digital model scanner...

Department Of Revenue - Madhya Pradesh

34479535 bids are invited for supply of misc lab items nylon syringe filter pore size 0.45um dia 13mm 100 in each box , disposable syringe 2.0ml 100 in each box , millipore membrane filter durapore pvdf 0.45um , millipore membrane filter durapore pvdf 0.22um , air tight plastic containers 250ml tarson hdpe polypropylene wide mouth bottle , plastic dropper posteur pipette 5 ml , 1 to 10 ml graduated pipette , pipette controller 1 to 100ml , rubber bubbler , burette stand with clamp rod and boss head , 20ml pipette volumetric , autosampler vial 2 ml hplc vial , laboratory hplc mobile phase reagent bottle with screwcap 5000 ml , volumetric flask 100 ml , volumetric flask 25ml , volumetric flask 5 ml , volumetric flask 1 ml ,volumetric flask 20 ml , funnels 0 plain 60 angle short stem25 mm , funnels 0 plain 60 angle short stem 50 mm ,extrelut nt 20 pre packed column for extraction ofliphophilic compounds from aqueous solutions 25 unit perpacket , n 95 masks , rectangular glass jar dimension220x195x80 mm total quantity : 3727...

Public Health Engineering Department - Madhya Pradesh

34455593 supply of calibrated glssware safety material and crm chemical for accrediated lab narmadapuram and nabl recognition of sub division lab seonimalwa, sohagpur, pipariya dist. narmadapuram 1 fire extinguisher abc tpye make viola, eco fire, safevent 2 sefety goggles make jackson, kleengukrd 3 humidity and temperature meter ( hydrometer ) dual and large display humidity range 0 10% rh resolution 0.1% temperature rang 0 60 e with converying case and nabl calibration certificate. ( make remi / relitech ) 4 flask volumetric with interchangeable solid glass and pp stopper cap 50 ml as per class a with nabl calibration certificate ( make borosil / relitech / duran ) 5 pipette, transfer volumetric accuracy as per class a , cap 50 ml, with nabl calibration certificate ( make borosil / relitech / duran ) 6 automatic burette ambar colour with reservoir capacity 2000 ml, cap 50 ml lc 0.1 ml, class a with nabl calibration certificate ( make borosil / relitech / duran ) 7 pipette, measuring graduated mohr type accuracy as per class a , cap 10 ml, with nabl calibration certificate ( make borosil / relitech / duran ) 8 automatic burette with reservoir capacity 2000 ml, cap 50 ml lc 0.1 ml, class a with nabl calibration certificate ( make borosil / relitech / duran ) 9 pipette, measuring graduated mohr type accuracy as per class a , cap 20 ml, with nabl calibration certificate ( make borosil / relitech / duran ) 10 pipette, trafer volumetric with one mask type, cap 2 ml, class a with nabl calibration certificate ( make borosil / relitech / duran ) 11 pipette, trafer volumetric with one mask type, cap 1 ml, class a with nabl calibration certificate ( make borosil / relitech / duran ) 12 pipette, trafer volumetric with one mask type, cap 10 ml, class a with nabl calibration certificate ( make borosil / relitech / duran ) 13 calcium standard solution from nist ca ( no3 ) 2 in hn 03 0.5 mol / 1 1000 traceble to crm mg / 1 ca ( 500ml ) ( make merck / bnd ) 14 turbidity standard crm from nist 500 ntu 500 ml make merck / bnd ( trecebality certificate of analysis ) 15 chloride standard solution traceable to crm from nist nacl in h2o, 1000 mg / 1 c1 ( 500 ml ) ( make merck / bnd ) 16 colour standard 500 hazen trecebility to crm from nist 500 ml ( with trecebality certificate of analysis ) ( make merck / bnd ) 17 alkalinity / standard / sodium carbonate 0.1 n / 100 mg / 1 traceable to crm from nist. ( make merck / bnd ) 18 thermo meter digital with etd probe with nabl calibration certificate precision thermameter digital with rtd prob with cable. ( make remi / relitech ) 19 thermo meter – 10 to 110 c imported with nabl calibration certificate ( make zeal england / relitech / remi ) 20 hygro meter ( density meter ) with nabl calibration certificate ( make relitech / remi ) ...

Department of Higher Education - Madhya Pradesh

34435002 bids are invited for 1 auto clave 2 bod incubator 3 cromatographic chamber 4 spectrophotometer 5 do meter digital 6 counductivity meter digital with cell 7 digital ph metr conductivity meter and temperature meter 8 digital photoelectric colorimeter 5lit 9 double distilation apperatus cap4lit 10 electronic blance0.01mg to 600gm 11 flame photometer digital 12 heating metel 4lit 13 hotplate with energy regulator 1500w 25x40cm 14 laboratory stirer 15 melting point apparatus digital 16 muffle furness 9*4*4 17 ph meter digital with electrodes 18 potantiometer digital 19 rotatory flask shaker 20 vacuum pump 21 water bath double 12 holes 22 water soil analysis kit 7 para meter 23 conductivity meter digital 24 compound microscope 25 dissecting microscope with bull lences 26 slide box 50 slides 27 binocular microscope 28 image projection system projection microscope 29 water bath double wall 12holes 30 double distilation apperatus cap2lit 31 hot air oven stainless steel 32 heating mental with regulator 1 lit cap 33 magnetic strirrer with hot plate 34 vortex shaker 35 water and soil testing analysis kit 36 ph meter with electrodes 37 digital colony counter 38 rotatory microtome with accessories 39 centrifuge machine 3500 rpm 40 thin layer chromotograhic chamber 41 oven 42 gel electroproshish with power supply(vertical) 43 bod 44 compound microscope 45 dissecting microscope with bull lences 46 image projection system projection microscope 47 binocular microscope 48 digital colony counter 49 rotatory microtom with accessories 50 bod incubator ss steel 51 ph meter...

Directorate Of Medical Education - Madhya Pradesh

34429793 tender for supply of chemical and reagent for mdru department third call , mdru kits and reagents , ammonium chloride 500gm , potassium bi carbonate 500gm , sodium chloride 500gm , tris hcl 500gm , sds 500gm , saturated phenol 500ml , chloroform 500ml , sodium acetate 250gm , isoamyl alcohol 500ml / 1ltr , glacial acetic acid 500ml / 1ltr , molecular biology grade agarose powder 250gm , bromophenol blue dye 2ml*5=1pack , ethidium bromide 10ml , molecular weight ( dna ladder ) 100bp & 1kb 1 vial , molecular weight ( dna ladder ) 50bp 1 vial , molecular weight ( dna ladder ) 25bp 1 vial , taq polymerase 500units / vial , amplitaq gold dna polymerase master mix 500units / vial , mgcl2 5ml , dntp mix 1ml , dnase 1000 unit , rnase 1000 unit , proteinase k 1000 unit , tris edta 500 gm , edta 250gm / 500gm , boric acid 250gm / 500gm , teepol5 liter , xylene cynol 10 gm , dmso 50 ml , tips i. 0.2 20 ?l tips , tips ii. 20 200 ?l tips , tips iii. 200 1000 ?l tips , superscript ii rnase reverse transcriptase / episcript™ rnase h reverse transcriptase ( episcript rt ) 400 / 500 reaction pack. , power sybrgreen pcr master mix 5 ml , power sybrgreen rt pcr reagent kit 5 ml , oligo ( dt ) 12 18 primer25ug ( 0.5ug / ul ) , absolute ethanol 500ml , pcr plates ( light cycler 480 compatible ) pack of 50 / pack of 100 , sealing foil ( rt pcr / qpcr grade ) ( light cycler 480 compatible ) pack of 50 / pack of 100 , filter tips each pack contains 1000 psc. , i. 0.2 20 ?l filter barrier tips , ii. 20 200 ?l filter barrier tips , iii. 200 1000 ?l filter barrier tips , mct variable tubes each pack contains 1000 psc. , i. 20 200?l tubes , ii. 200 600 ?l tubes , iii. 500 2000 ?l tubes , nitrile autodextorous gloves each pack contains 1000 psc. , mctstands for variable tubes sizes each pack contains 10 psc. , i. 20 200?l tubes stand , ii. 200 600 ?l tubes stand , iii. 500 2000 ?l tubes stand , filter tip boxes each pack contains 10 psc. , i. 0.2 20 ?l filter barrier tip box , ii. 20 200 ?l filter barrier tip box , iii. 200 1000 ?l filter barrier tip box , rt pcr grade water pack size of 20ml ( 20 ml * 5 ) , tip discard box ( 1 2 liter capacity ) each , graduated measuring cylinders 50, 100, 500, 1000 ml each , graduated beakers 50, 100, 500, 1000 ml each , flat bottom tube 5ml ( with screw cap ) pack size of 500 psc. , tube stand ( 15ml falcon, 5ml, 2ml, 0.5ml, 0.2ml mct ) pack size of 10 psc. , graduated conical flask 50, 100, 500, 1000ml pack size of 5 psc. , edta blood collection tube 5ml each pack contains 100 psc. , plain vial ( for clot activator ) each pack contains 100 psc. , fluoride vial each pack contains 100 psc. , test tube 5, 10 ml each pack contains 100 psc. , slide+cover slips ( 25mm*75mm ) each pack contains 100 psc. , tissue paper roll pack size of 12 psc. , fine tissue cloth roll pack size of 12 psc. , cotton pack size of 10 psc. , wash bottle / dropping bottle, 200ml, 500ml, 1ltr each , funnels variable range each , plastic bottle, 200, 500, 1000ml each , syringe + needle 2 ml, 5 ml pack size of 100 psc. each , nitrile gloves; medium and large size box pack size of 1000 psc. , dna isolation kit { blood } per kit , rna isolation kit per kit , phenol 500 ml , hno3 ( nitric acid ) 500 ml , propionaldehyde pure ( 97% ) 500 ml , phthalic anhydride 500 ml , glacialacetic acid ar 500 ml , hydrochloric acid ar 500 ml , sulfuric acid ar 500 ml , 2 amino ethanol 500 ml , pyridine ar 500 ml , ammonia solution ar 500 ml , ammonia chloride ar 500 ml , acetyl salicylic acid 500 ml , acetone ar 500 ml , anthranilic acid ar 500 ml , activated charcoal 500 ml , silica gel g 500 ml , benzoicacid ar 500 ml , sds 500 gm , colin ( cleaning detergent solution ) 500 ml , sterilium ( hand sanitizer ) 100 ml * 5 , dettol / lifeboy alcohol based hand sanitizer 100 ml * 5 , hypo 4% 5 l , floor cleaner phenyl 1 l * 5 , serum separator vial 3.5 ml ( vacutainer tube, 3.5ml, 13 x 75mm, plastic, additive: clot activator / polymer gel, gold hemogard closure, paper label ) pack size of 100 psc. each , labolene 1 l / 5 l , cleaning mop per psc , broom per psc , microwave gloves per pair , brown paper for autoclaving per roll , liquid nitrogen 10 / 25 ltr. , phosphate buffer saline ( 10x; ph 7.4; rnase free ) 500 ml , formalin ( formaldehyde aqueous solution; lab grade ) 500 ml , paraffin wax ( 58 600c for histology ) 500 gm , xylene ( molecular lab grade ) 500 ml , glycerol500 ml , ammonia ( nh4oh; extra pure ) 250 ml / 500 ml , methanol ( methyl alcohol, ch3oh ) 500 ml , acrylamide / bis ar 500 ml , 10x tbe buffer 500 ml , urea ( ultra pure; mol bio grade ) 500 gm / 1kg , ammonium persulfate 100 gm , temed ( ultra pure; mol bio grade ) 100 ml / 250 ml , 4’, 6 diamidino 2 phenylindole 50 ml , diethyl pyrocarbonate 5 gm / 25 gm , tae buffer , sybr gold 100ul , restriction enzyme – mnl i250 / 300 / 500 units , restriction enzyme – bcli1000 / 1500 / 2500 / 3000 units , restriction enzyme – hpych4v100 / 500 units , restriction enzyme – hpych4iii200 / 250 / 1000 / 1250 units , restriction enzyme – sau96i 1000 units , restriction enzyme – sfci200 / 1000 units , restriction enzyme – bcci1000 units , restriction enzyme – scrfi500 / 1000 / 2500 units , restriction enzyme – afliii250 / 1250 units , restriction enzyme – scai500 / 1000 / 1250 units , restriction enzyme – avai1000 / 2000 units , restriction enzyme – bsmi200 / 500 / 1000 / 2500 units , restriction enzyme – tspri ( also share cleavage site withtscai ) 1000 units , restriction enzyme – mboii250 / 300 / 1250 / 1500 units , restriction enzyme – bsh1236i500 / 1000 / 2500 units , restriction enzyme – banii1000 / 1500 / 2000 units , restriction enzyme – mph1103i1000 / 5000 units , restriction enzyme – dde i200 / 500 / 1000 / 2500 units , restriction enzyme – bsmb i ( also share cleavage site withesp3i ) 200 / 400 / 1000 units , restriction enzyme – afa i ( also share cleavage site withrsa i ) 1000 / 5000 units , restriction enzyme – bal i ( also share cleavage site withmlu ni ) 50 / 100 / 200 / 250 units , restriction enzyme – fspi ( also share cleavage site withnsbi ) 400 / 500 / 1000 / 2500 units , restriction enzyme – hpa ii ( also share cleavage site withmspi ) 1000 / 2000 / 4000 / 5000 / 10000 units , restriction enzyme hinf i , restriction enzyme hpych4 , restriction enzyme mboii , restriction enzyme bstui , restriction enzyme mvai , primers , fmr1 set 1 –f5 tcaggcgctcagctccgtttcggtttca 3 r5 5 aagcgccattggagccccgcacttcc 3 , mecp2 exon 1 set 1 f5 gttatgtctttagtctttgg–3´ r5 tgtgtttatcttcaaaatgt–3´ , exon 2set 1 f5 cctgcctctgctcacttgtt–3´ r5 ggggtcatcatacatgggtc–3´ , exon 2set 2 f5 agcccgtgcagccatcagcc–3´ r5 gttccccccgaccccaccct–3´ , exon 3 set 1 –f5 tttgtcagagcgttgtcacc–3´ r5 cttcccaggacttttctcca–3´ , exon 3 set 2 f5 aaccacctaagaagcccaaa–3´ r5 ctgcacagatcggatagaagac–3´ , exon 3 set 3 f5 ggcaggaagcgaaaagctgag–3´, r5 tgagtggtggtgatggtggtgg–3´ , exon 3 set 4 – f5 5´–tggtgaagcccctgctggt–3´ r5 ctccctcccctcggtgtttg–3´ , exon 3 set 5 f5ggagaagatgcccagaggag–3´ r5 cggtaagaaaaacatccccaa–3´ , exon3 ( l100v ) f5 aaccacctaagaagcccaaa 3 r5 gcttaagcttccgtgtccagccttcaggta 3 , putative promoter and exon 1. f5 gggtgcaatgaaacgctta 3 r5 tttaccacagccctctctcc 3 , mc4r rs17782313 f 5 aagttctacctaccatgttcttgg 3 r 5 ttccccctgaagcttttcttgtcattttgat 3 fto rs9939609 f 5 aactggctcttgaatgaaataggattcaga 3 r5 agagtaacagagactatccaagtgcagtac 3 , adipoqrs2241766 – f5 tgtgtgtgtggggtctgtct 3 r 5 tgtgatgaaagaggccagaa 3 , rs1501299 f5 ctacactgatataaactatatggag 3 r5 ccccaaatcacttcaggttg 3 , pcsk1 rs155971 – f5’tatatgcagccaccaatcca 3’ r5’aaaatgaagggagaagcacaaa3’ , pomcrs6232 f5 ttgtgcccttcatctgaaca 3 r5 tgtagcaactttggcatgga 3 , rs155971 f5tatatgcagccaccaatcca 3 r5 aaaatgaagggagaagcacaaa 3 , ppar g ( pro12ala ) f5gcc aat tcaagc cca gtc 3r5gat atgttt gca gac agt gta tca gtg aaggaa tcg ctttcc g 3 , kcnj11 ( rs5219 ) f5 gactctgcagtgaggcccta 3’ r5 acgttgcagttgcctttctt 3’ , capn10 ( rs3792267 ) f5 cacgcttgctgtgaagtaatgc 3’r5 tgattcc catggtctgtagcac 3’pik3ca set 1 forward 5’ ggagtatttcatgaaacaaatgaatgatgcg 3’ reverse 5’ gagctttcattttctcagttatctt 3’ , bat 25 set 1 f 5’ tcgcctccaagaatgtaagt 3’r 5’ tctgcattttaactatggctc 3’bat 26 set 1 f5’ tgactacttttgacttcagcc 3’r5’ aaccattcaacatttttaaccc 3’ , d2s123 set 1 f5’ aaacaggatgcctgccttta 3’ r5’ ggactttccacctatgggac 3’ , d5s346 set 1 f 5’ actcactctagtgataaatcggg 3’ r5 agcagataagacagtattactagtt 3 , d17s250 – set 1 f5’ ggaagaatcaaatagacaat 3’ r5’ gctggccatatatatatttaaacc 3’ , impdh2 set 1 f5 gtttctgcggtatcccaatc 3 r5 cgagcaagtccagcctat 3 bmp6 rs73719353 f5’ gctcctttgcacttcgctgt 3’ , r5’ aggctctgctg agctcctac 3’ , bmp6 rs73719341 f 5’tgaacttcccattcccctct 3’ r5’ataaaattagcattgatcca 3’ , bmp6 rs73719318 f5’caggtgctgtgcaacttctt 3’ r 5’agagggcaccatggttgcct 3’ , bmp6 rs73381662 f 5’ ctgagattcaattaggccca 3’ r 5’taaagaacagcaaaagtctg 3’ , bmp6 rs73381650 f 5’cacataaagattgctgcatt 3’ r 5’tagtaatcctaaaaatggga 3’ , anxa2 rs7170178 f 5’ ttcacagcagttcaaaatac 3’ r 5’ ctgggtttccagagatggaa 3’ , anxa2 rs73435133 f 5’ gagtgcaaggtgctgaggat 3’ r 5’ gatttcagacagcccttgca 3’ , anxa2 rs73418020 f 5’ tctgagagtgaaaggtgcac 3’ r 5’ tcccatcccctgaatccctg 3’ , anxa2 rs72746635 f 5’ cctgactcattgtcacatca 3’ r 5’ aagtggctttccactgccc 3’ , anxa2 rs73418025 f 5’ cttctcatcttactttt 3’ r 5’ agggaaggatacagaggaga 3’ , hsp 70 primer sequence5 agcgt aacac cacca ttcc 3 ( forward ) 5 tggct cccac cctat ctc 3 ( reverse ) , the gapdh sequence forward primer 5 agc cac atc gct gag aca c 3, reverse primer 5 gcc caa tac gaccaa atcc 3. , mthfr f:5 tgtggtctcttcatccctcgc 3;r: 5 ccttttggtgatgcttgttggc 3. , dpyd f:5 actcaatatctttactctttcatcaggac 3. r: 5 acattcaccaacttatgccaattct 3. , tyms f:5’ ggtacaatccgcatccaactatta 3’ r:5’ ctgataggtcacggacagattt 3’ , imp3 forward:5’atgactcctccctacccg3’ reverse:5’gaaagctgcttgatgtgc3’ , cxcl1forward: 5’ccagacccgcctgctg 3’and reverse:5’cctcctcccttctggtcagtt 3’ , cox 2 forward: 5 cagccatacagcaaatcc 3; reverse: 5 tcgcacttatactggtcaa 3 , hmlh1f 5 ttt tga tgt aga tgt ttt att agg gtt gt 3r 5 acc acc tcatcataa cta ccc aca 3 , ppar g ( pro12ala ) , f5gcc aat tcaagc cca gtc 3 , r5gat atgttt gca gac agt gta tca gtg aaggaa tcg ctt tcc g 3 , methylated ( hmlh1 ) f 5 acg tagacg ttt tat tag ggt cgc 3 r 5 cct catcgtaac tac ccg cg 3 , hmsh2 f 5 ggt tgt tgt ggt tgg atg ttg ttt 3 r 5 caa cta caa cat ctc ctt caa cta cac ca 3 , methylated ( hmsh2 ) f 5 tcg tgg tcg gac gtc gtt c 3 r 5 caa cgt ctc ctt cga cta cac cg 3 , ? actin: forward: 5’ ctacgtcgccctggacttcgagc 3’ ß actin: reverse: 5’ gatggagccgccgatccacacgg 3’ , kras forward: 5 gactgaatataaacttgtggtagttggacct 3.reverse: 5 ctattgttggatcatattcgtcc 3. , braf forward: 5 tcataatgcttgctgatagga 3. reverse: 5 ggccaaaaatttaatcagtgga 3. , mthfr ( c677t ) ‘‘5 gcacttgaaggagaaggtgtc 3” and reverse primer ‘‘5 aggacggtgcggtgagagtg 3” , mthfr ( a1298c ) forward ‘‘5 ctt tgg gga gct gaa gga cta cta c 3” and reverse ‘‘5 cac ttt gtg acc att ccg gtt tg 3” primers. , total rna isolation mini kit ( from human skin tissue ) / rneasy fibrous tissue mini kit ( for rna extraction from human skin tissue ) ( qiagen ) per kit ( each kit pack is for 50 reactions ) , purospin™ fibrous tissue rna purification kit ( luna nanotech ) ( for rna extraction from human skin tissue ) per kit ( each kit pack is for 250 reactions ) , aurum™ total rna fatty and fibrous tissue kit ( biorad ) / mp biomedicals fastrna pro green kitper kit ( each kit pack is for 50 reactions ) , human leptin elisa kit per kit ( each kit pack is for 96 reactions ) , human adiponectin elisa kit per kit ( each kit pack is for 96 reactions ) , human adipsin elisa kit per kit ( each kit pack is for 96 reactions ) , human resistin elisa kit per kit ( each kit pack is for 96 reactions ) , human iron elisa kit ( serum iron ) per kit ( each kit pack is for 96 reactions ) , human ferritin elisa kit ( serum / ferritin ) per kit ( each kit pack is for 96 reactions ) , gdf15 human elisa kit per kit ( each kit pack is for 96 reactions ) , spexin human elisa kit per kit ( each kit pack is for 96 reactions ) , human pai 1 elisa kit per kit ( each kit pack is for 96 reactions ) , thyroid estimation kit per kit ( each kit pack is for 96 reactions ) , ice maker machine for laboratory purpose 1 unit , microwave gloves each packet contains one pair of gloves. , pcr mini cooler / coolcube microplate and pcr tube cooler each , pipette 0.5 10ul, 02 20ul, 10 100ul, 20 200ul and 100 1000ul. each , horizontal gel apparatus: 18 – 20 cm ( length ) x 25 – 30 ( breadth ) x 5 7.5 cm ( height ) , 40 60 samples, multichannel pipette compatible combs and gel caste each , mini horizontal gel apparatus: 9 cm w x 11 cm l with grooves ( 8.7 cm l x 1.2 cm h ) on the side for gripping the gel tray. it should have two comb slots on the same tray area. buffer capacity should be 600 ml for the buffer tanks and optimum gel runs with a fill line indicator for buffer levels along the unit side each , multi size forceps lab set each packet containsmulti size forceps lab set , liquid nitrogen sample storage tanks each , liquid nitrogen sample handling gloves each packet contains one pair of gloves. , slide tray / rack each , l mold each , tissue cassette steel each , electric tissue float bath ( thermostate ) each , coupling jar each pack contains 2 psc. , staining rack each , whatman filter paper grade 1 & 2 each packet contains 50 psc.. , harri’s hematoxylin powder 25 / 50 / 100 / 250 / 500 gm , yellow eosin powder 25 / 50 / 100 / 250 / 500 gm , coverslip 18x18 ( microscopic ) each packet contains 100 psc.. , dpx mount 100 ml / 250 ml , hot plate each , mx35 premier microtome blade ( 34 / 80mm ) 50 blades each box contains 50 psc.. , diamond point marker pen ( histopathology use ) each , embedding mold and embedding ring each , qiamp dna ffpe tissue kit ( 50 rxns ) , genomic dna purification kit ( promega ) , rna extraction kit from tissue , cdna synthesis kit , superscript ii rnase reverse transcriptase , sybr green pcr master mix , sodium bisulphite , page loading dye , formamide , n’n’ methylene bisacrylamide , ammonium persulfate , temed , polyacrylamide , wizard dna clean up system ( promega ) , 2 mercaptoethanol , silver stain , hydroquinone , urea , blotting paper , dna ladder 10 bp , pas stain , histopathology plastic cassettes , poly – l – lysine coated slides , deep well mortar and pestle homogenizers ( medium size ) , deep well mortar and pestle ( small size ) , rneasy minielute cleanup kit , phase – lock gel heavy5 prime phase – lock gel heavy5 prime , qiazol lysis reagent , rneasy minielute cleanup kit , cryo vial 1 pkt contains 50 psc. , deep well mortar and pestle ( small size ) ...

Department of Higher Education - Madhya Pradesh

34393453 bids are invited for lab equipment laminar air flow , autoclave , hot air oven , incubator , gas cylinder and gas stove , spreaderll shaped , inoculation loop , petri plates , test tube normal size , pippete , stainless steel s patula , stainless steel s forceps , ethanol alcohol , cotton , firstaid equpment , staining material ,weighing balance machine , ph meter , centrifugemachine , calorimeter , blood counter , elisareader , hot plate , thermometer , magneticstrirrer , water bath , funnal s , glove boxes ,beaker and conical flask total quantity : 175...

Ministry Of Micro Small And Meduim Enterprises - Madhya Pradesh

34379058 bids are invited for 1 title1 hydrochloric acid 2 title2 nitric acid 3 title3 sulphuric acid 4 title4 sodium hydroxide pellets 5 title5 distilled water 10 x5 ltr 6 title6 silver nitrae 7 title7 cotton bundle 8 title8 ph paper 1 14 9 title9 ph paper 2 10 10 title10 litmus paper red 11 title11 litmus paper blue 12 title12 watman filter paper grade 41 13 title13 conical flask 250 ml 14 title14 wash bottle 1000 ml 15 title15 potassium permanganate 16 title16 methyl orange indicator 125 ml each 17 title17 phenopthalein indicator 125 ml each 18 title18 ethyl alcohol 500 ml each 19 title19 sodium bicarbonate 20 title20 sodium carbonate 21 title21 potassium oxalate 22 title22 oxalic acid 23 title23 potassium iodide 24 title24 apron 25 title25 cleaning cotton waste 26 title26 beaker 500 ml ...

Public Health Engineering Department - Madhya Pradesh

34356468 required nabl certified crm glassware non_lun for district and sub divisional laboratories of phed in dist betul 2 turbidity standard 1000 ntu 500ml crm with iso 17034 tracebility certificate 3 phbuffer 4.0 solutioncrm withiso 17034 tracebility certificate 4 phbuffer 7.0 solution crmwith iso 17034 tracebility certificate 5 phbuffer 9.2solution crm with iso 17034 tracebility certificate 6 conductivity 1413 standard crm withiso 17034 tracebility certificate 7 tds nacl standard 475 ml with iso 17034 tracebility certificate 8 sodium chloride 45g standard crm with iso 17034 tracebility certificate 9 calcium carbonate 20g crm with iso 17034 tracebility certificate 10 sodiumcarbonate 45 g crm with iso 17034 tracebility certificate 11 volumetric flask 50 ml, class a withnabl calibration certificate 12 volumetric flask 100 ml class a with nabl calibration certificate 13 measuring pipette cap. 1 ml class a with nabl calibration certificate 14 measuring pipette cap. 10 ml class a with nabl calibration certificate 15 automatic burette 50ml set class a with nabl calibration certificate 16 automatic amber color burette 50ml set class a withnabl calibration certificate 17 water wash bottles high plastic material make polylab / kasalablanka / abdos 500ml 18 bubbler for automatic burette 19 fire extingwisher 20 eye / face washer 21 electric pipette filling device electric / chargeable 22 sulphate standard1000 mg / l crm 500 ml with iso 17034 tracebility certificate 23 flouride standard flouride standard crm 1000mg / l500ml with iso 17034 tracebility certificate 24 potassium di cromate standardcrm with iso 17034 tracebility certificate 25 iron standardcrm 500 ml with iso 17034 tracebility certificate 26 nitrate standard flouride standard crm 500 ml with iso 17034 tracebility certificate 27 starch powder form 500g 28 sodium thiosulphate 0.01n solution 500ml capacity make envirotech / nicp / merck 29 acetic acid 100% puremake merck / thermo / sigma 30 potassium iodied 500g make merck / thermo / sigma 31 tonge + spetula set heavy steel good quality 32 beaker a class borosilicate 100ml 33 conical flask a class borosilicate 100ml 34 reagent bottle class a borosilicate 125ml 35 potassium per magnate500g make merck / thermo / sigma 36 crm colour standardchloroplatinatic soln 500 unit with iso 17034 tracebility certificate 37 digital bottle top burrete 50ml with bottle top dispenser, digital with singlechanel microlitre pipette transferpette, adjustable volume class a borosilicate glass bottle with nabl calibration certificate with supply, installation, testing and commissioning , make microlit / hirschmann / eppendorf / brand 38 digital bottle top umber burrete 50ml with umber bottle top dispenser, digital with singlechanel microlitre pipette transferpette, adjustable volume class a borosilicate glass bottle with nabl calibration certificate with supply, installation, testing and commissioning , make microlit / hirschmann / eppendorf / brand 39 silica crusible dish high quality100ml cap. 40 orion ionplus thermo scientific a optimum results fluoride electrode filling solution 5 pack * 60ml 41 conical flask a class borosilicate 250ml 42 acetone liquid pure 500ml cap. merck / sigma / nicp / envirotech 43 cotton bundle roll 250 gm or equivalent heavy quality...

Public Health Engineering Department - Madhya Pradesh

34181466 supply of instruments and glassware for testing of water quality in laboratory phe division ujjain and sub division laboratories khachrod 1 automatic burette with reservoir rubber bellow reservoir capacity 2000ml, cap 50ml.lc 0.1 class a with nabl calibration certificateborosil / rivera / schot / glassto / duron 2 automatic burette with reservoir rubber bellow reservoir capacity 2000ml, cap 50ml.lc 0.1 class a with nabl calibration certificateborosil / rivera / schot / glassto / duron 3 pipette volumetric with one mark, cap. 1.0 ml, class a with nabl calibration certifiedborosil / rivera / schot / glassto / duron 4 pipette volumetric with one mark, cap. 2.0 ml, class a with nabl calibration certifiedborosil / rivera / schot / glassto / duron 5 pipette volumetric with one mark, cap. 5.0 ml, class a with nabl calibration certifiedborosil / rivera / schot / glassto / duron 6 pipette volumetric with one mark, cap. 10.0 ml, class a with nabl calibration certifiedborosil / rivera / schot / glassto / duron 7 pipette volumetric with one mark, cap. 20.0 ml, class a with nabl calibration certifiedborosil / rivera / schot / glassto / duron 8 pipette volumetric with one mark, cap. 25.0 ml, class a with nabl calibration certifiedborosil / rivera / schot / glassto / duron 9 pipette volumetric with one mark, cap. 50.0 ml, class a with nabl calibration certifiedborosil / rivera / schot / glassto / duron 10 hydrometer for specific gravity measurement, range 1 2 point gradation interval 0.1 ml with nabl calibration certificateas per suitable 11 humidity and temperature meter ( hydrometer ) , dual and large display, humidity range 0 100%rh resolution 0.1%. temperature range 0 60°c with covoeying case and calibration certificate from nabl certified lab.as per suitable 12 visi cooler, temp 0 80°c capacity 320 ft, aesthetic sieek design with nabl calibration digital thermometeras per suitable 13 measuring pipette mohar type class a with certificate, capacity 2 ml graduation interval 0.1 ml with individual calibration certificate from nabl labborosil / rivera / schot / glassto / duron 14 measuring pipette mohar type class a with certificate, capacity 1 ml graduation interval 0.1 ml with individual calibration certificate from nabl labborosil / rivera / schot / glassto / duron 15 measuring pipette mohar type class a with certificate, capacity 5 ml graduation interval 0.1 ml with individual calibration certificate from nabl labborosil / rivera / schot / glassto / duron 16 measuring pipette mohar type class a with certificate, capacity 10 ml graduation interval 0.1 ml with individual calibration certificate from nabl labborosil / rivera / schot / glassto / duron 17 measuring cylinder 50 ml a class graduated with certified nabl certificateborosil / rivera / schot / glassto / duron 18 measuring cylinder 1000 ml a class graduated with certified nabl certificateborosil / rivera / schot / glassto / duron 19 beaker 1000mlborosil / rivera / schot / glassto / duron 20 beaker 500mlborosil / rivera / schot / glassto / duron 21 beaker 250mlborosil / rivera / schot / glassto / duron 22 beaker 100mlborosil / rivera / schot / glassto / duron 23 conical flask 100mlborosil / rivera / schot / glassto / duron 24 conical flask 150mlborosil / rivera / schot / glassto / duron 25 conical flask 250mlborosil / rivera / schot / glassto / duron 26 conical flask 500mlborosil / rivera / schot / glassto / duron 27 pipette standborosil / rivera / schot / glassto / duron 28 eye / face washeras per suitable 29 lab coatas per suitable 30 laboratory first aid box with wall mounting facilityas per suitable 31 fire extinguisher a b c typeas per suitable 32 safety gogglesas per suitable 33 hands on nitrile examination gloves 9.5 inch length 100 no. in each packas per suitable 34 air conditioner 1.5 tonas per suitable 35 glass thermometer with nabl certificateborosil / rivera / schot / glassto / duron 36 nesler cylinder standborosil / rivera / schot / glassto / duron 37 nesler cylinder 100ml class a certifiedborosil / rivera / schot / glassto / duron 38 electronic single pan balance capacity 200 gm least count 0.1 mg8 with demo & technical training including one year warranty ( nabl calibrated ) with 2 year warranty and amc.metler / wensor / aczet / shimadzu 39 weightbox e 2, 23 weights including fractional weights 200gm maximum with ( nabl calibrated ) with 2 year warranty and amc.metler / wensor / aczet / shimadzu 40 ups for computerv guard, zebronics 41 labq ultra water maker lab of type ill water system ( make millipore / lon exchange / thermofisher scientificfeatures:online conductivity meter...

Public Health And Family Welfare - Madhya Pradesh

34133129 bids are invited for sulfuric acid , basic fuchine powder , phenol cristal , methylated spirit , distill water , oil immersion , hand wash solution , dropping bottel , sputum cup , glass slide , falcon tube , disposable gloves packet , zip pouch 100 per boq chemical pack , parafilm roll 4 inch , face mask standured , lenscleaning paper , tisshu paper roll , filter paper watman , conical flask , bamboo stics long size , cotton bundle , falcon tube stand , bio hazard lable total quantity : 10804...

Directorate Of Purchase And Stores - Madhya Pradesh

34114860 supply of erlenmeyer flask , 125 ml erlenmeyer flask w / vent cap, polycarbonate, sterile ( 50 per pack ) , 500 ml erlenmeyer flask w / vent cap, polycarbonate, sterile , neck 43mm ( 25 per pack ) , 2 l erlenmeyer flask w / vent cap, polycarbonate, neck 48mm, sterile, ( 6 per pack ) , 48mm polypropylene cap, vented, for 2l plastic erlenmeyer flask, sterile, ( 24 per pack ) , 43mm polypropylene cap, vented, for 500ml and 1l plastic erlenmeyer flask, sterile, ( 50 per pack ) , cell scraper blade width 1.8cm, handle length 25cm ( 100 per pack ) , sterile tissue culture flask, surface treated vented cap, growth area 25.0cm2 ( 5x10 per case ) , n, n dimethylformamide ( dmf ) ( 250ml ) , 6 wells tissue culture plate, polystyrene sterile pack of 50...

Bhopal Municipal Corporation - Madhya Pradesh

34085039 requirement of crms for nabl water testing laboratory under 5.00 mgd filter plant 2 sulfate standard solution traceable to 3 iron stanard solution traceable to 4 fluoride standard solution traceable to 5 color 500 pt co unit calibration std 500 6 ph buffer solution 4 pk 500 ml 7 ph buffer solution 700 pk500 ml 8 ph buffer solution 900 pk500 ml 9 potassium chloride soluation 10 potassium chloride soluation 11 calclum carbonate volumeric standard 12 sodium carbonate pk 45 gm 13 sodium chloride pk 45 gm 14 turbidity 1000 ntu callbration standard 15 nabl registration charges with documenti 16 digital hydrometer for specific gravity: 17 humidity and temperature meter ( hygromet 18 standard weights f11 mg to 200 g, nab 19 flasks volumetric with interchangeable 20 flasks volumetric with interchangeable 21 flasks volumetric with interchangeable 22 flasks volumetric with interchangeable 23 flasks volumetric with interchangeable 24 flasks volumetric with interchangeable 25 pipettes volumetric clear glassclas 26 pipettes volumetric clear glassclas 27 pipettes volumetric clear glassclas 28 pipettes volumetric clear glassclas 29 pipettes volumetricclear glassclas 30 pipettes volumetric clear glassclas 31 cylinders colour comparison nessler, f 32 cylinders colour comparisonnessler, f 33 cylinders, measuring with hexagonal 34 bottles bod with ic stopper, 35 burette clear glass a class reservoir 36 burettes amber colour single bore teflon 37 flasks erlenmeyer conical narrow 38 flasks erlenmeyer conical narrow 39 beakers low form with graduation and 40 beakers low form with graduation and 41 beakers low form with graduation and 42 beakers low form with graduation and 43 pipettes volumetric clear glass, one 44 pipettes graduated clear glass, 45 pipettes graduated clear glass 46 pipettes graduated clear glass, 47 desiccators plain clear glass, 48 bottles reagent with ic joint 49 bottles reagent with ic joint 50 bottles reagent with ic joint 51 bottles reagent with ic joint 52 bottles reagent with ic joint 53 bottles bod with ic stopper 54 bottles laboratory round 55 all glass filter flask for filter 56 stand for nesslars cylinder 50 ml 57 tong for 300 mm, ss 58 safety shower ( wall mounted ) 59 eye washer ( wall mounted ) 60 tissue roll 61 lab coat apron 62 fire extinguisher abc, 6 kg 63 first aid 64 safety goggle 65 latex nitrile non sterile hand gloves...

Department of Agricultural Research and Education - Madhya Pradesh

33931719 bids are invited for cryobox cardboard, 81 well, bulk loose pack, per case , tissue culture flask with filter cap sterile, 25cm2, 200 per pack , tissue culture flask with filter cap sterile, 75cm2, 100 per pack , tissue culture plate sterile, 96 wells, individually wrapped, 50 per pk , micro centrifuge tube 5ml, sterile, natural, 100 per pk , rack for micro centrifuge tube 5 ml, 2 per pk , cryochill vial self standing sterile, 4.5 ml, extthread or int thread, 500 per pk , microtips, 0.2 10ul, bulk,1000 per pk , microtips, 2 200 yellow, universal, 1000 perpk , microtips, 200 1000 blue, bulk, 500 per pk , purepackfilter tips sterile, individually wrapped,1000ul, 400 per pk, tissue culture plate sterile,6 wells, individually wrapped,50 per pk total quantity : 48...

Public Health Engineering Department - Madhya Pradesh

33840510 supply of equipment and glassware requirement for gohadlab districtbhind 2 ph meter model no. 362 orion systronics, ranges 0 14, resolution 0.001, accuracy 0.002 ph, ( nabl ceritified ) 3 thermometer 4 electronicbalance lc 0.1mg, 200 gmcapacity ( nabl ceritified ) 5 turbidity meter 135 systronic 6 hydrometer range 1 2 pointgradation ( nabl ceritified ) 7 hygrometer, for humidity and temperature range 0 100% ( nabl ceritified ) 8 tds meter 308 orion systronic 9 fridge voltas 210 ltr. 10 glass thermometer with nabl calibration certificate 11 persion thermo meter digital with rtd probe with cable with nabl calibration certificate 12 eye washer 13 fire extinguisher 14 wet & dry thermameter 15 fist aid kit 16 weight box e 2, 23 weight including frictional weights 200 gm. ( nabl certified ) 17 air conditioner 1.5 ton 18 oven capacity 72 ltr. temp. range rt+20 250°c 19 auto zero burette capacity 50 ml with reservior capacity 2000ml50ml ( whitecolour ) ( nabl ceritified ) 20 auto zero burette capacity 50 ml with reservior capacity 2000ml50ml ( ambar ) ( nabl ceritified ) 21 pipette 10ml ( nabl ceritified ) 22 measuring cylinder 50ml hexagonal ( nabl ceritified ) 23 measuring cylinder graduate 100ml ( nabl ceritified ) 24 conical flask 250ml 25 conical flask 500ml 26 beaker 100ml 27 beaker 250ml 28 beaker 500ml 29 pipette graduate 1ml ( nabl ceritified ) 30 funnel 4 dia 31 nesselar cylinder 100ml 32 sample bottle 2 ltr plastic 33 sample bottle 1 ltr plastic 34 bacto sampling bottle 250ml....

Water Resources Department - Madhya Pradesh

33804995 calibration of equipments / instruments for the year 2022 23 at soil and material testing laboratory, wrd, hathaikheda, bhopal. 1 electronic weighing balance cap. all works with specification i / c lead and lift under the direction of engineer incharge. 200 gram 2 electronic weighing balance cap. all works with specification i / c lead and lift under the direction of engineer incharge.20 kg 3 electronic weighing balance cap. all works with specification i / c lead and lift under the direction of engineer incharge. 120 kg 4 ( a ) pressure gauge attached in oil water constant pressure system, along with hydraulic oil grade 64 replace. all works with specification i / c lead and lift under the direction of engineer incharge.16 kg / cm 2 5 ( b ) pressure gauge attached in pore pressure apparatus ( compound gauge ) along with repairing. all works with specification i / c lead and lift under the direction of engineer incharge. 10.50 kg / cm 2 6 ( c ) lvdt sensor. all works with specification i / c lead and lift under the direction of engineer incharge. ±20 mm 7 ( d ) load cell ( digital load indicator ) . all works with specification i / c lead and lift under the direction of engineer incharge. 10 kn 8 ( e ) digital pressure indicator 20 bar 9 concrete permeability apparatus pressure gauge. all works with specification i / c lead and lift under the direction of engineer incharge.21 kg / cm 2 10 concrete permeability apparatus pressure gauge. all works with specification i / c lead and lift under the direction of engineer incharge.17.5 kg / cm 2 11 permeability apparatus ( six cell ) . all works with specification i / c lead and lift under the direction of engineer incharge. 10.60 kg / cm 2 12 permeability apparatus ( six cell ) . all works with specification i / c lead and lift under the direction of engineer incharge. 7 kg / cm 2 13 pundit lab. ultrasonic instrument. all works with specification i / c lead and lift under the direction of engineer incharge. 14 aimil concrete test hammer. all works with specification i / c lead and lift under the direction of engineer incharge. 15 los angeles abrasion testing machine. all works with specification i / c lead and lift under the direction of engineer incharge. 16 digital compression testing machine. allworks with specification i / c lead and lift under the direction of engineer incharge.2000kn 17 digital compression testing machine. allworks with specification i / c lead and lift under the direction of engineer incharge.500kn 18 digital flexural strength testing machine. all works with specification i / c lead and lift under the direction of engineer incharge.100kn 19 vicat apparatus with dashpot. all workswith specification i / c lead and lift under the direction of engineer incharge. 20 water both for soundness of cement. all works with specification i / c lead and lift under the direction of engineer incharge. 21 measure: cylindrical metal measure ( determination of aggregate impact value ) . all works with specification i / c lead and lift under the direction of engineer incharge. 22 measure cylindrical metal measure ( determination of aggregate crushing value ) dia11.5 and height 18 cm. all works with specification i / c lead and lift under the direction of engineer incharge. 23 cylindrical metal measure cap. 3, 15 and 30 litre. all works with specification i / c lead and lift under the direction of engineer incharge. 1 set 24 sieves: 30 cm dia square hole 100 80, 63, 50, 40, 31.5, 25, 20, 16, 12.5, 10, 6.3 4.75. all works with specification i / c lead and lift under the direction of engineer incharge. 25 sieves: 20 cm dia fine mash 4.75 4.0 3.35, 2.36, 2.0 , 1.70, 1.18mm, 850, 600, 425, 300, 150, 90 and 75μ. all works with specification i / c lead and lift under the direction of engineer incharge. 26 oven cap. 110°c. all works with specification i / c lead and lift under the direction of engineer incharge. 27 flakiness: metal gauge. all works with specification i / c lead and lift under the direction of engineer incharge. 28 elongation: metal gauge. all works with specification i / c lead and lift under the direction of engineer incharge. 29 permeameter ( permeability. apparatus for soil testing ) . all works with specification i / c lead and lift under the direction of engineer incharge. 30 vernier calipers. all works with specification i / c lead and lift under the direction of engineer incharge. 31 metal scale. all works with specification i / c lead and lift under the direction of engineer incharge. 32 thermometer range ( 0 o to 250 o c ) . all works with specification i / c lead and lift under the direction of engineer incharge. 33 strain gauge. all works with specification i / c lead and lift under the direction of engineer incharge. 0.01to25mm 34 le chaterliar flask. all works with specification i / c lead and lift under the direction of engineer incharge. 250 ml 35 graduated glass measuring cylinder capacity : 10 ml, 20 ml, 50 ml, 100 ml, 250 ml, 500 ml, 1000 ml. all works with specification i / c lead and lift under the direction of engineer incharge. 36 byonacy balance. all works with specification i / c lead and lift under the direction of engineer incharge. 37 zeil dry and wet thermometer. all works with specification i / c lead and lift under the direction of engineer incharge. 38 gst @ 18 %...

Public Health And Family Welfare - Madhya Pradesh

33773938 bids are invited for antimony , arsenic , barium , boron , beryllium , calcium , cadmium , copper , chromium , gadolinium , gold , iron , leao , magnesium , mercury , nickel , silver , selenium , sodium , tellurium , tin , zinc , bismuth , germanium , indium , scandium , terbium , ittrium , acetonitrile , methanol , acetic acid , formic acid , magnesium sulphate anhydrous , sodium acetate anhydrous , sodium chloride , acetone , aluminum oxide , c 18 quechers bulk sorbent , sodium sulphate , nitric acid , hydrogen peroxide , hydrochloric acid , icap q rq tuning solution , icap q qnova calibration solution , ambercoloured volumetric flask class a , vitamin b9 , cyanocobalamine b12 , 5ml ria vials , sodium avetate , ammonium foemate , a amylase diluted with starch frombacillus amyloliquefaciens , 0.45um nylon syringe filter0.45um 25mm thickness , c 18 spe cartridge maxi cleanspe 900 mg c 18 s pure p n 20942 part no 5122344 packsize 5c , 0.45um membrane filter 0.45um 47mm , 1.5 mlhpcl vials 1.5ml or 2ml with screw cap and amp septa , llascorbic acid , potassium hydrogen phodphate , potassiumhydroxide , hydrochloric ar grade 35 to 37 percentage acid total quantity : 33679...

Directorate Of Health Services - Madhya Pradesh

33747699 supply of medicine and material medicine and material , medicine name , atropine inj 0.6 mg / ml 2 ml amp , bupivacaine hcl inj 0.5% 20 ml vial , glycopyrolate inj 0.2 mg / ml 1 ml amp , halothane inhalation 250 ml bottle , isoflurane inhalation 250 ml bottle , ketamine inj 10 mg / ml 10 ml vial , lignocaine inj 2% 30 ml vial , lignocaine gel 2% 30 gram tube , lignocaine +adrenaline inj 2% + 0.005 mg / ml30 ml vial , midazolam inj 1 mg / ml 5 ml amp / 10 ml vial , pentazocine injection 30mg / ml 1 ml ampule , thiopentone inj 0.5gm powder / vial 20 ml vial , nitrous ( store under pressure in metal cylinders of the type conforming to the appropriate safety regulations and at temperature not exceeding 37°c ) , oxygeninhalation , promethazine injection 10 mg / mlone injection 1 vial , propofal injection 10 mg / ml 1 ml / vial , aceclofenec tab 100mg 10 x10 , acetylsalicylic acidtablet 150 mg 10 x 10 , acetylsalicylic acid ( aspirin ) *tablet 25 mg 10 x 10 , allopurinol tablet300 mg 10 x 10 , allopurinol tablet 100 mg 10 x 10 , aspirin tab 75 mg 10 x 10 , atracurium inj 10 mg / ml 2.5 ml amp , diclofenac tab 50 mg 10 x 10 , diclofenac inj 25 mg / ml 3 ml amp , diclofenac 1% gel , fentanyl 50 microgram / ml 2 ml amp , hydroxychloroquine tablet 200 mg 10 x 10 , ibuprofen tab 400mg 10 x 10 , ibuprofen oral suspension 100mg / 5ml 60 ml bottle , morphine inj 10 mg / ml1 ml amp , paracetamol tab 500mg 10 x 10 , paracetamol drops 125mg / ml drops 125mg / ml , paracetamol inj150 mg / ml 2 ml amp , paracetamol syp 125mg / 5 ml 60 ml bottle , paracetamol tab 650mg 10 x 10 , pregabalin tablet 150 mg 10 x 10 , succinyl choline inj 50 mg / ml10 ml vial , sulfasalazine tablet 500 mg 10 x 10 , tapentadol tablet 100 mg 10 x 10 , tramadol inj 50 mg / ml 2 ml amp , tramadol tab 50mg 10 x 10 , betahistine tab 8 mg 10 x 10 , cinnarizine tab 25 mg 10 x 10 , adrenaline inj 1 mg / ml 1 ml amp , betamethasone tab 0.5 mg 10 x 10 , betamethasone sodium phosphate inj 4 mg / ml 1 ml amp , cetirizine tab 10 mg 10 x 10 , cetirizine syp 5mg / 5ml 30 ml bottle , chlorpheniramine inj 10 mg / ml10 ml vial , chlorpheniramine oral liquid 2 mg / 5 ml , dexamethasone inj 8 mg / 2 ml 2 ml vial , dexamethasone tab 0.5 mg 10 x 10 , hydrocortisone inj 100 mg / vial dry powder 100mg / vial , hydrocortisone ointment 0.5% , hydrocortisone ointment1% , hydroxyzine syrup 10 mg / 5 ml , hydroxyzinetablet25 mg 10 x 10 , pheniramine injection 22.75 mg / ml 2 ml vial , prednisolone tab 20 mg 10 x 10 , promethazine syp 5mg / 5ml 60 ml bottle , ferrous ascorbate ( 100mg. elemental iron+ folic acid 1.5 mg ) 10 x 10 , phytomenadione injection 10 mg / ml 10 mg ampule , carbamazepine tab 200 mg 10 x 10 , carbamazepine tablet 200 mg 10 x 10 , carbamazepineoral liquid 100 mg / 5 ml , diphenylhydantoin tab 30 mg 10x10 , levetiracetam tablet 250 mg 10 x 10 , magnesium sulphateinjection 500 mg / ml , phenobarbitone inj 200 mg 1 ml amp , phenobarbitone tab 30 mg 10 x 10 , phenytoin inj 50 mg / ml 2 ml amp , phenytoin / diphenylhydantoin tab 100mg 10 x 10 , sodium valproate tab 500 mg 10 x 10 , sodium valproate syrup each 5ml contains 200mg 200 ml bottle , valproate oral solution 200mg / 5ml 100 ml bottle , desferrioxamine injection 500 mg vial , naloxone inj 0.4 mg / ml 1 ml amp , pralidoxime ( pam ) inj 25 mg / ml 20 ml amp , abacavir tablet 300 mg 10 x 10 , acyclovir inj 250 mg / vial vial , acyclovir tab 200 mg 10 x 10 , acyclovir tab 800 mg 10 x 10 , albendazole 200mg / 5 ml 10 ml bottle , albendazole tab 400 mg 10 x 10 , amikacin inj 100 mg / 2 ml 2 ml vial , amikacin inj 500 mg / 2 ml vial2 ml vial , amoxycillin cap 250 mg 10 x 10 , amoxycillin cap 500 mg 10 x 10 , amoxycillin oral suspension 125 mg / 5 ml30 ml bottle , amoxycillin +clavulanic acid inj ( amoxycillin 500 + clavulanic acid 100 mg ) / vial , amoxycillin +clavulanic acid syp ( amoxicillin 200mg + clavulanic acid 28.5mg ) / 5ml 30 ml bottle , amoxycillin +clavulanic acid tab ( amoxycillin 500 + clavulanic acid 125mg ) 10 x 10 , amphotericin b injection 50 mg vial / ampoules , ampicillin cap 500 mg 10 x 10 , ampicillin inj 500 mg / vial , artesunate inj 60 mg / vial , artesunate powder for injection 120 mg , artesunate + sulphadoxine + pyrimethamine ( age group 15 or above ) ab artesunate 200 mg ( 3tab ) + sulphadoxine 750 mg ( 2tablets ) + pyrimethamine 37.5 mg ( 2 tab ) tablets ip1 combi pack , artesunate + sulphadoxine + pyrimethamine ( age group 9 to 14 years ) ab artesunate 150mg ( 3tab ) + sulphadoxine 500mg ( 2 tab ) +pyrimethamine 25mg tab ip ( 2tab ) 1 combi pack , artesunate + sulphadoxine + pyrimethamine ( age group between 1 4 years ) tab artesunate 50 mg ( 3 tab ) + sulphadoxine 500 mg ( 1 tab ) + pyrimethamine 25 mg ( 1 tab ) tablets ip 1 combi pack , azithromycin tab 250 mg 10 x 10 , azithromycin tab 500 mg 10 x 10 , azithromycin syp 200mg / 5ml 15 ml bottle , benzathine penicilline 6 lakh iu / vial , benzathine penicilline 12 lakh iu / vial , cefixime tab 50 mg 10 x 10 , cefixime tab 200 mg 10 x 10 , cefixime oral suspension 100mg / 5ml 10 ml bottle , cefotaxime inj 250 mg / vial , cefotaxime inj 500 mg / vial , cefotaxime inj 1gm / vial , cefpodoxime tab 200 mg 10 x 10 , ceftazidime powder for injection 250 mg , ceftazidime powder for injection 1gm , ceftriaxone inj 250 mg / vial , ceftriaxone inj 500 mg / vial , ceftriaxone inj 1 gm / vial , cephalexin cap 250 mg 10 x 10 , cephalexin syp 125mg / 5ml 30 ml bottle , chloroquine inj 40 mg / ml 5 ml amp , chloroquine syp 160mg / 10ml ( 50mg / 5ml base ) 60 ml bottle , chloroquine tab 250 mg 10 x 10 , ciprofloxacin tab 250 mg 10 x 10 , ciprofloxacintab 500 mg 10 x 10 , ciprofloxacin inj 200 mg / 100 ml 100 ml ffs bottle , clarithromycintablet 250 mg 10 x 10 , clindamycin capsule 150 mg 10 x 10 , clofazimine tablet 50 mg 4 10 x 10 , clofazimine capsule 100 mg 10 x 10 , clotrimazole ( vaginal tab ) pessary 500 mg ( with applicator ) single tab , clotrimazole cream 2%w / w 15 gram tube , cloxacillin capsule 125 mg 10 x 10 , cloxacillin capsule 500 mg 10 x 10 , cycloserine capsule 125 mg 10 x 10 , dapsone tablet 100 mg 10 x 10 , diethylcarbamazine tab 100 mg 10 x 10 , diethylcarbamazineoral liquid 120 mg / 5 ml , diloxanide furoate tablet 500 mg 10 x 10 , doxycycline cap 100mg 10 x 10 , doxycycline dry syrup 50 mg / 5 ml , fluconazole tab 150 mg 10 x 10 , furazolidone tab 100 mg 10 x 10 , gentamicin inj 40 mg / ml 2 ml amp , itraconazole tablet / capsule 100 mg 10 x 10 , ivermectin tab 12 mg 10 x 10 , levofloxacin tab 250 mg 10 x 10 , levofloxacin tab 500 mg 10 x 10 , linezolid tablet 600 mg 10 x 10 , meropenem 500 mg vial , metronidazole inj 500 mg / 100 ml100 ml ffs bottle , metronidazole tab 400 mg 10 x 10 , metronidazole oral suspension 200 mg / 5ml 60 ml bottle , norfloxacin tab 400 mg 10 x 10 , norfloxacin dispersible tablet 100 mg 10 x 10 , ofloxacin 200 mg 10 x 10 , ofloxacin 400mg 10 x 10 , piperacillin +tazobactam inj 4.5 gm / vial vial , primaquine tab 2.5 mg 10 x 10 , primaquine tab 15 mg 10 x 10 , primaquine tab 7.5 mg 10 x 10 , quinine inj 300 mg / ml 2 ml amp , quinine tab 300 mg 10 x 10 , sodium aminosalicylate granules 10 gm , sulfamethoxazole and trimethoprim tab800mg + 160mg 10 x 10 , sulfamethoxazole +trimethoprim tab200mg +40 mg 10 x 10 , sulfamethoxazole +trimethoprim oral liquid ( 200mg +40 mg ) / 5 ml 50 ml bottle , sulfamethoxazole+trimethoprim ( pediatric tablets ) tab 400 mg+80 mg 10 x 10 , tablet artemether ( a ) + lumefantrine ( b ) tablet 20 mg ( a ) + 120 mg ( b ) 1x6 tab , tablet artemether ( a ) + lumefantrine ( b ) oral liquid 80 mg ( a ) + 480 mg ( b ) / 5 ml , tablet artemether ( a ) + lumefantrine ( b ) tablet 80 mg ( a ) + 480 mg ( b ) , tablet penicillin v ( phenoxymethyl penicillin ) 250 mg , tinidazole tab 300 mg 10 x 10 , vancomycin powder for injection 1 g , vancomycin powder for injection 250 mg , vancomycin powder for injection 500 mg , flunarizine tablet 5 mg 10 x 10 , sumatriptan tablet 25 mg 10 x 10 , 5 fluro uracil 500 mg , bendamustine inj 100 mg , calcium leucovorin 50mg , capecitabine 500 mg , carboplatin 450 mg , cisplatin 50 mg , cyclophosphamide 500 mg , bleomycin inj 15 mg , docetaxel 120 mg , doxorubicin 50 mg , epirubicin 100 mg , bortezomib inj 2 mg , etoposide 100 mg , decarbazine inj 200 mg 10 mg / ml , erlotinib tab 150 mg , exemestine tab 25 mg , gemcitabine1.4 mg , fulvestrant inj 500 mg , imatinib mesylate 400 mg , gefitnib tab 250 mg , methotraxate 50 mg , oxaliplatin 100 mg , paclitaxel 260 mg , hydroxyurea cap 500 mg , ifosfamide inj 1 gm , tamoxifen 20 mg , irinotecan inj 100 mg , vincristin 1 mg , lenalidomide tab 25 mg , zoledronic acid 4 mg , letrozole tab 2.5mg , doxorubicin , pemetrexed inj 50 mg , pomalidomide cap 2 mg , rituximab inj 500 mg , sorafenib tab 200mg , sunitinib tab / capsule50 mg , temozolamide tab 250 mg , topotecan inj 4 mg , trastuzumab inj 440 mg , vinblastin inj 10 mg , vinorelbine inj 10 mg , trihexyphenidyl tab 2 mg 10 x 10 , levodopa ( a ) + carbidopa ( b ) tablet 100 mg ( a ) + 10 mg ( b ) cr 10 x 10 , levodopa ( a ) + carbidopa ( b ) tablet 100 mg ( a ) + 25 mg ( b ) cr 10 x 10 , levodopa ( a ) + carbidopa ( b ) tablet 250 mg ( a ) + 25 mg ( b ) 10 x 10 , diltiazem injection 5 mg / ml , adenosine inj 3 mg / ml 2 ml amp , amiodarone inj 50 mg / ml 3 ml amp , amiodarone tab 100 mg 10 x 10 , amlodipine tab 5 mg 10 x 10 , amlodipine tab 10 mg 10 x 10 , atenolol 100 mg 10 x 10 , atenolol tab 50 mg 10 x 10 , atorvastatin tab 10 mg 10 x 10 , atorvastatin tablet 40 mg 10 x 10 , chlorthalidone 12.5mg , chlorthalidone 25mg , clopidogrel tab 75 mg 10 x 10 , digoxin tab 0.25 mg 10 x 10 , digoxintab 250 mg 10 x 10 , diltiazem sr tablet 90 mg 10 x 10 , diltiazem tablet 60 mgl tablet 60 mgl 10 x 10 , diltizem tab 30 mg 10 x 10 , dobutamine inj 50 mg / ml 5 ml amp , dopamine inj 40 mg / ml5 ml amp , enalapril maleate tab 10 mg 10 x 10 , esmololinjection 10 mg / ml , finofibratetablet160 mg 10 x 10 , finofibrate tablet 40 mg 10 x 10 , hydrochlorothiazid tablet 12.5 mg 10 x 10 , hydrochlorothiazid tablet 50 mg 10 x 10 , isosorbide 5 mononitrate tab 20 mg 10 x 10 , isosorbide dinitrate tab 5 mg 10 x 10 , labetalol tab 100 mg 10 x 10 , labetalol inj 20 mg / 4 ml 4 ml amp , labetalol injection 5 mg / ml , methyldopa tab 250 mg 10 x 10 , metoprolol sr tab 25 mg 10 x 10 , metoprolol sr / plain tab 50 mg 10 x 10 , nifedipine cap 5 mg 10 x 10 , nifedipine tab 10 mg 10 x 10 , nitroglycerine ( glyceryl tri nitrate ) sub lingual tab 0.5 mg 10 tab , nitroglycerine ( glyceryl tri nitrate ) inj 25 mg / 5 ml 5 ml amp , noradrenaline inj 2 mg base / 2 ml amp. 2 ml amp , propranololtab 10 mg 10 x 10 , protamineinjection 50 mg / 5 ml , ramipril tab 2.5 mg 10 x 10 , streptokinaseinjection 15 lac / vialvial , telmisartan tab 40 mg 10 x 10 , verapamil tab 40 mg 10 x 10 , verapamilinjection 5 mg / 2 ml , urokinase ( 5 laciu ) vial , gum paint ( tannic acid ) 2% w / v 15 ml bottle , gutta percha ( gp ) 30tab / bottel , light cure composite , ketorolac10 mg tablet 10 x 10 , povidine iodine germicide gargle 20% w / v , gamma benzene hexachloride , benzoyl peroxide gel 5% , betamethasoneinjection 4 mg / ml 1 ml amp , betamethasone dipropionate ointment 0.05% 15 gram tube , calamine lotion 50 ml bottle , framycetin sulphate 1% cream 30 gram tube , fusidic acid cream / ointment 2% 5 gram tube , glycerin oral liquid , miconazole cream 2% w / w 15 gram tube , mupirocin cream / ointment 2% 5 gram tube , permethrin permethrin lotion 5% w / v ( 60 gm bottle , salicylic acid , silver sulphadiazine cream usp 1% 25 gram tube , haemodialysis fluid , intraperitoneal dialysis solution , bleaching powder containing not less than 30% w / w of available chlorine ( as per i.p ) containing not less than 30% w / w of available chlorine ( as per i.p ) 25 kg bag , cetrimide solution 20% ( concentrate for dilution ) , hydrogen peroxidesolution 6% , povidone iodine solution 5%, 100 ml bottle , povidone iodinevaginal pessary 200mg 10 x 10 , povidone iodine 5% ointment 15 gram tube , acetazolamide tab 250 mg 10 x 10 , furusemide tab 40 mg 10 x 10 , furusemide inj 10 mg / ml2 ml amp , hydrochlorothiazide tab 25 mg 10 x 10 , mannitol inj 20% 100 ml ffs bottle / 350 ml ffs bottle , mephentermine injection 30 ml vial mg / ml 10 ml vial , spironolactone tablet 25 mg 10 x 10 , xylometazoline nasal drops: adult ( 0.1% ) , boro spirit ear drops 0.183 gm boric acid in 2.08 ml of alcohol , normal saline nasal drops: sodium chloride drops 0.05% w / v , xylometazoline nasal drops 0.05 %, , turpentine oil 15% w / v 50ml bottel , wax solvent ear drops: benzocaine 2.7% w / v 10 ml bottel drop , wax solvent ear drops:paradichlorobenzene 2 % w / v 10 ml bottel , activated charcoal , hyoscine butylbromide 20mg / ml 1 ml vial / amp , tab mebeverine tab 200 mg 10 x 15 , bisacodyl tab 5mg10 x 10 , bisacodyl suppositories 5 mg 10 x 10 , dicyclomine hydrochloride inj 10 mg / ml 2 ml amp , dicyclomine hydrochloride tab 20 mg 10 x 10 , domperidone tab 10 mg 10 x 10 , domperidone 1mg per 1ml suspension , lactulose solution 10 gm / 15 ml , metoclopramide inj 5 mg / ml , metoclopramide tab 10 mg 10 x 10 , ondansetron tab 4 mg 10 x 10 , ondansetron inj 2 mg / ml 2 ml am , ondansetron syp 2mg / 5 ml 30 ml bottle , pantoprazole inj 40 mg / vial vial , rabeprazole tab 20 mg 10 x 10 , ranitidine tab 150 mg 10 x 10 , ranitidine inj 50 mg / 2 ml 2 ml amp , dicyclomine tablet 500 mg 10 x 10 , loperamide tablet 2 mg 10 x 10 , losartan 10 mg 10 x 10 , drotaverine inj 40 mg / 2 ml 2 ml amp , drotaverine tab 40 mg 10 x 10 , sucralfate syrup 1gm / 5ml 100ml bottle , sucralfatetablet 20 mg 10 x 10 , bicalutamidetablet 50 mg 10 x 10 , tamoxifen tablet 10 mg3 10 x 10 , ethinylestradioltablet 0.05 mg 10 x 10 , ethinylestradioltablet 0.01 mg 10 x 10 , empagliflozin 25 mg 10 x 10 , ethinylestradiol ( a ) + levonorgestrel ( b ) tablet 0.03 mg ( a ) + 0.15 mg ( b ) 10 x 10 , glibenclamidetablet 5 mg 10 x 10 , human chorionic gonadotropininjection 10000 iu vial of 1 ml injection , human chorionic gonadotropin injection 5000 iu vial of 2 ml injection , levonorgestreltablet 0.75 mg 10 x 10 , medroxyprogesteronetablet 10 mg 10 x 10 , medroxyprogesterone acetate injection 150 mg 1 ml / vial , methylprednisoloneinjection 1000 mg / ml vial , methylprednisolone tablet 16 mg 10 x 10 , methylprednisolonetablet 16 mg 10 x 10 , methylprednisolonetablet 4 mg 10 x 10 , ormeloxifenetablet 30 mg 10 x 10 , premix insulin 30:70 injection ( regular: nph ) 2 , premix insulin30:70 injection 40 iu / ml , sitagliptin tab 50 mg 10 x 10 , thinylestradiol ( a ) + levonorgestrel ( b ) tablet 0.03 mg ( a ) + 0.15 mg ( b ) with ferrous fumarate10 x 10 , metformin sr 1000mg 10x15 , pioglitazone 15mg , biphasic isophane insulin insulin biphasic aspart 30:70 100 iu / ml ( firm has to supply compatible pen along with cartridges as and when required without any extra cost ) ( 3ml cartridge ) , cartridges , carbimazole , carboprost ( 15 methyl pgf2a ) inj 250mcg 1 ml amp , clomiphene citrate 50 mg tab 10 x 10 , gliclazide tab 80 mg 10 x 10 , glimeperide tab 1 mg 10 x 10 , glimeperide tab 2 mg 10 x 10 , glucose packet 75 mg for ogtt test glucose packet 75 mg for ogtt test packet , insulin soluble inj 40 iu / ml 10 ml vial , levothyroxine tab 50 mcg 100 tab per bottle , levothyroxine tab 100 mcg 100 tab per bottle , metformin tab 500 mg 10 x 10 , iv human immunoglobin 5% iv ig ( 5mg / 100ml each ) , injection , anti d immunoglobulin for iv / im use ( monoclonal ) inj 150mcg 1 ml vial , anti d immunoglobulin for iv / im use ( monoclonal ) inj polyvalent 10 ml ( lyophilized ) inj 300mcg pfs / vial , anti snake venom , antitetanus immunoglobulins inj 250 iu / vial vial , hepatitis b immunoglobulin 100 iu / vial vial , rabies immunoglobulin 300 iu / 2 ml2 ml vial , rabies vaccine ( cell culture ) id / im inj 2.5 iu / ml 1 ml vial , formoterol inhaled bronchodilator , levosulbutamol 100 mcg , ambroxol hcl 15mg+terbutaline sulphate 1.25mg+guaiphenesin 50mg 5ml 15mg+1.25mg+50mg / 5m 100ml bottle , aminophylline inj 25 mg / ml 10 ml vial , bromhexine syp 4mg / 5ml 50 ml bottle , budesonide nebulising suspension containing budesonide 0.5 mg / 2 ml 2 ml amp , caffeine citrate inj 20 mg / ml 3 ml vial , deriphylline tablet sr 300 mg 10 x 10 , etophylline +theophylline tab 100 mg ( etophylline 77 + theophylline 23 ) mg 10 x 10 , etophylline +theophylline inj 220 mg / 2 ml ( 169.4+50.6 mg ) 2 ml amp , ipratropium inhalation ( mdi / dpi ) 20 mcg / dose ipratropium respirator solution for use in nebuliszer 250 mcg / ml , levosalbutamol 50mcg / dose , montelukastsyrup 60 ml bottle , montelukasttablet 5 mg 10 x 10 , salbutamol tab 4 mg 10 x 10 , salbutamol inhaler 100mcg / dose metered dose container , salbutamol syp 2mg / 5ml 60 ml bottle , syrup dextromethorphan syrup 10 mg / 5 ml 100 ml pack bottle , tiotropium inhalation ( dpi ) 18 mcg / dose , tiotropium inhalation ( dpi ) 9 mcg / dose , human albumin solution 5% bottel 250 ml , deferasirox tab 250mg 10 x 10 , dispersable tablet hydroxyurea 100 mg 10 x 10 , enoxaparin inj 40 mg equivalent to 4000 iu vial / pfs , erythropoietin injection 2000 iu / ml , erythropoietin injection 10000 iu / ml , ethamsylate tablet tab 250 mg 10 x 10 , heparin inj 1000 iu 5 ml vial , hydroxyureacapsule 500 mg 10 x 10 , inj. deferoxamine 500mg / vial vial , recombinant factor eight inhibitor bypassing activility ( feiba ) 500 units , recombinant factor ix 500iu , recombinant factor vii a 1 mg , recombinant factor viii 250iu , 500iu , tab. deferasirox tab 500 mg 30 tab , tab. deferiprone 500mg 10x10 , tranexamic acid inj 500 mg / 5 ml. , tranexamic acid tab 500mg 10x10 , warfarin tab 5 mg 10x10 , warfarin tablet 1 mg 10x10 , warfarin tablet 2 mg 10x10 , caffeine oral liquid 20 mg / ml , surfactant suspension inj 25 mg / ml 100 ml vial , donepezil tablet 5 mg 10 x 10 , water for injection , water for injection 5 ml amp 2 ml amp , disulfiram tablet 250 mg 10 x 10 , baclofen baclofen 40 mg tablet10 x 10 , duvadilan 10 mg10x50 , duvadilan inj 5mgvial , neostigmine inj 0.5 mg / ml 1 ml amp , vecuronium inj 2 mg / ml 2 ml amp , pilocarpine drops 4% 5 ml bottel , acyclovir ointment3% 5gm tube , atropine sulphate 1%, tube , 3 gm , carboxymethylcellulosedrops 0.5% 10 ml / vial , dexamethasone drop ( 0.1%, 5ml ) , eye drop 5ml eye drop , fluconazole eye drop 3 mg / ml ( 10 ml vial ) , eye drop10 ml eye drop , homatropinedrops 2% , lantanoprost 0.005% ( 5ml ) , eye drop 5ml eye drop , moxifloxacin 0.5% w / v ( 5 ml ) , eye drop 5ml eye drop , pilocarpinedrops 2% 5 ml bottel , pilocarpine drops 1% 5 ml bottel , prednisolone drops 1% 10 ml bottel , tropicamide drops 1% 5 ml drop , atropine 1% eye ointment 3 gram tube , atropine 1% eye drops 5 ml vial , chloramphenicol eye ointment 0.5% 4g / 5g tube , ciprofloxacin eye / ear drop 0.3% 5 ml vial , ciprofloxacin eye ointment 0.3% 3 / 3.5 gram tube , combo ear drop chloramphenicol 5% w / v +clotrimazole 1% +lignocaine hydrochloride 2% 5 ml drop , gentamicin ear / ear drop ( 0.3% ) 5 ml vial , timolol 0.5% eye drops 5 ml vial , codeine oral solution 15 mg / 5 ml 60 ml bottle , morphineinjection 15 mg / ml vial , morphine tablet 10 mg 10 x 10 , morphine tablet sr / 30 mg 10 x 10 , oxytocin injection 5 iu / ml injection 5 iu / ml1 ml ampule , drotaverine inj 40 mg / 2 ml 2 ml amp , methyl ergometrine maleate inj 0.2 mg / ml 1 ml amp , misoprostal tab 200 mcg 4 tab in 1 pack , combi pack with mifepristone + misoprostol ( 1 tablet of mifepristone 200 mg and 4 tablets of misoprostol 200mcg ) combi pack , methyl ergometrine maleate tab 0.125 mg 10 x 10 , mifepristone tab 200 mg 1 tab per pack , misoprostal tablet 100mcg 4 tab pack , misoprostoltablet 200mcg ( oral / vaginal ) 4 tab pack , risperidone 50 mg , alprazolam tab 0.25 mg 10 x 10 , chlorpromazine tab 100 mg 10 x 10 , clonazepam tablet 0.5 mg 10 x 10 , clozapine tablet 50 mg 10 x 10 , clozapine tablet 25 mg 10 x 10 , diazepam inj 5 mg / ml 2 ml amp , diazepam tab 5 mg 10 x 10 , escitalopram tablet 10 mg 10 x 10 , fluoxetine capsule 20mg 10 x 10 , fluphenazineinjection 25mg 1ml vial / ampoules , haloperidol inj 5 mg / ml 1 ml amp , haloperidol tab 5 mg 10 x 10 , imipramine tablet 25 mg 10 x 10 , lithium carbonatetablet 300 mg 10 x 10 , lorazepam tab 1 mg 10 x 10 , lorazepam inj 2 mg / ml , olanzapinetablet 5 mg 10 x 10 , olanzapine 10 mg 10 x 10 , phenobarbitonetablet 60mg 10 x 10 , promethazine injection 50 mg ( 25mg / ml ) 2ml vial / ampoules , risperidone tab 2 mg 10 x 10 , zolpidem 10 mg 10 x 10 , calcium gluconate inj 10% 10 ml vial , d 10 ( dextrose 10% ) iv fluid ( dextrose 10% ) 500 ml ffs bottle , d 25 injection ( dextrose ) iv fluid ( dextrose 25% ) 100 ml bottle , d 25 injection ( dextrose ) iv fluid ( dextrose 25% ) 500 ml bottle , dextrose 5% iv fluid ( dextrose 5% ) 500 ml ffs bottle , dextrose with saline i / v fluid ( dextrose 5% + saline 0.9% ) 500 ml ffs bottle , glucose ( a ) + sodium chloride ( b ) injection 5% ( a ) + 0.9% ( b ) 500ml ffs bottle , hydroxyethyl ( 6% saline solution for infusion ) starch 6%ip , pediatric solution like isolyte p, n / 2 & n / 5 pediatric solution like isolyte p, n / 2 & n / 5 100 ml bottle , potassium chloride oral solution 100mg / ml 200 ml bottle , reduced osmolarity ors pkt. who formula o.r.s. glucose 75meq, sodium 75m eq or m mol / l, chloride 65meq or m mol / l, potassium 20meq or m mol / l , citrate 10m mol / l osmolarity 245m osm / l, dextrose 13.5g / l sodium chloride 2.6g / l potassium chloride 1.5g / l, trisodium citrate dihydrate 2.9g / l+trisodium citrate dihydrate may be replaced by sodium hydrogen carbonate ( sodium bi carbonate ) 2.5g / l. sachet of 21.8gm , ringer lactate i / v 0.24 % v / v of lactic acid ( eq. to 0.32% w / v of sodium lactate ) , 0.6 % w / v sodium chloride, 0.04 %w / v potassium chloride and 0.027 % w / v calcium chloride 500 ml ffs bottle , sodium bicarbonate inj 7.5% w / v 10 ml amp , sodium chloride hypotonic inj n / 2 ( 0.45% ) 500 ml ffs bottle , sodium chloride isotonic inj 0.9% isotonic ( equivalent to na+154 m mol / l, cl+154 m mol / l ) 500 ml ffs bottle , sodium chloride isotonic inj 0.9% isotonic ( equivalent to na+154 m mol / l, cl+154 m mol / l ) 100 ml ffs bottle , nicotinamide tablet 50 mg7 10 x 10 , ascorbic acid ( vitamin c ) tablet 100 mg tablet 100 mg 10 x 10 , calcium carbonate .tab 500 mg 10 x 10 , calcium with vitamin d3 calcium equivalent to 500 mg & vit. d3 250 iu 10 x 10 , ferric carboxymaltose 250mg 10 x 10 , ferric carboxymaltose 50mg / ml 20 ml vial , folic acid tab 5mg 10 x 10 , iron & folic acid syp iron each 1 ml contains 20mg elemental iron+folic acid 100 ?g 50 ml bottle with dropper , iron & folic acid sugar coated iron folic acid sugar coated ( red tablet ) ferrous sulphate ip equivalent to60 mg elemental iron & 500 mcg folic acid ip 10 x 10 , iron & folic acid sugar coated iron folic acid sugar coated ( blue tablet ) ferrous sulphate ip equivalent to60 mg elemental iron & 500 mcg folic acid ip 10 x 10 , iron & folic acid sugar coated iron and folic acid sugar coated tab dried ferrous sulphate ip eq. to 45 mg ferrous iron and 400 mcg folic acid ip ( pink colored tab ) wifs junior ifa tablets 10 x 10 , iron sucrose inj 100 mg / 5 ml 5 ml amp , multivitamin sugar coated tab nfi formula sugar coated vit a 2500 iu , vit c 50mg, calcium pantothenate 1mg, vit b1 2 mg vit b6 0.5 mg vit d3 200 iu vit b2 2mg niacinamide 25mg folic acid 0.2mg. 10 x 10 , pyridoxine tab 10 mg 10 x 10 , pyridoxine tablet 40 mg 10 x 10 , pyridoxine tablet 100 mg 10 x 10 , riboflavin tablet 5 mg7 10 x 10 , thiamine injection 100 mg / ml , thiamine tablet 100 mg7 10 x 10 , vitamin a syp 100000 iu / ml with marked spoon for 1ml &2ml 100 ml bottle , vitamin k1 inj 1 mg / 0.5 ml 0.5 ml amp , vitamin. b complex tab nfi ( prophylactic ) b1 2 mg, b2 2mg, b6 0.5 mg, niacinamide 25 mg, calcium pantothenate 1 mg 10 x 10 , zinc sulphate tab dispersible 10mg 10 x 10 , zinc sulphate tab dispersible 20mg 10 x 10 , vitamin b12 inj, injection 500 mcg / ml ( 30 ml amp / vial ) , glacial acetic acid 99.99% 500 ml , visco pfs 3 ml prefilled syringe opthalmic , disposable gown , diclofenac+menthol 30 gm tube , cap antioxident 10x10 , tab. paracetamole 325 mg+ chlorpheniramine 4 mg + phenylepherine 10 mg 10x10 , syp diphynhydramine 100 ml , multivitamin drops 22 drops approx , material name , alkaline phosphatase 10x 22ml erba comfitable make , anti h span / tulip comfitable make , anti a1 lactin , anti d ( 1gg+2gm ) tulip / span / j.mitra comfitable make , anti ab anti sera span / tulip 10 ml comfitable make , ahg span / tulip vial comfitable make , abg cartiadge , albumine kit erba comfitable make , acitic acid 5% , acetone kit , bloting paper , bacilol , baby msks size 0, 1 , blood administration set , barium sulphate powder, susp. 95%w / v, powder ( hd ) 95% w / v 400 gram. , benedicts soluton ( qualitative ) 500 ml bottle , blood groupingseara antia, b&d ( 10 ml ) j.mitra / span / tulip comfitable make , blood lancet , blood bag 100 ml j.mitra / haemopack, hll life care comfitable make , blood bag 350 ml j.mitra / haemopack, hll life care comfitable make , blood bag 150ml ( single bag ) j.mitra / haemopack, hll life care comfitable make , blood bag 200ml ( single bag ) j.mitra / haemopack, hll life care comfitable make , blood cell counter key based gem , barium chloriad powder , barium chloriad ( 500 ml ) , brain tromoblastin for , b.t.c & c.t tube , basik fucksion powder , bruck sitrick , cidex , csf protien kit , csf suger kit , calcim reagent , crp kit ( agapee ) j.mitra / span qualicative 50 test kit comfitable make , crp kit 50 test kit erba comfitable make , cpk mb kit erba comfitable make rapid kit , capillaries ( serumbilirubinometer ) , capillaries ( wax ) , capillary tube for bt&ct , cover shlip ( 40gm ) , calorie meter , cyanemeth solution for hb ( drabkins solution , carbol fuchsin , culture media with nutrient agar high media company comfitable make , culture media with maconkey agar high media company comfitable make , culture media with blood agar high media company comfitable make , culture media with peptone water high media copany comfitable make , culture media with nutrient broth high media company comfitable make , culture plate , chikunguniya , counting numbers ( chekers ) , detaction for protien in urine ( uristixs ) 100strip , disposable cups for urine collection with screw cap , distilled water 5 letter , digital anyalytical balane 0.1gm to 160 gm , dengue card test span / j.mitra comfitable make , dropper rubber , drop mct oil , d.p.x. wax qualigence , esr tube , elisa plate reader with washer and printer , edta250 gm powder , e.d.t.a powder 500 gm , edta vial with screw cap , edta solution , electrolyte analyser reagents pack na+, k+ accurex enlite 2 para , electrolyte analyser reagents deproteinize , electrolyte analyser reagents riffil solution forna+, k+ and reffrence electrode , thermal paper roll for cell counter machine , electronic chemical weings scale , emmersion oil30ml , formaldehyde ( formalin ) 37% acq. 450 ml bottle , fliltter paper , field stain a qualigens , field stain b qualigens , forchest reagents 125 ml bottel , flask , flask , falckon tubecultre sterlized , glucose kit ( godpod ) , glutaraldehyde lotion 2% w / v stabilized 5 ltr. cans , glass droper , glass test tubes borosil glass 18 x 150 mm , glass piaptte , glass beaker 100 ml , glass beaker 200 ml , glass marking pencil ( white ) , glucometer sd company comfitable make , haemoglobin colour scale , heamocyto meter , glucometer stripsmorphan` comfitable make , glucometer strips acuchaklcomfitable make , glucometer stripssd company code free ivd , hydrogen peroxide sol. 20% w / v 1 ltr. bottle , h2so4 acid 20% , hb pipate , hb tube , hbsag card test rapiedj.mitra / span comfitable make , hdl chloleslestrol kit , h.c.v card rapid span / ing comfitable make , hdl kit erba comfitable make , hiv kit , hiv test card tridot flow through paste 3 dot span / j.mitra comfitable make , hematolgy cell counter reagents erma company pce 210 autodil er comfitable make , hematolgy cell counter reagents erma company pce 210 autolyse er comfitable make , hematolgy cell counter reagents erma company pce 210 autoclean er comfitable make , haemoglobin meter isi marked superior quality , hand sanitizer sterilium , incubator superior quality isi marked microbiology , listaman stain ( 500ml ) qualicative , laugles ioden , led bulb , lance paper , liquid hand wash , micropore , micro glass slide packet 50 slide packet , mp antigen test card for view for falciferum ozon / span / j.mitra comfitable make , malaria card test antibody j.mitra / span comfitable make , methylene blue , mithylated sprit100% , micropippate tips large , micropippate tips small , micropippate for analyzer erba company variable 5 50 comfitable make , micropippate for analyzer erba company variable 10 100 comfitable make , micropippate for analyzer erba company varialbe100 1000 comfitable make , micropippate for analyzer erba company varialbe 2micrlit. 1000 microlit comfitable make , multichanel pippate , n / 10 hcl , nitric acid 500 ml , new warce chamber , platilate diluting fluid , pt reagents span comfitable make , aptt reagents spancomfitable make , pandys reagent for csf , preganacy test strip 100strip , pasture piaptte ( borosil ) comfitable make , piaptte glass , phenol crystol , peatidisc large disposable , peatidisc small disposable , plain vial 12 x 75 with screw cap , permanentmarkers , pollythin 30 lit capacity , rapid pap kit span , rapid test kit for torch tes ( 1gm+1gg ) , r.b.c dilluting fluid ( 500 ml ) , r.a.factor 50 test kit qualicative j.mitra / span comfitable make , serum bluribine 4 x60 ml erbacomfitable make , serum bovine albumine 22% bsb span / tulip comfitable make , sodium citrate 3.8 % , sodium hypochlorid 5 lit jar , sulphuric acid ( 450 ml ) , serum tringlyieride ( 5x20ml ) , serum creatinine kit erba company 4 x60 ml comfitable make , serum protien kit erba comfitable make , staning rack , slide markers , slide stand , slide box 50 soidde , spirit lamp , sulpher powder , sulfuric acid 100% , semun diluting fluid , stop watch digtal , sypllis test card jaimitra / spam / biolab comfitable make , sputam cuntnar disposable , stickers ( blank ) 2x1 cm , twinket balt , taste tubeglass ( borosil ) 7.5x 12mm15 ml comfitable make , taste tubeglass ( borosil ) 7.5x 12mm5 ml comfitable make , tissue puper , teat rubber 1 ml , teat rubber 2 ml , teat rubber 5 ml , typhoid card test kitj.mitra / span comfitable make , torch test kit j.mitra / span comfitable make , t3, t4 tsh kit , test tube stand 10 holl , test tube stand 20 holl , thermocol box with packd , thermometer for water wath , triglyceride kit erba comfitable make , vdrl kit for sypllis comfitable make , vdrl kit j / mitra / span 50 test kit qualicative comfitable make , water wath , w.b.c dilluting fluid ( 500 ml ) , wbc diluting fluid 100ml , wintrob tube stand , xylene qualigens , zentition viloet 0.25% , zentition viloet 0.5% , zn stain , feeding tube for infant no. 6 , oxygen mask child , oxygen mask adult , cord clamp dispossable , plastic tubs , reagents for semi auto anyalyzer erba company , blood glucose kit erba company 50 test kit comfitable make , blood urea kit erba company 50 test kit comfitable make , sgpt test kit erba company 50 test kit comfitable make , sgot test kit erba company 50 test kit comfitable make , g6pd test kit erba company 50 test kit comfitable make , blood grouping sera 5 ml anti ab&d set j.mitra / span / tulip comfitable make , widal test kit erba company 50 test kit comfitable make , vdrl test kit erba company 50 test kit comfitable make , cholestrol kit erba company 50 test kit comfitable make , austrailia antigen card test , rpr kit for syplis 50 kit , lead protection partion , lead letters , lead protective barrir , lead goggle , lead protectvie apprean , lead rubber glove , lead gonad shield , intcifying screen kiren high speed comfitable make , intcifying screen kiren high speed comfitable make , intcifying screen kiren high speed comfitable make , intcifying screen kiren high speed comfitable make , xray castetes kiran, kr8 , xray castetes , xray castetes , xray castetes , xray hangers , xray hangers , xray hangers , xray hangers , x ray film 50 sheet packet , x ray film 50 sheet packet , x ray film 50 sheet packet , x ray film 50 sheet packet , x ray dental film 50 sheet packet , x ray developerpowder , x ray developerpowder , x ray fixerpowder , x ray fixerpowder , x ray view box , xray safe light , absorbent cotton wool ip 500 gm paket , absorbable gelatine sponge ip 66 80mm x 50mm x 10 mm , adhesive plaster usp 7.5 cm x10mts / roll , adhesive plaster usp 7.5 cm x5 mts roll , bismith lodoform paraffin paste , boric acid with sprit drop , b.b silk with 1 / 2 cir rb needle 20 mm length 75 cm no 1 , b.b silk with 1 / 2 cir rb needle 20 mm length 75 cm no 1 / 0 , b.b silk with 1 / 2 cir rb needle 20 mm length 75 cm no 2 , b.b silk with 1 / 2 cir rb needle 20 mm length 75 cm , b.b silk with 1 / 2 cir cutting needle 20 mm length 75 cm no 1 , b.b silk with 1 / 2 cir cutting needle 20 mm length 75 cm no1 / 0 , b.b silk with 1 / 2 cir cutting needle 20 mm length 75 cm no 2 , b.b silk with 3 / 8 cir rb reverse 2 / 0 cutting needle 45 mm length 76cm , b.b silk6 reels x 25 mts length 25 mts , cotton roll100 gm , cresol with soap sol. 5 ltr. cans , chromie with cd. rb needle 40 mm length 75cm , catgut chromic with 1 / 2 cir rb needle 40 mm length 95cm no. 1 , catgut chromic with 1 / 2 cir rb needle 40 mm length 95cm no. 1 0 , catgut chromic with 1 / 2 cir rb needle 40 mm length 95cm no. 2 , catgut chromic with 1 / 2 cir rb needle 40 mm length 95cm no. 2 0 , catgut chromic with cd cutting needle 12 mm length 70cm no. 1 , catgut chromic with cd cutting needle 12 mm length 70cm no. 1 0 , catgut chromic with cd cutting needle 12 mm length 70cm no. 2 , catgut chromic with cd cutting needle 12 mm length 70cm no. 2 0 , crap bandageall sizes , poly propylene with 1 / 2 cir rb needle 30 mm length 70 cm , poly propylene with 1 / 2 cir rb needle 40 mm length 70 cm , poly propylene with 1 / 2 cir rb heavy needle 30 mm length 70 cm , poly propylene with cutting needle 45 mm lengyh 100 cm , poly propylene with curved 8 / 0 rb bv double needle 7.6 mm length 60 cm , disposable syringe with needle cgs 1cc with mark 0 1ml , disposable syringe with needle cgs 2cc , disposable syringe with needle cgs 5cc , disposable syringe with needle cgs 10cc , disposable syringe with needle cgs 20cc , disposable syringe with needle cgs 50cc , disposable suction cather size: 12, 14 , disposable scale vein set size 20g , disposable scale vein set size 22g , disposable needle 18 g ( single use ) , disposable needle 20 g ( single use ) , disposable needle 22 g ( single use ) , disposable needle 23g ( single use ) , ecg gel 250 ml bottle , ecg paper80mm x 20mts for manual ecg machine bpl company 6208 view / view plus chemical red comfitable make , ecg paper 50mm x 20 mts computerzed for computer bpl company 6108tchemical blue comfitable make , endotracheal tube no 2.5 , endotracheal tube no 3 , endotracheal tube no 3.5 , endotracheal tube no 5 , endotracheal tube no 7 , endotracheal tube no 8 , foleys urinaty catheter size 8 ( 2way ) , foleys urinaty catheter size 10 ( 2way ) , foleys urinaty catheter size 14 ( 2way ) , foleys urinaty catheter size 16 ( 2way ) , foleys urinaty catheter size 18 ( 2way ) , foley balloon cather three way ( a ) fg 24 , glycerinc ip 30 ml plasric bottle , gention violet paint 0.5% 100ml bottle , hmf sachet , iv cannula ( two way ) size 18 , iv cannula ( two way ) size 20 , iv cannula ( two way ) size 22 , iv cannula ( two way ) size 24 , iv cannula ( two way ) size 26 , i.v. cannula sizes 23 two way , intravenous set ( adult ) with airway and needle , intravenous set ( children ) with airway and needle , infant mucus extractor , infant feeding tube ( catheter ) 8 g , infant feeding tube ( catheter ) 10 g , infant feeding tube no. 3.5 , infant feeding tube no. 7 , liquid paraffin ip 500 ml bottle , liqued stesimox , lysol , mackintosh double colour water proof , micro drip set , metrasses 3×6 with raxine cover 4 density , metrasses 2 5×4 with raxine cover 4 density for child bed , needle hypodermic insulin needle ( metallic non sterile ) size 26 gx1 / 2 , nasal prom for neonatiol , n 95 mask for swine flue , disposable mask , l.p. needle no. 22 , l.p. needle no. 23 , oxygen catheter , oxyzen flowmeter regulator , oxygen tube , plaster of paries 1kg pkt.isi qulity , paper adhesive plaster 1x9.0 mts , p.o.p. bandag 6 inch , p.o.p. bandag 4 inch , peadiartic chamber set 110 ml , pressure monitoring line , pvc apron , ryles tube ( p.v.s ) childrn size 10, 12 , ryles tube ( p.v.s ) adult size 16, 18, 14 , sanitary pads , slippers all sizes , sterile gloves size 6 isi marked , sterile gloves size 6 1 / 2 isi marked , sterile gloves size 7 isi marked , sterile gloves size 7 1 / 2 isi marked , surgical blade size 11, 100 blade per packet , surgical blade size 15, 100 blade per packet , surgical blade size 21, 100 blade per packet , surgical blade size 22, 100 blade per packet , surgical blade size 23, 100 blade per packet , suture needles curved &1 / 2 circle cutting assorted sizes 1 5 , suture needles curved &1 / 2 circle cutting assorted sizes 6 10 , suture needles curved &1 / 2 circle cutting assorted sizes 11 15 , suture 10 0 nylone , suture 8 0 silk , suture 5 0 mono phalment , suction catheter no.7 green , suction catheter no.8 green , suction catheter no.16 green , suction catheter no.14 green , scalp vein set ( single use diposable ) size 23 gauge , scalp vein set ( single use diposable ) size 24 gauge , spoon marked 1 ml / 2 ml plastic , surgical spirit 100 ml bottle , sterlium hand wash , three way connector , tincture benzoin co. 500 ml bottle , ultra sonogram gel 250 ml bottle , urinary drainage bag , volium drip set , vicryl no.1 polyglyoviont 1 / 2 cir needle 95 cm , vicryl no.1 0 polyglyoviont 1 / 2 cir needle 95 cm , vicryl no.2 polyglyoviont 1 / 2 cir needle 95 cm , wax dissoluent , pamper for children , oxygen key , tab. chlorine 500 mg isi marked , tab. water purifying 4 gm , montex test 2 tu , montex test 5 tu , 1 twv csx ¼ftlessa vanj dh vksj ls , e vks , p , qq mcy;w@, q ih ds yksxks yxk, tk, xsaa½ 2 iseiysv nis gq, ¼lwpuk i= uofookfgr naifr ds fy, tkudkjh ½ 3 lksan;z lkexzh@ lopnrk csx ¼ deiyhv csx fueu lkexzh dk uke& rksfy;k lsv nksvk ] da?khfcanhirrk ] usy dvj ] nks lsv :eky ] lsusvjh usifdu isdsv vksj khkk nksvk ½ lfgr 4 tkudkjh dkmz nik gqvk ftlesa { ks=h; vkkk rfkk , , u , e dh laidz dh tkudkjh 5 lwpuk i= ¼xhkz izjh { k.k fdv ds mi;ksx laca / kh funszk ij iw.kz lwpuk i=½ , d.mkse ckwdl ¼fvu½ , d.mkse ckwdl ¼qkbzcj½ , d.mkse ckwdl ¼ydm+h½ , osusvh ckwdl ¼fvu ½ , lsusvªjh usifdu isdsv 10 ihl , lsusvªjh usifdu isdsv 12 ihl , vkbzmsauvh fqdsku vsx qkwj u;w cksuz , vkbzmsauvh fqdsku vsx qkwj enj , digital wrist watch , digital thermometer , neonatal / infant weighing scale with sling , warm sleepig bag for neonates , blankets for neonates , mucus extractr , baby feeding spoon , torch with cells , bag for carrying kit / material during home visit , heamocheck book with strip complete , hemax cell cleaner 1 litre , hemax diluent 20 litre , hemax lyse 500ml , amber colored bottle 2 lit. , amber colored bottle 3 li. , ethanol absolute alcohol 500 ml , hcl 500 ml , diamond marker , tissue paper , auramine powder 25 gm , lense paper , thermacol box , sputum container , micro glass slide , forcep steel , weighing machine digital , water bath , paraffin role , spirit rectified 1 lit. , slide box 100 slide per box , glass beaker 200 ml , glass beaker 100 ml , permanent marker , slide rack , n / 95 mask , long stool lab , vinelands social maturity scale ( indian adaptalaion ) with manual , 16 pf questionnaire of age 16 and older with sheets with manual , binef kamath test of intelligence with manual , thematic apperception test ( indian adaption ) with manual , rorhchacs ink blot test cauds with location charts , nimhans neuro psychological battery for adult with manuals , nimhans index of sld with manuals , crescent blade , keraton ( 3.2 ) , disposable gown , vergin silk 8.0 black ( 1x12 ) , vergin silk 10.0 black ( 1x12 ) , vicryl 8.0 ( 1x12 ) , dark glass , cornear scissor , capsulereris forceps , scissor plain 4 inch , surgical blade 11 no. , side port , air cannula 27 g , fine port irrigaling vetis wire , banass scissor , trypan blue solution , propaciane hcl opthalmic solution , tropicaciyl plus eye drop , inj hyaluronidase ip 1500 iv , inj senscerocaine 0.5 1% , weight machine adult , scissor plain , artery forcep , tooth forcep , needle holder , oxygen flowmeter , cheatle forcep , sponge holdig forcep , bleaching powder 1 kg , stethoscope , labour ot fogging machine , ambu bag , cervical collar high neck , head mobilizer , fire extinguisherco2 2 kg , yoga mate , airotor hand piece , ultrasonic scaler , forcep ( set of 10 pieces ) , periosteal elevator , mouth mirror , sickle porpe , alginate , k file no. 10, 20 , 15, 25 , h file no. 15, 20, 25, 10 , formalin chamber , uv chamber , compressor , fracture plate , putty impression , zoe impression paste , upper & lower impression paste , abx diluent 20 lit can { horiba } , abx diluent 1 lit can { horiba } , white diff 1 lit { horiba } , abx minocleaner 100 ml { horiba } , printer ink modal h.p. tank4 bottel 3019 , t3 icromax , t4 icromax , tsh iromax , blood sugar erba , serum billirbin erba , blood uria erba , sgpt erba , sgot erba , uric acid erba , alkaline phosphate erba , total protin erba , hdl erba , total cholestrol erba , albumin erba , triglistride erba , diluent 20 lit hemax , :yse 500 ml hemax , cell cleaner e.z. 1 lit hemax , cleaner 100 ml hemax , printer |roll size 55 mm , printer roll size 50 mm , vtm kit 50 test / kit , standard q covid test card 25 test card / kit , face shield , ice gel pack 8x10 cm , brown tape 6 inch , zipper polythene 8x10 cm , polythene 1 kg red / black , sanitizer 100 ml , sanitizer 500 ml , shoe cover , disposable bed sheet , dead body suit , thermal scanner , pulse oxymeter , ppe kit , surgeon cap , disposable kelleys pad , latex examination gloves large 100 gloves / pkt , goggles , microglass slide blue star 50 slide / pkt , sanitiry napkin 8 pad / pkt , cough syrup sugar free 100 ml , tab vitamin c 500 mg sugar free , ct scan film 8x10 konica minolita , ct scan film 14x17 konica minolita , ct scan film 11x14konica minolita , shaving blade , ct scan film 10x12konica minolita...

Public Health Engineering Department - Madhya Pradesh

33739552 tender and contract for supply of glassware material for division and subdivision lab damoh , tender and contract for supply of glassware for division and subdivision lab damoh , automatic burettes with reservoir capacity 2000 ml , cap. 50ml lc 0.1 ml, class a with nabl calibration certificate , automatic burettes amber with reservoir capacity 2000 ml , cap. 50ml lc 0.1 ml, class a with nabl calibration certificate , pipette, transfer volumetric with one mark type , cap 1 ml, class a with nabl calibration certificate , pipette, transfer volumetric with one mark type , cap 20 ml, class a with nabl calibration certificate , pipette measuring graduated mohrtype, capacity 10 ml, class a with nabl calibration certificate , volumetric flask 50 ml class a with nabl calibration certificate , volumetric flask 100 ml class a with nabl calibration certificate , pipette measuring graduated mohrtype, capacity 2 ml, class a with nabl calibration certificate...

Bhopal Municipal Corporation - Madhya Pradesh

33717436 2nd call nit no 39 year 2022 23 purchasing of glass ware for water treatment plant kolar lab year ( 2022 23 ) , purchasing of glass ware , beaker low form size 100 ml, make borosil / riviera / jsil , beaker low form size 250 ml make borosil / riviera / jsil , beaker low form size 500 ml make borosil / riviera / jsil , beaker low form size 1000 ml make borosil / riviera / jsil , b.o.d. bottles size 125 ml make borosil / riviera / jsil , b.o.d. bottles size 300 ml make borosil / riviera / jsil , burettes with boroflo stopcock, class a size 10 ml, make borosil / riviera / jsil , burettes with boroflo stopcock, class a size 25 ml, make borosil / riviera / jsil , burettes with boroflo stopcock, class a size 50 ml, make borosil / riviera / jsil , cylinders nabl certified, class a size 250 ml, make borosil / riviera / jsil , cylinders nabl certified, class a size 500 ml, make borosil / riviera / jsil , cylinders nabl certified, class a size 1000 ml, make borosil / riviera / jsil , volumetric flasks with interchangeable solid glass stopper class a, narrow mouth size 100 ml, make borosil / riviera / jsil , volumetric flasks with interchangeable solid glass stopper class a, narrow mouth size 250 ml, make borosil / riviera / jsil , volumetric flasks with interchangeable solid glass stopper class a, narrow mouth size 500 ml, make borosil / riviera / jsil , volumetric flasks with interchangeable solid glass stopper class a, narrow mouth size 1000 ml, make borosil / riviera / jsil , erlenmeyer conical flask narrow mouth with rim size 50 ml, make borosil / riviera / jsil , erlenmeyer conical flask narrow mouth with rim size 100 ml, make borosil / riviera / jsil , erlenmeyer conical flask narrow mouth with rim size 250 ml, make borosil / riviera / jsil , erlenmeyer conical flask narrow mouth with rim size 500 ml, make borosil / riviera / jsil , quantitative filter papers ashless grades, grade 41: 20?m, 12.5 cm ( 125mm ) cat no 1441 125, pk 100 no, hsn code 48232000, make whatman , quantitative filter papers—ashless grades, grade 42: 2.5?m, 12.5 cm ( 125mm ) cat no 1442 125, pk 100 no, hsn code 48232000, make whatman , cotton bundle , extran® ma 02 neutral cat no 60755350001730, pk 5 lit , make merck , gst as per applicable...

Bhopal Municipal Corporation - Madhya Pradesh

33715439 purchasing & lab instrument for kolar laboratory year (2022 23) purchasing & lab instrument , uv visible spectrophoto meter make systronics / merck / supelco specifications wave length 190 1100nm , accuracy ±0 .1nm resolution 1.0 nm, bandwidth 1.0nm cuvette holder 50mm path length with display with calibration certificate , light source tungsten / deuterium / xenon flash lamp supplied with two pair of cuvette 50mm and 10 mm , turbidity meter nephelo meter direct turbidity range 0 100 with turbidity tube 04no. make –systronics / merck / eutech , ph meter make systronics / merck / supelco specifications range 0 14 ph calibration 5 point / 3point slop 85% to 115% including electrode and temperature probe , micro controller based conductivity tds with cells ( nabl cat no 103082 , model no 308, hsn code – 90278090, make –systronics , glass cuvette for spedtrophoto meter, pk 02 no , glass cuvette for turbidity meter, pk 02 no , glass body ph combination electrode, reference double junction , ag / agcl sealed, 12 x 120 mm, bnc connector, 1m cable length cat no 8034 015, product code ec620131, make eutech , all glass filter assembly complete set cat no 73200 544, make riviera specifications filter size : 47mm dia. effective filteration area : 9.60 cm2 filter flask capacity : 1000 ml funnel capacity : 300 ml spring clamp : anodised aluminium pressure : vacuum only , vacuum pr.pump, 4bar 220v / 50hz cat no xi0422050, make merck / riviera / millipore , dissolved oxygen lab do 745 cat no 285206800wt, make merck / xylem / supelco specifications measuring range 0...200 %; 0…..20 mg / l; temp 10….100°c resolution : 1%; 0.01 mg / l’ 0.1°c temp compensation : automatic with ntc0kohm or fixed temp accuracy :±1 digit, ±0.5% of the measuring range, t ( °c ) ± 0.1 ( 5...50°c ) connectors : 8 pol sensor socket, 4 pol usb interface socket calibration : direct input, temperature offset, single –point, automatic data storage : 4.000 entries with date, time, value 1+2 and temperature , gst as per applicable...

Department of agriculture cooperation and farmerswelfare - Madhya Pradesh

33695042 bids are invited for water condenser 90 cm , conical flask 250 ml capacity , flat bottom flask 02 liter capacity , burette 50ml capacity , burette 25ml capacity , beaker 1000 ml capacity , beaker 500 ml capacity , beaker 100 ml capacity , beaker 50 ml capacity , beaker 25 ml capacity , measuring cylinder 25ml capacity graduated , measuring cylinder 50ml capacity graduated , measuring cylinder 100ml capacity graduated , trap of dean and stock apparatus trap only , rm flask300ml , volumetric flask 500ml capacity , magnifying glass , pipette graduated 10ml capacity , soxhlet extractor only , specific gravity bottle capacity 50ml with thermometer 0 to50 degree celcius , still head , bottle capacity 250ml , bottlecapacity 100ml , iodine flask 500ml capacity , volumetricflask 25ml capacity total quantity : 113...

Department Of Revenue - Madhya Pradesh

33674414 bids are invited for 9v 1216 9 volt battary , 24 by 6 stepler pack , a3 size paper , a4 paper , aa size 1012 heavy duty leak proofll , aaa size 1015 heavy duty leak proofll , all out , aluimium foil roll , black hit , bone china gold line tea cup white 06 pc set , bottle plastic , box file , brass scissors heavy duty , brass tourch led type , carbon pkt , cello tape 2 inch brown , cello tape 2 inch white , cello tape1 inch , cello tape1 by 2 inch , chaku file , computer ups , correction pen , cotton napkin , dak folder , double punch , dusing cloth , dust been , dust pan supre steel , electric cattle , extension board , fevistick , file tag , flightier fluorescent pen , glass and house hold cleaner , good night machine , goonight rifile , hit spry , hot spot wif conector , key board , liquid ball pen eye and fine uni , lock with 03 key , marker ohp , medical bill form set 100 page , mouse , mouse pad , notepad , note sheet , pen roller jet , pen roller jet refile , palstictray , paper flag , paper wieght , pen drive 64gb , penodinary , pen odinary black , pen odinary red , pen odinaryrefile , pen stand , pencil , pencil eraser , pencil sharpner ,plastic compas box , register 6quire , room freshner ,rubber band pkt , rubber stamp , scale steel , scissor 8inch big tip , seek broom , single punch , stainless steelthermos push button thermo flask , stamp pad big , stamppad ink , staper big size , stapler small , stepler pin 10no ,stepler pin big , thermous 500ml , tissue paper , towel ,trimax pen , trimax pen refile , u pin , umbrella , urinal potpipie , washing powder , water mug , wiper full size 36 inch, odo mass , i.o.n book , trimax pen , thread heavy total quantity : 2200...

National Fertilizers Limited - Madhya Pradesh

33667446 supply of vibrating machine , nfl material code:bfi000318 vibrating machine specifications for vibrating machine / heavy duty continuous shaker the specifications for robust construction vibratingmachine areas follows : platformsize :1500x 1500 mm. arrangementof 36 nos of 5000 ml broil flasks / bottles on platform of single tier. platform revolving speed from 100 to 150 r.p.m. for shaking 36 nos of flasks. speed ( midium & low ) adjustable regulator and should be linear type for smooth regulation of speed.operating voltage :a.c. 230 volt, 50 hz motor :double speed induction motor heavy duty continuous rating motor. power : as per requirement ofabove machine voltage:230 + 10%. frequency: 50 hz + 3% .enclosure :ip 55 tefcinsulation class :f / standard duty: continuous vibration:low.noise: low.machine is required as f.o.r nfl biofertilizer plant vijaipur. packing should be soundenough to avoid any damages in transit. party should install the machine at our site. party should also provide guarantee certificate for minimum 12 months from the date of successful installation. details specification shall be as per annexure a => limited...

Public Health Engineering Department - Madhya Pradesh

33598150 supply of chemicals instruments for sub divisional laboratory khilchipur distt.rajgarh 1 automatic butette amber colour zero accuracy as per class a with reservoir, rubber bellow glass stopcock, reservoir capicity 2000 ml, burette capicity 50 ml graduation interval 0.1 ml tolerence 0.05 ml with nabl calibration certificate. 2 automatic butette plan zero accuracy as per class a with reservoir, rubber bellow glass stopcock, reservoir capicity 2000 ml, burette capicity 50 ml graduation interval 0.1 ml tolerence 0.05 ml with nabl calibration certificate. 3 measuring pipette mohr type class a capicity 1 ml, graduation interval 0.1 ml with individual calibration certificate from nabl 4 measuring pipette mohr type class a capicity 2 ml, graduation interval 0.1 ml with individual calibration certificate from nabl 5 measuring pipette mohr type class a capicity 5 ml, graduation interval 0.1 ml with individual calibration certificate from nabl 6 measuring pipette mohr type class a capicity 10 ml, graduation interval 0.1 ml with individual calibration certificate from nabl 7 volumetric pipette class a capicity 1 ml with calibration certificate from nabl 8 volumetric pipette class a capicity 2 ml with calibration certificate from nabl 9 volumetric pipette class a capicity 5 ml with calibration certificate from nabl 10 volumetric pipette class a capicity 10 ml with calibration certificate from nabl 11 volumetric pipette class a capicity 25 ml with calibration certificate from nabl 12 volumetric pipette class a capicity 50 ml with calibration certificate from nabl 13 volumetric pipette class a capicity 100 ml with calibration certificate from nabl 14 volumetric flask 50 ml a class with calibration certificate from nabl 15 volumetric flask 250 ml a class with calibration certificate from nabl 16 measuring cylinder hexagonal base 50 ml a class with calibration certificate from nabl 17 measuring cylinder hexagonal base 100 ml a class with calibration certificate from nabl 18 conical flask, cap. 250ml flat round botom class a, make borosil 19 nessler cylinder class a cap. 50 ml with nabl certificat make borosil 1 digital hydrometer with nabl certified 2 glass hydrometer with nabl certified 3 glass thermometer (1 to 100)ºc 4 analytical weight box with nabl certified 5 electronic balance 4 digit with nabl certified 6 visi cooler 320 ltr 7 safety shower well mounting 8 first aid box wall mounting 9 lab safety goggle 10 fire extinguisher 11 liquid hand wash 200ml packing 12 eye washer 13 tissue paper roll 14 hand gloves 15 distilled water grade i 16 air conditioner 1.5 ton bis as per required 17025 17 burette pump 18 sulphuric acid n/20 solution 19 sodium thio sulphate 20 universal ph indicatar solution (b)crm 1 calcium standard 2 sodium carbonate standard (alkalinity standard) 3 chloride standard 4 ph buffer 4.0 5 ph buffer 7.0 6 ph buffer 9.0 7 turbidity standard ntu 8 conductivity standard 1416 9 conductivity standard 1000 10 colour standard...

Department of Higher Education - Madhya Pradesh

33579273 bids are invited for boq1 water bath 6 holes , boq2 uv visible spectrophotometer single beam , boq3 chemical blance digital , boq4 digital blance , boq5 stabilizer 5kva , boq6 chemical cabinet storage , boq7 rotary vane vaccume pump , boq8 oil free vacuum pump , boq9 muffle furnace , boq10 refrigerator , boq11 thermostatic water bath , boq12 digital melting pint apparatus , boq13 digital ph meter , boq14 u contoroller based conductivity meter with cell and temp , boq15 heating mantal , boq16 high precision water bath , boq17 digital photoelctric colorimeter , boq18 karl fisher titrator , boq19 magnetic stirrer , boq20 autoclave portable , boq21 double distillation unit 2 , boq22 hot air oven 2 , boq23 heating mantle , boq24 muffle furnace , boq25 hot plate , boq26 magnetic stirrer with hot plate , boq27 laboratory stirrer , boq28 water bath 12 holes , boq29 betrological incubator , boq30 centrifuge machine , boq31 electronic balance , boq32 electrophoresis unit , boq33 micropipette , boq34 chemistry models , boq35 ammeter , boq36 digital conductivity meter , boq37 digital photo colorimeter , boq38 digital colony counter , boq39 dissolved oxygen meter , boq40 watersoil testing kits , boq41 digital flame photometer , boq42 digital spectrophotometer , boq43 flask shakerwrist action type , boq44 student polarimeter , boq45 vortex mixer , boq46 chemistry maps , boq47 beaker each , boq48 conical flask each , boq49 measuring cylinder , boq50 volumetric pipette , boq51 round bottom single , boq52 round bottom flask double , boq53 burette , boq54 graduated pipette , boq55 volumetric flask , boq56 burners , boq57 petri dish3 , boq58 tripod stand , boq59 condensers , boq60 wire guage , boq61 burette stand , boq62 test tube box , boq63 test tube stand , boq64 morter and pestleglass , boq65 morter and pestle porcelain , boq66 clamp and boss head , boq67 seprating funnel , boq68 slides and coverslips , boq69 dessicatorglass , boq70 droppers , boq71 kipps apparatus , boq72 spatula , boq73 thermometer , boq74 watch glass , boq75 weighing bottle , boq76 laboratory chemicals set , boq77 computer , boq78 interactive pannel 65inch total quantity : 516...

Public Health Engineering Department - Madhya Pradesh

33575542 supply of various laboratory glassware items for water testing laboratory at public health engineering subdivision pandhana , volumatric flask 50 ml class a with nablcalibration certificate , volumatric flask 100 ml class a with nablcalibration certificate , volumatric flask 500 ml class a with nablcalibration certificate , volumatric flask 1000 ml class a with nablcalibration certificate , automatic buratte plain with 2000 ml reservoir rubber bellow cap 25 mlnabl certified , automatic buratte amber colour with reservoir rubber belowreservoir capacity 2000ml cap. 50 mlwith nabl calibration certificae with 2000 ml reservoir rubber bellow cap 25 mlnabl certificate , volumetric pipette cap. 50.0 mlwith nabl calibration cerificate , measuring cylinder size 50.0 ml with nablcalibration certificate , measuring cylinder size 100.0 ml with nablcalibration certificate , volumetric pipette cap. 10.0 mlwith nabl calibration cerificate , lab coat ( apron ) half seleevs for man for laboratory use , 1000ml cap narrowmouth bottles pp confirming to uos class vi ( 24 no. in one pack ) , lab safety goggles , instant alcohol germ protection hand sanitizer kill 99.9 percent of germs without water200 ml pack , liquid handwash be 100 percent sure protect against 100 illnes scausing germ 200 ml pack , non contact infrared forehead therma meter ( temparature gun ) for screening , pipette, measuring graduated mohr type cap 10 ml, class a with calibrate nabl certificat...

Indore Municipal Corporation - Madhya Pradesh

33397862 supply of required instruments and glassware for existing lab at mushkhedhi project office of indore municipal corporation to meet the nabl accredited norms , supply of required instruments & glassware for existing lab at mushkhedhi project office of indore municipal corporation to meet the nabl accredited norms , providing and installation of laboratori refrigerator ( visi cooler ) 325 litre capacity with a glass door for convenient sample viewing, forced air circulation system, digital controller for internal temperature display ( should be nabl accredited & calibration certificate of nabl lab ) , plastic inner chamber, prepainted outer body and with dual glass etc, complete. , providing , supply & installation of digital hydrometer for specific gravity: density :0.000 2.000g / cm3 sample temperature:01 40c ( 321 104f ) viscosity: 0 2000mpa. with installation with nabl calibration certificate. with two years amc & two year guarantee. , providing , supply & installation of humidity and temperature meter ( hygro meter ) , dual and large display, for humidity and temperature, range 0 100%. rh resolution 0.1%, temperature range 0 60 c with carrying case, manual, temperature probe. with installation with nabl calibration certificate. with two years amc & two year guarantee. , providing , supply & installationweight box capacity from 1mg to 200 gram with nabl calibration certificate with two years amc & two year guarantee. , providing , supply & installation water purification unit for production of class a reagent grade 1 water pack 5ltr as per is 1070:92 with nabl calibration certificate with two years amc & two year guarantee. , supply of magnetic stirrer 2 litre capacity digital speed indicator as per is 1070:92 with nabl calibration certificate with two years amc & two year guarantee. , supply of ammonia high performance lon selective electrode diameter body 12mm material epoxy as per is 1070:92 with nabl calibration certificate with two years amc & two year guarantee. , volumetric flask borosilicate with stopper a class cap 50 ml calibrated form nabl certified calibration lab without validity limit , volumetric flask borosilicate with stopper a class cap 100 ml calibrated form nabl certified calibration lab without validity limit , volumetric flask borosilicate with stopper a class cap 200 ml calibrated form nabl certified calibration lab without validity limit , volumetric flask borosilicate with stopper a class cap 250 ml calibrated form nabl certified calibration lab without validity limit , volumetric flask borosilicate with stopper a class cap 500 ml calibrated form nabl certified calibration lab without validity limit , volumetric flask borosilicate with stopper a class cap 1000 ml calibrated form nabl certified calibration lab without validity limit , volumetric pipette borosilicate with stopper a class cap 1 ml calibrated form nabl certified calibration lab without validity limit , volumetric pipette borosilicate with stopper a class cap 2 ml calibrated form nabl certified calibration lab without validity limit , volumetric pipette borosilicate witha class cap 5ml calibrated form nabl certified calibration lab without validity limit , volumetric pipette borosilicate witha class cap 10 ml calibrated form nabl certified calibration lab without validity limit , volumetric pipette borosilicate witha class cap 25 ml calibrated form nabl certified calibration lab without validity limit , volumetric pipette borosilicate witha class cap 50 ml calibrated form nabl certified calibration lab without validity limit , nessalar cylinder borosilicate witha class cap 50 ml calibrated form nabl certified calibration lab without validity limit , nessalar cylinder borosilicate witha class cap 100 ml calibrated form nabl certified calibration lab without validity limit , measuring cylinder borosilicate witha class cap 50 ml calibrated form nabl certified calibration lab without validity limit , bod bottles borosilicate glass cap. 300 ml calibrated form nabl certified calibration lab without validity limit , burette borosilicate witha class cap 50 ml calibrated form nabl certified calibration lab without validity limit , burette amber borosilicate witha class cap 25 ml calibrated form nabl certified calibration lab without validity limit , sample bottle 1000 ml ldpe narrow mounth torson , conical flask with b class 500 ml , conical flaskb class 1000 ml , beakerb class 100ml , beakerb class 250ml , beaker b class 1000ml , beaker b class 2000ml , volumetric pipette a class 20ml , graduated pipette a class 1ml , graduated pipette a class 5ml , graduated pipettea class 25ml , dessicator 300 ml , reagent bottleb class 100ml , reagent bottle b class 250ml , reagent bottle b class 500ml , reagent bottle b class 1000ml , reagent bottle b class 2000ml , bod bottlewith stopper b class 300ml , wide mouth bottle with stopper b class 1000ml , evoparating dishb class 100ml , filterration assembly withvaccume15 22” 1 / 20 , flask for filteration assembly cap 500 ml , filter paper 125mm øgrade 1 pack of 100 circles , enamal tray 2*1 , enamal tray 1*1 , stand for nesslar cylinder50 ml , s s tounge small 30 cm , roubber corck 23 mm ø , roubber corck 30 mm ø , gooch crucible g 4 class 30 ml...

Bhopal Municipal Corporation - Madhya Pradesh

33355189 purchasing of glass ware for water treatment plant kolar , purchasing of glass ware , beaker low form size 100 ml, make borosil / riviera / jsil , beaker low form size 250 ml make borosil / riviera / jsil , beaker low form size 500 ml make borosil / riviera / jsil , beaker low form size 1000 ml make borosil / riviera / jsil , b.o.d. bottles size 125 ml make borosil / riviera / jsil , b.o.d. bottles size 300 ml make borosil / riviera / jsil , burettes with boroflo stopcock, class a size 10 ml, make borosil / riviera / jsil , burettes with boroflo stopcock, class a size 25 ml, make borosil / riviera / jsil , burettes with boroflo stopcock, class a size 50 ml, make borosil / riviera / jsil , cylinders nabl certified, class a size 250 ml, make borosil / riviera / jsil , cylinders nabl certified, class a size 500 ml, make borosil / riviera / jsil , cylinders nabl certified, class a size 1000 ml, make borosil / riviera / jsil , volumetric flasks with interchangeable solid glass stopper class a, narrow mouth size 100 ml, make borosil / riviera / jsil , volumetric flasks with interchangeable solid glass stopper class a, narrow mouth size 250 ml, make borosil / riviera / jsil , volumetric flasks with interchangeable solid glass stopper class a, narrow mouth size 500 ml, make borosil / riviera / jsil , volumetric flasks with interchangeable solid glass stopper class a, narrow mouth size 1000 ml, make borosil / riviera / jsil , erlenmeyer conical flask narrow mouth with rim size 50 ml, make borosil / riviera / jsil , erlenmeyer conical flask narrow mouth with rim size 100 ml, make borosil / riviera / jsil , erlenmeyer conical flask narrow mouth with rim size 250 ml, make borosil / riviera / jsil , erlenmeyer conical flask narrow mouth with rim size 500 ml, make borosil / riviera / jsil , quantitative filter papers ashless grades, grade 41: 20?m, 12.5 cm ( 125mm ) cat no 1441 125, pk 100 no, hsn code 48232000, make whatman , quantitative filter papers—ashless grades, grade 42: 2.5?m, 12.5 cm ( 125mm ) cat no 1442 125, pk 100 no, hsn code 48232000, make whatman , cotton bundle , extran® ma 02 neutral cat no 60755350001730, pk 5 lit , make merck , gst as per applicable...

Directorate Of Medical Education - Madhya Pradesh

33336734 tender for supply of chemical and reagents for mdru department of sgm hospital rewa , mdru chemical and reagents , ammonium chloride 250gm , potassium bi carbonate 250gm , sodium chloride 250gm , tris hcl 250gm , sds 250gm , saturated phenol 500ml , chloroform 500ml , sodium acetate 250gm , isoamyle alcohol 500ml , glacial acetic acid 500ml , molecular biology grade agarose powder 250gm , bromophenol blue dye 2ml , ethidium bromide 5ml , molecular weight ( dna ladder ) 100bp & 1kb 50ug , molecular weight ( dna ladder ) 50bp 50ug , molecular weight ( dna ladder ) 25bp 50ug , taq polymerase 5000unit , amplitaq gold dna polymerase master mix 500 unit , mgcl2 100 ul , dntp mix 100 ul , dnase 100 unit , rnase 100 unit , proteinase k 100 unit , triss 250gm , edta 250gm , boric acid 250gm , teepol 5 liter , xylene cynol 5 ml , dmso 500 ml , tips i. 0.2 20 ?l tips 2 pack ( pack size of 1000 psc. each ) , tips ii. 20 200 ?l tips 2 pack ( pack size of 1000 psc. each ) , tips iii. 200 1000 ?l tips 2 pack ( pack size of 1000 psc. each ) , superscript ii rnase reverse transcriptase 10000 u ( 200u / ul ) , power sybrgreen pcr master mix 2.5 ml , power sybrgreen rt pcr reagent kit 5 ml , oligo ( dt ) 12 18 primer25 ?g , absolute ethanol 500 ml , pcr plates pack of 50 , sealing foil ( rt pcr / qpcr grade ) pack of 50 , filter tips i. 0.2 20 ?l filter barrier tips 2 pack ( pack size of 1000 psc. each ) , filter tips ii. 20 200 ?l filter barrier tips 2 pack ( pack size of 1000 psc. each ) , filter tips iii. 200 1000 ?l filter barrier tips 2 pack ( pack size of 1000 psc. each ) , mct variable tubes i. 20 200?l tubes 2 pack ( pack size of 1000 psc. each ) , mct variable tubes ii. 200 600 ?l tubes 2 pack ( pack size of 1000 psc. each ) , mct variable tubes iii. 500 2000 ?l tubes 2 pack ( pack size of 1000 psc. each ) , nitrile autodextorous gloves 2 pack ( pack size of 1000 psc. ) , mctstands for variable tubes sizes i. 20 200?l tubes stand pack size of 1000 psc. each , mctstands for variable tubes sizes ii. 200 600 ?l tubes stand pack size of 1000 psc. each , mctstands for variable tubes sizes iii. 500 2000 ?l tubes stand pack size of 1000 psc. each , filter tip boxes i. 0.2 20 ?l filter barrier tip box 2 pack ( pack size of 1000 psc. each ) , filter tip boxes ii. 20 200 ?l filter barrier tip box 2 pack ( pack size of 1000 psc. each ) , filter tip boxes iii. 200 1000 ?l filter barrier tip box 2 pack ( pack size of 1000 psc. each ) , rt pcr grade water 20 ml , tip discard box ( 1 2 liter capacity ) 10 each , graduated measuring cylinders 50, 100, 500, 1000 ml 05each , graduated beakers 50, 100, 500, 1000 ml 05 each , flat bottom tube 5ml ( with screw cap ) 500 psc. , tube stand ( 15ml falcon, 5ml, 2ml, 0.5ml, 0.2ml mct ) pack size of 500 psc. , graduated conical flask 50, 100, 500, 1000ml pack size of 5 psc. each , edta blood collection tube 5ml 100 psc. , plain vial ( for clot activator ) 100psc. , fluoride vial 100 psc. , test tube 5, 10ml 100 psc. , slide+cover slips 50 psc. , tissue paper roll 10 psc. , fine tissue cloth roll 10 psc. , cotton 10 psc. , wash bottle / dropping bottle, 200ml, 500ml, 1ltr 5 psc. , funnels variable range 5 psc. , plastic bottle, 200, 500, 1000ml 5 psc. , syringe + needle 2ml, 5ml pack size of 100 psc. each , nitrile gloves; medium and large size pack size of 1000 psc. , dna isolation kit pack size for 100 reaction , rna isolation kit pack size for 100 reaction , phenol 500 ml , hno3 ( nitric acid ) 500 ml , propionaldehyde pure ( 97% ) 500 ml , phthalic anhydride 500 ml , glacialacetic acid ar 500ml , hydrochloric acid ar 500 ml , sulfuric acid ar 500 ml , 2 amino ethanol 500 ml , pyridine ar 500 ml , ammonia solution ar 500 ml , ammonia chloride ar 500 ml , acetyl salicylic acid 500 ml , acetone ar 500 ml , anthranilic acid ar 500 ml , activated charcoal 500 ml , silica gel g 500ml , benzoicacid ar 500ml , sds 250 gm , colin ( cleaning detergent solution ) 500 ml , sterilium ( hand sanitizer ) 500 ml , dettol / lifeboy alcohol based hand sanitizer 500 ml , hypo 4% 1000ml , floor cleaner phenyl 500 ml , serum separator vial 3 ml 100 psc. , labolene 1000 ml , cleaning mop 5 psc. , broom 5 psc. , microwave gloves 2 pkt. , brown paper for autoclaving 10 rolls , liquid nitrogen 5ltrpkt. , phosphate buffer saline 500 ml , formalin 500 ml , paraffin wax ( 58 60c ) 250 gm , xylene , glycerol 250 ml , ammonia 100 ml , methanol 250 ml , acrylamide / bis ar 250 ml. , 10x tbe buffer 500 gm , urea 100 ml , ammonium persulfate 100 ml , temed 100 ml , 4’, 6 diamidino 2 phenylindole 100 ml , diethyl pyrocorbonate 100ug , pbs 500ml , mnl i 500 unit , bcli 1500 unit , hpych4v 100 unit , hpych4iii 250 unit , sau96i 500 unit , sfci 200 unit , bcci 500 unit , scrfi 500 unit , afliii 250 unit , scai 500 unit , avai 500 unit , bsmi 250 unit , tspri 500 unit , mboii 300 unit , bsh1236i 500 unit , banii 1000 unit , mph1103i 500 unit , dde i 500 unit , bsmb i 200 unit , afa i 500 unit , bal i 250 unit , fspi 500 unit , primers 5 od , fmr1 set 1 – f5 tcaggcgctcagctccgtttcggtttca 3 r5 5 aagcgccattggagccccgcacttcc 3 5 od , mecp2 exon 1 set 1 f5 gttatgtctttagtctttgg–3´ r5 tgtgtttatcttcaaaatgt–3´ 5 od , exon 2set 1 f5 cctgcctctgctcacttgtt–3´ r5 ggggtcatcatacatgggtc–3´ 5 od , exon 2set 2 f5 agcccgtgcagccatcagcc–3´ r5 gttccccccgaccccaccct–3´ 5 od , exon 3 set 1 – f5 tttgtcagagcgttgtcacc–3´ r5 cttcccaggacttttctcca–3´ 5 od , exon 3 set 2 f5 aaccacctaagaagcccaaa–3´ r5 ctgcacagatcggatagaagac–3´ 5 od , exon 3 set 3 f5 ggcaggaagcgaaaagctgag–3´, r5 tgagtggtggtgatggtggtgg–3´ 5 od , exon 3 set 4 – f5 5´–tggtgaagcccctgctggt–3´ r5 ctccctcccctcggtgtttg–3´ 5 od , exon 3 set 5 f5ggagaagatgcccagaggag–3´ r5 cggtaagaaaaacatccccaa–3´ 5 od , exon3 ( l100v ) f5 aaccacctaagaagcccaaa 3 r5 gcttaagcttccgtgtccagccttcaggta 3 5 od , putative promoter and exon 1. f5 gggtgcaatgaaacgctta 3 r5 tttaccacagccctctctcc 3 5 od , mc4r rs17782313 f 5 aagttctacctaccatgttcttgg 3 r 5 ttccccctgaagcttttcttgtcattttgat 3 5 od , fto rs9939609 f 5 aactggctcttgaatgaaataggattcaga 3 r5 agagtaacagagactatccaagtgcagtac 3 5 od , adipoqrs2241766 – f5 tgtgtgtgtggggtctgtct 3 r 5 tgtgatgaaagaggccagaa 3 5 od , rs1501299 f5 ctacactgatataaactatatggag 3 r5 ccccaaatcacttcaggttg 3 5 od , pomcrs6232 f5 ttgtgcccttcatctgaaca 3 r5 tgtagcaactttggcatgga 3 rs155971 f5tatatgcagccaccaatcca 3 r5 aaaatgaagggagaagcacaaa 3 5 od , ppar g ( pro12ala ) f5gcc aat tcaagc cca gtc 3 r5gat atgttt gca gac agt gta tca gtg aaggaa tcg ctt tcc g 3 5 od , kcnj11 ( rs5219 ) f5 gactctgcagtgaggcccta 3’ r5 acgttgcagttgcctttctt 3’ 5 od , capn10 ( rs3792267 ) f5 cacgcttgctgtgaagtaatgc 3’ r5 tgattcc catggtctgtagcac 3’ 5 od , pik3ca set 1 forward 5’ ggagtatttcatgaaacaaatgaatgatgcg 3’ 5 od , pik3ca set 1 reverse 5’ gagctttcattttctcagttatctt 3’ 5 od , bat 25 set 1 f 5’ tcgcctccaagaatgtaagt 3’ r 5’ tctgcattttaactatggctc 3’ 5 od , bat 26 set 1 f5’ tgactacttttgacttcagcc 3’ r5’ aaccattcaacatttttaaccc 3’ 5 od , d2s123 set 1 f5’ aaacaggatgcctgcctttta 3’ r5’ gtttggactttccacctatgggac 3’ 5 od , d5s346 set 1 f 5’ actcactctagtgataaatcg 3 r5 agcagataagacagtattactagtt 3 5 od , d17s250 – set 1 f5’ ggaagaatcaaatagacaat 3’ r5’ gctggccatatatatatttaaacc 3’ 5 od , impdh2 set 1 f5 gtttctgcggtatcccaatc 3 r5 cgagcaagtccagcctat 3 5 od , bmp6 rs73719353 f5’ gctcctttgcacttcgctgt 3’ r5’ aggctctgctg agctcctac 3’ 5 od , bmp6 rs73719341 f 5’tgaacttcccattcccctct 3’ r5’ataaaattagcattgatcca 3’ 5 od , bmp6 rs73719318 f5’caggtgctgtgcaacttctt 3’ r 5’agagggcaccatggttgcct 3’ 5 od , bmp6 rs73381662f 5’ ctgagattcaattaggccca 3’r 5’taaagaacagcaaaagtctg 3’ 5 od , bmp6 rs73381650 f 5’cacataaagattgctgcatt 3’ r 5’tagtaatcctaaaaatggga 3’ 5 od , anxa2 rs7170178 f 5’ ttcacagcagttcaaaatac 3’ r 5’ ctgggtttccagagatggaa 3’ 5 od , anxa2 rs73435133 f 5’ gagtgcaaggtgctgaggat 3’ r 5’ gatttcagacagcccttgca 3’ 5 od , anxa2 rs73418020 f 5’ tctgagagtgaaaggtgcac 3’ r 5’ tcccatcccctgaatccctg 3’ 5 od , anxa2 rs72746635 f 5’ cctgactcattgtcacatca 3’ r 5’ aagtggctttccactgccc 3’ 5 od , anxa2 rs73418025 f 5’ cttctcatcttactttt 3’ r 5’ agggaaggatacagaggaga 3’ 5 od , hsp 70 primer sequence 5 agcgt aacac cacca ttcc 3 ( forward ) 5 tggct cccac cctat ctc 3 ( reverse ) 5 od , the gapdh sequence forward primer 5 agc cac atc gct gag aca c 3, reverse primer 5 gcc caa tac gaccaa atcc 3. 5 od , total rna mini kit ( from human skin tissue ) 2 pack ( pack size for 100 reaction ) , human leptin elisa kit pack size for 96 reaction , human adiponectin elisa kit pack size for 96 reaction , human adipsin elisa kit pack size for 96 reaction , human resistin elisa kit pack size for 96 reaction , human iron elisa kit ( serum iron ) pack size for 96 reaction , human ferritin elisa kit ( serum / ferritin ) pack size for 96 reaction , thyroid estimation kit pack size for 96 reaction , ice maker machine for laboratory purpose 1 psc. , microwave gloves 2 pkt. , pcr mini cooler 03 psc. , pipette 0.5 10ul, 02 20ul, 10 100ul, 20 200ul and 100 1000ul. 1 psc. each , horizontal gel apparatus: 18 – 20 cm ( length ) x 25 – 30 ( breadth ) x 5 7.5 cm ( height ) , 40 60 samples, multichannel pipette compatible combs and gel caste 1 psc. each , mini horizontal gel apparatus: 9 cm w x 11 cm l with grooves ( 8.7 cm l x 1.2 cm h ) on the side for gripping the gel tray. it should have two comb slots on the same tray area. 1 psc. each , buffer capacity should be 600 ml for the buffer tanks and optimum gel runs with a fill line indicator for buffer levels along the unit side , multi size forceps lab set 01 pkt. , liquid nitrogen sample storage tanks 5 tanks ( 3, 5, 10, 20, 25 ltrs ) , liquid nitrogen sample handling gloves 5 sets of gloves , slide tray / rack pack of 3psc. , l mold pack of 2 psc. , tissue cassette steel pack of 2 psc. , electric tissue float bath ( thermostate ) 1 psc. , coupling jar pack of 2 psc. , staining rack pack of 3 psc. , whatman filter paper grade 1 & 2 2 pack ( pack size of 50 psc. ) , harri’s hematoxylin powder 2 pack of 50 gm , yellow eosin powder 2 pack of 50 gm , coverslip 18x18 ( microscopic ) 2pack ( pack size of 100 psc ) . , dpx mount 50 ml , thymol crystals 250 gm , plastic boxes 5 boxes , steel / aluminium boxes 3 boxes , hot plate 1 psc. , mx35 premier microtome blade ( 34 / 80mm ) 50 blades 1 box , diamond pen ( histopathology use ) 1 pen , embedding mold and embedding ring 5 psc. , human pai 1 elisa kit pack size of 96 reactions , mortar and pestle homogenizers 1 psc....

Kendriya Vidyalaya Sangathan - Madhya Pradesh

33243374 bids are invited for bunsen burner , micro test tube , capillary tube , mirror , lens stand , burettes , pipettes , kaleidoscope , filter papers , ray streak apparatus , litmus paper blue red , electrodes fixed in cork , cork , newton colour disk , electroscope , magnesium ribbon , ph paper strips , delivery tube , one way key , resistance coil , safranin , compound microscope , methylene blue solution , g clamp , double mouth flask , phenolphthalein , iron filling , watch glass , yeast powder , glass rod stir , sand paper , plastic strip with woolen cloth attached at one side , y tube brosillicate , iodine solution , electrode iron copper strip , methyl orange indicator , a cork fitted with u shape tube , plane mirror strip , pulley with stand , magnets , zn granules , china dish , stand withclamp , conical flask , magnifying glass , w tube , glazedtile , chromatography column , spatula spoon , pestlemortar , ebonite rod , tongs , circuit board assembly withtorch bulbs , prism , dry cell , periscope , chromatographyjar , test tube , translucent sheet , butter paper ,distillation flask with side tube , acetone , copper sulphate ,barium chloride , potassium permagnate , hydrogenperoxide , ammonia solution , indigo carmine indicator ,iron ferrous sulphate , potassium iodide solution , sodiumacetate , boric acid , chromatography paper , distillationassembly , sulpher powder total quantity : 267...

Indian Army - Madhya Pradesh

33241352 bids are invited for domestic vacuum flasks as per is 7708 ( q4 ) , tiffin box ( q3 ) total quantity : 75...

Bhopal Municipal Corporation - Madhya Pradesh

33235082 supply of laboratory essential equipment supply of laboratory essential equipment for bairagarh filter plant lab under zone no.01 , indian lab q water maker type 3 10 lph with pre filter with ro and stablizer cat no. 4452 specification 1 online conductivity meter: displays product water quality for continues monitoring2 automatic flush device (afd) ensure periodic of the filter sysytem.3 dry rub protection: ensure protection of the pump when inlet isunavailable. 4 optional filtration:can be attached at the point of dispensing the spout to ensure compliance to microbiological reduction valve. 5 feed water specification; tds:500 ppm max fe,mn: nill free chlorine : nill silica : (20 ppm total organic carbon (toc):(3 ppm ph:6.8 8.5 dissolve cd2:(ppm intel pressure :0.5 2.0kg/cm2 6 product water specification: product flow : 10lit/h pure water conductivity :(1 micro siemens/cm pure water resistivity : (1 mq turbidity : (1 ntu toc : (200ppb with pre filter with r.o and compatable stablizer for voltage fluctuation make lon exchange,merck,thermo , lab refrigerator: specification: outer body : g.i inner chamber : plastic number of door (glass):01 shelves :04 external dimension: 584x584x1702mm temperature range : 1cto 10c capacity :300 liter supply :220 240 volts 50hz single phase supply with compatiable voltage stablizer make remi,elanpro,bioline,technologies , all glass filter assembly (for faecal test)complete set specification: filter size:47mm dia effective filteration area:60cm2 filter flask capacity :1000ml funnel capacity :300ml. spring clamp:anodised aluminium. pressure:vaccume only. make: riviera,torson,merck , vaccume pr.pump ,4 bar 220v/50hz cat no. x10422050 make: milipore,merck,torson , conductivity meter (cond lfm lab 945) cat no.285206840 wt specification: measuring range:0 20us/cm,0 200us/cm 0 500 gm/i salinity : 0 70 (after iot) temprerature : 10 100c resolution : 0.1us:1us:0.01ms:0.1ms0.1c accuracy +1digit + 0.5% of the measuring range,t(c)+0.1(5 50c) temperature compensation : auto matic with ntc 30k ohm or fixed temperature. connectors: 8 pol sensor socket,4 pol usb interface socket. calibration: direct input,temperature offset,single point automatic. data storage: 4,000entries with data,time,value 1+2 and temperature ,make:merck,hach,fisher...

Department of Higher Education - Madhya Pradesh

33179014 bids are invited for title 01 auto clave title 02 do meter digital title 03 counductivity meter digital with cell title 04 digital photoelectric colorimeter 5lit title 05 double distilation apperatus cap2lit title 06 electronic blance0.01mg to 600gm title 07 flame photometer digital title 08 heating metel 7lit title 09 hotplate with energy regulator 1500w title 10 centrifuge machine title 11 thin layer chromatograpy app title 12 magnetic stirrer with hot plate title 13 muffle furness title 14 shaking machine with wrist action title 15 bod incubator title 16 vortex mixer title 17 digital colony counter 4 digit title 18 digital turbidity meter 3.5 digit title 19 tds meter digital title 20 digital ph metr conductivity meter and temperature meter title 21 water bath double 12 holes title 22 water soil analysis kit 7 para meter title 23 ph meter digital with electrodes title 24 rotatory flask shaker title 25 vacuum pump title 26 melting point apparatus digital title 27 micropipette variable title 28 polarimeter half shades title 29 compound microscope title 30 dissecting microscope with bull lences title31 binocular microscope title 32 image projection system tringular microscope title 33 thin layer chromotograhic chamber title 34 water and soil testing analysis kit title 35 digital colony counter title 36 rotatory microtome with accessories title 37 digital spectrophotometer title 38 ph meter with electrodes title 39 gel electroproshish with power supply ( vertical ) title 40 hot air oven stainless steel title41 high defination microscope title 42 bod incubulator title 43 digital tds meter title 44 compound microscope title 45 dissecting microscope with bull lences title 46 image projection system tringular microscope title 47 oven title 48 beteriological incubator ss steel title 49 digital colony counter title 50 centrifuge machine3500 rpm title 51 binocular microscope title 52 rotatory microtom with accessories title 53 computer for zoology lab title 54 dna model 3d title55 human plastic skeleton title 56 blood pressure machine title 57 digital spectrophotometer title 58 fet characteristic apparatus title 59 mosfet characteristic app title 60 ujt characteristic app title 61 s.c.r characteristic app title 62 thermistor characteristic app title 63 diac and tiac characteristic app title 64 photo diode characteristic app title 65 photo transistor characteristic app title 66 power amplifier title 67 hartley and colpitts oscillator title 68 study of crystall oscillator title 69 high defination microscope title 70 newton ring app complete with travelling microscope power title 71 series and parailal resonrnce circuits title 72 reading telescop title 73 four probe methods title 74 spectrometer 6 / 7 title 75 die electric constant apparatus title 76 screw gauge electronic title 77 verniear calipers electronics title 78 ac ammeter title 79 dc voltmeter title 80 milimeter / milvoltameter / micrometer title 81 daniel cell title 82 jeager apparatus title 83 ldr cheracteristic apparatus title 84 cro digital 30 mhz / 40mhz title 85 high defination microscope title 86 travelling microscope title 87 digital multimeter total quantity : 236...

Indore Municipal Corporation - Madhya Pradesh

33141932 supply of required instruments and glassware for existing lab at mushkhedhi project office of indore municipal corporation to meet the nabl accredited norms , supply of required instruments & glassware for existing lab at mushkhedhi project office of indore municipal corporation to meet the nabl accredited norms , providing and installation of laboratori refrigerator ( visi cooler ) 325 litre capacity with a glass door for convenient sample viewing, forced air circulation system, digital controller for internal temperature display ( should be nabl accredited & calibration certificate of nabl lab ) , plastic inner chamber, prepainted outer body and with dual glass etc, complete. , providing , supply & installation of digital hydrometer for specific gravity: density :0.000 2.000g / cm3 sample temperature:01 40c ( 321 104f ) viscosity: 0 2000mpa. with installation with nabl calibration certificate. with two years amc & two year guarantee. , providing , supply & installation of humidity and temperature meter ( hygro meter ) , dual and large display, for humidity and temperature, range 0 100%. rh resolution 0.1%, temperature range 0 60 c with carrying case, manual, temperature probe. with installation with nabl calibration certificate. with two years amc & two year guarantee. , providing , supply & installationweight box capacity from 1mg to 200 gram with nabl calibration certificate with two years amc & two year guarantee. , providing , supply & installation water purification unit for production of class a reagent grade 1 water pack 5ltr as per is 1070:92 with nabl calibration certificate with two years amc & two year guarantee. , volumetric flask borosilicate with stopper a class cap 50 ml calibrated form nabl certified calibration lab without validity limit , volumetric flask borosilicate with stopper a class cap 100 ml calibrated form nabl certified calibration lab without validity limit , volumetric flask borosilicate with stopper a class cap 200 ml calibrated form nabl certified calibration lab without validity limit , volumetric flask borosilicate with stopper a class cap 250 ml calibrated form nabl certified calibration lab without validity limit , volumetric flask borosilicate with stopper a class cap 500 ml calibrated form nabl certified calibration lab without validity limit , volumetric flask borosilicate with stopper a class cap 1000 ml calibrated form nabl certified calibration lab without validity limit , volumetric pipette borosilicate with stopper a class cap 1 ml calibrated form nabl certified calibration lab without validity limit , volumetric pipette borosilicate with stopper a class cap 2 ml calibrated form nabl certified calibration lab without validity limit , volumetric pipette borosilicate witha class cap 5ml calibrated form nabl certified calibration lab without validity limit , volumetric pipette borosilicate witha class cap 10 ml calibrated form nabl certified calibration lab without validity limit , volumetric pipette borosilicate witha class cap 25 ml calibrated form nabl certified calibration lab without validity limit , volumetric pipette borosilicate witha class cap 50 ml calibrated form nabl certified calibration lab without validity limit , nessalar cylinder borosilicate witha class cap 50 ml calibrated form nabl certified calibration lab without validity limit , nessalar cylinder borosilicate witha class cap 100 ml calibrated form nabl certified calibration lab without validity limit , measuring cylinder borosilicate witha class cap 50 ml calibrated form nabl certified calibration lab without validity limit , bod bottles borosilicate glass cap. 300 ml calibrated form nabl certified calibration lab without validity limit , burette borosilicate witha class cap 50 ml calibrated form nabl certified calibration lab without validity limit , burette amber borosilicate witha class cap 25 ml calibrated form nabl certified calibration lab without validity limit , sample bottle 1000 ml ldpe narrow mounth torson , conical flask with b class 500 ml , conical flaskb class 1000 ml , beakerb class 100ml , beakerb class 250ml , beaker b class 1000ml , beaker b class 2000ml , volumetric pipette a class 20ml , graduated pipette a class 1ml , graduated pipette a class 5ml , graduated pipettea class 25ml , dessicator 300 ml , reagent bottleb class 100ml , reagent bottle b class 250ml , reagent bottle b class 500ml , reagent bottle b class 1000ml , reagent bottle b class 2000ml , bod bottlewith stopper b class 300ml , wide mouth bottle with stopper b class 1000ml , evoparating dishb class 100ml , filterration assembly withvaccume15 22” 1 / 20 , flask for filteration assembly cap 500 ml , filter paper 125mm øgrade 1 pack of 100 circles , enamal tray 2*1 , enamal tray 1*1 , stand for nesslar cylinder50 ml , s s tounge small 30 cm , roubber corck 23 mm ø , roubber corck 30 mm ø , gooch crucible g 4 class 30 ml...

Indian Army - Madhya Pradesh

32960584 bids are invited for domestic vacuum flasks as per is 7708 (q4) , tiffin box (q3)mse total quantity : 75...

National Fertilizers Limited - Madhya Pradesh

32920617 supply of vibrating machine vibrating machine , nfl material code:bfi000318 vibrating machine specifications for vibrating machine / heavy duty continuous shaker the specifications for robust construction vibratingmachine areas follows : platformsize :1500x 1500 mm. arrangementof 36 nos of 5000 ml broil flasks / bottles on platform of single tier. platform revolving speed from 100 to 150 r.p.m. for shaking 36 nos of flasks. speed ( midium & low ) adjustable regulator and should be linear type for smooth regulation of speed.operating voltage :a.c. 230 volt, 50 hz motor :double speed induction motor heavy duty continuous rating motor. power : as per requirement ofabove machine voltage:230 + 10%. frequency: 50 hz + 3% .enclosure :ip 55 tefcinsulation class :f / standard duty: continuous vibration:low.noise: low.machine is required as f.o.r nfl biofertilizer plant vijaipur. packing should be soundenough to avoid any damages in transit. party should install the machine at our site. party should also provide guarantee certificate for minimum 12 months from the date of successful installation. details specification shall be as per annexure a => limited...

Madhya Pradesh Power Generating Company Limited - Madhya Pradesh

32881185 procurement of essential science lab items for school at sstpp, township i magnetic compass 2 thermometer 110 deg c magnii:ying glass 3 framed 4 bar magnet2” 5 p11 meter pen model 6 test tube stand tripod stand 6r” . n test tube holder 7 8 ( 9 stop watch digital 10 dissectian box superior ii concave lens 20cm 12 convex lens20cm 13 ytube 14 u horse shoe magnet 15 spirit lamp al 16tspirit regular magnetic compass with 17 ring microscope compound 18 student 19 electronic balance 20 heart model jumbo human digestive sys. model 21 22 23 skeleton + stand test tube with rim 15x125 24 china dish 4 25 conical flask 26 conical flask i0oml 27 conical flask i5oml 28 conical flask 250ml 29 conical flask 500ml 30 watch glass 3” 31 glass rod6m 32 slide box 50 33 dropper glass 6 34 dropping botfles 6oml 35 wooden rack 36 covel slip glass 37 dissect1an box 38 filter paper no. 1 39 wash bottle 500ml 40.| beaker5oml 41 beaker i 00ml 42 beaker i5oml 44 beaker 250ml beaker 500ml 45 46 beaker 1000ml mfas1jrement cylinder io0ml 47 reagent bot1le nm 48 funnel glass 75mm 49 magnetic compass 50 pipette vol 20ml burete stand funnel 52 bunsen burner brass 53 bell jar experiment 54 slide box small 55 circulatory sys model 56 plant cell model 57 animal cell model 58 human skeleton model 59 petri dish poly 60 bunsen burnerbrass — 61 petri dish 75 mm m 62 distillation appt — 63 circuit board with led — 64 multimeter digital — 65 dc motor with lead etc...

Zilla Swasthya Samiti - Madhya Pradesh

32831176 supply of lab materials supply of lab mateirlas spirit lamp , methylated sprit , measuring cylinder , drop bottles , methylene blue pow ,sulphuric acid , flat bottles flasks , hand wash solution , distieed water , wash bottle plastic , drop plastic , funnel plastic , weight machine , slides boxes , laboratory gown , faiken tube , gloves disposable , diamond marker , brown tape , slides for microscope , zip ploythin bag , carbol fuchsin /basic fuchsin ,filter paper , parafilm roll , face mask , phenol , lens paper , phenol , thermocol box , tissue roll , silika gel , absorent cotton , stock bottle palstic ,wooden stick , liquid praftin , potassium permangate , physical balance , sldie rack made of metal , counting chamber , micro pipette , micro tips , multi channel pipette , test tube , incubator , fiel stand , wbc diluting fluid , neubauer chamber , tb antigen , mitogen , tourniquet belt , strings , handwash , autoclave , immersion oil , liquid paraffin , montex vial ,staint tray , digital hygrometer , apron , stopwatch , hand towel hand towel , box , lithium heprine vial , nile vial ...

National Fertilizers Limited - Madhya Pradesh

32733927 supply of lab chemical erlenmeyer graduated conical narrow no 50.000 mouth conical flasks 5000 ml capacity size od x height 220 x 365 mm approx. make borosil / qualigen / riveria / vensil / labco / perfit only limited...